Primers, probes and application of an rpa colloidal gold lateral flow immunochromatographic method for detecting tobacco bacterial wilt

Abstract

The application provides a primer, a probe and application of an RPA-gold colloidal lateral flow immunochromatography method for detecting tobacco bacterial wilt bacteria. The primer comprises a specific primer pair designed for a tobacco bacterial wilt bacteria genome ABNQ24_03690-lpxC gene interval sequence; the probe comprises a gold nanoparticle combined probe, a quality control line capture probe and a tobacco bacterial wilt bacteria capture probe. Meanwhile, application of the primer and the probe in preparation of a tobacco bacterial wilt bacteria detection product and a detection method are provided. The specific primer and the probe designed for the tobacco bacterial wilt bacteria genome ABNQ24_03690-lpxC gene interval sequence are fused with the rapid isothermal amplification technology of RPA and the visual detection advantage of the gold colloidal lateral flow immunochromatography, rapid, high-sensitivity and high-specificity detection of the tobacco bacterial wilt bacteria is realized, complex instruments and professional operations are not needed, and the method is suitable for early, convenient and rapid diagnosis in multiple scenes.

Description

Technical Field

[0001] This invention relates to the field of molecular detection technology for agricultural diseases, and in particular to primers, probes and their applications for RPA-colloidal gold lateral flow immunochromatography detection of tobacco wilt pathogen. Background Technology

[0002] Tobacco bacterial wilt is a devastating soil-borne bacterial disease caused by the Ralstonia solanacearum complex species. Widely distributed in tropical, subtropical, and temperate humid tobacco-growing regions worldwide, it is one of the core biological stressors hindering the high-quality development of the tobacco industry. This pathogen has an extremely wide host range, infecting over 200 species of plants from more than 50 families, including Solanaceae and Leguminosae. It spreads through soil, irrigation water, agricultural operations, and seedlings, entering through wounds in the plant's root system and blocking the vascular bundles. This leads to typical symptoms in tobacco plants such as leaf wilting, browning of the vascular bundles at the base of the stem, and death of the entire plant. Yield losses in affected fields can reach 30% to 80%, and in severe cases, complete crop failure.

[0003] The occurrence of tobacco bacterial wilt is closely related to soil microecology, climate conditions, and cultivation management. High temperature and humidity significantly accelerate the reproduction and spread of pathogens. Currently, the control of this disease mainly relies on a comprehensive strategy combining agricultural, biological, and chemical control. However, due to the characteristics of delayed disease detection, rapid disease development, and rapid spread, the control effect is often unsatisfactory. Therefore, timely and accurate early diagnosis is crucial for controlling the spread and outbreak of tobacco bacterial wilt and reducing disease losses. However, current high-precision and rapid diagnostic methods in production have significant limitations and cannot meet practical needs.

[0004] Current mainstream diagnostic methods mainly include empirical judgment, bacterial culture, and molecular identification analysis methods such as PCR. Empirical judgment is limited by the experience of agricultural technicians; it cannot determine the early stages, but while it is accurate in later stages, it can lead to missed opportunities for control measures and is therefore of little value. Bacterial culture is the traditional "gold standard," but the isolation and culture of the bacteria is difficult and the culture cycle is long, making rapid diagnosis impossible and potentially delaying control measures. Molecular detection methods such as PCR use specific primers to assist in diagnosis; although highly accurate, this method suffers from drawbacks such as high equipment requirements, high cost, and delayed timeliness.

[0005] Therefore, there is an urgent need in tobacco production for a rapid detection technology for tobacco wilt pathogens that is easy to operate, fast to detect, highly sensitive, specific, and cost-effective, so as to achieve early and accurate diagnosis of tobacco wilt, provide strong support for timely treatment and prevention of transmission, make up for the shortcomings of existing detection methods, and meet the detection needs of different agricultural production scenarios. Summary of the Invention

[0006] The technical problem to be solved by this invention is to provide primers, probes and applications for RPA-colloidal gold lateral flow immunochromatography to detect Ralstonia pseudosolanacearum EN1 (CP158968.1, Location: 755865-757524). It utilizes specific primers and probes designed for the ABNQ24_03690-lpxC gene region sequence of Ralstonia pseudosolanacearum EN1 (CP158968.1, Location: 755865-757524), combining the rapid isothermal amplification technology of RPA (recombinase polymerase amplification) with the visual detection advantages of lateral flow immunochromatography. This achieves rapid, highly sensitive, and highly specific detection of Ralstonia pseudosolanacearum EN1, without the need for complex instruments or professional operation, and is suitable for convenient early diagnosis in multiple scenarios.

