A pathological diagnosis biomarker combination of adrenal origin cushing's syndrome and application thereof

Abstract

The application belongs to the technical field of diagnostic markers, and particularly relates to a pathological diagnosis biomarker combination for adrenal Cushing syndrome and application. The pathological diagnosis biomarker combination comprises low density lipoprotein receptor (LDLR), 3-hydroxy-3-methylglutaryl coenzyme A synthetase 1 (HMGCS1) and cytochrome P450 11B1 (CYP11B1). The area under the ROC curve (AUC) of the pathological diagnosis biomarker combination can reach 0.881 (95% confidence interval (CI): 0.775-987; sensitivity: 85.7%; specificity: 85.0%), which indicates that the combination of LDLR, HMGCS1 and CYP11B1 as the pathological diagnosis biomarker combination for adrenal Cushing syndrome has high accuracy.

Description

Technical Field

[0001] This invention belongs to the field of diagnostic biomarker technology, specifically relating to a combination of pathological diagnostic biomarkers for adrenal-derived Cushing's syndrome and their application. Background Technology

[0002] With the popularization and clinical application of modern advanced imaging diagnostic technology, the detection rate of adrenal incidental tumors has been increasing year by year, and their incidence shows a significant upward trend with the increase of patient age, making them a common type of adrenal disease in clinical practice. Among various types of adrenal incidental tumors, cortisol-producing adenomas (CPA) account for as high as 20%-50%, and are the core lesion type causing adrenal-derived Cushing's syndrome. CPA is characterized by persistent excessive secretion of glucocorticoids such as cortisol. Based on the degree of hypercortisol secretion, it can be divided into two subtypes: overt Cushing's syndrome (CS) and subclinical Cushing's syndrome (SCS). Patients in a state of long-term hypercortisol secretion will induce blood hypercoagulability, increase the risk of infection, and significantly increase the incidence and mortality of cardiovascular and cerebrovascular events such as myocardial infarction, arrhythmia, and stroke, as well as chronic kidney disease, seriously threatening the patient's life and health. Currently, the clinical diagnosis of CPA can be carried out with reference to the relevant diagnostic guidelines of the Endocrine Society. However, histopathological diagnosis can only indirectly detect adrenocortical tumors. There is no specific and accurate detection method to identify the lesion site of excessive cortisol secretion. Compared with CYP11B2-labeled aldosterone-producing tumors and CgA-labeled pheochromocytomas, cortisol tumors have always lacked specific and reliable pathological diagnostic biomarkers, which has become a key shortcoming in clinical pathological diagnosis.

[0003] Biomarkers, as biochemical indicators capable of marking changes or potential changes in the structure and function of systems, organs, tissues, and even cells and subcellular structures, possess irreplaceable application value in disease diagnosis, disease staging assessment, and evaluation of the safety and efficacy of new drugs and therapies. For adrenal-derived Cushing's syndrome, specific pathological diagnostic biomarkers can not only achieve precise pathological subtyping of cortisol tumors but also directly locate lesions with high cortisol secretion, overcoming the limitations of current pathological diagnoses that can only indirectly identify tumors and cannot determine functional attributes. This provides core evidence for clinical treatment planning and prognostic assessment. Therefore, developing pathological diagnostic biomarkers for adrenal-derived Cushing's syndrome that combine high sensitivity and high specificity, and overcoming the industry challenge of lacking specific indicators in the pathological diagnosis of cortisol tumors, is an urgent need to improve the diagnosis and treatment of this disease and a key research direction in the field of adrenal disease pathological diagnosis.

[0004] At present, some research has been conducted on the pathological characteristics of CPA, but all of them have obvious limitations and cannot meet the needs of accurate clinical pathological diagnosis. Previous studies have indicated that, compared to patients with bilateral adrenal hyperplasia-related primary giant nodular adrenal hyperplasia and primary pigmented nodular adrenal hyperplasia, patients with CPA have significantly elevated levels of cholesterol synthesis and transporter enzymes (HMGCR, LDLR). However, these studies did not include normal adrenal tissue as a control, making it impossible to distinguish whether abnormal cholesterol metabolism is a tumor-specific change or a common manifestation of adrenal hyperfunction, thus limiting its reference value. A mononuclear and spatial transcriptomics study published in 2024 identified a cholesterol and steroid-enriched metabolism-specific cell population (CSEM) that was significantly enriched in CPA, and confirmed that the expression of cholesterol synthesis-related enzyme 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1) was significantly upregulated. However, this study did not clarify the association between the CSEM cell population and the cortisol-secreting cell population, lacked classical lineage markers, and did not achieve paired analysis of intracellular cholesterol-related enzyme expression levels and tissue cortisol secretion, thus failing to confirm that the relevant indicators can be used as specific diagnostic criteria for cortisol hypersecretion. In summary, current technologies have not yet identified specific pathological biomarkers that can accurately reflect the excessive cortisol secretion in adrenal-derived Cushing's syndrome, making it difficult to accurately locate lesions and make a pathological diagnosis of the disease. There is an urgent need to develop efficient and specific combinations of biomarkers to fill the technological gap. Summary of the Invention

[0005] Based on this, the purpose of this invention is to provide a combination of biomarkers for the pathological diagnosis of adrenal-derived Cushing's syndrome and their application.

