Cassava mebcat1 gene and application thereof

Abstract

This invention belongs to the field of biotechnology, specifically relating to cassava. MeBCAT1 Genes and their applications. This invention clones cassava from cassava. MeBCAT1 The gene, when overexpressed in cassava, increases the content of branched-chain amino acids valine, isoleucine, and leucine in transgenic cassava. Furthermore, the present invention... MeBCAT1 In addition to increasing the content of branched-chain amino acids, the gene can also increase the content of amino acids such as proline, lysine, and glutamic acid in cassava. These experimental results provide a new approach to improving the feed value of cassava and offer new candidate genes for breeding superior cassava varieties using molecular techniques, which is of great significance in the breeding of new cassava varieties and the selection of superior cassava varieties.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to cassava. MeBCAT1 Genes and their applications. Background Technology

[0002] Cassava ( Manihot esculenta Cassava (Crantz), native to the southern Amazon basin, belongs to the Euphorbiaceae family and is considered one of the world's three major tuber crops, along with sweet potato and potato. Cassava is rich in various vitamins, minerals, and carbohydrates, possessing high nutritional and feed value. The tubers and leaves are the most commonly utilized parts: the tubers are rich in carbohydrates, an important energy source; the leaves contain abundant vitamin A, beta-carotene, vitamin C, iron, calcium, and other minerals, as well as plant protein and dietary fiber, making it a good plant protein feed. Therefore, increasing the protein content and starch yield of cassava is a breeding objective.

[0003] In recent years, the shortage and rising prices of grain feed have created an urgent need for livestock and poultry feed production to develop more economical alternative feed ingredients. Cassava, with its drought and poor soil tolerance and lower price than grain crops such as rice and corn, is commonly used in livestock and poultry feed, particularly its leaves and roots. Compared to corn, cassava roots, stems, and leaves have lower levels of crude protein and various amino acids, but relatively higher levels of crude fat, calcium, and potassium. Therefore, exogenous amino acids need to be supplemented when formulating livestock and poultry feed to meet their growth and development needs. The protein required for livestock and poultry growth mainly depends on the crude protein and amino acids supplied by their feed. The shortage of high-protein and high-amino acid feeds has become a significant bottleneck restricting the high-quality development of animal husbandry. In response to the current scarcity of high-amino acid cassava varieties, in-depth research into the amino acid synthesis mechanism of cassava, the cultivation of new cassava varieties with high protein and amino acid content, and full utilization of the vast, barren hilly and mountainous areas are effective ways to solve the grain feed shortage.

[0004] Branched-chain amino acids (BCAAs), composed of leucine (Leu), isoleucine (Ile), and valine (Val), are essential nutrients for the human body, playing crucial roles in protein synthesis, energy production, and neurotransmitter production. BCAAs can be synthesized in bacteria, plants, and fungi, but animals cannot synthesize them themselves. Studies have shown that BCAAs are important regulators of metabolic health and the aging process. They account for approximately 25% of the total amino acids in human proteins and must be obtained through diet, thus being considered indispensable nutrients.

[0005] Currently, the function and molecular mechanisms of branched-chain amino acid (BCAA) genes in cassava, particularly their role in BCAA accumulation and stress response, remain unclear. Therefore, research on branched-chain amino acid regulation in cassava is of great significance for cultivating high-quality cassava varieties with high amino acid content using molecular techniques. Summary of the Invention

[0006] This invention provides cassava MeBCAT1 Genes and their applications, overexpression in cassava MeBCAT1 It can increase the content of branched-chain amino acids in cassava plants.

[0007] The technical solution of this invention is implemented as follows: The first aspect of the invention is to provide cassava. MeBCAT1 The gene, whose nucleotide sequence is shown in SEQ ID NO:1.

[0008] The second aspect of the invention is to provide cassava containing the first aspect of the invention. MeBCAT1 Recombinant vectors for the coding region of a gene.

[0009] The recombinant vector can be a commonly used vector in the field of gene recombination, such as a virus or plasmid. This invention does not limit its use. In one specific embodiment of this invention, the original vector is the pCAMBIA1300 vector; however, it should be understood that other plasmids or viruses can also be used.

[0010] Preferably, the original vector for the recombinant vector is the pCAMBIA1300 vector, and the cassava... MeBCAT1 The gene coding region is located in the pCAMBIA1300::GFP expression vector. Sal I and Bam HI Between two restriction endonuclease sites.

[0011] A third aspect of the invention is to provide cassava comprising the first aspect. MeBCAT1 The host bacteria of the gene coding region.

[0012] A fourth aspect of the present invention is to provide an expression cassette containing the coding region of the cassava MeBCAT1 gene as described in the first aspect of the present invention.

