A reagent, method and use for reducing astringency in grape berries
By studying the effects of brassinolide, strigolactone, and melatonin on the astringency of grape berries, and combining electronic tongue evaluation and transcriptome analysis, the regulatory mechanisms were revealed, and a highly efficient method for reducing the astringency of grape berries was provided, which is applicable to the large-scale production of fresh grapes.
Patent Information
- Application Number
- CN202610646001.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-12
- Publication Date
- 2026-08-25
- Estimated Expiration
- 2046-05-12
AI Technical Summary
In the existing technology, the mechanisms of action of brassinolide, melatonin and strigolactone in regulating the astringency of grape fruit are unclear, and there is a lack of efficient methods to reduce the astringency of grape fruit.
By systematically studying the effects of brassinolide (BR), strigolactone (GR24), and melatonin (Mel) on the astringency, tannin content, total phenols, and anthocyanins of 'Black King' grapes, and combining electronic tongue evaluation and transcriptome analysis, we found that these three plant growth regulators can reduce the astringency of grapes and elucidated their regulatory mechanism.
It effectively reduces the astringency of grapes, provides clear information on the types of plant growth regulators, effective concentration ranges, and treatment periods, and is suitable for large-scale production of fresh grapes, showing promising prospects for industrial application.
Smart Images

Figure CN122168676B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of fruit cultivation technology, and more specifically, relates to a reagent, method, and application for reducing the astringency of grapes. Background Technology
[0002] Astringency is a common taste attribute in fruits that has a decisive influence on sensory acceptance. Its essence is closely related to the synthesis and accumulation of phenolic compounds (especially tannins and some flavonoids, such as flavonols and anthocyanins) in the fruit. Phenolic compounds can interact non-covalently with proline-rich proteins in oral saliva or mucous membranes, forming precipitates that reduce oral lubrication and induce typical sensations such as dryness, astringency, and roughness, thus significantly affecting the palatability and flavor quality of the fruit. Existing studies have shown that the astringency of various fruits is closely related to the content, composition, and physicochemical properties of tannins and other polyphenols. For example, the astringency of persimmons, olives, and Kakadu plums is significantly correlated with the accumulation and structural characteristics of hydrolyzable tannins, as well as the physicochemical properties and antioxidant characteristics of these tannins. The astringency of bayberry fruits is also significantly correlated with changes in the content of various phenolic compounds. The astringency of grape fruits mainly originates from the accumulation of tannins and related flavonoids in the peel and seeds, and the intensity of astringency depends not only on the tannin content but also significantly influenced by its structural composition, degree of polymerization, and other factors. A moderate level of astringency can enhance the flavor profile and impart quality characteristics, while excessive astringency can reduce the fresh eating experience and market acceptance.
[0003] At the metabolic regulation level, the synthesis and accumulation of phenolic substances such as tannins are finely regulated by a multi-level regulatory network. Among them, plant hormones, as key signaling molecules connecting growth and development with secondary metabolism, play an important regulatory role in the remodeling of phenolic metabolism and the formation of astringency in fruits. Hormones can participate in the synthesis, transport, and degradation of astringency-related substances in grapes by influencing key structural genes and transcriptional regulatory modules of the main phenylpropanoid metabolic pathway and its downstream flavonoid branches (including proanthocyanidins / tannins and anthocyanins). In recent years, the roles of emerging hormones such as brassinosteroids (BR), melatonin (Mel), and strigolactones (SL) in fruit quality regulation have gradually attracted attention, but their modes of action and molecular mechanisms in the formation of astringency in fruits still lack systematic explanation. BR has been shown to participate in multiple stages such as sugar and acid metabolism, anthocyanin accumulation, aroma substance formation, and ripening process; in grapes, BR can promote fruit ripening and synergistically regulate anthocyanin synthesis with abscisic acid (ABA) and ethylene (ET). However, research on the synthesis of polyphenols such as tannins and their association with astringent phenotypes is relatively insufficient. Melatonin has been reported to regulate phenolic metabolism in crops such as peaches, tomatoes, and grapes. Exogenous melatonin treatment can promote the accumulation of anthocyanins and tannins by activating the endogenous Melatonin synthesis pathway and upregulating phenolic metabolism-related enzyme genes. Strigolactones are considered "interaction hubs" in hormone signaling networks and can interact synergistically with multiple hormone pathways to regulate phenolic metabolism: for example, they interact with gibberellins to affect anthocyanin synthesis in apples; in strawberries, they can promote anthocyanin synthesis and accumulation, enhance antioxidant capacity, reduce fruit wilting due to water deficiency, and increase fruit mechanical resistance by regulating phenylpropanoid metabolism. Studies in grapes have also shown that strigolactones can synergistically alter anthocyanin content and composition with ABA, thereby affecting fruit quality and antioxidant activity. However, whether strigolactones further regulate the synthesis and accumulation of key astringent components such as proanthocyanidins / tannins, and the mechanism by which they contribute to fruit astringency, still require further in-depth analysis.
[0004] It is noteworthy that there are potential synergistic accumulation and metabolic coupling relationships among different phenolic components, providing important clues for elucidating the metabolic network of hormone regulation of grape astringency. Previous studies have shown a significant correlation between total phenols, flavonoids, and tannins in pear fruit, suggesting that astringency-related phenolic substances may exhibit synergistic accumulation characteristics. In sumac, tannin and flavonoid synthesis share key enzyme genes at the molecular level, revealing the possible existence of common metabolic nodes and regulatory modules. This evidence suggests that the effect of hormones on astringency may not act on a single component, but rather achieves synergistic reshaping of multiple astringency-related substances by regulating key nodes and branching of the phenylpropanoid / flavonoid pathway. However, the molecular mechanisms by which brassinolide, melatonin, and strigolactone participate in fruit quality regulation have not yet been systematically elucidated in grape astringency formation, and research on the regulatory effects of BR and GR on grape astringency and their molecular pathways remains relatively weak. Summary of the Invention
[0005] To address the problems existing in the prior art, this invention discloses a method for reducing the astringency of grape fruits using plant growth regulators. Through a systematic study of the effects of brassinolide (BR), strigolactone (GR24), and melatonin (Mel) on the astringency, tannin content, total phenols, and anthocyanins of 'Black King' grape fruits, combined with electronic tongue evaluation and transcriptome analysis, it was found that all three plant growth regulators can reduce the astringency of grape fruits, and the mechanism by which brassinolide and strigolactone regulate the astringency of grape fruits was elucidated.
[0006] This invention reveals that the regulation of astringency by BR (Bremse Brett) is concentration-dependent; low concentrations (0.2 mg / L) of BR reduce astringency, while high concentrations (0.8 mg / L) increase it. Low concentrations of BR, while decreasing tannin content, increase total phenols, suggesting that this treatment may alter the branching pathway of phenylpropanoid metabolism. Transcriptome data show that BR treatment activates signaling genes. BZR1 and synthetic genes DWF4 Upregulate lignin synthesis genes CCR (Vitvi14g01757) and anthocyanin synthesis gene UFGT At the same time, it inhibits the gene for flavonol synthesis. FLS This expression pattern suggests that low-concentration BR may divert metabolic flux from proanthocyanidin synthesis to anthocyanin and lignin branches via the BZR1-mediated signaling pathway, thereby reducing astringency while promoting pericarp coloring. Unlike BR, GR significantly reduced astringency at all concentrations, with GR-3 (3 μmol / L) showing the strongest effect. GR treatment caused a simultaneous decrease in tannin, total phenol, and flavonoid content; transcriptomic analysis showed that it inhibited... DFR and UFGT The expression, and strongly downgraded. CCR (Vitvi14g01757). Simultaneously, the GR signaling gene...D14 and synthetic genes D27 Upregulation confirms that exogenous GR treatment effectively activates the plant's response system, indicating that GR inhibits... DFR and CCR It directly blocks the synthesis of proanthocyanidins, thereby achieving a strong astringent effect.