[0006] To achieve the above objectives, the present invention can adopt the following technical solutions: In one aspect, the present invention provides a combination of pathological diagnostic biomarkers for adrenal-derived Cushing's syndrome, which includes low-density lipoprotein receptor (LDLR), 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1), and cytochrome P450 11B1 (CYP11B1).

[0007] In another aspect, the present invention provides the application of a detection reagent of the above-mentioned combination of pathological diagnostic biomarkers in the preparation of diagnostic reagents or kits for adrenal-derived Cushing's syndrome.

[0008] Preferably, in the above applications, the detection reagents for the pathological diagnostic biomarker combination include: Detection reagents based on immunoblotting; or Detection reagents based on ligand blotting; or Detection reagents based on enzyme-linked immunosorbent assay (ELISA); or Detection reagents based on flow cytometry; or Detection reagents based on immunohistochemistry / immunofluorescence detection; or Gene sequencing-based detection reagents; or Detection reagents based on quantitative real-time qPCR.

[0009] More preferably, in the above applications, the detection reagents based on gene sequencing include detection reagents based on PCR amplification sequencing.

[0010] More preferably, in the above applications, The detection reagents based on immunoblotting include: RIPA lysis buffer, protease / phosphatase inhibitor, SDS-PAGE gel preparation reagent, protein loading buffer, electrophoresis buffer, transfer buffer, PVDF / nitrocellulose membrane, blocking solution, and one or more of primary or secondary antibodies; Detection reagents based on ligand blot assay include one or more of the following: biotin labeling, streptavidin, PVDF membrane, blocking solution, washing solution, or ECL chromogenic solution; The detection reagents based on enzyme-linked immunosorbent assay (ELISA) include one or more of the following: coating protein, sample diluent, biotin-labeled detection antibody, streptavidin, chromogenic substrate, stop solution or washing solution; Detection reagents based on flow cytometry include one or more of the following: fluorescently labeled antibodies, flow cytometry staining buffer, erythrocyte lysis buffer, or fixative. Detection reagents based on immunohistochemistry / immunofluorescence include: citrate antigen retrieval solution, hydrogen peroxide, blocking serum, primary antibody, secondary antibody, chromogenic solution, fluorescent mounting medium, DAPI nuclear staining or hematoxylin counterstaining solution, or one or more of these. PCR-based sequencing detection reagents include DNA extraction reagents and / or PCR amplification primers; Detection reagents based on quantitative real-time qPCR include one or more combinations of DNA extraction reagents, PCR amplification primers, fluorescent reagents, or fluorescent probes.

[0011] In another aspect, the present invention provides a diagnostic reagent or kit for adrenal-derived Cushing's syndrome, comprising a detection reagent of the above-mentioned combination of pathological diagnostic biomarkers.

[0012] Preferably, in the above-mentioned diagnostic reagents or kits for adrenal-derived Cushing's syndrome, the detection reagents for the pathological diagnostic biomarker combination include: Detection reagents based on immunoblotting; or Detection reagents based on ligand blotting; or Detection reagents based on enzyme-linked immunosorbent assay (ELISA); or Detection reagents based on flow cytometry; or Detection reagents based on immunohistochemistry / immunofluorescence detection; or Gene sequencing-based detection reagents; or Detection reagents based on quantitative real-time qPCR.

[0013] More preferably, among the above-mentioned diagnostic reagents or kits for adrenal-derived Cushing's syndrome, the gene sequencing-based detection reagents include PCR amplification sequencing-based detection reagents.

[0014] More preferably, in the above-mentioned diagnostic reagents or kits for adrenal-derived Cushing's syndrome, The detection reagents based on immunoblotting include: RIPA lysis buffer, protease / phosphatase inhibitor, SDS-PAGE gel preparation reagent, protein loading buffer, electrophoresis buffer, transfer buffer, PVDF / nitrocellulose membrane, blocking solution, and one or more of primary or secondary antibodies; Detection reagents based on ligand blot assay include one or more of the following: biotin labeling, streptavidin, PVDF membrane, blocking solution, washing solution, or ECL chromogenic solution; The detection reagents based on enzyme-linked immunosorbent assay (ELISA) include one or more of the following: coating protein, sample diluent, biotin-labeled detection antibody, streptavidin, chromogenic substrate, stop solution or washing solution; Detection reagents based on flow cytometry include one or more of the following: fluorescently labeled antibodies, flow cytometry staining buffer, erythrocyte lysis buffer, or fixative. Detection reagents based on immunohistochemistry / immunofluorescence include: citrate antigen retrieval solution, hydrogen peroxide, blocking serum, primary antibody, secondary antibody, chromogenic solution, fluorescent mounting medium, DAPI nuclear staining or hematoxylin counterstaining solution, or one or more of these. PCR-based sequencing detection reagents include DNA extraction reagents and / or PCR amplification primers; Detection reagents based on quantitative real-time qPCR include one or more combinations of DNA extraction reagents, PCR amplification primers, fluorescent reagents, or fluorescent probes.

