Methods for increasing cellulase activity using combinations of endogenous promoters and their associated 5' utrs of trichoderma reesei
By integrating the PTrAE promoter and the upstream 5' UTR region of the TrAE gene into the Trichoderma reesei Δku70Rut-C30 strain, the PTrAE-5' UTRTrAE-xyr1 overexpression cassette was constructed, solving the problem of insufficient cellulase activity enhancement in existing technologies and achieving a significant increase in cellulase activity and a reduction in production costs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANGHAI JIAOTONG UNIV
- Filing Date
- 2026-03-02
- Publication Date
- 2026-06-09
AI Technical Summary
In the existing technology, simply increasing the transcription level of Xyr1 in Trichoderma reesei has not effectively enhanced cellulase activity, and existing methods lack systematic research on the role of the promoter PTrAE and its corresponding natural 5′ UTR in regulating xyr1 expression and cellulase synthesis.
The expression of the xyr1 gene was regulated by the endogenous promoter PTrAE and its associated 5′ UTR combination of Trichoderma reesei. By integrating the PTrAE promoter and the upstream 5′ UTR region of the TrAE gene into the Trichoderma reesei Δku70Rut-C30 strain, the PTrAE-5′ UTRTrAE-xyr1 overexpression cassette was constructed to improve the transcription and translation efficiency of xyr1.
The activity of cellulase was significantly improved. The filter paper enzyme activity of the engineered strain QEaeuX reached 2.6 IU/mL at 96 h, which was about 101% higher than that of the starting strain, and about 40% higher than that of strains using PTrAE alone or in combination with egl2 5' UTR, thus reducing the production cost of cellulase.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of genetic engineering and biotechnology, specifically relating to a method for improving cellulase activity by utilizing the endogenous promoter of Trichoderma reesei and its associated 5′ UTR combination regulation, and the engineered strains constructed using this method. Background Technology
[0002] Lignocellulosic biomass is a widely available renewable resource, primarily composed of cellulose, hemicellulose, and lignin. Cellulase can hydrolyze cellulose into sugars usable by fermenting microorganisms, thus providing a carbon source for the large-scale production of biofuels and bio-based chemicals. Therefore, utilizing microbial fermentation to produce cellulase and further obtain hydrolyzed sugars is an important way to address the shortage of raw materials for green manufacturing applications. However, the current production cost of cellulase remains high, failing to meet the economic requirements of large-scale fermentation production. This is one of the key bottlenecks restricting the large-scale application of efficient conversion technologies for lignocellulosic biomass. Therefore, developing and establishing technical methods to improve the production efficiency and economy of cellulase remains a core objective in this field.
[0003] Trichoderma reesei ( Trichoderma reesei *Trichoderma reesei* is one of the most widely used cellulase-producing microorganisms, possessing strong protein secretion capabilities and a relatively complete cellulase-degrading enzyme system. In *Trichoderma reesei*, the expression of cellulase genes is synergistically controlled by multiple transcription factors, among which… Xyr1 It is widely recognized as a core activator regulating cellulase gene transcription. Therefore, by increasing... Xyr1 Enhancing the expression level of cells to improve the synthesis of downstream cellulases is a common strategy in current strain modification.
[0004] In the existing technology, for Xyr1 The engineered regulation mainly focuses on the transcriptional level, such as using strong promoters or inducible promoters to drive transcription. xyr1 Overexpression of genes is often used to increase their transcriptional levels (Zhong Yaohua, Shen Linjing, Wang Yifan, A method for increasing the activity of Trichoderma reesei cellulose hydrolase using a cellulose-inducible promoter, Chinese Invention Patent, ZL113913443B). However, studies have found that simply increasing... xyr1 The transcriptional level does not always yield a corresponding increase in Xyr1 protein accumulation and cellulase activity, suggesting that... xyr1 Functional expression processes may be influenced by other regulatory factors (Shen et al ., Tailoring the expression of Xyr1 leads to efficient production of lignocellulolytic enzymes inTrichoderma reesei for improved saccharification of corncob residues. Biotechnol Biofuels Bioprod . 2022;15(1):142).
