Method for correcting truncating mutations in the apc gene in colorectal cancer using abe base editing

By using ABE base editing technology to correct truncated mutations in the APC gene in colorectal cancer and restore the expression of the full-length APC protein, the problem of existing technologies being unable to correct truncated APC mutations has been solved, enabling precision treatment of colorectal cancer and significantly inhibiting tumor growth and proliferation.

CN122256352APending Publication Date: 2026-06-23XIN HUA HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
XIN HUA HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
Filing Date
2026-03-27
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Current technologies cannot effectively correct truncated mutations in the APC gene in colorectal cancer, which lead to cancer cell proliferation and metastasis, and there is a lack of methods to restore its normal tumor-suppressing function.

Method used

Using ABE base editing technology, an adenine base editing system targeting the APC gene in colorectal cancer was employed. By utilizing ABE protein and specific sgRNA, precise editing was performed in the truncated mutation region of the APC gene to correct C>T type base mutations and restore the expression of the full-length APC protein.

Benefits of technology

It showed significant inhibition of colorectal cancer cell proliferation and tumor growth both in vitro and in vivo, restored the anti-cancer function of APC, achieved a dual anti-cancer effect, and had no obvious systemic toxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256352A_ABST
    Figure CN122256352A_ABST
Patent Text Reader

Abstract

The application discloses an adenine base editing system for targeting colorectal cancer APC genes, comprising: a) an adenine base editor; and b) an sgRNA specifically combined with the APC gene, wherein the target sequence of the sgRNA is located in a truncated mutation region of the APC gene, and the truncated mutation region is located in the 1286-1513th codon of the APC gene. The adenine base editing system corrects the Q1338 truncated mutation of the APC protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a method for correcting truncated mutations in the APC gene of colorectal cancer using ABE base editing technology and its application in the treatment of colorectal cancer. Background Technology

[0002] Adenine base editor (ABE) is a precision gene editing technology that has emerged in recent years. Developed in 2017 by David Liu's lab at Harvard University, ABE can achieve efficient A>G conversion on the genome, thereby correcting C>T type base mutations. Its mechanism of action involves the ABE protein, guided by sgRNA, locating to the target gene site and unwinding the DNA double strand. The fused adenosine deaminase deaminizes adenosine (A) in a region of the target DNA called the editing window, converting it into the intermediate inosine (I). This intermediate is recognized as guanine (G) during DNA replication, and ultimately, through DNA repair, the AT base pairs on the double-stranded DNA are converted to GC base pairs, thus achieving base editing. Since its introduction, the ABE base editor has demonstrated great potential for application in the treatment of various genetic diseases, including retinal diseases, alpha-1 antitrypsin deficiency, congenital heart disease, cystic fibrosis, beta-thalassemia, and spinal muscular atrophy (SMA).

[0003] Cancer is one of the most significant threats to human life and health, characterized by gene mutations or other alterations in the cellular genome that cause cell growth to deviate from the body's normal regulation. Identifying and intervening in driver genes of specific tumors has become a major goal of cancer research. Currently, 568 cancer driver genes have been identified in 66 different types of cancer tissues. Among them, the adenomatous polyposis coli (APC) gene has the highest mutation rate in colorectal cancer (CRC), which ranks third in global cancer incidence and second in mortality.

[0004] APC is a tumor suppressor gene that encodes a tumor suppressor protein containing multiple functional domains. It is 2843 amino acids long and forms a protein complex with AXIN1 and GSK3β, acting as an antagonist of the WNT signaling pathway. Furthermore, it participates in the regulation of various biological processes, including cell migration and adhesion, transcriptional activation, and apoptosis, in a WNT-independent manner. Defects in the APC gene can lead to familial adenomatous polyposis (FAP), which typically progresses to malignancy. APC gene mutations occur in most colorectal cancers; however, it is noteworthy that most APC mutations do not usually result in complete loss of the APC protein. Studies have found that over 90% of APC mutations involve premature stop codons, leading to C-terminal truncation of the APC protein (Rowan et al., 2000. APC mutations in sporadic colorectal tumors: A mutational "hotspot" and interdependence of the "twohits"). Truncated APC proteins lack binding regions for microtubules, EB1, and β-catenin, and can induce chromosomal instability, promoting tumor cell proliferation and migration while inhibiting differentiation. To address APC truncated mutations, Alona Zilberberg's team used aminoglycosides and macrolides to induce gene readthrough and restore full-length APC protein expression. In mice, this inhibited tumorigenic traits caused by APC truncated mutations (Zilberberg et al., 2010. Restoration of APC gene function in colorectal cancer cells by aminoglycoside- and macrolide-induced readthrough of premature termination codons). However, this method lacks specificity and is limited in clinical application. Jerry W. Shay's team discovered that a small molecule truncated APC selective inhibitor (TASIN-1) can specifically kill tumor cells with truncated APCs without significantly affecting WT APC cells, thereby inhibiting CRC growth (Zhang et al., 2016. Selective targeting of mutant adenomatous polyposis coli (APC) in colorectal cancer).Zhang Jian's research group has developed inhibitors targeting the binding of truncated APC protein to the cancer metastasis target Asef protein, thereby inhibiting CRC metastasis (Jiang et al., 2017. Peptidomimetic inhibitors of APC-Asef interaction block colorectal cancer migration). However, these inhibitors aim to suppress the oncogenic function of truncated APC and cannot restore the normal tumor suppressor function of the APC gene. Currently, there are no clinical drugs or treatments that can effectively correct APC truncated mutations in CRC patients to restore their normal gene function. Therefore, precise, effective, stable, and safe ABE base editing is still needed to correct APC gene truncated mutations (C>T) in colorectal cancer.