[0015] The beneficial effects of this invention include at least the following: the area under the ROC curve (AUC) of the combination of pathological diagnostic biomarkers (LDLR, HMGCS1, and CYP11B1) for adrenal-derived Cushing's syndrome in this invention can reach 0.881 (95% confidence interval (CI): 0.775-987; sensitivity: 85.7%; specificity: 85.0%), indicating that using LDLR, HMGCS1, and CYP11B1 as a combination of pathological diagnostic biomarkers for adrenal-derived Cushing's syndrome is highly accurate. Attached Figure Description

[0016] Figure 1 Differential expression molecular proteomics analysis of CS, SCS, and NFA; where A: volcano plot of differential expression molecules of CS / NFA; B: pathway enrichment analysis of differential expression molecules of CS / NFA using the Kyoto Encyclopedia of Genes and Genomes; C: volcano plot of differential expression molecules of SCS / NFA; D: pathway enrichment analysis of differential expression molecules of SCS / NFA using the Kyoto Encyclopedia of Genes and Genomes. Figure 2 Heatmap analysis of relevant steps in the cortisol synthesis pathway of CS, SCS and NFA; Figure 3 These are 12 differentially expressed protein molecules identified when comparing CS / SCS with NFA. Figure 4 The abundance of 12 differentially expressed protein molecules in the three groups; Figure 5 To observe the expression and distribution of three candidate marker molecules in CS, SCS and NFA using immunohistochemical staining; Figure 6 Colocalization analysis was performed using tyramine signal amplification-based immunofluorescence (TSA) technique. Figure 7 The ROC curve for the training set samples in Example 1; Figure 8 The ROC curves for the test set samples in Example 2; Figure 9 The staining effect of markers in adrenal tumor tissues of two patients with adrenal-derived Cushing's syndrome; Figure 10 The staining effect of biomarkers in adrenal tumor tissues of two patients with subclinical Cushing's syndrome of adrenal origin; Figure 11 The staining effect of biomarkers in adrenal tumor tissues from two patients with non-functional tumors; Figure 12 The staining effect of markers in adrenal tumor tissues of two patients with aldosterone-secreting tumors. Detailed Implementation

[0017] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0018] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinct meaning in the context. As used herein, it should be understood that terms such as “comprising,” “having,” “including,” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or,” depending on the context.

[0019] In a first aspect, embodiments of the present invention provide a combination of pathological diagnostic biomarkers for adrenal-derived Cushing's syndrome, the combination of pathological diagnostic biomarkers including low-density lipoprotein receptor, 3-hydroxy-3-methylglutaryl-CoA synthase 1 and cytochrome P450 11B1.

[0020] It should be noted that this invention, through proteomic studies and differential comparisons of adrenal tissues from patients with adrenal-derived Cushing's syndrome and those with non-functional tumors or subclinical Cushing's syndrome, using data from patients with non-functional tumors as a control, discovered that the abundance of low-density lipoprotein receptor (LDLR) and 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1) can objectively reflect the degree of cortisol over-secretion in adrenal-derived Cushing's syndrome. Furthermore, combining this with cytochrome P450 11B1 (CYP11B1)—a key enzyme in cortisol secretion—for diagnosis and evaluation can more accurately reflect the degree of cortisol over-secretion in adrenal-derived Cushing's syndrome. Furthermore, based on the abundance of these three protein molecules, this invention uses tyramine signal amplified immunofluorescence (TSA) technology to perform immunofluorescence co-localization staining on pathological sections of adrenal tumor tissue. The staining positive areas show varying degrees of saturation in the lesions: Cushing's syndrome > subclinical Cushing's syndrome > aldosterone-producing tumor / non-functional tumor. That is, in adrenal-derived Cushing's syndrome, areas of excessive cortisol secretion can be clearly observed. Therefore, the above three protein molecules can serve as pathological biomarkers for diagnosing adrenal-derived Cushing's syndrome, and can also be combined with other clinical indicators for precise diagnosis.

[0021] Secondly, embodiments of the present invention provide an application of the detection reagent of the above-mentioned combination of pathological diagnostic biomarkers in the preparation of diagnostic reagents or kits for adrenal-derived Cushing's syndrome.

[0022] It should be noted that the detection reagent of this biomarker combination for pathological diagnosis can specifically identify and quantitatively detect the gene or protein expression levels of low-density lipoprotein receptor, 3-hydroxy-3-methylglutaryl-CoA synthase 1, and cytochrome P45011B1, making it a core tool for biomarker detection. Its application in the preparation of diagnostic reagents or kits for adrenal-derived Cushing's syndrome allows for precise differentiation of adrenal-derived Cushing's syndrome from other types of Cushing's syndrome by detecting abnormal expression of this biomarker combination, clarifying the pathological origin of the disease. This overcomes the limitations of traditional diagnosis relying solely on hormone level detection and imaging examinations, achieving a leap from functional diagnosis to pathological molecular diagnosis. This detection reagent is compatible with various conventional detection technology platforms and can be prepared into different forms of diagnostic reagents or kits according to clinical needs, possessing strong clinical practicality and promotional value, providing a reliable detection tool for the precise diagnosis and treatment of adrenal-derived Cushing's syndrome.

[0023] In some specific examples, the detection reagents for the combination of pathological diagnostic biomarkers in the above applications include: Detection reagents based on immunoblotting; or Detection reagents based on ligand blotting; or Detection reagents based on enzyme-linked immunosorbent assay (ELISA); or Detection reagents based on flow cytometry; or Detection reagents based on immunohistochemistry / immunofluorescence detection; or Gene sequencing-based detection reagents; or Detection reagents based on quantitative real-time qPCR.