[0007] The present invention solves the aforementioned technical problem by adopting the following technical solution:

[0008] This invention provides primers for RPA-colloidal gold lateral flow immunochromatographic detection of Ralstonia solanacearum, which are:

[0009] NAT-FF: TCTTTCTTTCTTTCTTTCGGTTAAGCTAACAAAAATAGATACGTGACG;

[0010] NAT-RR: GAGTACGAGAATTAGCCCGGGGCCCCGTCAAGCGGCAGTCGTTACG.

[0011] As one of the preferred embodiments of the present invention, the primers are specifically designed for the conserved region of Ralstonia pseudosolanacearum, the pathogen of tobacco wilt, the sequence of which is referenced (CP158968.1, Location: 755865-757524).

[0012] Verification showed that this region is highly stable in *Ralstonia solanacearum*, and its sequence differs significantly from that of *Burkholderia gravidarum*, *Klebsiella pneumoniae*, and other tobacco pathogens, ensuring the specificity of primer binding.

[0013] As one of the preferred embodiments of the present invention, in the specific primer pair, the 5' end of the forward primer NAT-FF contains the NAT sequence "TCTTTCTTTCTTTCTTTC", and the 5' end of the reverse primer NAT-RR contains the NAT sequence "GAGTACGAGAATTAGC"; a C12 spacer region, i.e., iSpC12, is designed between the NAT sequence and its corresponding base primer sequence to prevent the primers from forming dimers.

[0014] This invention also provides a probe for RPA-lateral flow immunochromatographic detection of Ralstonia solanacearum, including a gold nanoparticle binding probe, a control line capture probe, and a Ralstonia solanacearum capture probe as follows:

[0015] Gold nanoparticles bound to probe GP: GAAAGAAAGAAAGAAAGAAAAAAAAA-SH;

[0016] Quality control line capture probe QP: CTTTCTTTCTTTCTTTC-Biotin;

[0017] Biological wilt pathogen capture probe SP: ACTATTGGGCTTCGTATTTT-Biotin.

[0018] As one of the preferred embodiments of the present invention, the gold nanoparticle binding probe is modified with thiol groups, and after coupling with gold nanoparticles, it has color development ability, specifically binds to the amplification product, and flows with the chromatography solvent; the quality control line capture probe is used to capture gold nanoparticle binding probes that have not bound to the amplification product; the tobacco wilt pathogen capture probe is a detection line specific probe, which complementarily binds to the amplification product and makes the detection line color develop.

[0019] This invention provides the application of the above-mentioned primers and probes in the preparation of detection products for tobacco wilt pathogens.

[0020] The present invention further provides an RPA-colloidal gold lateral flow immunochromatographic assay kit for detecting Ralstonia solanacearum, comprising the aforementioned primers and probes. Specifically, the kit is in the form of a test strip.

[0021] More specifically, colloidal gold lateral flow test strips typically consist of a sample pad, a conjugate pad (containing colloidal gold-labeled antibodies), a nitrocellulose membrane (NC membrane, containing T and C lines), and an absorbent pad. When the sample is added to the sample well / test strip and becomes saturated with sample solution, it flows forward along the test strip under capillary action. The conjugate pad releases the gold-labeled antibody: as the sample flows through the conjugate pad, the colloidal gold-labeled antibody (protein antibody) dissolves within it. If the sample contains the target antigen, an "antigen-colloidal gold antibody" complex is formed. The T line captures the complex (detection line): the complex migrates with the liquid to the T line (Test Line), where another specific antibody is immobilized. This antibody can simultaneously recognize different epitopes of the same antigen, thereby capturing the complex and accumulating a large number of colloidal gold particles, forming a visible red band. C-line colorimetric verification system effectiveness (control line): Regardless of whether the sample contains antigen, excess colloidal gold-labeled antibody or free label will continue to migrate to the C-line (control line), be captured by the secondary antibody (such as goat anti-mouse IgG) fixed there, and form a red band, indicating that the test strip is working properly.

[0022] This invention also provides a method for detecting Ralstonia solanacearum bacterial wilt pathogens using RPA-colloidal gold lateral flow immunochromatography, employing the above-mentioned kit, and the method is as follows:

[0023] (1) Nucleic acid DNA extraction from samples. Nucleic acid extraction is performed on soil, water, and plant tissue samples to be tested. If conditions are limited, it can be simplified as follows: take about 0.2-0.5g of the fresh soil / plant / water sample to be tested with sterile scissors or a small spoon, add it to a 1.5ml pointed-bottom tube sampling tube with a small amount of quartz sand, add 200-500ul of sterile water, and then manually grind it for 1-2 minutes with a crushing rod (water samples do not require water replenishment or grinding). After mixing, let it stand for 3-5 minutes, and take the supernatant solution for RPA amplification to detect the sample. However, this method has a significant impact on the detection accuracy. Soil / plant sample pretreatment grinding kit (Changsha Linyun Biotechnology Co., Ltd.).