[0005] APC gene mutations often occur within a small region called the mutation cluster region (MCR) (codons 1286–1513) (Miyoshi et al., 1992. Somatic mutations of the APC gene in colorectal tumors: mutation cluster region in the APC gene). Most point mutations are C>T type base transitions. When this mutation occurs at the coding sites for glutamine (Q, codon CAG), arginine (R, codon CGA), or tryptophan (W, codon UGG), it can lead to premature termination codons (TAG or TGA), resulting in a C-terminated truncated APC protein. Therefore, using the ABE base editor to correct these C>T type point mutations in the APC gene to restore the expression of the full-length APC protein has significant application value in the field of precision treatment for CRC. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention is the first to apply ABE base editing technology to the therapeutic application research of colorectal cancer.

[0007] Specifically, the first aspect of the present invention provides an adenine base editing system targeting the APC gene in colorectal cancer, comprising: a) an adenine base editor; and b) an sgRNA that specifically binds to the APC gene, wherein the target sequence of the sgRNA is located in a truncated mutation region of the APC gene; preferably, the truncated mutation region is located in codons 1286–1513 of the APC gene.

[0008] In some embodiments, the editor includes: i) an adenine deaminase domain; ii) a DNA-binding protein or a variant thereof.

[0009] In some embodiments, the CRISPR protein is selected from the group consisting of: Cas9, nCas9 (D10A), nCas9 (H840A), dCas9, Cas9-NG, SpG-Cas9, SpRY, xCas9, SaCas9, SaCas9-KKH, CjCas9, Cas12a, Cas12b, Cas12f, or engineered variants of the above proteins that have enhanced specificity or relaxed PAM recognition capabilities.

[0010] In some embodiments, the adenine deaminase is selected from the group consisting of ABE7.9, ABE7.10, ABE8e, ABE8.20, ABE9, or a TadA homolog from prokaryotes, or a derivative variant obtained through phage-assisted evolution that has high activity, high fidelity, or a narrow editing window.

[0011] In some embodiments, the adenine base editing system corrects premature stop codons on APC mutant proteins.

[0012] In some implementations, the correction includes restoring the expression of the full-length APC protein.

[0013] In some embodiments, the adenine base editing system corrects APC protein Q1338. Truncated mutation. Specifically, Q1338... This indicates that the translation of the APC gene terminates at glutamine at position 1338.

[0014] In some embodiments, the sgRNA comprises the nucleotide sequence shown in SEQ ID NO: 1 or 2 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 1 or 2.

[0015] A second aspect of the present invention provides a pharmaceutical composition comprising the adenine base editing system described in the first aspect of the present invention, and a pharmaceutically acceptable delivery carrier.

[0016] In some embodiments, the delivery vector is selected from lipid nanoparticles or adeno-associated virus (AAV).

[0017] A third aspect of the present invention provides a method for in vitro repair of APC gene truncated mutations in colorectal cancer, comprising: using the adenine base editing system described in the first aspect of the present invention in in vitro cells; and correcting the APC truncated mutation.

[0018] In some implementations, the APC truncated mutation is Q1338. Truncated mutation.

[0019] A fourth aspect of the present invention provides a kit for preparing a therapeutic agent for colorectal cancer, comprising: a) the adenine base editing system described in the first aspect of the present invention; and optionally b) instructions for delivering the system to target cells.

[0020] The fifth aspect of the present invention provides the use of the adenine base editing system described in the first aspect of the present invention in the preparation of a medicament for inhibiting colorectal cancer.

[0021] The sixth aspect of the present invention provides an in vitro cell model for inhibiting colorectal cancer by base editing, wherein the truncated mutation of the APC gene in the cell model has been repaired by the method described in the third aspect of the present invention.

