A pharmaceutical composition comprising a modulator of the rxra signaling pathway and uses thereof

Abstract

This invention discloses a pharmaceutical composition containing an RXRA signaling pathway modulator and its uses, belonging to the field of biomedical technology. By constructing three non-reproductive system injury models with different mechanisms—acute lung injury (ALI), partial hepatectomy (PHx), and cerebral ischemia-reperfusion injury (tMCAO)—this invention reveals that systemic stress leads to decreased serum retinoic acid (RA) levels and abnormal transport proteins, thereby inhibiting the key gene for steroid production in testicular interstitial cells, RXRA. Cyp11a1 The transcriptional activation of retinoic acid ultimately leads to a common molecular mechanism of testicular dysfunction. This invention further confirms that supplementing with exogenous retinoic acid or using RXRA agonists (such as bexarotine) can significantly restore serum testosterone levels, sperm quality, and testicular tissue structure in stressed mice, and upregulate... Cyp11a1 This invention provides new drug targets and treatment strategies for preventing and treating reproductive function damage in critically ill patients.

Description

Technical Field

[0001] This invention relates to the fields of reproductive biology, stress physiology, and molecular endocrine regulation, specifically to a pharmaceutical composition containing an RXRA signaling pathway modulator and its use, particularly a method for improving or restoring testicular function under systemic stress by regulating the retinoic acid–retinoid X receptor α (RA–RXRA) signaling pathway and its use in the preparation of reproductive function protection products. Background Technology

[0002] Under systemic stress induced by factors such as trauma, infection, and ischemia, the body's endocrine and metabolic networks undergo extensive reprogramming, with damage to reproductive system function being a common stress-related complication. Clinical studies show that patients with severe stress often experience reproductive dysfunction such as decreased serum testosterone levels and reduced sperm quality, and long-term stress can even lead to irreversible testicular damage.

[0003] Currently, research on stress-related reproductive dysfunction mainly focuses on two directions: one is the central inhibitory mechanism of the hypothalamic-pituitary-gonadal axis (HPG axis); the other is attribution to non-specific factors such as the proliferation of inflammatory factors. However, the above studies have obvious limitations: first, it is still inconclusive whether systemic stress from different sources (such as lung injury, liver injury, and brain injury) affects testicular function through common peripheral molecular mechanisms; second, existing studies have not revealed molecular targets that can be precisely intervened.

[0004] In summary, current technologies lack research on the common molecular mechanisms of testicular dysfunction under systemic stress, and also fail to provide safe and efficient intervention strategies based on peripheral molecular pathways. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art, reveal the common molecular mechanisms of testicular dysfunction under systemic stress from different sources, and provide a peripheral targeted regulation method based on the RA–RXRA signaling pathway to improve and restore stress-related testicular function.

[0006] To achieve the above objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides the use of an RXRA signaling pathway modulator in the preparation of a medicament or health product for improving or restoring testicular function under systemic stress.

[0007] Specifically, this invention provides the use of RXRA signaling pathway modulators in the preparation of drugs for the prevention or treatment of testicular dysfunction caused by systemic stress.

[0008] Preferably, the systemic stress state is induced by damage to the non-reproductive system.

[0009] Furthermore, the non-reproductive system injury includes, but is not limited to, acute lung injury, liver injury, or cerebral ischemia-reperfusion injury.

[0010] Preferably, the drug activates the RXRA signaling pathway in testicular interstitial cells, upregulates the expression of key enzymes in steroid production, promotes testosterone synthesis, and inhibits germ cell apoptosis.

[0011] Preferably, the RXRA signaling pathway modulator is retinoic acid or a retinoic acid X receptor α agonist.

[0012] In a second aspect, the present invention provides a pharmaceutical composition for improving systemic stress-related testicular dysfunction based on the RXRA signaling pathway, the composition comprising an effective amount of an RXRA signaling pathway modulator and a pharmaceutically acceptable carrier.

[0013] Specifically, the present invention provides a pharmaceutical composition for improving systemic stress-related testicular dysfunction, the pharmaceutical composition comprising an effective amount of an RXRA signaling pathway modulator and a pharmaceutically acceptable carrier.