[0007] Mel only reduced astringency at low to medium concentrations (50 μmol / L, 5 μmol / L), but had no significant effect at high concentrations (200 μmol / L). Unlike BR and GR, Mel significantly reduced tannin and total phenol content, but had no significant effect on flavonoids, suggesting that its mechanism of action may differ from transcriptional-level synthetic inhibition. Given Mel's strong antioxidant activity, it is speculated that it may reduce astringency perception by scavenging reactive oxygen species and reducing the degree of tannin polymerization. It is worth noting that... CCR (Vitvi14g01757) showed completely opposite regulatory directions in BR and GR treatments, suggesting that this gene may be a key node in regulating the balance between astringency and lignification in fruit.
[0008] To achieve the above objectives, the present invention adopts the following technical solution: On the one hand, the present invention provides a reagent for reducing the astringency of grapes, including at least one plant growth regulator selected from strigolactone, brassinolide, and melatonin.
[0009] Further, the concentration of brassinolide is 0.1~0.6 mg / L, the concentration of strigolactone is 1~3 μmol / L, and the concentration of melatonin is 5~50 μmol / L.
[0010] On the other hand, the present invention provides a method for reducing the astringency of grapes by applying a plant growth regulator to the grapes, said plant growth regulator including at least one of strigolactone, brassinolide, and melatonin.
[0011] Further, the concentration of brassinolide is 0.1~0.6 mg / L, the concentration of strigolactone is 1~3 μmol / L, and the concentration of melatonin is 5~50 μmol / L.
[0012] Furthermore, the plant growth regulator is applied during the late stage of grape fruit hardening or the early stage of color change.
[0013] Furthermore, the plant growth regulator is applied by soaking, spraying, or injecting the fruit spikes.
[0014] In another aspect, the present invention provides the use of plant growth regulators in the preparation of reagents to reduce the astringency of grape fruits, wherein the plant growth regulators include at least one of strigolactone, brassinolide, and melatonin.
[0015] Further, the concentration of brassinolide is 0.1~0.6 mg / L, the concentration of strigolactone is 1~3 μmol / L, and the concentration of melatonin is 5~50 μmol / L.
[0016] Furthermore, the reagent inhibits DFR and / or CCR Gene expression inhibits tannin synthesis, thereby reducing the astringency of grapes.
[0017] Furthermore, the present invention provides CCR The use of genes as targets in the preparation of reagents for regulating grape fruit quality, the aforementioned CCR The gene sequence is shown in SEQ ID NO.1, and it regulates... CCR Gene expression achieves the following effects: (1) Overexpression CCR Genes that increase astringency, tannin content, and total phenolic content in grapes, the overexpression of which... CCR The gene sequence is shown in SEQ ID NO.1; (2) Silence CCR Genes that reduce the astringency intensity and tannin content of grape berries, the silenced CCR The gene sequence is shown in SEQ ID NO.2.
[0018] The present invention has the following beneficial effects: 1. For the first time, strigolactones were found to have a strong and specific effect on reducing the astringency of grapes. Treatment with 3 μmol / L GR24 can reduce the astringency by more than 50% without affecting the normal coloring of the fruit, which solves the problem of the lack of efficient astringency reduction methods in the existing technology.
[0019] 2. This study reveals for the first time that low concentrations of brassinolide (0.1~0.6 mg / L) can synergistically achieve multiple quality improvements such as "reducing astringency, enhancing color, and increasing total phenols," overcoming the technical prejudice held by those skilled in the art that brassinolide does not reduce or increase astringency.
[0020] 3. It provides clear information on the types of plant growth regulators, effective concentration ranges, and treatment periods. It is simple to operate, low in cost, suitable for large-scale production of table grapes, and has good prospects for industrial application.
[0021] 4. The molecular mechanisms by which strigolactone and brassinolide reduce grape astringency were elucidated, and the following were identified: CCR , DFR , BZR1 Key gene targets, such as those identified, provide a theoretical basis for molecular breeding and precise quality control of grapes. Attached Figure Description
[0022] Figure 1 The effects of (A) brassinolide, (B) strigolactone and (C) melatonin on grape berry weight are presented. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate highly significant differences ( P < 0.01); Figure 2 The effects of (A) brassinolide, (B) strigolactone and (C) melatonin on grape fruit shape index and berry size are presented. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate highly significant differences ( P < 0.01); Figure 3 The effects of (A) brassinolide, (B) strigolactone and (C) melatonin on grape skin and pulp firmness are given. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate highly significant differences ( P < 0.01); Figure 4 The effects of (A) brassinolide, (B) strigolactone and (C) melatonin on soluble solids and titratable acid in grape berries are presented. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P <0.05), different uppercase letters indicate highly significant differences ( P < 0.01); Figure 5 The effects of (A) brassinolide, (B) strigolactone and (C) melatonin on tannin content in grape skins are presented. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate extremely significant differences ( P < 0.01); Figure 6 The effects of (A) brassinolide, (B) strigolactone and (C) melatonin on the total phenolic content in grape skins are presented. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate highly significant differences ( P < 0.01); Figure 7The effects of (A) brassinolide, (B) strigolactone and (C) melatonin on the flavonoid content in grape skins are presented. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate highly significant differences ( P < 0.01); Figure 8 Harvests treated with different plant growth regulators; Figure 9 The values represent the grape skin color brightness after treatment with different concentrations of hormones. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate highly significant differences ( P <0.01); Figure 10 The data represent the red and green color index of grape skins after treatment with different concentrations of hormones. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate highly significant differences ( P < 0.01); Figure 11 The values represent the yellow-blue hue of grape skins after treatment with different concentrations of hormones. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate highly significant differences ( P < 0.01); Figure 12 The anthocyanin content in grape skins after treatment with different concentrations of hormones is given. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate highly significant differences ( P < 0.01); Figure 13 The effects of (A) brassinolide, (B) strigolactone and (C) melatonin on the astringency content in grape skins are presented. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate highly significant differences ( P < 0.01); Figure 14Pearson correlation analysis was performed between Aftertaste-A and various physiological parameters, including tannins, total phenols, flavonoids, and anthocyanins. The correlation coefficients were expressed as decimals, ranging from -1 to 1. A coefficient close to 1 indicates a strong positive correlation, a coefficient close to -1 indicates a strong negative correlation, and a coefficient close to 0 indicates no significant correlation. Among them, A represents the correlation of the CK group, B represents the correlation of the BR-1 group, C represents the correlation of the GR-3 group, and D represents the correlation of the Mel-1 group. Figure 15 Volcano plots showing the differences in gene expression levels between the CK, BR-1 and CK, GR-3 groups; Figure 16 KEGG enrichment analysis for CK and BR-1 groups; Figure 17 KEGG enrichment analysis for CK and GR-3 groups; Figure 18 Heatmap of gene clustering analysis for the three treatment groups; Figure 19 The effects of BR-1 and GR-3 treatments on co-responding genes of the two hormones are presented. Data are expressed as mean ± standard error, and * indicates significant differences. P < 0.05), ** indicates that the difference is highly significant ( P < 0.01); Figure 20 The effect of BR-1 treatment on BR-1-specific response genes is shown. Data are expressed as mean ± standard error, and * indicates significant differences. P < 0.05), ** indicates that the difference is highly significant ( P < 0.01); Figure 21 The effect of GR-3 treatment on GR-3-specific response genes is shown. Data are expressed as mean ± standard error, and * indicates significant differences. P < 0.05), ** indicates that the difference is highly significant ( P < 0.01); Figure 22 The correlation analysis results between gene expression levels and fruit quality indicators are shown. The correlation coefficients are expressed as decimals, ranging from -1 to 1. A coefficient close to 1 indicates a strong positive correlation, a coefficient close to -1 indicates a strong negative correlation, and a coefficient close to 0 indicates no significant correlation. The left side shows the correlation analysis between candidate gene expression levels and quality-related traits in the BR treatment group, while the right side shows the correlation analysis between candidate gene expression levels and quality-related traits in the GR treatment group. Figure 23 For each treatment on grape fruit CCR The effect of relative gene expression levels on the data is expressed as mean ± standard error, with different lowercase letters indicating significant differences.P < 0.05), different capital letters indicate highly significant differences ( P < 0.01); Figure 24 To illustrate the effects of each treatment on the astringency intensity and tannin content of grape berries, data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate highly significant differences ( P < 0.01); Figure 25 The data represent the changes in astringency intensity of grape berries in each treatment group during the hormone recovery experiment. Data are expressed as mean ± standard error, with different lowercase letters indicating significant differences. P < 0.05), different capital letters indicate highly significant differences ( P < 0.01); Figure 26 The changes in total phenols, anthocyanins, and flavonoids in grape berries under different treatments are presented as mean ± standard error. Different lowercase letters indicate significant differences. P < 0.05), different capital letters indicate highly significant differences ( P < 0.01). Detailed Implementation
[0023] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be noted that the embodiments described below are intended to facilitate the understanding of the present invention and do not limit it in any way.
[0024] Example 1: Treatment of grape berries with plant growth regulators (1) Test materials The experiment was conducted in June 2025 at the Grape Germplasm Resource Nursery of Zhejiang Wanli University, Ningbo City, Zhejiang Province (121.27°E, 30.23°N). Sixty five-year-old 'Black Emperor' table grape vines with uniform growth vigor and no obvious pests or diseases were selected as experimental materials. 'Black Emperor' is a hybrid of European and American grapes, a triploid offspring of Kyoho and Muscat Bailey A, and has the quality characteristics of being naturally seedless, having a high soluble solids content, low acidity, and a firm and crisp flesh.
[0025] The grape germplasm resource nursery is located on the south bank of Hangzhou Bay on the east coast of China, in a subtropical monsoon climate zone with an average annual temperature of 18.2℃ and annual precipitation of 1247.2 mm. The soil is loam with a pH of 8.01; organic matter content is 0.25%, total nitrogen is 0.050%, available phosphorus is 44 mg / kg, and available potassium is 301 mg / kg. During the experiment, the grapevines were managed with water and fertilizer according to local conventional methods.
[0026] (2) Experimental treatment Four grapevines with uniform growth vigor were selected as replicates for each treatment. On each vine, five bunches of fruit were selected and marked at the same fruiting position (uniform height and orientation). During the late pit hardening stage, the marked bunches were treated with strigolactone (GR24, Solarbio IS3390), strigolactone synthesis inhibitor (Tis108, Yuanye S25193), brassinolide (BR, Yuanye B21633), brassinolide synthesis inhibitor (BRZ, Yuanye S87623), and melatonin (Mel, Maclean G810401), respectively. The bunches were immersed in the treatment solution for 30 seconds. Specific treatment concentrations are shown in Table 1. The control group (CK) was treated with an equal volume of water. Fruits were harvested after ripening (soluble solids ≥15%), marked, and transported to the laboratory at low temperature. One part of the samples was used for fruit quality and related physicochemical index determination; the other part was flash-frozen in liquid nitrogen and stored at -80℃ for subsequent transcriptome sequencing analysis.
[0027] Table 1. Experimental treatments for each group
[0028] Example 2: Determination of astringency and physicochemical properties (1) Measurement method 1. Fruit quality measurement Fruit weight was determined using a 0.01 g / cm² electronic balance (Sartorius BSA124S-CW). The longitudinal diameter (longest straight-line distance from the apex to the base of the pedicel) and transverse diameter (maximum width at the equator) were measured using 0.01 mm vernier calipers. Fruit shape index (longitudinal diameter / transverse diameter) and fruit size (longitudinal diameter × transverse diameter) were calculated. Each treatment was repeated three times, with 10 fruits measured per replicate.
[0029] Fruit firmness was determined using a GY-4 fruit firmness tester (Lynd, China), equipped with a 2 mm diameter probe (P / 2) and a testing speed of 1 mm / s. For peel firmness: the probe was inserted vertically into the peel at a constant speed, and the piercing force was recorded. For flesh firmness: after removing a 1 cm thick layer of peel, the probe was inserted vertically into the fruit along its longitudinal axis at a constant speed. Each treatment was performed in three biological replicates, with 10 fruits measured per replicate. Measurements are in Newtons (N).
[0030] Soluble solids content was determined using a portable refractometer (PAL 1; ATAGO, Tokyo, Japan). Titratable acid (TA) content was determined by acid-base titration: 25 g of grape pulp was homogenized with an equal volume of distilled water; 50 g of the homogenate was diluted in 100 mL of distilled water, incubated in a water bath at 80°C with shaking for 30 min, cooled, and brought to a final volume of 250 mL before filtration. 50 mL of the filtrate was added with phenolphthalein indicator and titrated with standard NaOH solution until a stable light red color was achieved and maintained for 30 s (endpoint). The TA content was calculated based on the volume of NaOH consumed. Each treatment was performed in triplicate, with 10 fruits measured in each replicate.
[0031] 2. Determination of fruit peel color The L, a, and b values of the unblemished center of each fruit were determined using a Konica-Minolta CR-410 colorimeter. Each treatment was repeated three times, with 10 fruits measured per replicate.
[0032] 3. Determination of phenolic content in fruit peel The contents of relevant substances in grape skins were determined using kits: soluble tannins (Suzhou Mengxi Tannin Content Kit, M0120A), total phenols (Suzhou Mengxi Plant Total Phenolic Reagent Kit, M0119A), flavonoids (Suzhou Mengxi Plant Flavonoid Kit, M0118A), and anthocyanin content (Suzhou Mengxi Plant Anthocyanin Content Kit, M0126A). Each treatment was performed in triplicate.