[0013] The fifth aspect of the invention is to provide cassava as described in the first aspect of the invention. MeBCAT1 The application of genes, or recombinant vectors as described in the second aspect of the present invention, or host bacteria as described in the third aspect of the present invention, or expression cassettes as described in the fourth aspect of the present invention, in increasing the content of branched-chain amino acids in cassava leaves, wherein the branched-chain amino acids are valine, isoleucine, and / or leucine.

[0014] The sixth aspect of the invention is to provide cassava as described in the first aspect of the invention. MeBCAT1 The use of genes, or recombinant vectors as described in the second aspect of the invention, or host bacteria as described in the third aspect of the invention, or expression cassettes as described in the fourth aspect of the invention, in increasing the content of branched-chain amino acids in cassava leaves, while simultaneously increasing the content of proline, lysine, glutamic acid, 4-hydroxyproline, arginine, aspartic acid, tyrosine, asparagine, glutamine, and / or D-2-aminobutyric acid.

[0015] The seventh aspect of the invention is to provide cassava as described in the first aspect of the invention. MeBCAT1 The gene, or the recombinant vector as described in the second aspect of the present invention, or the host bacterium as described in the third aspect of the present invention, or the expression cassette as described in the fourth aspect of the present invention, can increase the content of branched-chain amino acids in cassava leaves, while increasing the content of proline, lysine, glutamic acid, 4-hydroxyproline, arginine, aspartic acid, tyrosine, asparagine, glutamine and / or D-2-aminobutyric acid, without affecting the content of γ-aminobutyric acid.

[0016] The eighth aspect of the invention is to provide cassava as described in the first aspect of the invention. MeBCAT1 The application of genes, or recombinant vectors as described in the second aspect of the present invention, or host bacteria as described in the third aspect of the present invention, or expression cassettes as described in the fourth aspect of the present invention in cassava molecular breeding, screening of cassava germplasm with high amino acid content, improving the feed value of cassava and / or cultivating cassava with high amino acid content.

[0017] The ninth aspect of the present invention is to provide a cassava, wherein the cassava described in the first aspect is used. MeBCAT1 Obtained by transferring genes into cassava plants.

[0018] A tenth aspect of the present invention is to provide a primer pair comprising the following primers: Primer F: 5'- gc gtcgac ATGATTCAAACAAGAGCAGG -3' and Primer R: 5'-tc ggatcc ATGTATCTCCACAGTCCAGC -3'.

[0019] Beneficial effects: This invention cloned cassava from cassava. MeBCAT1 The gene, when overexpressed in cassava, increases the content of branched-chain amino acids (valine, isoleucine, and leucine) in transgenic cassava. Furthermore, the cassava described in this invention... MeBCAT1In addition to increasing the content of branched-chain amino acids, the gene can also increase the content of proline, lysine, glutamic acid, 4-hydroxyproline, arginine, aspartic acid, tyrosine, asparagine, glutamine, and D-2-aminobutyric acid in cassava. These experimental results provide a new approach to improving the feed value of cassava and offer new candidate genes for breeding superior cassava varieties using molecular techniques, which is of great significance in the breeding of new and superior cassava varieties. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 cassava MeBCAT1 Gene expression profiling analysis, **** indicates extremely significant differences (P<0.0001).

[0022] Figure 2 Subcellular localization of MeBCAT1 protein in cassava: Figure A shows the detection results of MeBCAT1 protein in the cytoplasm and nucleus, and Figure B shows the detection results of MeBCAT1 protein in chloroplasts.

[0023] Figure 3 . MeBCAT1 Gene expression analysis of transgenic cassava.

[0024] Figure 4 . MeBCAT1 Amino acid content of genetically modified cassava (1), **** indicates extremely significant difference (P<0.0001); *** (P<0.001); ** (P<0.01).

[0025] Figure 5 . MeBCAT1 Amino acid content of genetically modified cassava (2), **** indicates extremely significant difference (P<0.0001); *** (P<0.001); ** (P<0.01). Detailed Implementation

[0026] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to better understand the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0027] Example 1 Cassava MeBCAT1 Cloning of genes RNA was extracted from cassava leaves using the TIANGEN Plant Polysaccharide and Polyphenol RNA Extraction Kit to obtain total RNA suitable for subsequent experiments. Reverse transcription was performed according to the instructions of the reverse transcription kit (Fastking gDNA Dispelling RTSuperMix, TIANGEN) to obtain cDNA. The obtained cDNA was then used as a template for... Primer F: 5'- gc gtcgac ATGATTCAAACAAGAGCAGG -3' and Primer R: 5'-tc ggatcc Using primers ATGTATCTCCACAGTCCAGC-3' (SEQ ID No:2 and SEQ ID No:3), high-fidelity PCR amplification (PrimeSTAR Max DNA Polymerase, TAKARA) was performed. The PCR product was recovered and verified by sequencing, yielding the correct cassava. MeBCAT1 The gene, whose sequence is shown in SEQ ID No:1 (with... SalI and BamHI (The restriction enzyme cleavage sites of the two restriction endonucleases).