[0014] Preferably, the RXRA signaling pathway modulator is an RXRA signaling pathway activator.

[0015] Furthermore, the RXRA signaling pathway activator is retinoic acid or an analogue thereof.

[0016] Furthermore, the retinoic acid is all-trans retinoic acid or 9-cis retinoic acid; the analogue is bexarotine.

[0017] In the above uses or pharmaceutical compositions, the drug is administered orally or by gavage, and the effective dose is 10 mg / kg body weight.

[0018] This invention reveals that acute lung injury, liver resection, and cerebral ischemia all lead to a significant decrease in serum retinoic acid (RA) levels and abnormal levels of retinoic acid-binding protein 4 (RBP4). This systemic retinoic acid metabolic disorder subsequently inhibits the activity of the nuclear receptor RXRA in Leydig cells. RXRA is a key enzyme regulating steroid synthesis. Cyp11a1 This is a crucial transcription factor, and its suppressed function directly leads to reduced testosterone synthesis and testicular dysfunction. Based on this finding, this invention proposes to reactivate this signaling pathway by supplementing with exogenous RA or using RXRA-specific agonists (such as bexarotine).

[0019] Compared with the prior art, the beneficial effects of the present invention are: Revealing a common mechanism with strong universality: This invention is the first to discover and confirm that "suppression of the RA–RXRA signaling pathway" is a common molecular mechanism for testicular dysfunction caused by systemic stress from different sources (lung, liver, brain). This discovery breaks through the limitations of existing technologies that focus on single stressors and establishes a universal therapeutic target that spans organs and diseases.

[0020] Precise peripheral intervention with high safety: The regulatory strategy of this invention targets molecular pathways in the testis (Leydig cells) rather than intervening in the hypothalamic-pituitary (HPG) central axis. This peripheral targeting strategy not only has a rapid onset of action but also effectively avoids the risk of systemic endocrine disorders that may be caused by regulating central hormones, thus exhibiting better physiological compatibility and safety.

[0021] Flexible intervention strategies and significant therapeutic effects: This invention provides two independent intervention pathways: "supplementing exogenous ligands (retinoic acid)" and "activating nuclear receptors (RXRA agonists)." Experiments have confirmed that either pathway can effectively restore the transcriptional regulatory function of Leydig cells under stress and significantly upregulate key enzymes in steroid production (such as...). Cyp11a1 This invention expresses and reverses testicular atrophy, decreased sperm quality, and testosterone deficiency, providing a flexible treatment option for clinical use. Its application prospects are broad: the mechanism and intervention method revealed in this invention do not depend on a specific primary lesion and are applicable to various stress scenarios such as trauma, infection, surgery, and ischemia. It can be used to develop broad-spectrum reproductive function protection drugs or functional foods, possessing significant clinical translational value. Attached Figure Description

[0022] Figure 1 This study demonstrates how systemic stress (acute lung injury, ALI) impairs testicular function in mice. (A) Comparison of testicular weight (g) between the Sham and ALI groups. (B) Sperm concentration (×10⁻⁶) as shown by computer-aided semen analysis (CASA). 6 (C) Sperm motility (%) as shown by CASA analysis. (D) Serum testosterone concentration (ng / ml) as measured by ELISA. Data are expressed as Mean ± SD, n = 5–7. *P < 0.05, **P < 0.01.

[0023] Figure 2This study demonstrates testicular tissue damage and apoptosis induced by systemic stress in mice. (AB) Hematoxylin-eosin (H&E) staining images of testicular tissue from the Sham group (A) and the ALI group (B), showing damage to the seminiferous tubules in the ALI group. Scale bar = 50 µm. (C) Cosentino scores show a significantly increased degree of seminiferous tubule damage in the ALI group. (DE) TUNEL staining images of testicular tissue from the Sham group (D) and the ALI group (E) (green fluorescence indicates apoptotic cells, blue DAPI stains the nuclei), showing a significantly increased apoptosis in the ALI group. Scale bar = 50 µm. (F) Statistical results show a significantly increased apoptosis index in the ALI group. Data are expressed as Mean ± SD, n = 5. **P < 0.01.