[0033] 4. Analysis of astringency in fruit peel Accurately weigh grape peel powder samples and add ultrapure water at a sample:water ratio of 1:2. After extraction by shaking for 30 minutes, allow to stand, filter, and collect the supernatant for later use. Place the treated supernatant into the electronic tongue (INSENTSA402B) automatic sampler, selecting the corresponding sensor based on the target taste (astringency, sweetness, etc.). First, immerse the positive and negative electrodes of the sensor in the positive and negative detection cleaning solutions respectively for 90 seconds, then wash them sequentially with two different reference solutions for 120 seconds each. After the sensor returns to its equilibrium position for 30 seconds, testing begins, with a testing time of 30 seconds. After the test, the sensor is washed in each of the two sets of reference solutions for 3 seconds, then inserted into a new reference solution for a 30-second aftertaste test. The taste information is processed by the electronic tongue pattern recognition system and transmitted to the data acquisition processor. Software analysis yields quantitative taste data, with the aftertaste intensity expressed as the Aftertaste-A value. Each treatment is biologically replicated three times.
[0034] (2) Results Analysis 1. Effects of plant growth regulators on the quality of table grapes like Figure 1 , Figure 2As shown, the three growth regulator treatments significantly affected the appearance and internal quality indicators of grape fruits, but there were significant differences among the different hormones and their concentrations. Among the brassinolide treatments, BR-3 and BR-4 significantly increased single-berry weight, with no significant difference between the two concentrations. BR-1, BR-4, and the strigolactone treatments (GR-1, GR-4, GR-5) and the melatonin treatment (Mel-2) all significantly increased fruit size, with GR-5 showing the most significant promoting effect. Except for BR-1, the other brassinolide treatments significantly reduced the fruit shape index, with BR-2 showing a highly significant reduction, indicating that BR treatments tend to promote lateral fruit enlargement. In contrast, strigolactone and melatonin treatments had no significant effect on the fruit shape index.
[0035] like Figure 3 As shown, treatment with all three growth regulators significantly reduced peel firmness, with the most pronounced reduction observed in medium-to-high concentration treatments (such as BR-4, GR-3, and Mel-2). Regarding flesh firmness, BR-3, BR-6, GR-1, GR-5, and Mel-1 all significantly reduced flesh firmness, while GR-3 exhibited the opposite effect, significantly increasing flesh firmness. This demonstrates the differential regulation of cell wall properties by strigolactones at different concentrations.
[0036] like Figure 4 As shown, regarding intrinsic quality indicators, medium and high concentrations of brassinolide (BR-3 and BR-4) significantly increased the soluble solids content of fruits; strigolactone treatments exhibited a clear concentration-dependent effect, with low concentration (GR-1) significantly increasing soluble solids content, while high concentration (GR-3) led to a significantly decreased soluble solids content. The effect of brassinolide on titratable acidity also showed a significant concentration effect: low concentration (BR-1) significantly increased titratable acidity content, while high concentration (BR-4) significantly decreased it. In melatonin treatment, titratable acidity content continuously decreased with increasing treatment concentration; furthermore, GR-1 and GR-3 also significantly decreased titratable acidity content.
[0037] In hormone interaction treatments, BR and BRZ alone had no significant effect on single-fruit weight, but their combined treatment (BR-6) showed a significant synergistic effect, resulting in a highly significant reduction in single-fruit weight. Both BR and BRZ alone maintained the slender fruit shape and significantly increased fruit size, while the combined treatment had no significant effect on fruit shape and exhibited a clear antagonistic effect on fruit size, leading to a highly significant reduction in fruit size. BRZ alone significantly reduced peel firmness, while the BR and BRZ combined treatment showed an antagonistic effect, with BRZ having a dominant reducing effect. In contrast, the BR and BRZ combined treatment showed a synergistic effect on flesh firmness, resulting in a highly significant reduction in flesh firmness. Tis alone significantly increased flesh firmness, while its combined treatment with GR showed an antagonistic effect, with Tis having a dominant enhancing effect. Both GR and Tis alone significantly increased soluble solids content, with no significant difference between the two, but the combined treatment significantly weakened this promoting effect. Regarding titratable acids, BRZ treatment alone significantly reduced their content, while the combined treatment with BR showed an antagonistic effect, with BR playing a dominant role in increasing the content. GR treatment alone significantly reduced the content of titratable acids, while Tis treatment alone significantly increased this index. The combined treatment of the two also showed an antagonistic effect, with Tis playing a dominant role in increasing the content.
[0038] 2. Effects of plant growth regulators on tannin content in fresh table grapes like Figure 5 As shown, all three plant growth regulators reduced tannin content in grape skins, but their regulatory effects varied significantly between hormone types and concentrations. In brassinolide (BR) treatment, tannin content in the skin changed significantly with treatment concentration, with lower concentrations showing a stronger inhibitory effect. Specifically, BR-1 treatment resulted in a significantly lower tannin content in the skin compared to the control. P < 0.01), and the rate of decrease gradually weakens with increasing concentration, indicating that BR has a significant concentration-dependent negative regulatory characteristic on tannin accumulation in pericarp. Treatment with strigolactone (GR) significantly reduced tannin content in pericarp ( P < 0.05 or P < 0.01), but the differences between different concentration treatments were not significant, indicating that the reduction effect of GR on tannin content was not significantly related to the treatment concentration, showing a relatively stable negative regulatory effect. Melatonin (Mel) regulated tannin content in the peel in a similar pattern to BR. Low and medium concentration treatments (Mel-1 and Mel-2) both significantly reduced tannin content in the peel ( P < 0.01), while the high concentration treatment (Mel-3) showed no significant difference compared to the control, indicating that Mel's regulation of tannin content also has a certain concentration dependence.
[0039] In hormone interaction treatments, BR (BR-2) and BZR (BR-5) treatments alone significantly reduced the tannin content in the pericarp (BR-2 and BZR (BR-5)). P < 0.01 or P < 0.05), the tannin content in the combined treatment group (BR-6) was not significantly different from that in BR-5, indicating that BRZ played a dominant role in the combined treatment, and exogenous BR did not further enhance its tannin-reducing effect. Both GR-1 and GR-4 treatments alone could significantly reduce the tannin content in the peel ( P < 0.01), while the combined treatment of the two (GR-5) had no significant effect on tannin content, showing no significant difference from the control group, and exhibiting a clear antagonistic effect.
[0040] 3. Effects of plant growth regulators on the total phenolic and flavonoid content of fresh table grapes like Figure 6 As shown, all three plant growth regulators significantly affected the total phenolic content in grape peels, with significant differences in regulatory effects among hormone types and concentrations. Low concentrations of brassinolide (BR-1, BR-2) and strigolactone (GR-1) treatments significantly increased the total phenolic content in grape peels, while medium- and high concentrations (BR-3, BR-4, GR-2, GR-3) significantly decreased it. P < 0.01). Treatment with different concentrations of melatonin (Mel) significantly reduced the total phenol content ( P < 0.01), but the effect was more significant at lower concentrations (the lowest in the Mel-1 group, 49.51 mg / g), indicating that Mel has a concentration-dependent negative regulatory effect on the accumulation of total phenols in the pericarp. Both plant growth regulator inhibitors BRZ and Tis, treated alone, significantly reduced the total phenol content in the pericarp. Combined treatments of BRZ with BR and Tis with GR also significantly reduced the total phenol content in the pericarp, but with antagonistic effects, and the inhibitors' reducing effect was dominant.
[0041] like Figure 7 As shown, all three plant growth regulators affected the flavonoid content in grape peels. Among them, BR-2, GR-3, and Mel-1 treatments significantly reduced the flavonoid content in grape peels (…). P < 0.01, P < 0.05), and the other treatments showed no significant difference from CK. BRZ had no significant effect on flavonoid content, but the flavonoid content in the Tis-only treatment group (GR-4) was significantly lower than that in CK, and the flavonoid content in the Tis and GR combined treatment group (GR-5) was significantly lower than that in CK and GR-1, but there was no significant difference from GR-4.