[0024] It should be noted that the above seven types of testing reagents are respectively adapted for protein and gene level detection of biomarkers, covering different clinical testing scenarios and needs, and each has its own technical advantages: immunoblotting, ligand blotting, and enzyme-linked immunosorbent assay (ELISA) are suitable for quantitative detection of proteins in in vitro samples. Among them, ELISA is simple to operate and suitable for routine batch testing in clinical practice, while immunoblotting is suitable for validation analysis of protein expression; flow cytometry can achieve protein expression detection at the single-cell level, and is suitable for precise analysis of adrenal cell suspensions; immunohistochemistry / immunofluorescence detection can realize the localization and expression analysis of biomarkers in tissue sections, directly reflecting the molecular pathological characteristics of diseased adrenal tissue, and is a core method for pathological diagnosis; gene sequencing and quantitative real-time qPCR are suitable for gene level detection of biomarkers, reflecting changes in gene expression and gene mutation status, revealing the pathological mechanism of the disease from the molecular root. The seven types of testing reagents can be used alone or in combination to achieve multi-dimensional and multi-level detection of biomarker combinations, providing diversified technical support for the diagnosis of adrenal-derived Cushing's syndrome.

[0025] In some specific examples, the detection reagents based on gene sequencing in the above applications include detection reagents based on PCR amplification sequencing.

[0026] It should be noted that PCR amplification sequencing is a commonly used gene detection technology in clinical practice, offering advantages such as high amplification efficiency, high sequencing accuracy, and low sample volume. Detection reagents based on this technology can first achieve specific enrichment of biomarker genes through PCR amplification, followed by sequencing analysis. This improves detection sensitivity and accurately detects gene expression levels, mutation sites, and other information, making it suitable for the gene-level detection needs of adrenal-derived Cushing's syndrome biomarker combinations. Compared to whole-genome sequencing, PCR amplification sequencing is more targeted, has lower detection costs, and a shorter detection cycle, making it more suitable for routine clinical diagnostic applications. This detection reagent provides an efficient and practical technical tool for the accurate gene-level detection of biomarker combinations.

[0027] In some specific examples, in the above applications, The detection reagents based on immunoblotting include: RIPA lysis buffer, protease / phosphatase inhibitor, SDS-PAGE gel preparation reagent, protein loading buffer, electrophoresis buffer, transfer buffer, PVDF / nitrocellulose membrane, blocking solution, and one or more of primary or secondary antibodies; Detection reagents based on ligand blot assay include one or more of the following: biotin labeling, streptavidin, PVDF membrane, blocking solution, washing solution, or ECL chromogenic solution; The detection reagents based on enzyme-linked immunosorbent assay (ELISA) include one or more of the following: coating protein, sample diluent, biotin-labeled detection antibody, streptavidin, chromogenic substrate, stop solution or washing solution; Detection reagents based on flow cytometry include one or more of the following: fluorescently labeled antibodies, flow cytometry staining buffer, erythrocyte lysis buffer, or fixative. Detection reagents based on immunohistochemistry / immunofluorescence include: citrate antigen retrieval solution, hydrogen peroxide, blocking serum, primary antibody, secondary antibody, chromogenic solution, fluorescent mounting medium, DAPI nuclear staining or hematoxylin counterstaining solution, or one or more of these. PCR-based sequencing detection reagents include DNA extraction reagents and / or PCR amplification primers; Detection reagents based on quantitative real-time qPCR include one or more combinations of DNA extraction reagents, PCR amplification primers, fluorescent reagents, or fluorescent probes.

[0028] It should be noted that the components of all types of test reagents are core functional components adapted to the corresponding detection methods, and are optimized for the combination of low-density lipoprotein receptor, 3-hydroxy-3-methylglutaryl-CoA synthase 1 and cytochrome P45011B1 markers to ensure the specificity, accuracy and stability of the detection. In immunoblotting reagents, the primary antibody is a specific antibody against three biomarkers, and protease / phosphatase inhibitors prevent protein degradation, ensuring accurate test results. In ligand blotting reagents, biotin labeling enables specific labeling of target proteins, and ECL chromogenic solution enables efficient signal amplification. In enzyme-linked immunosorbent assay (ELISA) reagents, the coating protein is a biomarker-specific antigen, the chromogenic substrate reaction is sensitive, and the results are easily quantified. In flow cytometry reagents, the fluorescein-labeled antibody is a fluorescein-conjugated specific antibody, enabling quantitative fluorescence detection of target proteins. In immunohistochemistry / immunofluorescence assay reagents, citrate antigen retrieval solution enables efficient retrieval of antigens in tissues, specific primary / secondary antibodies ensure accurate recognition of target molecules, and chromogenic solution / fluorescent mounting medium enables signal visualization. In gene detection reagents, PCR amplification primers are specific primers against three biomarker genes, eliminating non-specific amplification; fluorescent reagents / probes enable real-time quantitative gene amplification; and DNA extraction reagents enable efficient extraction and purification of nucleic acids from samples. The synergistic effect of each component ensures accurate detection of the biomarker combination by different detection methods, providing reliable reagent support for the diagnosis of adrenal-derived Cushing's syndrome.

[0029] Secondly, embodiments of the present invention provide a diagnostic reagent or kit for adrenal-derived Cushing's syndrome, which includes a detection reagent of the above-mentioned combination of pathological diagnostic biomarkers.