[0024] Figure 3 This study demonstrates the role of systemic stress in inhibiting testicular steroid production and regulating RXRA. (AB) Immunofluorescence staining of CYP11A1 in testicular tissues of the Sham group (A) and the ALI group (B) (red fluorescence indicates CYP11A1, blue DAPI stains the nucleus), showing a significant decrease in CYP11A1 expression in the ALI group. Scale bar = 50µm. (C) After xiknockdown of RXRA with siRNA in 293T cells, the relative expression level of the RXRA gene decreased significantly. (D) Dual-luciferase reporter gene assay results showed that RXRA significantly activated the activity of the wild-type Cyp11a1 promoter (WT promoter), but significantly reduced its activation of the mutant promoter (Mut promoter). Data are expressed as Mean ± SD, n = 6–8. **P < 0.01.

[0025] Figure 4 Demonstrates the improvement of testicular dysfunction induced by ALI caused by the RXRA agonist (bexarotine). (AC) After treatment with bexarotine in ALI model mice, testicular weight (g) (A) and sperm concentration (×10) were significantly improved. 6 Both serum testosterone levels (ng / ml) (B) and serum testosterone levels (ng / ml) (C) showed significant recovery. (DE) TUNEL staining showed a significant reduction in apoptotic cells in the testicular tissue of the bexarotine treatment group (E) compared to the untreated ALI group (D). Scale bar = 50µm. (F) Statistical results showed a significant decrease in the apoptosis index in the bexarotine treatment group. Data are expressed as Mean ± SD, n = 5. *P < 0.05, **P < 0.01.

[0026] Figure 5This study demonstrates how systemic stress leads to abnormal serum retinoic acid levels and transporter proteins. (A) Comparison of serum retinoic acid concentrations (nmol / L) between the Sham and ALI groups showed a significant decrease in the ALI group. (B) Comparison of serum retinoic acid-binding protein 4 (RBP4) concentrations (nmol / L) between the Sham and ALI groups showed a significant decrease in the ALI group. Data are expressed as Mean ± SD, n = 5. **P < 0.01.

[0027] Figure 6 This study demonstrates how retinoic acid supplementation improves testicular dysfunction induced by ALI. (AC) After retinoic acid treatment in ALI model mice, testicular weight (g) (A) and sperm concentration (×10⁻⁶) were significantly increased. 6 Both serum testosterone levels (ng / ml) (B) and serum testosterone levels (ng / ml) (C) were significantly restored. (D) qPCR results showed that retinoic acid supplementation significantly upregulated the relative expression level of Cyp11a1 in the testes of ALI mice. Data are expressed as Mean±SD, n=5. *P<0.05, **P<0.01.

[0028] Figure 7 Systemic stress from different sources (liver injury PHx, brain injury tMCAO) all led to damage to the RA-testosterone axis. In the (AC) partial hepatectomy (PHx) model group, mouse testicular weight (A), serum testosterone (B), and serum retinoic acid (C) levels were significantly lower than those in the control group. In the (DF) cerebral ischemia-reperfusion (tMCAO) model group, mouse testicular weight (D), serum testosterone (E), and serum retinoic acid (F) levels were significantly lower than those in the control group. Data are expressed as Mean ± SD, n = 5–7. **P < 0.01.

[0029] Figure 8 This study demonstrates the universal therapeutic effect of retinoic acid supplementation on testicular dysfunction caused by liver and brain injury. (AB) In PHx model mice, serum testosterone levels significantly increased after RA treatment (A), and the testicular cell apoptosis index significantly decreased (B). (DE) In tMCAO model mice, serum testosterone levels significantly increased after RA treatment (D), and the testicular cell apoptosis index significantly decreased (E). Data are expressed as Mean ± SD, n = 5–7. *P < 0.05, **P < 0.01.