[0005] The 5′ untranslated region (UTR), as a crucial regulatory element connecting the promoter and coding sequence, has been shown to play a vital role in regulating mRNA stability, translation initiation efficiency, and protein expression levels. Previous studies have reported that by linking a strong promoter with a gene derived from a highly expressed cellulase gene (… cbh1 , egl2 Combining the 5′ UTRs of different cellulase genes with the expression level of heterologous proteins in *Trichoderma reesei* can, to some extent, enhance the expression level of heterologous proteins (Yao Cheng, Study on the effects of 5′ UTRs of different cellulase genes and the translation initiation complex eIF4F on protein expression in *Trichoderma reesei*. Shandong: Master's Thesis, Shandong University, 2023). However, the above studies mainly focus on structural proteins or secretases, and the 5′ UTR is usually regarded as a modularly replaceable enhancing element. Its applicability to the expression regulation of functional proteins such as transcription factors, and the effect of combining it with corresponding endogenous promoters, still lack systematic research.
[0006] Multi-omics analysis can uncover novel functional genes involved in the regulation of cellulase synthesis. For example, comparative proteomic analysis of cellulose-induced and glucose-based non-induced conditions has revealed the dynamin subunit. Dlc 1. This invention can participate in the synthesis and regulation of cellulase in *Trichoderma reesei*, thereby constructing a highly efficient enzyme-producing strain (Zhao Xinqing, Yang Jie, Bai Fengwu, Construction method, recombinant strain and application of a high-yield cellulase-producing *Trichoderma reesei* strain, Chinese Invention Patent, Application No.: 2024101838397, Application Date: February 19, 2024). Based on this, the present invention further explores transcriptomic information under cellulose-induced conditions and discovers that the combination of the endogenous promoter and its associated 5'UTR can better initiate the key transcription factor Xyr1, thus leading to this invention. Summary of the Invention
[0007] To address the shortcomings of existing technologies, the present invention aims to provide a method for enhancing cellulase activity by utilizing the endogenous promoter of Trichoderma reesei and its associated 5′ UTR combination, as well as a dedicated engineered strain thereof.
[0008] This invention first discovered that, by using TrAE promoter (P) TrAE Drivers of transcriptional regulatory factors xyr1 Gene overexpression can, to some extent, improve... xyr1The transcriptional level. However, the increase in cellulase activity in the recombinant strain was not ideal, suggesting that in P... TrAE Under promoter control, xyr1 Expression efficiency may be significantly affected by downstream sequences of the promoter, especially the 5′ UTR region. It is known that the 5′ UTR of a specific gene can affect mRNA stability and regulate the translation efficiency of the corresponding protein product (Pan). et al ., UTR-Insight: integrating deep learning for efficient 5′ UTR discovery and design, BMC Genomics 2025;26:107). However, current technologies particularly lack specificity for P. TrAE The promoter and its corresponding gene's natural 5′ UTR regulate xyr1 A technical solution for expression and cellulase synthesis is needed. Therefore, there is an urgent need to develop a method based on promoter P. TrAE The study proposes a combined expression regulation method for the natural 5′UTR of the corresponding gene to achieve efficient functional expression of Xyr1 protein without solely relying on increasing transcription intensity, and further enhance the synthesis capacity of Trichoderma reesei cellulase, thus providing a new technical approach for efficient and low-cost cellulase production.
[0009] During their research, the inventors' group discovered an acetylesterase gene (jgi|TrireRUTC30:136770, named) in the Trichoderma reesei RUT-C30 strain while analyzing enzyme production regulatory elements using transcriptomics. TrAE The enzyme it encodes has been shown to be a key functional component in xylan deacetylation (Koutaniemi S, van Gool MP, Juvonen M, Jokela J, Hinz SW, Schols HA, Tenkanen M. Distinct roles of carbohydrateesterase family CE16 acetyl esterases and polymer-acting acetyl xylanesterases in xylan deacetylation). J Biotechnol(2013, 168(4):684-92). Meanwhile, in the research group's data, the transcription of this gene was also induced by the cellulase inducer microcrystalline cellulose, exhibiting a high and stable transcription level under induction conditions, and a 5′UTR was found upstream of it. Based on the above research background, it is suggested that the upstream regulatory region of this gene may have potential application value in regulating cellulase expression. Based on this, the technical solution of this invention was proposed and implemented.
[0010] The technical solution of the present invention includes: First, this invention provides a method for enhancing cellulase activity by utilizing the endogenous promoter of *Trichoderma reesei* and its associated 5′ UTR combination regulation. The method involves using *Trichoderma reesei* Δku70... Rut-C30 As the starting strain, the endogenous promoter P was used. TrAE as well as TrAE 5' UTR region upstream of the gene TrAE Combining to express xyr1 Strains of genes; in their genome xyr1 The gene was integrated into 36,429 gene loci, of which xyr1 Upstream of the gene is the promoter P TrAE and 5' UTR TrAE Downstream is xyr1 The original terminator, resistance gene hph Located in the upstream homologous arm and promoter P TrAE between.