[0030] It should be noted that this diagnostic reagent or kit uses a combination of low-density lipoprotein receptor, 3-hydroxy-3-methylglutaryl-CoA synthase 1, and cytochrome P450 11B1 biomarkers as its core functional components. It can be equipped with compatible standards, quality control materials, operating instructions, and related testing consumables according to clinical testing needs. The product design closely aligns with the actual needs of pathological diagnosis and clinical testing. This product can detect the protein or gene levels of the biomarker combination, and can detect a single biomarker or perform synergistic detection of all three. The test results can directly reflect the molecular pathological state of adrenal tissue, accurately diagnose adrenal-derived Cushing's syndrome, and differentiate the pathological subtypes of the disease, providing a molecular basis for developing individualized treatment plans. The product is suitable for hospital laboratories, pathology departments, endocrinology departments, and other departments, enabling early pathological diagnosis and differential diagnosis of adrenal-derived Cushing's syndrome, filling a gap in related clinical diagnostic products.

[0031] In some specific examples, the detection reagents for the pathological diagnostic biomarker combination in the above-mentioned diagnostic reagents or kits for adrenal-derived Cushing's syndrome include: Detection reagents based on immunoblotting; or Detection reagents based on ligand blotting; or Detection reagents based on enzyme-linked immunosorbent assay (ELISA); or Detection reagents based on flow cytometry; or Detection reagents based on immunohistochemistry / immunofluorescence detection; or Gene sequencing-based detection reagents; or Detection reagents based on quantitative real-time qPCR.

[0032] It should be noted that this diagnostic reagent or kit integrates multiple types of biomarker testing reagents, allowing for flexible selection of testing methods based on the clinical testing objectives and sample type: Pathologists can use immunohistochemistry / immunofluorescence reagents to achieve molecular pathological diagnosis of adrenal tissue sections and directly locate the expression sites of biomarkers; laboratory departments can use enzyme-linked immunosorbent assay (ELISA) and quantitative qPCR reagents to achieve rapid batch testing of in vitro samples such as peripheral blood and adrenal aspiration fluid, suitable for early disease screening and postoperative follow-up; research institutions can use immunoblotting and gene sequencing reagents to achieve in-depth validation and mechanism research of biomarkers. The integration of multiple types of testing reagents enables this product to cover the full range of needs from routine clinical diagnosis to scientific research analysis, enhancing its applicability and practicality. Furthermore, different testing methods can be cross-validated, further ensuring the accuracy and reliability of diagnostic results.

[0033] In some specific examples, the diagnostic reagents or kits for adrenal-derived Cushing's syndrome mentioned above include gene sequencing-based detection reagents, including those based on PCR amplification sequencing.

[0034] It should be noted that integrating PCR amplification and sequencing-based detection reagents into diagnostic reagents or kits enables precise detection of biomarker combinations at the gene level. This allows for the detection of changes in gene expression levels and the screening of abnormalities such as gene mutations and fusions, revealing the pathological mechanism of adrenal-derived Cushing's syndrome at its molecular root. This reagent is compatible with routine clinical PCR instruments and sequencers, requiring no large-scale specialized equipment. It is low-cost, easy to operate, and can be used in clinical laboratories after simple training, making it suitable for routine clinical application. Furthermore, the PCR amplification and sequencing detection reagent, in synergy with other types of detection reagents, can achieve dual-level gene-protein detection of biomarker combinations, significantly improving diagnostic accuracy and providing more comprehensive technical support for the precise molecular pathological diagnosis of adrenal-derived Cushing's syndrome.

[0035] In some specific examples, the above-mentioned diagnostic reagents or kits for adrenal-derived Cushing's syndrome, The detection reagents based on immunoblotting include: RIPA lysis buffer, protease / phosphatase inhibitor, SDS-PAGE gel preparation reagent, protein loading buffer, electrophoresis buffer, transfer buffer, PVDF / nitrocellulose membrane, blocking solution, and one or more of primary or secondary antibodies; Detection reagents based on ligand blot assay include one or more of the following: biotin labeling, streptavidin, PVDF membrane, blocking solution, washing solution, or ECL chromogenic solution; The detection reagents based on enzyme-linked immunosorbent assay (ELISA) include one or more of the following: coating protein, sample diluent, biotin-labeled detection antibody, streptavidin, chromogenic substrate, stop solution or washing solution; Detection reagents based on flow cytometry include one or more of the following: fluorescently labeled antibodies, flow cytometry staining buffer, erythrocyte lysis buffer, or fixative. Detection reagents based on immunohistochemistry / immunofluorescence include: citrate antigen retrieval solution, hydrogen peroxide, blocking serum, primary antibody, secondary antibody, chromogenic solution, fluorescent mounting medium, DAPI nuclear staining or hematoxylin counterstaining solution, or one or more of these. PCR-based sequencing detection reagents include DNA extraction reagents and / or PCR amplification primers; Detection reagents based on quantitative real-time qPCR include one or more combinations of DNA extraction reagents, PCR amplification primers, fluorescent reagents, or fluorescent probes.

[0036] It should be noted that all components of this diagnostic reagent or kit have undergone rigorous screening and optimization. The proportions and purity of each component meet the standards for clinical testing and pathological diagnosis. Furthermore, the specificity of the combination of low-density lipoprotein receptor, 3-hydroxy-3-methylglutaryl-CoA synthase 1, and cytochrome P450 11B1 markers has been validated, with no cross-reactivity, ensuring the specificity of the test. Simultaneously, all reagents are ready-to-use or easy-to-prepare, requiring no complex pretreatment steps, significantly reducing operational difficulty and facilitating use by clinical staff. The reagents exhibit good stability and can be stored under normal conditions, ensuring the product's shelf life and effectiveness. In addition, the kit includes dedicated standards and quality control materials, enabling quality control throughout the testing process and ensuring consistency and comparability of results from different laboratories and batches. This provides a reliable product guarantee for the standardized and precise diagnosis of adrenal-derived Cushing's syndrome.