[0030] Figure 9 This is a schematic diagram illustrating the principle of the method of the present invention. Systemic stress (1) leads to a decrease in circulating retinoic acid (RA) levels and abnormal transport proteins (2), thereby inhibiting the transcriptional regulation function of the RXRA signaling pathway in testicular interstitial cells (3) and downregulating steroid-related genes (such as... Cyp11a1The expression of retinoic acid (4) ultimately leads to impaired testicular function (5). This invention restores testicular function by supplementing exogenous retinoic acid (6) or using RXRA agonists (7) to reactivate the pathway. Detailed Implementation

[0031] Explanation of terms and abbreviations: RA: Retinoic Acid RXRA: Retinoid X Receptor α RBP4: Retinoic Acid Binding Protein 4 Sham: Sham Surgery Group ALI: Acute Lung Injury PHx: Partial Hepatectomy tMCAO: Transient Middle Cerebral Artery Occlusion WT: Wild Type Mut: Mutation To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0032] This invention proposes a technical solution to improve or restore testicular function under systemic stress by regulating the retinoic acid-retinoic acid X receptor α (RA-RXRA) signaling pathway. Its core principle is as follows: Figure 9 As shown, under systemic stress, metabolic reprogramming leads to decreased circulating retinoic acid (RA) levels and abnormalities in the transporter protein (RBP4), hindering the transport of retinoic acid to testicular tissue. This change inhibits the transcriptional activity of the nuclear receptor RXRA in Leydig cells, resulting in downregulation of key steroid-producing enzymes (such as CYP11A1), thereby causing reduced testosterone synthesis and impaired spermatogenesis. This invention restores testicular function by supplementing with exogenous retinoic acid or using RXRA agonists (such as bexarotine) to reactivate this pathway.

[0033] Technical Solution Overview: 1. Experimental Model This invention employs three different non-reproductive system injury models to simulate systemic stress states, in order to verify the universality of this mechanism: (1) Acute lung injury (ALI): mimicking respiratory stress induced by infection or trauma; (2) Partial hepatectomy (PHx): mimicking the metabolic stress induced by surgical procedures or regenerative demands; (3) Cerebral ischemia-reperfusion (tMCAO): mimicking the nervous system stress induced by ischemic stroke.

[0034] 2. Regulatory measures In response to the aforementioned stress state, the present invention intervenes through one or two of the following methods: (1) Supplementation with retinoic acid or its analogues: such as all-trans retinoic acid (atRA) or 9-cis-retinoic acid (9-cis-RA) to supplement the ligands that are lacking in the body.

[0035] (2) Activate the RXRA signaling pathway: For example, administering RXRA-specific agonists (such as bexarotene) can directly enhance the transcriptional activity of RXRA in Leydig cells.

[0036] The following are the specific experimental procedures and results.

[0037] I. Experimental Materials and Reagents 1. Laboratory animals Male C57BL / 6J mice, aged 7-8 weeks and weighing 22-26g, were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. (Nanjing, China). Five mice were housed in individually ventilated cages (IVCs) with a specific pathogen-free (SPF) barrier environment. Husbandry conditions were controlled as follows: temperature 22±1℃, relative humidity 50%±5%, 12-hour light / 12-hour dark cycle (light time 08:00-20:00), and free access to standard irradiated feed and autoclaved water. All experimental procedures were approved by the Institute of Laboratory Animal Welfare and Ethics (IACUC) of Nanjing Medical University.

[0038] 2. Main reagents Anesthetics: Ketamine, Xylazine hydrochloride, Isoflurane.

[0039] Modeling reagent: hydrochloric acid (HCl, analytical grade, diluted to 0.1N).

[0040] Drugs: 9-cis-retinoic acid (RA, purity ≥98%, purchased from Macklin), bexarotene (RXRA agonist, purity ≥99%, purchased from Aladdin), sterile corn oil (solvent).

[0041] Cells: HEK293T cells (purchased from ATCC).

[0042] Test kits: Mouse testosterone ELISA kit, mouse retinoic acid (RA) ELISA kit, and mouse retinoic acid binding protein 4 (RBP4) ELISA kit (all purchased from Shanghai Enzyme-LinkedBiotechnology Co., Ltd.).