[0024] (2) Using a small amount of fresh test samples as templates, RPA amplification system is formed using the primers and RPA amplification reagents to perform RPA amplification;

[0025] (3) A colloidal gold side-flow immunochromatographic strip with the probe immobilized;

[0026] (4) The amplification product is combined with the loading buffer, and the detection result of the colloidal gold lateral flow immunochromatographic strip of the amplification product is used to determine whether it is positive for tobacco wilt disease.

[0027] The RPA amplification system for detecting *Ralstonia solanacearum* consists of the following components: 1.0 μL each of primers (100 μM / L), 30 μL of buffer A, 2 μL of buffer B, 3 μL of sample, and 10 μL of sterile water. After thorough mixing, add 2.5 μL of 280 nm magnesium acetate (MgAc) and mix well. Amplify at a constant temperature of 37-40℃ for 20-25 minutes, inverting and mixing 3-5 times during the process.

[0028] The RPA amplification products were visualized using colloidal gold lateral flow chromatography strips. 2 μL of RPA amplification product was mixed thoroughly with 48 μL of PBST buffer (containing 0.1% Tween 20 in -FPBS-F buffer) for 2-3 min. Then, 2-3 drops (10-20 μL) of the mixture were applied to the sample area of ​​the colloidal gold lateral flow chromatography strip. The mixture was allowed to react at room temperature for 5-10 min before observing the results.

[0029] The advantages of this invention compared to the prior art are:

[0030] (1) Precise targeting, with both high specificity and efficiency.

[0031] The primers and probes of this invention are designed to target the specific gene sequence of tobacco bacterial wilt (SEQ ID NO. 1), which is clearly different from Burkholderia and Klebsiella pneumoniae. Furthermore, the primers feature an innovative and unique design: the forward primer contains the NAT sequence "AACAAACAAACAAACA" at its 5' end, and the reverse primer contains the NAT sequence "GTGATCGAGAATTAGC" at its 5' end. An iSpC12 spacer is also provided between the NAT sequence and the base primer, effectively preventing primer dimerization, improving primer detection efficiency, and ensuring detection accuracy. In addition, RPA amplification detection of other tobacco pathogens, such as soft rot (Erwini sp.), black shank (Phytophthora parasitica), and fungal wilt (Fusarium oxysporum, Fusarium solanum, Fusarium commune, etc.), showed good specificity and no false positives.

[0032] (2) High sensitivity, meeting the needs of preliminary diagnosis

[0033] This invention can accurately detect all 8 bacterial wilt pathogen samples from 20 strains, with detection limits of 1 pg / μl of bacterial wilt genome in pathogen genomic DNA, plant tissue, and soil samples (similar sensitivity to conventional PCR). 3 CFU / g fresh sample, 10 4 CFU / g fresh sample. This buys crucial time for early disease intervention and prevention, reducing the risk of disease outbreaks.

[0034] (3) Rapid detection, no equipment required

[0035] This invention combines the advantages of RPA isothermal amplification technology and lateral flow immunochromatography. RPA amplification can be completed in 20-30 minutes under constant temperature conditions of 37-40℃, and subsequent chromatographic colorimetric detection only takes 5 minutes. The entire detection process takes about 30 minutes, which is much faster than bacterial isolation and culture and PCR molecular detection. No equipment is required, and detection can be carried out in a simple constant temperature environment, making it suitable for rapid on-site screening scenarios.

[0036] (4) Easy to operate and simple to apply

[0037] The detection process of this invention is simplified to three steps: "sample preparation → RPA amplification → chromatographic development". No professional molecular biology operation skills are required, and simple training is all that is needed to get started, which greatly reduces labor costs and operational difficulty. The results can be directly judged by the color development of the detection line and control line of the lateral flow immunochromatographic strip. Positive, negative and invalid results are clear at a glance. No instrument analysis is required. The results are intuitive and have high diagnostic efficiency and convenience. Attached Figure Description

[0038] Figure 1 Results of RPA detection system (A) and conventional PCR (B) for *Ralstonia solanacearum*. CK+: *Ralstonia solanacearum* genomic DNA; CK-: negative control (sterile water).

[0039] Figure 2 Specific detection results of RPA (A) and conventional PCR (B) for Ralstonia solanacearum in the samples. 1-8: Ralstonia solanacearum; 9-20: other bacteria; M: DL2000 DNA Maker.

[0040] Figure 3 Sensitivity results for RPA and conventional PCR in samples of *Ralstonia solanacearum*. A and B represent the sensitivity test for *Ralstonia solanacearum* DNA, with values ​​of 100 ng / μl, 10 ng / μl, 1 ng / μl, 100 pg / μl, 10 pg / μl, 1 pg / μl, 100 fg / μl, 10 fg / μl, 1 fg / μl, and 0 fg / μl for samples 1-10, respectively. C and D represent the sensitivity test for infected plants. E and F represent the sensitivity test for infected soil, with values ​​of 10 ng / μl for samples 1-10. 9 cfu / g, 10 8 cfu / g, 10 7 cfu / g, 10 6 cfu / g, 10 5 cfu / g, 10 4 cfu / g, 10 3 cfu / g, 10 2 cfu / g, 10 1 cfu / g, 0 cfu / g; M is DL2000 DNA maker.