[0037] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.

[0038] Example 1 This invention provides a screening process for a combination of pathological diagnostic biomarkers for adrenal-derived Cushing's syndrome.

[0039] (1) Proteomics analysis Data from patients with adrenogenic Cushing's syndrome, subclinical Cushing's syndrome, and non-functional tumors were obtained from the Chongqing Adrenogenic Autonomic Cortisol Secretion Cohort Study (CONACSS) cohort. This proteomics project extracted proteins from adrenal tissue samples from patients and used data-independent acquisition orbitrap astral LC-MS / MS proteomic analysis to obtain relevant protein and peptide information for patients with adrenogenic Cushing's syndrome, subclinical Cushing's syndrome, and non-functional tumors.

[0040] (2) Subjects of proteomics research This study included 9 patients with adrenal-derived Cushing's syndrome, 10 patients with subclinical Cushing's syndrome, and 10 patients with non-functional tumors, all of whom underwent laparoscopic adrenalectomy. Their ages ranged from 29 to 61 years. Detailed information for the three groups of patients is shown in Table 1.

[0041] Table 1 Basic Clinical Information of Patients

[0042] Continuous data are expressed as medians (interquartile ranges) and compared using the Mann-Whitney U test. Categorical data are expressed as quantities (percentages) and compared using the Fisher exact test.

[0043] (3) Genomic DNA extraction and sequencing analysis Genomic DNA was extracted from Cushing's syndrome (CS) adenomas using the TIANamp Genomic DNA Extraction Kit (DP304) from TIANGEN, following standard procedures. All CS samples were... PRKACASanger sequencing was performed on high-frequency mutation sites in the gene; PCR amplification was performed using specific primers with the sequences: Forward: GTTTCTGACGGCTGGACTG, Reverse: AGTCCACGGCCTTGTTGTAG, using 2x M-PCR OPTI Mix provided by Selleck Chemicals. The final reaction volume was 50 µL, containing 50 ng of DNA and 10 nM primers; sequencing was performed by Beijing Qingke Biotechnology Co., Ltd.

[0044] (4) Proteomics analysis of adrenal gland samples Proteomics analysis of adrenal gland samples was performed by Shanghai Zhongke New Life Technology Co., Ltd. using the Orbitrap Astral LC-MS / MS platform in data-independent acquisition (DIA) mode. Samples were homogenized using a FastPrep-24 homogenizer, followed by SDT buffer extraction to extract proteins. Peptides were analyzed using an Orbitrap Astral mass spectrometer. MS1 scan range was 380 m / z–980 m / z with a resolution of 240,000; MS2 used 299 variable isolation windows with a collision energy of 25 eV. Data were processed using DIA-NN software, with trypsin digestion, fixed modification to cysteine ​​carbamoyl methylation, dynamic modification to methionine oxidation and N-terminal acetylation, and a protein identification confidence level of 99% (FDR ≤ 1%). Subsequent protein identification, differential expression analysis, and functional annotation were performed.

[0045] (5) Data Analysis Using the DIA Orbitrap Astral LC-MS / MS platform, a total of 152,332 peptides and 10,442 proteins were identified in all samples, with single samples containing >90,000 peptides and >8,000 proteins. Scatter plots showed a high correlation between protein abundance and signal intensity in each group. Pearson correlation coefficients among biological replicates ranged from 0.81 to 0.99, indicating good reproducibility. A total of 8,776 proteins were detected in the CS, SCS, and NFA groups. Principal component analysis (PCA) showed significant separation of proteomics characteristics among the three groups (see [link to PCA]). Figure 1 ).

[0046] (6) Results Analysis (6.1) Proteomic characterization of CS, SCS and NFA To differentiate the proteomic characteristics of CS, SCS, and NFA, the inventors conducted differential expression and KEGG pathway analysis. CS downregulated 649 proteins and upregulated 411 proteins compared to NFA, with key cholesterol metabolism enzymes significantly increased, including DHCR24, LDLR, LIPE, HMGCS1, FDFT1, SQLE, and HMGCR.

[0047] (6.2) Comparison of steroid synthesis pathways among CS, SCS and NFA groups KEGG pathway enrichment analysis using proteomics revealed significant activation of cortisol synthesis / secretion and steroid biosynthesis (see [link to KEGG pathway analysis]). Figure 1 Heatmap analysis was performed on the relevant steps of the cortisol synthesis pathway, including cholesterol synthesis, cholesterol esterification, cholesterol transport, and adrenal steroid synthesis. The results showed that the levels of cholesterol synthesis, cholesterol esterification, and cholesterol transport in patients with CS and SCS were significantly higher than those in the NFA group. Figure 2 ).