[0011] The endogenous promoter P TrAE It is based on Trichoderma reesei Δku70 Rut-C30 The genome was used as a template, and its genome sequence was based on the publicly available Rut-C30 genome, which can be found in the JGI MycoCosm database. The corresponding Trichoderma reesei Rut-C30 strain genome version is TrireRUTC30_1. The nucleotide sequence containing the promoter was amplified using primer pair AE-F / AE-R, and its nucleotide sequence is shown in SEQ ID NO.1; the 5' UTR... TrAE It is based on Trichoderma reesei Δ ku70 Rut-C30 Using the genome as a template, UTR-F / UTR amplification was performed using primer pairs. TrAE The nucleotide sequence of the 5' UTR upstream of the gene is shown in SEQ ID NO.2.
[0012] The primer pairs are designed and screened by primer design software. Preferably, the nucleotide sequences of the primer pairs AE-F / AE-R are shown in SEQ ID NO.3 and SEQ ID NO.4; and the nucleotide sequences of the primer pairs UTR-F / UTR-R are shown in SEQ ID NO.5 and SEQ ID NO.6.
[0013] Then, with Trichoderma reesei Δku70 Rut-C30 Genome as template amplification xyr1 The gene and its terminator region were amplified using primer pairs 36429-UF / 36429-UR and 36429-DF / 36429-DR, amplifying the upstream and downstream homologous arms of the 36429 gene, respectively. Then, the upstream homologous arm and the resistance gene were amplified. hph P TrAE 5' UTR TrAE , xyr1 The gene, its terminator, and downstream homologous arms were fused sequentially to prepare an expression cassette, which was named P. TrAE -5' UTR TrAE -xyr1 Through expression box; then P TrAE- 5' UTR TrAE -xyr1 Transformation of Trichoderma reesei to Trichoderma Δ ku70 Rut-C30 Among the strains, an engineered Trichoderma reesei strain with enhanced cellulase activity was obtained, and this strain was named QEaeuX; wherein the... hph The resistance gene was amplified in plasmid T- hph .
[0014] The primer pairs were designed and screened using primer design software. Preferably, the nucleotide sequences of the primer pair 36429-UF / 36429-UR are shown in SEQ ID NO.7 and SEQ ID NO.8; and the nucleotide sequences of the primer pair 36429-DF / 36429-DR are shown in SEQ ID NO.9 and SEQ ID NO.10.
[0015] The method of the present invention for enhancing cellulase activity by utilizing the endogenous promoter of Trichoderma reesei and its associated 5′ UTR combination regulation, more specifically includes the following implementation steps: (1) Trichoderma reesei Δ ku70 Rut-C30 Using the genome as a template, primer pairs AE-F / AE-R were used to amplify cells containing... TrAE The nucleotide sequence of the gene promoter, named P TrAE Its nucleotide sequence is shown in SEQ ID NO.1; *Trichoderma reesei* Δ ku70 Rut-C30Using the genome as a template, UTR-F / UTR amplification was performed using primer pairs. TrAE The nucleotide sequence of the 5' UTR upstream of the gene, this 5' UTR is named 5' UTR. TrAE Its nucleotide sequence is shown in SEQ ID NO.2; *Trichoderma reesei* Δ ku70 Rut-C30 Genome as template amplification xyr1 The gene and its terminator region were amplified using primer pairs 36429-UF / 36429-UR and 36429-DF / 36429-DR, respectively. 36429 The upstream and downstream homologous arms of the gene, and then the upstream homologous arm, the resistance gene hph P TrAE 5' UTR TrAE 、xyr1 The gene, its terminator, and downstream homologous arms were fused sequentially to prepare an expression cassette, which was named P. TrAE- 5' UTR TrAE -xyr1 Overexpression box; wherein the hph The resistance gene was amplified in plasmid T- hph ; (2) The P obtained in step (1) TrAE- 5' UTR TrAE -xyr1 Transformation of Trichoderma reesei to Trichoderma Δ ku70 Rut-C30 Among the strains, an engineered Trichoderma reesei strain with enhanced cellulase activity was obtained, and this strain was named QEaeuX; (3) The QEaeuX strain was cultured in the set fermentation medium. The fermentation conditions were 28±2℃ and 200±10 r / min. Cellulase activity was detected at regular intervals during the fermentation process.