[0043] Antibody: Rabbit anti-mouse CYP11A1 polyclonal antibody (Proteintech).

[0044] Molecular biology reagents: TRIzol total RNA extraction reagent (Takara), Prime Script RT Master Mix (Takara), ChamQ Universal SYBR qPCR Master Mix (Vazyme), Lipofectamine 2000 transfection reagent (Thermo Fisher), Dual luciferase assay kit (Vazyme).

[0045] Main instruments: Computer-aided sperm analysis system (Hamilton Thorne IVOS II, USA), laser confocal microscope (Zeiss LSM 900, Germany), real-time quantitative PCR instrument (Applied Biosystems QuantStudio 7).

[0046] II. Experimental Methods 1. Establishment and evaluation of systemic stress models This invention constructs three non-reproductive system injury models with different mechanisms to verify the common effects of stress on testicular function.

[0047] 1.1 Acute Lung Injury (ALI) Model: Mice were deeply anesthetized by intraperitoneal injection of a mixture of ketamine (100 mg / kg) and xylazine (10 mg / kg). The neck was prepared and disinfected, and a 0.5 cm incision was made along the midline to bluntly dissect and expose the trachea. Under direct vision, a 24G intravenous catheter was inserted into the trachea through the cricothyroid cartilage ring and gently advanced into the left main bronchus. Sterile 0.1N hydrochloric acid (HCl) solution was slowly infused through the catheter at a dose of 2.5 mL / kg (50 μL for a 20 g mouse). Immediately after infusion, the mouse was placed on a 60° inclined surgical board, head-up and feet-down, tilted to the left for 30 seconds to promote uniform distribution of acid within the lung lobe. The catheter was removed, and the incision was sutured layer by layer. Postoperatively, the mouse was placed on a 37°C constant-temperature heating pad for rewarming until fully awake.

[0048] 1.2 Partial Hepatectomy (PHx) Model: Mice were anesthetized with isoflurane inhalation at an induction concentration of 5% and a maintenance concentration of 1.5%, with an oxygen flow rate of 1 L / min. Mice were placed in a supine position, and the abdomen was disinfected. A midline incision (approximately 1.5 cm long) was made approximately 1 cm below the xiphoid process to access the abdominal cavity. The abdomen was gently compressed to expose the liver. The perihepatic ligaments were freed, and the hepatic pedicles at the base of the left lateral lobe and the middle lobe of the liver were ligated using 6-0 silk sutures to ensure blood flow occlusion. These two lobes were then removed. The amount of liver tissue removed was approximately 70% of the total liver volume. After confirming no bleeding, the abdominal cavity was irrigated with warm saline and sutured in layers. The mice were then placed in a 37°C environment for postoperative recovery.

[0049] 1.3 Cerebral Ischemia-Reperfusion (tMCAO) Model: Isoflurane inhalation anesthesia was used (parameters as above). A midline incision was made in the neck to expose the right common carotid artery (CCA), external carotid artery (ECA), and internal carotid artery (ICA). The distal ECA was ligated. A small incision was made proximal to the CCA, and a specially designed nylon monofilament suture (coated with silicone, 0.21±0.01mm in diameter, purchased from RWD LifeScience) was inserted and advanced approximately 9-10mm through the ICA to the origin of the middle cerebral artery (MCA) to block blood flow. After 60 minutes of ischemia, the suture was gently removed, restoring blood flow to the MCA and achieving reperfusion. The proximal CCA incision was ligated, and the skin was sutured. Postoperatively, a moist soft feed was provided to assist feeding.

[0050] 1.4 Sham group: Mice in the sham group underwent the same anesthesia, skin incision and blood vessel / organ exposure procedures, but did not undergo acid infusion, liver lobe removal or suture insertion.

[0051] 2. Drug intervention plan Drug preparation: 9-cis-retinoic acid (RA) and bexarotine (BE) are dissolved in sterile corn oil and prepared immediately before use. The operation process must be strictly protected from light.