[0048] (6.3) Screening for pathological biomarkers that can identify adrenal-derived Cushing's syndrome (CS). To investigate pathological biomarkers associated with the diagnosis of adrenal-derived Cushing's syndrome (CS), we further evaluated differentially expressed molecules at different levels identified through proteomics. By narrowing the range of differentially expressed molecules (FC>2.5, or <0.4, p<0.01) and selecting common molecules when comparing CS / SCS with NFA, we identified 12 differentially expressed protein molecules (FC>2.5, or <0.4, p<0.01). Figure 3 The two protein molecules that changed most significantly were the low-density lipoprotein receptor (LDLR) and 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1). Figure 4 Therefore, one of these molecules can be used as a molecular marker for cortisolomas. Furthermore, cytochrome P450 11B1 (CYP11B1) is a known monooxygenase located in the adrenal cortex, belonging to the cytochrome P450 enzyme family. It plays a crucial role in the final step of cortisol synthesis by catalyzing the conversion of 11-deoxycortisol to cortisol. Based on these findings, this invention proposes using any one of LDLR, HMGCS1, and CYP11B1 as a molecular marker for cortisolomas. However, to improve diagnostic accuracy and reduce the error rate, we suggest a combined biomarker strategy. By combining the differential expression of low-density lipoprotein receptor (LDLR), 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1), and cytochrome P450 11B1 (CYP11B1), i.e., using these three molecules in combination as biomarkers, the specific lesion area of ​​cortisoloma can be identified more precisely. This multiple biomarker approach can enhance the sensitivity and specificity of diagnosis, thereby improving the shortcomings of previous single biomarker methods in terms of accuracy and reliability. Its functions are shown in Table 2 below.

[0049] Table 2 Functional descriptions of the three proteins

[0050] Example 2 (1) After completing the above biomarker screening, the expression and distribution of the three protein molecules in CS, SCS and NFA were first observed by immunohistochemical staining. Figure 5 Then, co-localization analysis was performed using tyramine signal amplification-based immunofluorescence (TSA) technology, specifically, immunofluorescence analysis was performed on 6 μm paraffin-embedded tissue sections to detect the co-expression of CYP11B1 and the primary antibody. The specific steps are as follows: Sections are first dewaxed in xylene and then rehydrated via an ethanol gradient; antigen retrieval is performed at 98°C for 15 minutes, using Tris-EDTA antigen retrieval buffer (pH 9 or pH 6, for primary antibody and CYP11B1, respectively), followed by washing with PBS; autofluorescence of erythrocytes is eliminated by treatment with autofluorescence quencher A for 30 minutes, followed by washing with PBS again; endogenous peroxidase is blocked by incubation in 3% hydrogen peroxide for 30 minutes, followed by another PBS wash; peroxidase activity is blocked with blocking buffer at room temperature for 60 minutes; subsequently, sections are incubated overnight at 4°C with LDLR and HMGCS1 primary antibodies; after PBS washing, sections are incubated with polyHRP-bound secondary antibody for 60 minutes; after three PBS washes, sections are treated with Tyramide conjugate; after 8 minutes, the reaction is terminated with a reaction termination reagent and sections are washed with PBS; cell nuclei are stained with DAPI (G1407-25ML, Servicebio) for 10 minutes; finally, images are acquired using an Olympus VS200 slide scanner (Japan). The results are as follows Figure 6 As shown, the results indicate that the regions simultaneously expressing LDLR, HMGCS1, and CYP11B1 are the result regions. The co-localization positive results in CS, SCS, and NFA show a gradient change, i.e., CS > SCS > NFA.

[0051] (2) Next, recruit 60 subjects (30 CS and 30 NFA) according to the requirements of Example 1. Randomize the 60 subjects into training set and test set in a 2:1 ratio. The training set includes 20 CS and 20 NFA, and the test set includes 10 CS and 10 NFA.

[0052] (3) Based on these three biomarkers, a diagnostic model was established using binary logistic regression (the diagnostic variable (independent variable) is the relative abundance of the three biomarkers, and the dependent variable is the NFA of patients with and without CS, i.e., a binary variable indicating whether or not one has CS). Then, receiver operating characteristic (ROC) analysis was performed to quantify the diagnostic performance of the combination of the three biomarkers. Both binary logistic regression and ROC analysis were performed using the conventional statistical software SPSS 21.0 (IBM Corp., Armonk, NY, USA). The ROC curve is used to evaluate the quality of classification and detection results and is a very important and common statistical analysis method. It is a coordinate graph composed of the false positive rate (1-specificity) on the horizontal axis and the true positive rate (sensitivity) on the vertical axis, plotting the different results obtained by the test sample under different judgment criteria (thresholds). The area under the curve (AUC) is used to represent accuracy; the higher the AUC value, the higher the accuracy.

[0053] The results showed that the area under the ROC curve (AUC) in the training set was 0.921 (95% confidence interval (CI): 0.843-1; sensitivity: 90.5%; specificity: 80.0%). Figure 7 The area under the ROC curve (AUC) in the test set was 0.881 (95% confidence interval (CI): 0.775-987; sensitivity: 85.7%; specificity: 85.0%). Figure 8 ).

[0054] In addition, the co-localization of LDLR, HMGCS1, and CYP11B1 in different indications was analyzed (analysis method as in Example 1), and the results are shown below: In adrenal tumor tissues of patients with adrenal-derived Cushing's syndrome, the staining results of LDLR, HMGCS1, and CYP11B1 are as follows: Figure 9 As shown; staining results of LDLR, HMGCS1, and CYP11B1 in adrenal tumor tissue from patients with subclinical Cushing's syndrome of adrenal origin are as follows. Figure 10 As shown; the staining results of LDLR, HMGCS1, and CYP11B1 in adrenal tumor tissue from patients with non-functional tumors are as follows. Figure 11 As shown; the staining results of LDLR, HMGCS1, and CYP11B1 in adrenal tumor tissue from patients with aldosterone-secreting tumors are as follows. Figure 12 As shown in the figure. Based on the above comparisons, it can be concluded that the combined co-expression regions of LDLR, HMGCS1, and CYP11B1 in patients with adrenal-derived Cushing's syndrome are significantly higher than those in patients with non-functional tumors and aldosterone-secreting tumors.