[0016] The engineered strain QEaeuX described in this invention can be cultured in a fermentation medium containing sufficient carbon source, nitrogen source, and trace elements. One possible embodiment of the fermentation medium formulation (g / L) is: (NH4)2SO4: 2-5; KH2PO4: 0.6-1.0; MgSO4·7H2O: 0.6-1.0; CaCl2·2H2O: 1-1.5; microcrystalline cellulose: 15-30; peptone: 1-3; Na2HPO4·7H2O: 25-35; FeSO4·7H2O: 0.01-0.02; MnSO4·H2O: 0.002-0.004; ZnSO4·7H2O: 0.001-0.002; CoCl2·2H2O: 0.002-0.006; pH 4.5-5.5.
[0017] The preferred technical solution for the fermentation medium formulation (g / L) is as follows: (NH4)2SO4: 3; KH2PO4: 0.8; MgSO4·7H2O: 0.8; CaCl2·2H2O: 1.2; microcrystalline cellulose: 20; peptone: 2; Na2HPO4·7H2O: 30; FeSO4·7H2O: 0.01; MnSO4·H2O: 0.0032; ZnSO4·7H2O: 0.0014; CoCl2·2H2O: 0.004; pH 4.8.
[0018] The engineered strain constructed by the above method was experimentally verified to produce a cellulase activity of 2.6 IU / m when cultured in shake flasks for 96 h under the above fermentation conditions.
[0019] The significant advantages and beneficial effects of this invention are reflected in: Experiments confirmed that the cellulase activity produced by the engineered strain constructed using the method of this invention was significantly improved. Specifically, the filter paper enzyme activity of strain QEaeuX reached 2.6 IU / mL after 96 h of shake-flask culture, which was significantly higher than that of the starting strain Δ. ku70 Rut-C30 An increase of approximately 101%. Meanwhile, compared to using only promoter P... TrAE The strain QaeX, which did not introduce 5' UTR to overexpress Xyr1, and the strain utilizing promoter P... TrAE and cellulase gene egl2 Compared to strain QaegX, which overexpresses Xyr1 via a 5' UTR combination, QEaeuX showed approximately 40% increased filter paper enzyme activity. These results indicate that the introduction of promoter P... TrAE Regulation of Xyr1 by combining its corresponding natural 5' UTR gene and Xyr1 significantly enhances the overall activity of Trichoderma reesei cellulase. Therefore, the method for improving Trichoderma reesei cellulase activity provided by this invention can effectively increase cellulase production levels, thereby reducing enzyme preparation production costs and showing promising industrial application prospects. Attached Figure Description
[0020] Figure 1 It utilizes the promoter P TrAE and its corresponding natural 5' UTR gene TrAE The engineered Trichoderma reesei strain QEaeuX, constructed using only the promoter P, was developed. TrAE The constructed control strain QEaeX and the strain using promoter P TrAE and egl2 Gene 5'UTR egl2 A schematic diagram of the construction of the control strain QEaegX; Figure 2 Among engineered strains Xyr1Transcriptional level and protein expression analysis: Figure A shows... xyr1 Results of gene transcription level analysis; Figure B shows... Xyr1 Western blot results of intracellular proteins; Figure 3 This is a comparison of the cellulase activity of the engineered bacteria and that of the original strain. Detailed Implementation
[0021] The present invention will be further described below with reference to embodiments, but this is not intended to limit the invention in any way. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection of the present invention.
[0022] Example 1. Utilizing the endogenous promoter P of Trichoderma reesei TrAE and its associated 5' UTR combination overexpression xyr1 The expression box is constructed.