[0052] Administration method and dosage: RA group: 10 mg / kg of RA solution was administered by oral gavage.

[0053] BE group: 10 mg / kg of BE solution was administered by gavage.

[0054] Solvent group: An equal volume of sterile corn oil was administered by gavage.

[0055] Dosing window: The first dose is administered 2 hours before the modeling surgery, followed by doses every 24 hours until the end of sample collection.

[0056] 3. Sample Collection and Processing 3.1 Blood Sample: Collect approximately 0.5 mL of whole blood via cardiac puncture. Allow the blood sample to stand vertically at room temperature (20-25℃) for 30 minutes to allow natural coagulation and serum precipitation. Then, centrifuge at 1600×g for 15 minutes at 4℃. Carefully aspirate the supernatant pale yellow clear serum and aliquot it into sterile EP tubes. Store at -80℃ for later use.

[0057] 3.2 Tissue samples: Bilateral testes and epididymis were dissected, fatty connective tissue was removed, surface liquid was blotted dry with filter paper, and then weighed.

[0058] Left testis: Fixed in modified Davidson's fixative for 24-48 hours for histopathological examination.

[0059] Right testis: flash-frozen in liquid nitrogen and then stored at -80°C for RNA extraction.

[0060] Left epididymal tail: Immediately placed in preheated PBS for sperm quality analysis.

[0061] 4. Detection Indicators and Methods 4.1 Computer-Aided Semen Quality Analysis (CASA) The left epididymal tail was collected, shredded in an EP tube containing 400 μL of preheated (37°C) PBS, and incubated at 37°C for 5 minutes to release sperm. After gentle mixing, 10 μL of the sperm suspension was added to a sperm counting chamber. Sperm concentration (×10⁻¹⁰) was measured using a computer-assisted sperm analysis system (Hamilton Thorne IVOS II, USA). 6 / ml, Total Motility (%). At least 5 fields of view were analyzed for each sample.

[0062] 4.2 Serum Hormone and Biochemical Indicator Detection Serum testosterone, retinoic acid, and RBP4 levels were detected using enzyme-linked immunosorbent assay (ELISA). The experiments were performed strictly according to the kit instructions. (1) Add the standard and diluted serum sample to a microplate coated with specific antibodies; (2) Wash the plate after incubating at 37℃ for the specified time; (3) Add enzyme-labeled antibody and substrate for color development; (4) Add the stop solution and use an ELISA reader to measure the absorbance (OD value) at a wavelength of 450 nm. Calculate the concentration using the standard curve.

[0063] 4.3 Histopathological examination (H&E staining) Fixed testicular tissue was dehydrated with graded ethanol, cleared with xylene, and embedded in paraffin. Serial sections were prepared along the long axis of the testis, 5 μm thick. After dewaxing and hydration, the sections were stained with hematoxylin and eosin (H&E). The integrity of the seminiferous tubules and the morphology of interstitial cells were observed using an optical microscope. The Cosentino score was used for semi-quantitative assessment of the degree of testicular damage.

[0064] 4.4 Apoptosis Detection (TUNEL) In situ apoptosis detection kits (TUNEL, Vazyme) were used. Paraffin sections were dewaxed and hydrated, then digested with DNase-free proteinase K (20 μg / mL) at 37°C for 20 min. After washing with PBS, TUNEL reaction solution was added, and the sections were incubated at 37°C in the dark for 60 min. After washing with PBS, the sections were mounted with mounting medium containing DAPI. Observation and photography were performed using a laser confocal microscope. Apoptotic cell nuclei showed green fluorescence, while total cell nuclei showed blue fluorescence. Three to five fields of view were randomly selected from each section, and the apoptotic index (%) was calculated.

[0065] 4.5 Immunofluorescence staining Paraffin sections were dewaxed and hydrated, then microwaved in sodium citrate buffer (pH 6.0) to retrieve antigens. After cooling, they were blocked with goat serum blocking buffer at room temperature for 1 hour. Rabbit anti-CYP11A1 polyclonal antibody (1:200 dilution) was added, and the sections were incubated overnight in a humidified chamber at 4°C. The next day, the sections were washed with PBS, and fluorescently labeled goat anti-rabbit IgG secondary antibody (1:200 dilution) was added. The sections were incubated at room temperature in the dark for 1 hour. Cell nuclei were counterstained with DAPI, and the sections were mounted for observation.