[0042] 4. Effects of plant growth regulators on the color and anthocyanin content of fresh table grapes like Figures 8-11As shown, the L values showed a highly significant difference after treatment with low concentrations of strigolactone (GR-1) and melatonin (Mel-1, Mel-2). P < 0.01: GR-1 treatment significantly increased the L value and made the peel color brighter; Mel-1 and Mel-2 treatments significantly decreased the L value and darkened the peel color; BR-4 significantly increased the L value and improved the peel brightness. Only BR-3 and BR-4 treatments significantly changed the a value from negative to positive in the control group (< 0.01). P < 0.01), the red hue of the peel is significantly highlighted; the a value increased significantly after Mel-1 and Mel-3 treatments ( P < 0.05), the green hue of the peel was weakened and the red color was slightly enhanced; the a values of the other treatment groups were not significantly different from those of the CK group. The b values were significantly reduced after BR-1 and Mel-2 treatments ( P < 0.05), the yellow hue of the peel was weakened and the blue hue was relatively prominent. The b values of the other brassinolide and melatonin treatment groups were not significantly different from the control group. In the strigolactone treatment group, the b value was positively correlated with the concentration. Among them, the GR-3 treatment increased the b value to the highest (10.89), and the yellow hue of the peel was significantly deepened. The GR-4 and GR-5 treatments significantly reduced the b value, and the yellow hue of the peel was significantly weakened. The Tis treatment alone (GR-4) significantly increased the a value and decreased the b value, and the red hue of the peel was significantly increased, while the yellow hue was significantly weakened. The Tis and GR combined treatment (GR-5) had antagonistic effects on the regulation of both the a and b values, and the effect of Tis was dominant: the a value increased by a very significant amount and the b value decreased by a very significant amount. The phenotype of increased red hue and weakened yellow hue of the peel was consistent with the Tis treatment alone.
[0043] like Figure 12 As shown, among all treatments, BR-3 (0.6 mg / L) had the strongest promoting effect on anthocyanin accumulation in the pericarp, with an anthocyanin content of 233.98 μg / g. Low concentrations of strigolactone treatment (GR-1, GR-2) significantly increased anthocyanin content. P < 0.01), with contents of 37.09 μg / g and 33.06 μg / g, respectively, while the high-concentration treatment (GR-3) showed no significant difference compared to the control. Mel-2 showed the most significant effect on increasing anthocyanin content in the pericarp among the melatonin treatments. P < 0.01), with a content of 57.30 μg / g. Furthermore, treatment with the brassinolide inhibitor BRZ alone (BR-5) significantly increased anthocyanin content; the anthocyanin content in the BR and BRZ combined treatment group (BR-6) was between that of BR-2 and BR-5, exhibiting a significant antagonistic effect. Treatment with the strigolactone inhibitor Tis alone (GR-4) and its combined treatment with GR-1 (GR-5) had no significant effect on the anthocyanin content of the pericarp.
[0044] 5. Effects of plant growth regulators on the astringency of fresh table grapes like Figure 13 As shown, the three plant growth regulators had significantly different effects on the astringency of the fruit peel (Aftertaste-A). Strigolactone treatment had the strongest effect in reducing astringency, followed by melatonin, while brassinolide had the weakest effect. Low to medium concentrations of brassinolide and melatonin treatments (BR-1, BR-2, BR-3 and Mel-1, Mel-2) significantly reduced the astringency of the fruit peel. P < 0.01), among which BR-1 and Mel-1 had the most significant effects, with Aftertaste-A values of 0.57 and 0.45, respectively, while the high concentration treatment (BR-4) significantly increased the astringency of the peel ( P < 0.01), with a value of 0.92. Treatment with strigolactones significantly reduced the astringency of the fruit peel ( P < 0.01), and the overall concentration decreased with increasing concentration; GR-3 showed the most significant reduction effect and was the best among all treatment groups, with an Aftertaste-A value of 0.42, which was 50.59% lower than that of the CK group. In addition, treatment with brassinolide inhibitor BRZ alone (BR-5) could significantly reduce the astringency of the peel ( P < 0.01), the astringency of the peel in the BR-6 group treated with the combined BR and BRZ treatment was not significantly different from that in the BR-2 and BR-5 groups. Treatment with the strigolactone inhibitor Tis alone (GR-4) significantly reduced the astringency of the peel. P < 0.01), its compound treatment (GR-5) can also significantly reduce the astringency of the fruit peel ( P < 0.01), but significantly higher than GR-1 and GR-4.
[0045] In summary, all three plant growth regulators significantly affected the fruit quality of 'Black King' grapes, but their regulatory mechanisms differed. Strigolactone (GR24) significantly reduced astringency and soluble tannin content at all concentrations, with the 3 μmol / L treatment showing the strongest effect, reducing astringency (Aftertaste-A value) by 50.59%. Compared to brassinolide and melatonin, GR24 was the most effective in reducing grape astringency, without significantly affecting skin color. Low concentrations of brassinolide (0.2 mg / L) significantly reduced astringency while increasing total phenolic and anthocyanin content, promoting fruit coloring and achieving a synergistic effect of "reducing astringency, increasing color, and increasing total phenolic content"; high concentrations (0.8 mg / L) increased astringency. Melatonin significantly reduced astringency at low to medium concentrations (50 μmol / L), but total phenolic content decreased simultaneously; high concentrations were ineffective.
[0046] Example 3 Correlation Analysis BR-1, GR-3, and Mel-1 treatments showed the most significant reduction in astringency of grape skins; therefore, these three groups, along with the control (CK), were selected for correlation analysis between astringency and related chemical indicators. Figure 14 The results showed that astringency was strongly positively correlated with tannin content in all groups (r = 0.987, 0.990, 0.994, and 0.924 for CK, BR-1, GR-3, and Mel-1, respectively), and also strongly positively correlated with total phenol content (r = 0.834, 0.975, 0.886, and 0.815, respectively). Furthermore, a positive correlation was also observed between tannin and total phenol content in each group (r = 0.735, 0.933, 0.998, and 0.910). Given that tannin is an important component of total phenols and its correlation with astringency is generally higher than that with total phenols, this suggests that tannin content may be one of the main contributing factors explaining the differences in astringency in grape skins.
[0047] In contrast, the correlation between astringency and flavonoid metabolism indicators showed a clear treatment dependence. Figure 14 Astringency and anthocyanin content showed a weak positive correlation in the CK, BR-1, GR-3, and Mel-1 groups (r = 0.190–0.477), suggesting a possible co-current trend, but anthocyanins have a limited direct contribution to astringency. The correlation between flavonoids and astringency was more pronounced: a strong positive correlation was observed in the BR-1 group (r = 0.843), a moderate positive correlation in the Mel-1 group (r = 0.647), while almost no correlation was found in the GR-3 group (r = 0.091). Overall, astringency is more likely to fluctuate in synergy with the overall changes in flavonoids (especially the flavan-3-ol / proanthocyanidin branches, which are more directly related to astringency).