[0023] Trichoderma reesei Δ ku70 Rut-C30 Using genomic DNA as a template, primer pairs AE-F / AE-R were used to amplify molecules containing the promoter P. TrAE (Its nucleotide sequence is shown in SEQ ID NO.1), and it was amplified using primer pair UTR-F / UTR-R. TrAE 5' UTR upstream of the gene TrAE (Its nucleotide sequence is shown in SEQ ID NO2), and it was amplified using primer pair Xyr1-F / Xyr1-R. xyr1 The gene and its terminator region were amplified using primer pairs 36429-UF / 36429-UR and 36429-DF / 36429-DR. 36429 Upstream and downstream homologous arms of the gene; and using primer pair Hph-F / Hph-R from T- hph Amplification in plasmids hph Expression box. Then 36429 Upstream homologous arm of the gene, resistance gene hph P egl2 5' UTR TrAE , xyr1 Genes and terminators 36429The downstream homologous arm of the gene was fused. The fusion PCR program was as follows: 20 µl buffer, 1 µl dNTP, 1 µl phatase enzyme, and 1 µg fragment, with ddH2O added to make up to 50 µl. The fusion program was: 95℃ pre-denaturation for 5 min, 94℃ denaturation for 20 s, 60℃ annealing for 20 s, and 72℃ extension for 3 min, for 10 cycles, followed by a final extension at 72℃ for 5 min, to obtain the expression cassette, which was named P. TrAE- 5' UTR TrAE - xyr1 Overexpression box; see diagram of expression box Figure 1 As shown.
[0024] The specific nucleotide sequences of the above primer pairs are as follows: AE-F: ATTCCGTCACCAGCCCTGGGTTGTGATCGAAAGGTCAACTCTGAA, as shown in SEQ ID NO.3; AE-R: GAGTCTCACAGGAAATGGAGAA, as shown in SEQ ID NO.4; UTR-F: TTCTCCATTTCCTGTGAGACTCATATCATGGCCAGACCATCC, as shown in SEQ ID NO.5; UTR-R: TGTGATTCTCTGCGTTCGCT, as shown in SEQ ID NO.6; 36429-UF: AAAGACGGTTCGTCTTGAGAA, as shown in SEQ ID NO.7; 36429-UR: TTCAATATCAGTTAACGTCGATTGTTGCTTGTGCTGTGTGT, as shown in SEQ ID NO.8; 36429-DF: CGATTCTATGATGCGTGCAGTGGCAATGCAACAGGACG, as shown in SEQ ID NO.9; 36429-DR: GGCCTTCTATTCCCCCAA, as shown in SEQ ID NO.10; Xyr1-F: AGCGAACGCAGAGAATCACAATGTTGTCCAATCCTCTCCGT, as shown in SEQ ID NO.11; Xyr1-R: CTGCACGCATCATAGAATCG, as shown in SEQ ID NO.12; Hph-F: CGACGTTAACTGATATTGAA, as shown in SEQ ID NO.13; Hph-R: CAACCCAGGGCTGGTGACGGAAT, as shown in SEQ ID NO.14.
[0025] Example 2. Using P TrAE- 5' UTR TrAE -xyr1 Transformation of Trichoderma reesei Δ using an expression cassette ku70 Rut-C30 Construction of engineered Trichoderma reesei strains with high cellulase activity Trichoderma reesei Δ ku70 Rut-C30 The genetic transformation utilizes a PEG / CaCl2-mediated protoplast transformation method to develop hygromycin resistance genes. hph Select the marker.
[0026] Purified P TrAE- 5' UTR TrAE -xyr1 Transformation of Trichoderma reesei Δ using an expression cassette ku70 Rut-C30 A protoplast-constructed Trichoderma reesei strain QEaeuX with high cellulase activity was developed. The specific method for the PEG / CaCl2-mediated protoplast transformation is as follows: (1) Trichoderma reesei Δ ku70 Rut-C30 Preparation of protoplasts: Take freshly prepared Trichoderma reesei spores, at 10 8 Mycelia were inoculated at a density of 1 / mL into 50 mL of CM liquid medium and cultured at 28°C for 36 h. After culture, mycelia were collected by filtration and transferred to cell wall lysis buffer for enzymatic hydrolysis. The cell wall lysis buffer was prepared by dissolving 0.2 g of lysozyme and 0.5 g of lyase in 50 mL of Solution I. After thoroughly mixing the mycelia with the lysis buffer, lysis was performed at 28°C and 100 rpm for 180 min. After lysis, the lysis buffer was filtered through four layers of lens paper. The filtrate was centrifuged at 4°C and 5,000 rpm for 10 min, and the supernatant was discarded. The precipitate was then gently resuspended in Solution II, and centrifuged again at 4°C and 5,000 rpm for 10 min, after which the supernatant was discarded. Finally, 1-5 mL of Solution II was added to resuspend the precipitate, and the resulting protoplast cell suspension was stored on ice for later use. The entire protoplast preparation process was carried out under low-temperature conditions.