[0066] 4.6 Cell Culture and siRNA Transfection HEK293T cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum (FBS) and incubated at 37°C in a 5% CO2 incubator. When cell confluence reached 60-70%, cells were transfected with Lipofectamine 2000 targeting human cells. RXRA Specific siRNA or negative control siRNA (NC) was used. Cells were collected 12 hours after transfection to extract total RNA, which was detected by qRT-PCR. RXRA Knockout efficiency (using human primer humRxra).

[0067] 4.7 RNA extraction and qRT-PCR Total RNA was extracted from mouse testicular tissue or 293T cells using TRIzol reagent. After chloroform extraction, isopropanol precipitation, and washing with 75% ethanol, the RNA was dissolved in RNase-free water. 1 μg of total RNA was reverse transcribed into cDNA using a reverse transcription kit. Amplification was performed using SYBR Green dye on an Applied Biosystems real-time quantitative PCR instrument.

[0068] Targeting mouse testicular tissue ( Figure 6 D): Detect the relative expression level of Cyp11a1, a key gene for steroid production, using Mouse Ppia as an internal control.

[0069] Targeting 293T cells ( Figure 3 C): Detect the relative expression level of RXRA, using Human Ppia as an internal reference.

[0070] Human Ppia was used as an internal control in 293T cell experiments, and Mouse Ppia was used as an internal control in mouse tissue experiments.

[0071] The qRT-PCR primer sequences (5'-3') are as follows: Cyp11a1(Mouse)F:AGGTCCTTCAATGAGATCCCTT; Cyp11a1(Mouse)R: TCCCTGTAAATGGGGCCATAC; humRxra(Human)F:TTCTCTCTACCCCAGGTGAACTC; humRxra(Human)R:AGGAGGCCATATTTCCTGAG; Ppia (internal reference Human)F: TCTTGAGGGAAGCATATTGG; Ppia (internal reference Human)R: CAGGGAGACTGACTGTAGCAC; Ppia (internal reference Mouse)F: CGCGTCTCCTTCGAGCTGTTTG; Ppia (internal reference Mouse)R: TGTAAAGTCACCACCCTGGCACAT.

[0072] 4.8 Dual-luciferase reporter gene assay (1) Plasmid construction: constructing a plasmid containing mouse Cyp11a1 pGL4-Luc reporter vector (WT) for gene promoter regions, and vectors with mutations at the RXRA binding site (Mut).

[0073] (2) Transfection: HEK293T cells were seeded in 24-well plates. When the confluence reached 70%, the RXRA overexpression plasmid and the above reporter vector (WT or Mut) were co-transfected using Lipofectamine 2000 transfection reagent. The transfection efficiency was corrected using the internal control plasmid pRL-TK.

[0074] (3) Detection: 24-48 hours after transfection, cells were lysed and the activities of firefly luciferase and kidney luciferase were measured using a dual luciferase assay kit. The relative luciferase activity (Firefly / Renilla) was calculated.

[0075] 5. Statistical Analysis All data were statistically analyzed using GraphPad Prism 8.0 software. Quantitative data are expressed as mean ± standard deviation (Mean ± SD). Comparisons between two groups were performed using Student's t-test (for normally distributed data) or Mann-Whitney U test (for non-normally distributed data). Comparisons among multiple groups were performed using one-way ANOVA followed by Tukey's post-hoc test. A p-value < 0.05 was considered statistically significant (*P < 0.05, **P < 0.01).

[0076] III. Experimental Results Example 1: Systemic stress leads to impaired testicular function in mice The results are as follows Figure 1 As shown, the ALI model group mice had reduced testicular weight, significantly decreased sperm concentration and motility, and drastically reduced serum testosterone levels.