[0048] Combination Figure 5 , Figure 6 and Figure 13 The results showed that BR-1, GR-3, and Mel-1 all significantly reduced the astringency and tannin content of the pericarp, with GR-3 showing the most significant effect on reducing astringency; however, they differed in their regulation of total phenols: BR-1 increased the total phenol content, while Mel-1 and GR-3 decreased it. Therefore, the BR-1 and GR-3 treatment groups were selected for transcriptome sequencing in subsequent studies.
[0049] Example 4: Transcriptome sequencing and differential gene expression analysis (1) Experimental methods 1. Transcriptome analysis Total RNA was extracted from grape samples for transcriptome sequencing and library construction. mRNA was reverse transcribed into complementary DNA (cDNA) using random primers. The purified cDNA fragments were end-repaired and ligated with Illumina sequencing adapters. The ligation products were separated by agarose gel electrophoresis, amplified by PCR, and sequenced on the BGISEQ-500 platform (Dahua Technology, China). High-quality, clean data were obtained by removing adapter sequences, unknown "N" bases, and low-quality reads. Three biological replicates were set for each treatment. De novo transcriptome assembly of the reference genome was performed using Trinity software. String Tie was used to calculate the fragment per thousand bases per million mapped fragments (FPKM) value to quantify the expression abundance and variation of individual genes. Differential RNA expression between the two groups was analyzed using R software, and the false discovery rate (FDR) was used for calibration. P Value; with P Differentially expressed genes (DEGs) were screened using thresholds of <0.05 and fold change (FC) >1, and then the DEGs were subjected to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis.
[0050] 2. qRT-PCR Total RNA was extracted using a polysaccharide and polyphenol plant total RNA extraction kit (HuiLing, China). cDNA was synthesized using the NovoScript Plus All-in-one 1st Strand cDNA Synthesis SuperMix (gDNA Purge) reverse transcription kit (Novoprotein, China). Real-time quantitative PCR (qRT-PCR) was performed using the TransStart Tip Green qPCR SuperMix kit (Novoprotein, China) and a q225 real-time PCR instrument (Kubo, Guangzhou, China). The reaction mixture (10 μL) consisted of 1 μL template cDNA, 1 μL each of forward and reverse primers, 5 μL of 2×TransStart Tip Green qPCR SuperMix, and water to a final volume of 10 μL. The reaction program was: 95℃ pre-denaturation for 60 s; 95℃ for 20 s, 60℃ for 60 s, for 45 cycles. VvEF1α As an internal control gene, three replicates were set up for each reaction; using 2 ⁻ΔΔCt Data analysis was performed, and gene expression level maps were plotted. Primers are shown in Table 2. Excel 2025 was used for data analysis and processing, and SPSS 25.0 was used for univariate ANOVA analysis of each indicator. GraphPad Prism 10 was used for plotting.
[0051] Table 2 Primer Sequences
[0052] (2) Results Analysis 1. Analysis of differentially expressed genes (DEGs) like Figures 15-18 As shown, the BR-1 treatment group screened out 2340 DEGs, of which 1339 were upregulated and 1001 were downregulated. KEGG pathway enrichment showed that these DEGs were significantly enriched in biological pathways such as response to hydrogen peroxide, protein complex oligomerization, and disaccharide metabolic process. This invention focuses on metabolic pathways closely related to astringency formation, including the anthocyanin biosynthesis pathway, the flavonoid biosynthesis pathway, and the phenylpropanoid biosynthesis pathway, from which 13 key candidate genes were screened. For example, in the anthocyanin biosynthesis pathway, anthocyanidin 3-O-glucosyltransferase is encoded. UFGT In the flavonoid biosynthesis pathway, the gene Vitvi16g00156, encoding flavonol synthase (FLS), was upregulated by 2.78-fold (log2FC = 1.60); in the flavonoid biosynthesis pathway, the gene Vitvi18g02538, encoding flavonol synthase (FLS), was downregulated by 3.22-fold (log2FC = -1.57); in the phenylpropanoid biosynthesis pathway, the gene encoding cinnamoyl-CoA reductase (CNA) was downregulated by 3.22-fold (log2FC = -1.57). CCR The expression of the gene Vitvi14g01757 was upregulated 2.73-fold (log2FC=1.57). Simultaneously, this invention also focuses on pathways related to brassinosteroid synthesis or signal transduction—brassinosteroid biosynthesis and plant hormone signal transduction pathways—and screened 18 key candidate genes, among which the brassinosteroid synthesis gene Vitvi04g01278 (… DWF4 The expression of brassinolide signal transduction gene Vitvi19g00061 was upregulated by 1.98-fold (log2FC=1.11). BZR1The expression of the signal transduction and binding gene Vitvi18g00635 was upregulated by 1.92-fold (log2FC=1.66). PSK The expression was upregulated by 25.78 times (log2FC=4.74).
[0053] A total of 2485 DEGs were obtained from the GR-3 treatment group, of which 1177 were upregulated and 1308 were downregulated. These DEGs were mainly enriched in pathways such as Phenylpropanoid biosynthesis, Anthocyanin biosynthesis, and Diterpenoid biosynthesis. This invention focuses on analyzing the flavonoid biosynthesis pathway and the terpenoid backbone biosynthesis pathway, from which 8 key candidate genes were screened. For example, in the flavonoid biosynthesis pathway, the gene encoding dihydroflavonol 4-reductase (…) DFR The expression of the gene Vitvi15g01503 was downregulated by 2.05-fold (log2FC=-1.33); in the terpene skeletal biosynthesis pathway, the expression of Vitvi19g00005, a gene encoding coenzyme transport and metabolism (SPS), was upregulated by 2.72-fold (log2FC=1.16). Furthermore, screening results for carotenoid synthesis genes and signal transduction-related pathways identified 24 key candidate genes, among which the carotenoid synthesis gene Vitvi03g00533 (… AOG The expression of the signal transduction and binding-related gene Vitvi02g00636 (ARR-B) was upregulated by 3.25-fold (log2FC=1.41), and the expression of the signal transduction and binding-related gene Vitvi02g00636 (ARR-B) was upregulated by 2.72-fold (log2FC=1.15).
[0054] Intersection analysis was performed on 31 candidate genes from the BR-1 treatment group and 32 candidate genes from the GR-3 treatment group, further screening revealed 11 common DEGs (genes that respond to both treatments). Among these, 6 showed common upregulation, 3 showed common downregulation, and 2 showed treatment-differential regulation. These common DEGs were significantly enriched in four pathways: carotenoid biosynthesis, flavonoid biosynthesis, phenylpropanoid biosynthesis, and plant hormone signal transduction. This invention focuses on four regulatory genes: Vitvi12g02158 in the phenylpropanoid biosynthesis pathway. CCRThe levels of β-hydroxylamine (Vitvi14g01757) showed differential downregulation among treatments, with BR-1 and GR-3 treatments downregulated by 2.24-fold (log2FC=-1.05) and 1.83-fold (log2FC=-1.63), respectively. Vitvi14g01757, which belongs to the same phenylpropane biosynthetic pathway, also showed a lower reduction. CCR Significant regulatory differences were observed between treatments. In the BR-1 treatment, the gene was upregulated by 2.73-fold (log2FC=1.57), while in the GR-3 treatment, it was downregulated by 8.08-fold (log2FC=-3.30). Vitvi18g00635 in the plant hormone signal transduction pathway... PSK Both treatments showed upregulation, but the magnitude of upregulation differed significantly. The BR-1 treatment upregulated 25.78-fold (log2FC=4.74), while the GR-3 treatment upregulated only 5.33-fold (log2FC=2.12). Vitvi15g04511 (PSK), a hormone signal transduction pathway in the same plant genus, also showed differential upregulation between treatments. The BR-1 treatment upregulated 4.80-fold (log2FC=2.37), while the GR-3 treatment upregulated only 3.15-fold (log2FC=1.36).