[0041] Figure 4 Practical detection results of RPA and conventional PCR for Ralstonia solanacearum in the samples. Among them, A and B are plant samples, C and D are soil samples, and samples 1-10 are 8 suspected positive samples (1-8) and 2 negative samples (9, 10), respectively; M: DL2000 DNA maker. Detailed Implementation

[0042] Example 1

[0043] 1. Materials

[0044] (1) Inoculation and detection of bacterial wilt:

[0045] After activating the pathogens by culturing them on NB solid medium for 2 days, bacterial pus was scraped from a sterile aqueous suspension to prepare an aqueous suspension of the strain. The concentration of the strains was then determined by the dilution plate count method. The aqueous suspension samples were used within 3 days.

[0046] Take 1g of stem tissue from healthy tobacco seedlings (10-15 leaf seedlings of Yunyan 87) after surface disinfection, grind it, and add it to a freshly prepared suspension of *Ralstonia solanacearum*, so that the final concentration of *Ralstonia solanacearum* is 1×10⁻⁶. 10 CFU / g, 1×10 9 CFU / g, 1×10 8 CFU / g, 1×10 7 CFU / g, 1×10 6 CFU / g, 1×10 5 CFU / g, 1×10 4 CFU / g, 1×10 3 CFU / g, 1×10 2 CFU / g, 1×10 1 CFU / g and 0 CFU / g were used as plant materials to simulate infection with different concentrations of pathogens under natural conditions.

[0047] Take 1g of sterilized soil and mix it with bacterial suspensions of different concentrations of *Ralstonia solanacearum* to achieve a final concentration of 1×10⁻⁶. 10 CFU / g, 1×10 9 CFU / g, 1×10 8 CFU / g, 1×10 7 CFU / g, 1×10 6 CFU / g, 1×10 5 CFU / g, 1×10 4 CFU / g, 1×10 3 CFU / g, 1×10 2 CFU / g, 1×10 1 CFU / g and 0 CFU / g were used as soil materials to simulate different concentrations of pathogens under natural conditions.

[0048] (2) Test strains

[0049] A total of 20 strains were used in this study, including 8 strains of Rhesus solanacearum (evolutionary type I) and 12 non-target strains (Table 1). All strains were isolated from major tobacco-growing areas in Hunan Province and were preserved by the Applied Fungi Laboratory of the Hunan Institute of Microbiology.

[0050] The isolated and purified bacterial strains were cultured on NA medium at 30°C for 24-36 hours in an artificial climate incubator. An equal volume of 60% glycerol was added to the bacterial culture medium, and after mixing, it was stored at -80°C. The fungal strains used in this study were cultured on PDA medium at 28°C for 5-7 days.

[0051] Table 1. Strains used in this experiment

[0052]

[0053] (3) Test culture medium

[0054] PDA medium: 200g potato, 20g glucose, 15g agar powder, distilled water to a final volume of 1000ml.

[0055] PCA medium: 20g potato, 20g carrot, 15g agar powder, distilled water to a final volume of 1000ml.

[0056] Water agar medium: 15g agar powder, distilled water to a final volume of 1000ml.

[0057] NA medium: 10.0g peptone, 3.0g beef extract, 5.0g sodium chloride, 15.0g agar, and distilled water to a final volume of 1000ml.

[0058] NB medium: 10g peptone, 3g beef extract powder / paste, 5g sodium chloride, distilled water to a final volume of 1000ml.

[0059] 2. Reagents and Instruments

[0060] The main reagents and instruments are shown in Table 2.

[0061] Table 2 Instruments and Reagents

[0062]

[0063] The RPA research detection kit (48T) and the modification of primers and probes were provided by Wuhan Dangkang Xingzhong Biotechnology Co., Ltd., which also provided product and technical support. The genomic DNA extraction kits for plants, water bodies, soil, and strains were provided by Shanghai Sangon Biotech.

[0064] 3 Experimental Methods

[0065] (1) Genomic DNA extraction

[0066] Genomic DNA extraction of the strain: Select single colonies of the strain and expand them in 10 ml NA solution. After 24 h, collect the bacterial culture in the exponential growth phase and extract its DNA using a bacterial DNA extraction kit according to the manufacturer's instructions.