[0027] The above-mentioned CM liquid culture medium (g / L) is: sucrose 15, yeast powder 3, acid hydrolyzed casein 3, natural pH, sterilized at 115℃ for 15 min. Solution I above: 1.2M MgSO4·7H2O, 10mM NaH2PO4, 1M Na2HPO4, adjust pH to 5.8, sterilize at 115℃ for 15 min; Solution II above: 1.2 M sorbitol, 50 mM CaCl2·2H2O, 15 mM Tris-HCl, pH 7.6, sterilized at 115℃ for 15 min.
[0028] (2) P TrAE- 5' UTR TrAE -xyr1 Transformation of Trichoderma reesei Δ using an expression cassette ku70 Rut-C30 High-cellulase-active Trichoderma reesei engineered strains were obtained: P TrAE- 5' UTR TrAE -xyr1 Overexpression cassette, pre-cooled PEG solution, Δ ku70 Rut-C30 Protoplasts were mixed at a volume ratio of 1:6:30 and incubated on ice for 30 min. Then, 1 mL of preheated PEG solution was added to the mixture, and the mixture was incubated in a water bath at 30°C for 3 min. Finally, 3 mL of solution II was added and gently mixed. The above solution was added to 50 mL of TB3 transformation medium containing 0.5 μg / mL hygromycin (purchased from Sigma), mixed, poured into plates, cooled and solidified, and cultured at 28°C for 3-5 days. Transformed strains were selected for molecular verification. The engineered strain that was verified correctly was named the high-cellulase-producing Trichoderma reesei engineered strain QEaeuX.
[0029] The PEG culture medium was: 20% PEG 6000, 50 mM CaCl2·2H2O, 15 mM Tris-HCl, pH 7.5.
[0030] The above TB3 medium conversion medium (g / L) consists of 200 g of sucrose, 3 g of yeast extract, 3 g of acid-hydrolyzed casein, 20 g of agar powder, natural pH, and sterilized at 115°C for 15 min.
[0031] Example 3. Transcriptional regulators of high-cellulase-producing Trichoderma reesei engineered strains xyr1 Transcriptional level and intracellular protein analysis of genes The high-cellulase-producing Trichoderma reesei engineered strain QEaeuX and the starting strain Δ obtained in Example 2 were used. ku70 Rut-C30 and control strain QEaeX at 10 8Mycelia / mL were inoculated into 50 mL (250 mL Erlenmeyer flasks) of seed culture medium and cultured at 28℃ and 200 rpm for 36 h by shaking. Subsequently, 5 mL of the seed culture was inoculated into fermentation medium and cultured for another 48 h at 28℃ and 200 rpm. After cultivation, mycelia were collected by filtration, and total RNA was extracted for RT-qPCR analysis. The results are as follows. Figure 2 As shown in Figure A, in the engineered strain QEaeuX xyr1 The transcription level was significantly increased, compared with the starting strain Δ ku70 Rut-C30 Compared to the control strains QEaeX and QEaegX, the improvement was approximately 420%, and compared to the control strains QEaeX and QEaegX, the improvements were approximately 18.6% and 18.9%, respectively. This result indicates that P... TrAE- 5' UTR TrAE -xyr1 The overexpression cassette has been successfully integrated into the genome and can effectively drive... xyr1 High-level transcriptional expression.
[0032] Using mycelia obtained after 48 h of culture as material, lysis was performed for 30 min on ice using RIPA strong lysis buffer (purchased from Beyotime Biotechnology). Subsequently, 1× SDS loading buffer was added for mixing and denaturation, and Western blot analysis was performed using anti-Xyr1 antibody. The results showed that the intracellular Xyr1 protein level in the engineered strain QEaeuX was significantly higher than that in the starting strain Δ ku70 Rut-C30 The results, along with control strains QEaeX and QEaegX, demonstrate that the introduction of the promoter-5′UTR combination can effectively improve the protein expression level of Xyr1.
[0033] The seed culture medium was as follows (g / L): (NH4)2SO4 3, KH2PO4 0.8, MgSO4·7H2O 0.8, CaCl2·2H2O 1.2, glucose 20, peptone 2, Na2HPO4·7H2O 30, FeSO4·7H2O 0.01, MnSO4·H2O 0.0032, ZnSO4·7H2O 0.0014, CoCl2·2H2O 0.004, pH 4.8, sterilized at 115°C for 30 min.