[0055] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A combination of pathological diagnostic biomarkers for adrenal-derived Cushing's syndrome, characterized in that, The biomarker combination for pathological diagnosis includes low-density lipoprotein receptor, 3-hydroxy-3-methylglutaryl-CoA synthase 1, and cytochrome P45011B1.

2. The use of the detection reagent of the pathological diagnostic biomarker combination according to claim 1 in the preparation of diagnostic reagents or kits for adrenal-derived Cushing's syndrome.

3. The application according to claim 2, characterized in that, The detection reagents for the pathological diagnostic biomarker combination include: Detection reagents based on immunoblotting; or Detection reagents based on ligand blotting; or Detection reagents based on enzyme-linked immunosorbent assay (ELISA); or Detection reagents based on flow cytometry; or Detection reagents based on immunohistochemistry / immunofluorescence detection; or Gene sequencing-based detection reagents; or Detection reagents based on quantitative real-time qPCR.

4. The application according to claim 3, characterized in that, Gene sequencing-based detection reagents include those based on PCR amplification and sequencing.

5. The application according to claim 4, characterized in that, The detection reagents based on immunoblotting include: RIPA lysis buffer, protease / phosphatase inhibitor, SDS-PAGE gel preparation reagent, protein loading buffer, electrophoresis buffer, transfer buffer, PVDF / nitrocellulose membrane, blocking solution, and one or more of primary or secondary antibodies; Detection reagents based on ligand blot assay include one or more of the following: biotin labeling, streptavidin, PVDF membrane, blocking solution, washing solution, or ECL chromogenic solution; The detection reagents based on enzyme-linked immunosorbent assay (ELISA) include one or more of the following: coating protein, sample diluent, biotin-labeled detection antibody, streptavidin, chromogenic substrate, stop solution or washing solution; Detection reagents based on flow cytometry include one or more of the following: fluorescently labeled antibodies, flow cytometry staining buffer, erythrocyte lysis buffer, or fixative. Detection reagents based on immunohistochemistry / immunofluorescence include: citrate antigen retrieval solution, hydrogen peroxide, blocking serum, primary antibody, secondary antibody, chromogenic solution, fluorescent mounting medium, DAPI nuclear staining or hematoxylin counterstaining solution, or one or more of these. PCR-based sequencing detection reagents include DNA extraction reagents and / or PCR amplification primers; Detection reagents based on quantitative real-time qPCR include one or more combinations of DNA extraction reagents, PCR amplification primers, fluorescent reagents, or fluorescent probes.

6. A diagnostic reagent or kit for adrenal-derived Cushing's syndrome, characterized in that, The detection reagent includes the combination of pathological diagnostic biomarkers as described in claim 1.

7. The diagnostic reagent or kit for adrenal-derived Cushing's syndrome according to claim 6, characterized in that, The detection reagents for the pathological diagnostic biomarker combination include: Detection reagents based on immunoblotting; or Detection reagents based on ligand blotting; or Detection reagents based on enzyme-linked immunosorbent assay (ELISA); or Detection reagents based on flow cytometry; or Detection reagents based on immunohistochemistry / immunofluorescence detection; or Gene sequencing-based detection reagents; or Detection reagents based on quantitative real-time qPCR.

8. The diagnostic reagent or kit for adrenal-derived Cushing's syndrome according to claim 7, characterized in that, Gene sequencing-based detection reagents include those based on PCR amplification and sequencing.

9. The diagnostic reagent or kit for adrenal-derived Cushing's syndrome according to claim 8, characterized in that, The detection reagents based on immunoblotting include: RIPA lysis buffer, protease / phosphatase inhibitor, SDS-PAGE gel preparation reagent, protein loading buffer, electrophoresis buffer, transfer buffer, PVDF / nitrocellulose membrane, blocking solution, and one or more of primary or secondary antibodies; Detection reagents based on ligand blot assay include one or more of the following: biotin labeling, streptavidin, PVDF membrane, blocking solution, washing solution, or ECL chromogenic solution; The detection reagents based on enzyme-linked immunosorbent assay (ELISA) include one or more of the following: coating protein, sample diluent, biotin-labeled detection antibody, streptavidin, chromogenic substrate, stop solution or washing solution; Detection reagents based on flow cytometry include one or more of the following: fluorescently labeled antibodies, flow cytometry staining buffer, erythrocyte lysis buffer, or fixative. Detection reagents based on immunohistochemistry / immunofluorescence include: citrate antigen retrieval solution, hydrogen peroxide, blocking serum, primary antibody, secondary antibody, chromogenic solution, fluorescent mounting medium, DAPI nuclear staining or hematoxylin counterstaining solution, or one or more of these. PCR-based sequencing detection reagents include DNA extraction reagents and / or PCR amplification primers; Detection reagents based on quantitative real-time qPCR include one or more combinations of DNA extraction reagents, PCR amplification primers, fluorescent reagents, or fluorescent probes.

Images