[0067] Add 50 μl of reaction solution (50 mM Tris, 150 mM NaCl, 2% PVP, 1% Tween-20) to a sample of tobacco plants simulating natural disease, grind for 50 s using a grinder, and then place the filter paper absorb the grinding product into 200 μl of washing solution (10 mM Tris, 0.1% Tween-20) for 1 min. The product absorbed by the filter paper is the DNA template.

[0068] Soil genomic DNA extraction: Genomic DNA of *Ralstonia solanacearum* was extracted from diseased soil and simulated infected soil using a kit. The experimental procedure was performed according to the kit's instructions.

[0069] All DNA samples were stored at -20°C for use in RPA and routine PCR testing.

[0070] (2) RPA primer and probe design

[0071] Experimental methods: This invention is aimed at tobacco-growing areas in Hunan Province. Therefore, during development, whole-genome sequencing data of Ralstonia pseudosolanacearum strains were screened in the NCBI database. Two strains with the closest geographical location and the most extensive research were analyzed and selected, namely the CQPS strain isolated in Chongqing and the EN1 strain isolated in Enshi, Hubei Province. In addition, Klebsiella pneumoniae and Burkholderia (with complete genomes) that coexisted with the bacterial wilt samples were selected for study. Ultimately, the genome sequences of Ralstonia pseudosolanacearum strains CQPS-1 and EN1 (CP016914.1 and CP158968.10) were compared with those of Klebsiella pneumoniae strain KP144 (CP138841.1) and Burkholderia cenocepacia (CP091012.1) CMCC(B)2300. This revealed some gene fragments specific to Ralstonia pseudosolanacearum and Klebsiella pneumoniae and Burkholderia. These gene fragments were then filtered out using NCBI's BLASTn analysis to eliminate those with low specificity. The final candidate sequences were then aligned to DNA sequences on NCBI to identify gene fragments suitable for designing specific amplification primers, and RPA-specific detection primers were designed.

[0072] After comparative analysis, the specific gene fragment was finally obtained—the ABNQ24_03690-lpxC gene region sequence of the Tobacco Bacterium wilt genome (CP158968.1, position 755865-757524), and its partial nucleotide sequence is shown in SEQ ID NO. 1.

[0073] SEQ ID NO.1(5’- 3’):GAACTAGTGCGCCTACTTCGCGAACCGGCGCGGGACGAGGAGCTACGGCCGGCTGACGTCGTCTTTGTGCTTGCTCCGGCGCGACGGCAGGTACTACCCCTAAAGGAGTCGCAGCTGTAGCTGTATGTCCAACAGCTACGGCTCGGGGCGCGTCCGCCTGTAGTCCACGAGCTGGCACCTGTGGGCCCGCGGTAGAAAGACGTCGTGCCTCCGGTCCGCCCACAGCGGCTATCGCGACCGCCACCGCCCTTAGAGCTGCCGGCCTAGGTCCAGGTGCGCGCACTTCTACTACGGCAACGGCCCCCGGCGGCCTGCGTTGCAGTTGCAGTGGAACGCCGGGCTCACGTTGGGCTACGGCTGCCAGAACTGGTGCCTGAACTACCACGCAACAAAGTTGTACCGGCGGGAGTTGAGTGAAAGGTTAAGCTAACAAAAATAGATACGTGAGATGTATCCACTATTGGGCTTCGTATGGTAAAAGTGCACGGACGGAGGTTTTGCTGAAAACATAGCCCTACAATCCGGGACGGTATCAGACGAGTGCTAAAGTCGTGCGTCGGTGGTACGGCAACGCAGTAGCCGGCGTGCCGCCACGCCCTACGGCCTGTCCTGAGCCGGCAAGCCTCCCCACGCCCGCCGCAGTCTCTGCGCGGTCGTAGCTAAGGCGTAACGACTGCCGCTTGACGGGGCCCCGGAGGTGGACATCGTGCCAATGGTGTGGCAAAAACTGCTAGTACCGCATCGCGACGCTTGCGTGCGGGTACGGCGCGAACCTGTCCAGAACGAGCTCTGGCTCGGACGCGCACTTAAGCCGCGACGGCAGGCGGTCGTACGCTTGGGACGGCAGTCACGGGACGCGCGCGCGGGTCCGAGGGTAGTGCT。

[0074] Gene fragments suitable for designing specific detection primers for *Ralstonia pseudosolanacearum* strain, the causal agent of bacterial wilt of tobacco, were identified from the sequence shown in SEQ ID NO.1. Specific primers NAT-FF and NAT-RR for RPA detection were designed. Furthermore, gold nanoparticle binding probe GP, control line capture probe QP, and *Ralstonia pseudosolanacearum* capture probe SP were designed by combining the probe with the target sequence region. Their sequences are shown in Table 3 below. The synthesis and modification of the primers and probes were supported by Wuhan Dangkang Xingzhong Biotechnology Co., Ltd.