[0034] The fermentation medium was as follows (g / L): (NH4)2SO4 3, KH2PO4 0.8, MgSO4·7H2O 0.8, CaCl2·2H2O 1.2, microcrystalline cellulose 20, peptone 2, Na2HPO4·7H2O 30, FeSO4·7H2O 0.01, MnSO4·H2O 0.0032, ZnSO4·7H2O 0.0014, CoCl2·2H2O 0.004, pH 4.8, sterilized at 115°C for 30 min.
[0035] Example 4. Determination of cellulase activity in engineered strains of Trichoderma reesei with high cellulase production. The engineered strain QEaeuX obtained in Example 2 and the starting strain Δ were used. ku70 Rut-C30 Control strains QEaeX and QEaegX were inoculated into 50 mL (250 mL Erlenmeyer flasks) of seed culture medium and cultured at 28℃ and 200 rpm for 36 hours. After that, 5 mL of bacterial culture from each strain was transferred to 50 mL of fermentation culture medium and cultured for 48 h and 96 h respectively. The culture medium was then collected, centrifuged, and the supernatant was collected to determine the cellulase activity.
[0036] Figure 3 The filter paper enzyme activity of the engineered strain QEaeuX reached 2.6 IU / mL after 96 h of shake-flask culture, which was higher than that of the original strain Δ. ku70 Rut-C30 An increase of approximately 101%. Meanwhile, compared to using only promoter P... TrAE The Trichoderma reesei strain QaeX, which did not introduce 5' UTR overexpression of Xyr1, and the strain utilizing promoter P... TrAE and cellulase gene egl2 Compared to the strain QaegX, which overexpresses Xyr1 using the 5' UTR combination, QEaeuX showed approximately 40% higher filter paper enzyme activity. This indicates that the engineered strain obtained using the method of this invention can significantly enhance the cellulase activity of Trichoderma reesei.
[0037] Based on this, it can be determined that the invention discloses the use of the endogenous promoter P of Trichoderma reesei. TrAE The method of enhancing cellulase activity through the associated 5'UTR combination can significantly increase cellulase yield. This method has high theoretical research significance and practical application value.
[0038] The above filter paper enzyme activity was determined according to the People's Republic of China Light Industry Standard QB 2583-2003.
[0039] Method for determining enzyme activity on filter paper: Fold a 1×6 cm (50±1 mg) filter paper and place it at the bottom of the test tube. Add 1.5 mL of pH 4.8 citrate buffer and 0.5 mL of appropriately diluted crude enzyme solution, and mix well. After incubating at 50℃ for 30 min, add 3 mL of DNS, vortex to mix, boil for 10 min, and then add distilled water to a final volume of 25 mL. Shake well and measure the OD value at 540 nm. For the blank control, add DNS first, then add the enzyme solution.
[0040] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A method for enhancing cellulase activity by utilizing the endogenous promoter of Trichoderma reesei and its associated 5′ UTR combination regulation, characterized in that: The steps are: using Trichoderma reesei Δku70 Rut-C30 As the starting strain, the endogenous promoter P was used. TrAE as well as TrAE 5' UTR region upstream of the gene TrAE Combining to express xyr1 Strains of genes; in their genome xyr1 The gene was integrated into 36,429 gene loci, of which xyr1 Upstream of the gene is the promoter P TrAE and 5' UTR TrAE Downstream is xyr1 The original terminator, resistance gene hph Located in the upstream homologous arm and promoter P TrAE between.
2. The method according to claim 1, characterized in that: The endogenous promoter P TrAE It is based on Trichoderma reesei Δku70 Rut-C30 Using the genome as a template, the nucleotide sequence containing the promoter was amplified using primer pair AE-F / AE-R, and its nucleotide sequence is shown in SEQ ID NO.1; the 5' UTR TrAE It is based on Trichoderma reesei Δ ku70 Rut-C30 Using the genome as a template, UTR-F / UTR amplification was performed using primer pairs. TrAE The nucleotide sequence of the 5' UTR upstream of the gene is shown in SEQ ID NO.
2.
3. The method according to claim 2, characterized in that: The nucleotide sequences of the primer pair AE-F / AE-R are shown in SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequences of the primer pair UTR-F / UTR-R are shown in SEQ ID NO.5 and SEQ ID NO.
6.