[0055] 2. qRT-PCR analysis To verify the reliability of the transcriptome sequencing results, this invention selected 17 DEGs related to hormone signal transduction, phenolic metabolism, and astringency formation for q-PCR verification, including 4 BR-1 treatment-specific response genes, 9 GR-3 treatment-specific response genes, and 4 genes that respond to both treatments. For example... Figures 19-21 The results showed that the expression trends of all candidate genes by q-PCR were highly consistent with the FPKM values of transcriptome sequencing, confirming the reliability of the transcriptome data and providing a basis for subsequent regulatory analysis.
[0056] Genes exhibiting a specific response to BR-1 treatment are primarily enriched in the endogenous synthesis of BR and the phenylpropanone metabolism pathway. Among these, the rate-limiting enzyme gene for BR synthesis, Vitvi04g01278 (… DWF4 ) and the key gene Vitvi09g00086 that activates BR signaling ( CYP92A6 All were significantly upregulated compared to the control group. P<0.01), while the latter showed an upregulation of up to 2938.77 times, indicating that exogenous BR treatment effectively activated the endogenous BR signaling pathway in the fruit. Furthermore, the genes Vitvi01g02293 and Vitvi04g01237, related to the phenylpropanoid metabolism pathway, were also significantly upregulated. The former is an inhibitor of anthocyanin synthesis, while the latter catalyzes flavonoid glycosylation, promoting anthocyanin accumulation and color development in vacuoles. Specifically, the expression level of Vitvi01g02293 was upregulated to 1.13 times that of the control, while Vitvi04g01237 was upregulated to 62.82 times, indicating that although there was an inhibitory effect, the promoting effect on anthocyanin synthesis and accumulation was dominant, which is consistent with the phenotypic characteristics of BR treatment promoting fruit coloring.
[0057] Genes exhibiting a specific response to GR-3 treatment are primarily enriched in the GR signaling and phenylpropanoid metabolism pathways. Among them, the GR synthesis rate-limiting enzyme gene Vitvi02g00235 ( D27 ) and its receptor gene Vitvi11g00371 ( D14 ) significantly upregulated compared to the control group ( P < 0.05), confirming that exogenous GR24 treatment successfully activated the endogenous SL signaling pathway in the fruit. The plant hormone signal transduction genes Vitvi02g00636 and Vitvi11g00651 were significantly upregulated, while the expression level of Vitvi06g01073, a key gene regulating fruit color, was downregulated to 0.84 times that of the control, consistent with the weaker coloring observed after GR treatment. In the flavonoid secondary metabolism pathway, the core enzyme gene for anthocyanin homeostasis regulation, Vitvi03g00533 (…), was… AOG The expression level of the anthocyanin synthesis rate-limiting enzyme gene Vitvi19g00396 was upregulated to 1.31 times that of the control, but the expression level of the gene was also upregulated. DFR ) and the flavonoid terminal modifying enzyme gene Vitvi01g04438 ( AMOT The levels of tannins were downregulated by 0.28-fold and 0.64-fold, respectively, which may have inhibited tannin synthesis, thus explaining the stronger astringency-reducing effect of GR treatment compared to BR treatment. The sucrose phosphate synthase gene Vitvi19g00005 was significantly upregulated to 59.71-fold. These results are consistent with the phenotypic characteristics of GR treatment, which specifically reduces astringency without affecting fruit coloring.
[0058] Four genes that responded to both treatments showed differential expression patterns: downstream hormone signaling response genes Vitvi15g04511 and Vitvi18g00635 were upregulated in both treatments, but the upregulation in the BR-1 treatment was significantly higher than that in the GR-3 treatment, indicating that the fruit was more sensitive to BR treatment; while the core gene of the phenylpropanone metabolic pathway, Vitvi14g01757 ( CCR ) and the key enzyme gene Vitvi16g00156 at the end of flavonoid / anthocyanin synthesis ( UFGT The expression patterns were completely opposite in the two treatments—significantly upregulated in the BR-1 treatment and significantly downregulated in the GR-3 treatment, which directly reflects the differential regulation of the phenylpropane metabolic pathway by the two hormones.
[0059] The correlation analysis results between gene expression levels and fruit quality indicators showed that ( Figure 22 After treatment with GR-3, the correlation between the expression levels of the aforementioned genes and tannin content and astringency indicators changed significantly: genes that were originally strongly positively correlated became weakly positively correlated or even negatively correlated, while genes that were originally strongly negatively correlated became weakly negatively correlated or even positively correlated. These results confirm at the transcriptional level that GR treatment achieves its astringency-reducing effect by inhibiting the expression of key genes involved in tannin synthesis.
[0060] In summary, this invention reveals the molecular mechanism of different hormones through transcriptome analysis: brassinolide treatment upregulates the BR synthesis gene. DWF4 Signal transduction genes BZR1 and the phenylpropane core gene Vitvi14g01757 ( CCR ), and at the same time, increased UFGT , lower FLS This shifts the metabolic flow from proanthocyanidins to anthocyanin and lignin synthesis. GR treatment activates SL synthesis genes. D27 and receptors D14 Vitvi14g01757 was strongly downgraded. CCR (8.08 times) and DFR and suppress UFGT It broadly blocks the tannin synthesis pathway. Both respond to Vitvi14g01757 (…). CCR The gene was upregulated 2.73-fold in BR and downregulated 8.08-fold in GR, showing completely opposite regulatory directions, and is a key node in the balance between astringency and lignification. The qRT-PCR validation results were highly consistent with the transcriptome results, confirming the reliability of the data.
[0061] Example 5 CCR Validation of key targets for strigolactones and brassinolides in regulating grape astringency (1) Construction of experimental materials and carriers Five-year-old 'Black King' grapevines with uniform growth vigor were selected from the grape germplasm resource nursery of Zhejiang Wanli University as experimental materials. Transcriptome sequencing data were used to obtain... CCR The full-length cDNA sequence of the gene (Vitvi14g01757, SEQ ID NO.1) was used to design specific primers (forward: ATGGCATCTCCTCCTCCTCC, reverse: TCAGCCAAAATTGGAACCGCAC) for construction. CCROverexpression vector (SEQ ID NO.1) and silencing vector (SEQ ID NO.2). The amplified products were double-digested with BamHI and SalI and then ligated into the pCAMBIA1301-35S overexpression vector and the pTRV2 virus-induced gene silencing (VIGS) vector, respectively, to construct... CCR Overexpression vector (35S:: CCR ) and silencing vector (pTRV2- CCR Simultaneously, an empty vector control (EV) was constructed. The constructed vectors were transformed into Agrobacterium GV3101 competent cells, and after verification by PCR and sequencing, they were used for subsequent infection experiments.