[0077] Example 2: Systemic stress-induced testicular tissue damage and apoptosis The results are as follows Figure 2 As shown, the seminiferous tubules in the testes of the ALI group exhibited disordered structure and a significant increase in TUNEL-positive cells.

[0078] Example 3: Verification of the mechanism by which systemic stress inhibits testicular steroid production and regulates RXRA. The results are as follows Figure 3As shown, CYP11A1 protein expression was reduced in the ALI group. In vitro experiments confirmed that RXRA can bind to and activate the Cyp11a1 promoter, and knockdown of RXRA led to downregulation of Cyp11a1 gene expression.

[0079] Example 4: RXRA agonists improve testicular function The results are as follows Figure 4 As shown, bexarotine treatment significantly restored testicular weight, sperm quality, and testosterone levels in ALI mice and reduced cell apoptosis.

[0080] Example 5: Systemic stress leads to abnormalities in serum RA and RBP4. The results are as follows Figure 5 As shown, the serum RA and RBP4 levels in the ALI group mice were significantly lower than those in the control group.

[0081] Example 6: Retinol supplementation improves testicular function The results are as follows Figure 6 As shown, RA supplementation significantly improved reproductive function indicators in ALI mice and upregulated Cyp11a1 expression.

[0082] Example 7: Results of multi-model validation (PHx and tMCAO) are as follows Figure 7 and Figure 8 As shown, a synchronous decrease in serum RA and testosterone was also observed in liver injury and brain injury models. Figure 7 After RA treatment, serum testosterone levels in both mouse models significantly increased, and testicular cell apoptosis was inhibited. Figure 8 This confirms that the mechanism and intervention strategy have good universality.

[0083] The RA–RXRA signaling pathway regulation method of this invention can be industrially prepared into drugs or health products for improving systemic stress-related testicular dysfunction. This product can be administered via various routes, including oral and injection, and is suitable for reproductive function protection in stressful situations such as trauma, infection, and surgery, demonstrating significant clinical application value and market potential.

[0084] [Other Notes] The embodiments described above are merely partial implementations of the present invention, used to illustrate the technical solutions of the present invention, and are not intended to limit the scope of protection of the present invention. Various modifications, alterations, or equivalent substitutions made by those skilled in the art without departing from the concept and principle of the present invention should fall within the scope of protection of the present invention. The scope of protection of the present invention is defined by the appended claims.

Claims

1. Use of RXRA signaling pathway modulators in the preparation of drugs for the prevention or treatment of testicular dysfunction caused by systemic stress.

2. The use according to claim 1, characterized in that, The systemic stress state was induced by damage to the non-reproductive system.

3. The use according to claim 2, characterized in that, The non-reproductive system injuries include, but are not limited to, acute lung injury, liver injury, or cerebral ischemia-reperfusion injury.

4. The use according to claim 1, characterized in that, The drug activates the RXRA signaling pathway in testicular interstitial cells, upregulates the expression of key enzymes in steroid production, promotes testosterone synthesis, and inhibits germ cell apoptosis.

5. The use according to claim 1, characterized in that, The RXRA signaling pathway modulator is retinoic acid or a retinoic acid X receptor α agonist.

6. A pharmaceutical composition for improving systemic stress-related testicular dysfunction, characterized in that, The pharmaceutical composition comprises an effective amount of an RXRA signaling pathway modulator and a pharmaceutically acceptable carrier.

7. The pharmaceutical composition according to claim 6, characterized in that, The RXRA signaling pathway modulator is an RXRA signaling pathway activator.

8. The pharmaceutical composition according to claim 7, characterized in that, The RXRA signaling pathway activator is retinoic acid or an analogue thereof.

9. The pharmaceutical composition according to claim 8, characterized in that, The retinoic acid is all-trans retinoic acid or 9-cis retinoic acid; the analogue is bexarotine.

10. The use according to any one of claims 1 to 5 or the pharmaceutical composition according to any one of claims 6 to 9, characterized in that, The drug is administered orally or by gavage, with an effective dose of 10 mg / kg body weight.

Images