4. The method according to any one of claims 1-3, characterized in that: Trichoderma reesei Δku70 Rut-C30 Genome as template amplification xyr1 The gene and its terminator region were amplified using primer pairs 36429-UF / 36429-UR and 36429-DF / 36429-DR, amplifying the upstream and downstream homologous arms of the 36429 gene, respectively. Then, the upstream homologous arm and the resistance gene were amplified. hph P TrAE 5'UTR TrAE , xyr1 The gene, its terminator, and downstream homologous arms were fused sequentially to prepare an expression cassette, which was named P. TrAE -5' UTR TrAE -xyr1 Through expression box; then P TrAE- 5' UTR TrAE -xyr1 Transformation of Trichoderma reesei to Trichoderma Δ via expression cassette ku70 Rut-C30 Among the strains, an engineered Trichoderma reesei strain with enhanced cellulase activity was obtained, and this strain was named QEaeuX; wherein the... hph The resistance gene was amplified in plasmid T- hph .
5. The method according to claim 4, characterized in that: The nucleotide sequences of the primer pair 36429-UF / 36429-UR are shown in SEQ ID NO.7 and SEQ ID NO.8; the nucleotide sequences of the primer pair 36429-DF / 36429-DR are shown in SEQ ID NO.9 and SEQ ID NO.
10.
6. The method according to claim 1, characterized in that: The specific steps are as follows: (1) Trichoderma reesei Δ ku70 Rut-C30 Using the genome as a template, primer pairs AE-F / AE-R were used to amplify cells containing... TrAE The nucleotide sequence of the gene promoter, named P TrAE Its nucleotide sequence is shown in SEQ ID NO.1; *Trichoderma reesei* Δ ku70 Rut-C30 Using the genome as a template, UTR-F / UTR amplification was performed using primer pairs. TrAE The nucleotide sequence of the 5' UTR upstream of the gene, this 5' UTR is named 5' UTR. TrAE Its nucleotide sequence is shown in SEQ ID NO.2; *Trichoderma reesei* Δ ku70 Rut-C30 Genome as template amplification xyr1 The gene and its terminator region were amplified using primer pairs 36429-UF / 36429-UR and 36429-DF / 36429-DR, respectively. 36429 The upstream and downstream homologous arms of the gene, and then the upstream homologous arm, the resistance gene hph P TrAE 5' UTR TrAE xyr1 The gene, its terminator, and downstream homologous arms were fused sequentially to prepare an expression cassette, which was named P. TrAE- 5' UTR TrAE -xyr1 Overexpression box; wherein the hph The resistance gene was amplified in plasmid T- hph ; (2) The P obtained in step (1) TrAE- 5' UTR TrAE -xyr1 Transformation of Trichoderma reesei to Trichoderma Δ via expression cassette ku70 Rut-C30 Among the strains, an engineered strain of Trichoderma reesei with enhanced cellulase activity was obtained, and this strain was named QEaeuX; (3) The QEaeuX strain was cultured in the set fermentation medium. The fermentation conditions were 28±2℃ and 200±10 r / min. Cellulase activity was detected at regular intervals during the fermentation process.
7. The method according to claim 6, characterized in that: The fermentation medium formula (g / L) is as follows: (NH4)2SO4: 2-5; KH2PO4: 0.6-1.0; MgSO4·7H2O: 0.6-1.0; CaCl2·2H2O: 1-1.5; microcrystalline cellulose: 15-30; peptone: 1-3; Na2HPO4·7H2O: 25-35; FeSO4·7H2O: 0.01-0.02; MnSO4·H2O: 0.002-0.004; ZnSO4·7H2O: 0.001-0.002; CoCl2·2H2O: 0.002-0.006; pH 4.5-5.
5.
8. The method according to claim 7, characterized in that: The fermentation medium formula (g / L) is as follows: (NH4)2SO4: 3; KH2PO4: 0.8; MgSO4·7H2O: 0.8; CaCl2·2H2O: 1.2; microcrystalline cellulose: 20; peptone: 2; Na2HPO4·7H2O: 30; FeSO4·7H2O: 0.01; MnSO4·H2O: 0.0032; ZnSO4·7H2O: 0.0014; CoCl2·2H2O: 0.004; pH 4.
8.
9. A high-yield cellulase-producing Trichoderma reesei engineered strain, characterized by: The engineered strain is named QEaeuX and is constructed by the method described in any one of claims 1-8.
10. The application of the engineered strain according to claim 9 in the efficient production of cellulase from filamentous fungi.