[0062] (2) Transient transformation of grape fruit and hormone replenishment treatment During the later stage of fruit pit hardening, select fruit clusters that are of uniform size, free from pests and diseases, and have similar coloring, and perform the following treatments respectively: Group 1: Gene Function Verification Overexpression group (OE-) CCR ): will contain 35S:: CCR Agrobacterium tumefaciens culture (OD) of the carrier 600 =0.8) and an equal volume of infiltration buffer (10 mmol / L MES (2-(N-morpholino)ethanesulfonic acid), 10 mmol / L MgCl2, 200 μmol / L acetylsylgenone, pH 5.6), and 100 μL of the bacterial solution was slowly injected into the lower 0.5 cm of the pericarp from the fruit stalk using 1 mL of sterile injection solution, with each spike receiving 100 μL.
[0063] Silencing group (RNAi- CCR ): Containing pTRV2- CCR Agrobacterium tumefaciens culture (OD) of the carrier 600 =0.6) and the auxiliary carrier pTRV1 bacterial solution were mixed at a ratio of 1:1 and injected into the lower 0.5 cm of the pericarp in the same way.
[0064] Empty vector control group (EV): Agrobacterium tumefaciens bacterial suspension containing empty vector was injected.
[0065] Control group (CK): Injected with an equal volume of infiltration buffer.
[0066] Group 2: Hormone Replenishment Verification RNAi- CCR +GR-3 group: First press RNAi- CCR The method involves injecting a silencing vector, followed by soaking the ears of fruit in 3 μmol / L strigolactone (GR24) for 30 s 48 h later.
[0067] RNAi- CCR+CK group: The silencing vector was injected first, and the group was soaked in water 48 h later.
[0068] OE- CCR +BR-1 group: First press OE- CCR The method involved injecting the overexpression vector, followed by soaking the ears of fruit in 0.2 mg / L brassinolide (BR) for 30 seconds 48 h later.
[0069] OE- CCR +CK group: The expression vector was injected first, and then the cells were soaked in water for 48 hours.
[0070] Positive control group: The ears of fruit were soaked for 30 seconds in 0.2 mg / L brassinolide (BR-1) and 3 μmol / L strigolactone (GR-3), respectively.
[0071] Each treatment group consisted of 4 grapevines as biological replicates, with 5 bunches of fruit per vine. After treatment, the grapevines were bagged and cultured in the dark for 48 hours, followed by normal light conditions. Samples were taken on days 7, 14, and 21 post-treatment, with 10 fruits randomly selected each time. These samples were flash-frozen in liquid nitrogen and stored at -80°C for subsequent assays.
[0072] (3) CCR Gene expression level detection The qRT-PCR method described in Example 4 was used to detect the presence of [unclear - possibly related to COVID-19] in the fruits of each treatment group. CCR The relative expression level of (Vitvi14g01757) was determined by... VvEF1α It is an internal reference gene.
[0073] The results are as follows Figure 23 As shown, compared with the CK and EV groups, OE- CCR In the group CCR Expression levels were significantly upregulated, peaking on day 14, reaching 6.85 times that of the CK group; RNAi- CCR In the group CCR Expression levels were significantly downregulated, decreasing to 0.22-fold in the CK group by day 14. BR-1 treatment group CCR Expression levels were upregulated by 2.89-fold in the GR-3 treatment group and downregulated by 6.72-fold in the GR-3 treatment group, consistent with the trend of transcriptome results, confirming the effectiveness of the transient transformation system.
[0074] (4) Determination of astringency and tannin content in fruit The astringency intensity (Aftertaste-A) and tannin content in the peel of the fruits in each of the two treatment groups were determined using the electronic tongue method and reagent kit method described in Example 2.
[0075] The results are as follows Figure 24 As shown, OE- CCRThe astringency intensity of the group was significantly higher than that of the control group, with an Aftertaste-A value of 1.08 on day 14, which was 27.1% higher than that of the control group; the tannin content in the peel also increased to 1.42 times that of the control group. RNAi- CCR The astringency of the group was significantly reduced, with an Aftertaste-A value of 0.55 on day 14, a decrease of 35.3% compared to the CK group. However, the reduction in astringency was significantly lower than that of the GR-3 treatment group, indicating that strigolactone (GR24) can reduce astringency through... CCR In addition, it also achieves potent detoxification by synergistically inhibiting other targets such as DFR.
[0076] like Figure 25 As shown, in the hormone replacement test, RNAi- CCR The Aftertaste-A value of the +GR-3 group was 0.45, compared to RNAi- CCR The +CK group showed a significant decrease, but it was significantly higher than that of the GR-3-only treatment group, indicating that... CCR The silence significantly weakened the deastringency effect of GR24, confirming... CCR It is a key target for the deastringency reduction of strigolactone (GR24). OE- CCR The Aftertaste-A value of the +BR-1 group was 0.62, which was significantly lower than that of the OE- CCR The +CK group showed higher levels than the BR-1 treatment alone, indicating that brassinolide (BR) can be transmitted through... BZR1- UFGT wait CCR Partial offsetting by non-dependent pathways CCR Overexpression leads to an increase in astringency.
[0077] (5) Determination of total phenols, anthocyanins and flavonoids The total phenol, anthocyanin and flavonoid content of fruits in each treatment group was determined using the kit method described in Example 2.
[0078] The results are as follows Figure 26 As shown, OE- CCR The total phenol content in the control group was significantly higher than that in the control group, while the anthocyanin content showed no significant change, and the flavonoid content was slightly lower; RNAi- CCR The total phenol content of the group was significantly reduced, while the contents of anthocyanins and flavonoids did not change significantly.
[0079] In hormone replacement trials, RNAi- CCR +GR-3 group and RNAi- CCR Compared with the control group, there were no significant differences in the contents of total phenols, anthocyanins, and flavonoids, further confirming that strigolactone (GR24) is involved. CCR Regulates astringency-related metabolism. OE- CCR The anthocyanin content in the +BR-1 group was higher than that in the OE- CCRThe +CK group showed a significant increase, reaching 85.6% of the BR-1-only treatment group, indicating that brassinolide (BR) can... CCR Non-dependent approach ( BZR1-UFGT It effectively promotes the accumulation of anthocyanins, achieving a synergistic effect of "reducing astringency and enhancing color".
[0080] In summary, this embodiment, through overexpression and viral-induced gene silencing (VIGS) transient silencing technology, verified the results from both the "gain of function" and "loss of function" perspectives. CCR The positive regulatory role of genes on the astringency of grape berries. Overexpression CCR The gene significantly increased tannin content and astringency intensity, while silencing the gene significantly reduced astringency. Hormone replacement experiments further confirmed this. CCR It can significantly weaken the astringent effect of strigolactone (GR24), while overexpression CCR Exogenous brassinolide (BR) can still be obtained through BZR1-UFGT These non-dependent pathways partially offset the increase in astringency and promote anthocyanin accumulation. The above results indicate that... CCR It is a key common target for brassinolide and strigolactone in regulating grape astringency, with strigolactone (GR24) mainly acting by inhibiting... CCR It achieves a strong astringency reduction, while brassinolide (BR) achieves a synergistic effect of "astringency reduction and color enhancement" by reshaping metabolic flow.
[0081] While the present invention has been disclosed above, it is not limited thereto. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the invention; therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.
Claims
1. Overexpression CCR The use of genes in improving the astringency intensity, tannin content, and total phenolic content of grape berries is characterized by, The CCR The gene sequence is shown in SEQ ID NO.1.
Citation Information
Patent Citations
Gene engineering method for raising plant useful secondary substance content
CN1513986A
Increased grape yields with brassinosteroid application
US20200345008A1