[0075] Table 3 RPA primers and probes

[0076]

[0077] In the experiment, the primers used for 16S rDNA sequencing identification and evolutionary identification of the bacterial wilt pathogen were all universal primers, and their sequences are as follows (Table 4):

[0078] Table 4 Primers for strain identification

[0079]

[0080] (3) RPA reaction process

[0081] The RPA amplification system (RPA rapid amplification kit, Wuhan Dangkang Xingzhong Technology Co., Ltd.) for detecting tobacco wilt pathogens consists of the following components: 1.0 μL each of primers (100 μM / L), 30 μL of buffer A, 2 μL of buffer B, 3 μL of sample, and 10 μL of sterile water. After thorough mixing, add 2.5 μL of 280 nm magnesium acetate (MgAc) and mix well. Amplify at a constant temperature of 37-40℃ for 20-25 minutes, inverting and mixing 3-5 times during the process.

[0082] Prepare colloidal gold lateral flow chromatography strips using standard methods for visual detection of RPA amplification products. Mix 2 μL of RPA amplification product with 48 μL of PBST buffer (containing 0.1% Tween 20-FPBS-F buffer) thoroughly for 2-3 min. Then, add 2-3 drops (10-20 μL) of the mixture to the sample area of ​​the colloidal gold lateral flow chromatography strip and allow it to react at room temperature for 5-10 min before observing the results.

[0083] (4) Determination of the sensitivity and specificity of RPA

[0084] To test the specificity of the RPA system primers, we selected 8 strains of Rhesus solanaceus (evolutionary type I) from different origins and 12 non-target strains for testing.

[0085] The sensitivity of RPA detection was evaluated using serial dilutions of *Ralstonia solanacearum* genomic DNA. *Ralstonia solanacearum* genomic DNA was serially diluted 10-fold to 100 ng / μl, 10 ng / μl, 1 ng / μl, 100 pg / μl, 10 pg / μl, 1 pg / μl, 100 fg / μl, 10 fg / μl, 1 fg / μl, and 0 fg / μl. Each concentration of genomic DNA was used as a template for both the RPA system and conventional PCR.

[0086] (5) Practicality test

[0087] To verify the practicality of the RPA detection system for *Ralstonia solanacearum*, eight samples of infected plant tissue and diseased soil from *Ralstonia solanacearum*-infected fields in Hunan tobacco-growing areas, and two samples of healthy tobacco plants and rhizosphere soil (Table 5) were analyzed using both the RPA detection system and conventional PCR. The surface of infected tobacco stems was rinsed with water and disinfected with 70% alcohol. One g of plant tissue was crushed and its DNA was extracted using the plant genomic DNA extraction method, serving as the template for both the RPA detection technology and conventional PCR. DNA from the diseased soil was extracted using a kit for both the RPA detection system and conventional PCR.

[0088] 3. Experimental Results

[0089] 3.1 Establishment of RPA-colloidal gold method detection system for Ralstonia solanacearum causal agent

[0090] Using *Ralstonia solanacearum* genomic DNA and ddH2O as templates, respectively, RPA amplification and visualization were performed using the aforementioned primers and probes, following the same procedure. The results showed that the RPA amplification product using *Ralstonia solanacearum* genomic DNA as a template exhibited both a detection band and a control band on the lateral flow chromatography strip; while the negative control using ddH2O as a template only showed a control band. Figure 1 The result is as follows: Figure 1 The ZhongA test strip shows a positive result (CK+) with two red lines (test band and control band), a negative result (CK-) with only one line (control band), and an invalid test strip with no red lines. Figure 1 Image B shows the electrophoresis results of conventional PCR detection.

[0091] Therefore, the RPA detection system for Ralstonia solanacearum based on RPA amplification technology and lateral flow chromatography test strips can be used for the visual and rapid detection of Ralstonia solanacearum.

[0092] 3.2 Specificity of the RPA-colloidal gold method detection system for Ralstonia solanacearum causal agent

[0093] The RPA detection system for *Ralstonia solanacearum* was specifically tested using genomic DNA from 8 *Ralstonia solanacearum* strains and 12 non-target strains (Table 1). Only RPA amplification products using *Ralstonia solanacearum* endogenomic DNA as a template showed both a detection band and a control band on the lateral flow chromatography strip, while the detection results for other tested strains only showed a control band. Figure 2 (A). Furthermore, the amplification product of the endothelial DNA of *Ralstonia solanacearum* using conventional PCR with NAT-FF / NAT-RR primers was approximately 270 bp, showing significant amplification, while other tested strains showed no amplification. Figure 2 (See section B). This demonstrates that the RPA detection system based on the aforementioned RPA primers exhibits high detection specificity against *Ralstonia solanacearum*, the pathogen of *Ralstonia solanacearum*.