[0028] The PCR amplification reaction system is as follows:

[0029] PCR amplification procedure:

[0030] Example 2 MeBCAT1 Gene expression profiling analysis According to cassava MeBCAT1 Gene-specific sequences were identified, and primers (SEQ ID No:4 and SEQ ID No:5) were designed. RT-qPCR analysis was performed to analyze the gene expression profiles in cassava edible / feed tissues (roots, stems, and leaves). The results showed... MeBCAT1 The transcriptional activity of the gene in the stems and leaves was significantly higher than that in the roots. Figure 1 ).

[0031] Primer F: 5'-TCAGTCTCTGGGACTTGCTTC-3' and Primer R: 5'-TGCAGCCCGAGATGCATAAT-3'.

[0032] Example 3: MeBCAT1 Subcellular Localization To verify the subcellular localization of MeBCAT1, a [structure / system] was constructed. 35S::MeBCAT1::GFP carrier, with 35S::GFP The vector served as a control. The engineered vector was transformed into Agrobacterium GV3101. A positive clone was identified, and 1 ml of overnight cultured Agrobacterium was transferred to 25 ml of LB liquid medium. 2 μl of 100 mM acetylsalicylic acid and 100 μl of 0.5 M MES were added, and the culture was incubated at 28°C with a shaker until the OD value reached approximately 1.0. The bacterial cells were collected and resuspended in 10 mM MgCl2 until the OD value reached 1.0. 2 µl of 100 mM AS was added per ml of bacterial culture, and the culture was allowed to stand for at least 3 hours to prepare the infection solution. The infection solution was then loaded into a 5 ml syringe, and the liquid was injected into the tobacco leaf from the lower epidermis using the thumb to press the syringe backplate. After injection, the tobacco leaf appeared moist. 72 hours after injection, samples were taken and fluorescence signals were detected using a laser confocal fluorescence microscope. The results showed that MeBCAT1 protein was distributed in both the cytoplasm and nucleus. Figure 2 (Figure A in the image) Further adjusting the field of view revealed the location of autofluorescence in the chloroplasts; no GFP fluorescence signal was observed, indicating that MeBCAT1 was not localized in the chloroplasts. Figure 2 (Figure B in the diagram).

[0033] Example 4 Cassava MeBCAT1 Gene function verification (1) Construction of overexpression vector The above cassava MeBCAT1 The nucleotide sequence of a gene, using SalI and two BamHI Restriction endonucleases were used to double-digest the target fragment and the pCAMBIA1300 vector plasmid, respectively. The digested target fragment was then recovered, ligated, transformed, and sequenced to verify its correctness, thus yielding pCAMBIA1300-. 35s : MeBCAT1- eGFP Overexpression vector.

[0034] (2) Genetic transformation of cassava This experiment used the Agrobacterium-mediated method to introduce pGAMBIA1300- 35s:MeBCAT1-eGFP Transgenic cassava plants were obtained by transforming embryonic fragile callus cells of the cassava cultivar SC205 with an overexpression vector.

[0035] The specific steps are as follows: pGAMBIA1300- 35s:MeBCAT1 - eGFPThe plasmid was transferred into Agrobacterium LBA4404 competent cells using the freeze-thaw shock method (i.e., take 100 μL of Agrobacterium competent cells into a pre-cooled centrifuge tube, add 0.1-1 μg of plasmid DNA, quickly place the centrifuge tube into liquid nitrogen to freeze for 5 minutes, quickly remove the centrifuge tube from the liquid nitrogen, and immediately place it in a 37℃ water bath for heat shock for 5 minutes). Agrobacterium was then spread on solid YEB medium supplemented with kanamycin and rifampicin antibiotics. After the colonies grew, PCR identification was performed. PCR-positive colonies were shaken and preserved for subsequent plant infection.

[0036] Using embryogenic fragile callus from cassava cultivar SC205 as recipient material, pGAMBIA1300- 35s : MeBCAT1 - eGFP Agrobacterium bacterial suspension with an OD of approximately 0.5 was collected by centrifugation, washed twice with GD antibiotic-free medium, and resuspended in an equal volume of GD medium supplemented with 100 mmol / L acetylsylgenone. A small amount of embryogenic fragile callus was added and suspended at room temperature for 30 min. The bacterial suspension was removed, and the callus cells were placed on GD solid medium supplemented with 100 mmol / L acetylsylgenone and cultured in the dark at 20-22°C for 3 days. After repeatedly washing the callus cells with sterile water, the callus cells were placed on GD solid medium supplemented with 500 mg / L carbenicillin and 5 mg / L hygromycin and cultured under light at 26°C for 2 weeks. Untransformed cells were discarded, and resistant callus was induced. The callus cells were then transferred to embryo induction medium supplemented with 500 mg / L carbenicillin and 5 mg / L hygromycin to obtain resistant transgenic plants. The transgenic plants were analyzed by RT-qPCR according to the method in Example 2. MeBCAT1 Relative expression level ( Figure 3 ).