[0094] 3.3 Specificity of the RPA-colloidal gold method for detecting Ralstonia solanacearum causal agent

[0095] The sensitivity of the RPA (Ralstonia solanacearum) detection system was evaluated using serial dilutions of *Ralstonia solanacearum* genomic DNA. The *Ralstonia solanacearum* genomic DNA was serially diluted 10-fold, and multiple tests were performed at each DNA concentration, with water used as a negative control. The sensitivity of the RPA detection system for detecting *Ralstonia solanacearum* was analyzed using this as a template. Results are as follows: Figure 3 As shown in Figure A: Side-flow chromatography strips #1 to #6 show both control and detection lines, with the detection line gradually fading at lower concentrations. Strips #7 to #9 only show control bands, indicating that the detection limit of the RPA detection system for *Ralstonia solanacearum* genomic DNA is 1 pg / L. Furthermore, using the same concentration of DAN dilution as a template for conventional PCR analysis, the amplified products were detected by agarose gel electrophoresis. Lanes 1-6 all showed amplified bands of 250+ bp, while lanes 7-10 showed no amplified products, indicating that the detection limit of conventional PCR for *Ralstonia solanacearum* genomic DNA is also 1 pg / L. Figure 3 (See Figure B). This demonstrates that the detection limit of the RPA detection system for *Ralstonia solanacearum* is 1 pg / L, similar to that of conventional PCR, indicating high detection sensitivity.

[0096] The sensitivity of the RPA detection system for susceptible plants was evaluated by mixing plant tissue with a serially diluted suspension of *Ralstonia solanacearum*. The results are as follows: Figure 3 As shown in Figure C, control lines and detection lines appeared on lateral flow test strips #1 to #7, while control lines appeared on test strips #8 to #10, indicating that the detection can detect as low as 1*10. 3 CFU / g of infected plants. Figure 3In the D assay, the same DNA from the infected plant material was used as a template, and the assay was performed using a standard PCR method. No bands were observed in lanes 8-10, indicating the same detection limit as the RPA assay system.

[0097] The sensitivity of the RPA detection system for detecting contaminated soil was evaluated by mixing sterile soil with a serially diluted suspension of *Ralstonia solanacearum*. Results are as follows: Figure 3 As shown in Figure E, control lines and test lines appeared on lateral flow test strips #1 to #6, while control lines appeared only on lateral flow test strips #7 to #10, indicating that the test can detect a minimum of 1. 10 4 CFU / g of contaminated soil. The same contaminated soil test results were recorded using the same RPA testing system (using standard PCR). Figure 3 (F).

[0098] 3.4 Practicality Test of RPA-Colloidal Gold Method for the Detection of Tobacco Bacterium Bacterium Filtration

[0099] DNA was extracted from eight suspected tobacco plants with bacterial wilt and rhizosphere soil samples collected from Changsha and Xiangxi areas of Hunan Province, as well as from two healthy tobacco plants and rhizosphere soil samples (Table 5). The DNA was then analyzed using the RPA system and amplified by conventional PCR (40 cycles). Results showed that the RPA detection technology could extract DNA from eight tobacco plant samples (Table 5). Figure 4 A: 1#~7#) and soil samples ( Figure 4 Tobacco wilt pathogens were successfully detected in C:1#~7#, while healthy tobacco plants ( Figure 4 Middle A: 9#~10#) and healthy soil ( Figure 4 No *Ralstonia solanacearum* was detected in samples B (9#~10#). Furthermore, the results of the conventional PCR test were completely consistent with those of the RPA test system. Figure 4 (B and D) This indicates that the RPA detection system developed in this study can be used for the rapid detection of tobacco wilt pathogens in tobacco plants and soil, and has strong practicality.

[0100] Table 5. Tobacco and soil samples from the field.

[0101]

[0102] Note: "+" indicates a positive test result, and "-" indicates a negative test result.

[0103] This invention establishes a sensitive, specific, rapid, and intuitive detection system for detecting *Ralstonia solanacearum* in the field by combining recombinant enzyme polymerase amplification (RPA) technology with lateral flow test strips. This system also features rapid amplification, high specificity, high sensitivity, good practicality, and low requirements for equipment, making it of significant practical value.

[0104] This invention exhibits high specificity, high sensitivity, and wide applicability. Experiments show that it can accurately detect 8 bacterial wilt pathogen samples from 20 bacterial strain samples, with detection limits of 1 pg / μl of bacterial wilt genome in genomic DNA, plants, and soil (same sensitivity as conventional PCR). 3 CFU / g, 10 4 CFU / g.

[0105] This invention has high scalability. The RPA detection system for Tobacco Ralstonia solanacearum can complete the amplification reaction in 20 minutes at a constant temperature of 38℃, and the detection time is about 10 minutes when combined with a lateral flow test strip. The entire detection process only requires a simple heating device, and after a little training, the results can be read visually in about 30 minutes, which allows for timely on-site detection.

Claims

1. A primer for RPA-colloidal gold lateral flow immunochromatographic detection of Ralstonia solanacearum, characterized in that, Its nucleotide sequence is as follows: Forward primer NAT-FF: TCTTTCTTTCTTTCTTTCGGTTAAGCTAACAAAAATAGATACGTGACG, Reverse primer NAT-RR: GAGTACGAGAATTAGCCCGGGGCCCCGTCAAGCGGCAGTCGTTACG.

2. The primer as described in claim 1, characterized in that, The forward primer NAT-FF contains the NAT sequence "TCTTTCTTTCTTTCTTTC" at its 5' end, and the reverse primer NAT-RR contains the NAT sequence "GAGTACGAGAATTAGC" at its 5' end. A C12 spacer region iSpC12 is designed between the NAT sequence and its corresponding base primer sequence to prevent the primers from forming dimers.

3. A probe for RPA-colloidal gold lateral flow immunochromatographic detection of Ralstonia solanacearum, comprising a gold nanoparticle binding probe, a control line capture probe, and a Ralstonia solanacearum capture probe: Gold nanoparticles bound to probe GP: GAAAGAAAGAAAGAAAGAAAAAAAAA Quality control line capture probe QP: CTTTCTTTCTTTCTTTC Tobacco bacterial wilt pathogen capture probe SP: ACTATTGGGCTTCGTATTTT.

4. The probe as described in claim 3, characterized in that, The gold nanoparticle binding probe is modified with thiol groups, and after coupling with gold nanoparticles, it has color development ability, specifically binds to the amplification product, and flows with the chromatography solvent; the quality control line capture probe is used to capture gold nanoparticle binding probes that have not bound to the amplification product. The tobacco wilt pathogen capture probe is a detection line-specific probe that binds complementary to the amplification product and causes the detection line to develop color. The quality control line capture probe and the tobacco wilt pathogen capture probe are modified with different colorimetric markers.

5. The use of the primers as described in claim 1 or 2, and / or the probes as described in claim 3 or 4, in the preparation of products for detecting *Ralstonia solanacearum*.

6. An RPA-colloidal gold lateral flow immunochromatographic assay kit for detecting Ralstonia solanacearum, characterized in that, It includes the primers as described in claim 1 or 2, and the probes as described in claim 3 or 4; Specifically, the kit is in the form of a test strip.

7. A method for detecting RPA-colloidal gold lateral flow immunochromatography of tobacco wilt pathogens, comprising using the kit as described in claim 6, wherein the sample's nucleic acid DNA template is used to form an RPA amplification system through the primers and RPA amplification reagents for RPA amplification; the amplification product is bound to a loading buffer and detected by passing it through a colloidal gold lateral flow immunochromatographic strip immobilized with the probe to obtain the detection result.

8. The method as described in claim 7, characterized in that, Includes the following steps: (1) Extract nucleic acid DNA from the sample; (2) Using fresh test samples as templates, RPA amplification system is formed using the primers and RPA amplification reagents to perform RPA amplification; (3) A colloidal gold side-flow immunochromatographic strip with the probe immobilized; (4) The RPA amplification product is combined with the loading buffer and detected by the RPA amplification product loading colloidal gold lateral flow immunochromatographic strip to determine whether it is positive for tobacco wilt pathogen.

9. The method as described in claim 8, characterized in that, The samples were selected from soil, water, and plant tissues; The nucleic acid DNA extraction method uses an extraction kit, or specifically: take about 0.2-0.5g of the fresh soil / plant / water sample to be tested with sterile scissors or a small spoon, add it to a 1.5ml pointed-bottom tube sampling tube with a small amount of quartz sand, add 200-500ul of sterile water, then manually grind it with a crusher for 1-2 minutes, mix well, let it stand for 3-5 minutes, and take the supernatant solution for RPA amplification to detect the sample.

10. The method as described in claim 8, characterized in that, In step (2), the RPA amplification system consists of: 1.0 μL of each 100 μM / L primer, 30 μL of buffer A, 2 μL of buffer B, 3 μL of sample, and 10 μL of sterile water. After thorough mixing, add 2.5 μL of 280 nm magnesium acetate and mix well. Amplify at a constant temperature of 37-40℃ for 20-25 minutes, inverting and mixing 3-5 times during the process. In step (3), the colloidal gold lateral flow test strip is used to perform a visual detection operation on the RPA amplification product: take 2 μL of RPA amplification product and mix thoroughly with 48 μL of -FPBS-F buffer containing 0.1% Tween 20 for 2-3 min; drop 10-20 μL (2-3 drops) of the mixture onto the sample area of ​​the colloidal gold lateral flow chromatography test strip, react at room temperature for 5-10 min and then observe the results.

Images