[0037] An appropriate amount of cassava leaves was weighed and extracted using an acid hydrolysis method. Metabolites in the sample were detected using ultra-high performance liquid chromatography-tandem high-resolution Orbitrap mass spectrometry (UHPLCQE, Thermo, USA). Qualitative and quantitative analysis of the metabolites in the sample was performed by comparing the retention time and molecular weight (molecular weight error <10 ppm) with those of standards. Results are as follows: Figure 4-5 As shown.

[0038] Depend on Figure 4-5 The data shows that MeBCAT1In transgenic cassava leaves, the contents of valine, isoleucine, leucine, proline, lysine, glutamic acid, 4-hydroxyproline, arginine, aspartic acid, tyrosine, asparagine, and glutamine were all significantly increased (p<0.0001); the contents of alanine and D-2-aminobutyric acid were also increased to varying degrees, while the content of γ-aminobutyric acid did not change significantly. These results indicate that overexpression... MeBCAT1 The gene can not only significantly increase the content of three branched-chain amino acids in transgenic cassava plants, but also significantly increase the content of other amino acids in transgenic cassava plants, thus significantly increasing the feed value of cassava.

[0039] The specific embodiments of the present invention have been described in detail above, but they are merely examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent transformations and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. A type of cassava MeBCAT1 Genes, or cassava containing the aforementioned genes MeBCAT1 Recombinant vectors containing the gene coding region of the gene, or containing the cassava mentioned above. MeBCAT1 The application of host bacteria or expression cassettes of the gene coding region in increasing the content of branched-chain amino acids in cassava leaves, wherein the branched-chain amino acids are valine, isoleucine, and / or leucine; the cassava... MeBCAT1 The nucleotide sequence of the gene is shown in SEQ ID NO:1, and the cassava described above is overexpressed in cassava. MeBCAT1 Genes increase the content of branched-chain amino acids in cassava leaves.

2. A type of cassava MeBCAT1 Genes, or cassava containing the aforementioned genes MeBCAT1 Recombinant vectors containing the gene coding region of the gene, or containing the cassava mentioned above. MeBCAT1 The application of host bacteria or expression cassettes of gene coding regions in increasing the content of branched-chain amino acids in cassava leaves is characterized by, Overexpression of the aforementioned cassava in cassava MeBCAT1 The gene increases the content of branched-chain amino acids in cassava leaves, while also increasing the content of proline, lysine, glutamic acid, 4-hydroxyproline, arginine, aspartic acid, tyrosine, asparagine, glutamine, and / or D-2-aminobutyric acid; the cassava MeBCAT1 The nucleotide sequence of the gene is shown in SEQ ID NO:1; the branched amino acids are valine, isoleucine and / or leucine.

3. A type of cassava MeBCAT1 Genes, or cassava containing the aforementioned genes MeBCAT1 Recombinant vectors containing the gene coding region of the gene, or containing the cassava mentioned above. MeBCAT1 The application of host bacteria or expression cassettes of gene coding regions in increasing the content of branched-chain amino acids in cassava leaves is characterized by, Overexpression of the aforementioned cassava in cassava MeBCAT1 The gene increases the content of branched-chain amino acids in cassava leaves, while also increasing the content of proline, lysine, glutamic acid, 4-hydroxyproline, arginine, aspartic acid, tyrosine, asparagine, glutamine, and / or D-2-aminobutyric acid (GABA), without affecting the content of GABA; the cassava MeBCAT1 The nucleotide sequence of the gene is shown in SEQ ID NO:1, and the branched-chain amino acids are valine, isoleucine and / or leucine.

4. A type of cassava MeBCAT1 Genes, or cassava containing the aforementioned genes MeBCAT1 Recombinant vectors containing the gene coding region of the gene, or containing the cassava mentioned above. MeBCAT1 The application of host bacteria or expression cassettes of gene coding regions in the cultivation of cassava with high amino acid content; the cassava MeBCAT1 The nucleotide sequence of the gene is shown in SEQ ID NO:1, and the amino acids are branched-chain amino acids. Overexpression of the gene in cassava... MeBCAT1 The gene increases the content of branched-chain amino acids in cassava leaves, wherein the branched-chain amino acids are valine, isoleucine and / or leucine.

5. A type of cassava, characterized in that, Cassava overexpression MeBCAT1 Gene acquisition; the cassava MeBCAT1 The nucleotide sequence of the gene is shown in SEQ ID NO:1.

Images