[0022] In some implementations, the APC truncated mutation is Q1338. Truncated mutation.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention marks the first application of ABE base editing technology in the treatment of solid tumors (human colorectal cancer). The method of this invention, without introducing exogenous genes, precisely edits the oncogenic truncated APC protein to restore it to the tumor-suppressing full-length APC protein. This removes the tumor-promoting function of the truncated APC protein while simultaneously increasing the tumor-suppressing function of the full-length APC protein, thus achieving a dual tumor-suppressing effect. Attached Figure Description

[0024] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1 Analysis of mutation types in colorectal cancer cell lines. (A) 29 colorectal cancer cell lines containing different types of point mutations in the APC gene from the CCLE database; (B) Nucleotide mutation types in each cell line; (C) Sanger sequencing identification of APC gene mutation Q1338 in the SW480 / SW620 cell line. (CAG to TAG) truncated mutation, while the control cell line HCT116 does not contain the mutation at amino acid position Q1338 of the APC gene; (D)Q1338 A schematic diagram of the mutation resulting in a C-terminal truncated APC protein; (E) sgRNA designed to target the stop codon at position 1338 of the SW480 APC gene mutation site.

[0025] Figure 2ABE base editing successfully corrected the premature stop codon mutation in the APC cell line of SW480. (AC) Sanger sequencing (A) and next-generation sequencing (B, C) verified that co-transferring ABE8e and sgRNA could partially correct the APC truncation mutation in the SW480 cell line, with an efficiency of approximately 30%. (D) Sanger sequencing identified selected monoclonal SW480 cell lines with APC editing. Clone#1 and Clone#2 represent two SW480 cell lines with corrected APC (the same applies below). (E) Western blot detection of APC C-terminal protein, with α-Tublin as an internal control; HCT116 was a positive control for full-length APC protein expression, and WT represented wild-type SW480 cells.

[0026] Figure 3 SW480 cells with APC-edited cells showed significantly decreased proliferation. (AB) EdU incorporation assay for cell proliferation, scale bar at 200 μm; (B) Statistical results of the percentage of cells positive for EdU incorporation staining. P <0.05, P <0.01; (CD) Flow cytometry detection of Ki67, a cell proliferation marker; (D) Statistical results of the percentage of Ki6-positive cells. P <0.0001.

[0027] Figure 4 The expression of WNT signaling pathway-related molecules was reduced in the APC-edited SW480 cell line. (AB) Western Blot and IF were used to detect the β-catenin protein level in the APC-corrected SW480 cell line, with GAPDH as the internal control, F-actin as the cytoskeleton, and WT as wild-type SW480. The scale bar was 50 μm. (C) Western Blot was used to detect the β-catenin protein level in the nucleus and cytoplasm of the SW480 cell line, with W as whole-cell lysate protein, C as cytoplasmic protein, N as nuclear protein, LaminB1 as the nuclear internal control, and α-Tublin as the cytoplasmic internal control. (D) RT-qPCR was used to detect the mRNA levels of CTNNB1 gene, downstream target genes of the WNT signaling pathway (AXIN2, MYC, CCND1, CCND2), and TCF7 / LEF1, with GAPDH as the internal control. ns P > 0.05. P<0.01, P<0.001, P<0.0001; (E) Western Blot was used to detect the protein expression levels of non-phosphorylated β-catenin, MYC, CCND1 and CCND2, with GAPDH as an internal control.

[0028] Figure 5 In vivo delivery of the ABE system induces regression of colorectal cancer xenografts. A. Schematic diagram of the local drug delivery regimen for tumor treatment in the SW480 xenograft mouse model; B. Base editing efficiency of LNP eGFP or LNP ABE8esgRNA in SW480 xenografts; C. Xenograft volume was measured from day 10, and then every 2 days thereafter. Data are expressed as mean ± standard deviation (mean ± SD) (n=5). Two-way ANOVA was used for statistical analysis of differences (p-values ​​are indicated); D. Whole bioluminescence imaging of mice carrying SW480 Luc xenografts treated with LNP eGFP and LNP ABE8esgRNA on day 30 post-transplantation (n=5); E. Bar chart based on Figure D, showing the mean bioluminescence intensity of the two groups. Data are expressed as mean ± standard deviation. Statistical differences were analyzed using a two-tailed unpaired t-test (P-values ​​indicated); F. Mouse weight was recorded starting on day 10 and then every two days until the first mouse reached the ethical endpoint. Data are expressed as mean ± standard deviation (n=7). Statistical differences were analyzed using a two-way ANOVA (P-values ​​indicated); G. Survival curves and complete tumor regression in the SW480 subcutaneous xenograft model after intratumoral LNP treatment (n=7); H. Individual tumor volume changes in the SW480 subcutaneous xenograft model after two intratumoral LNP injections (n=7); I. Off-target rate detection for predicted off-target sites mismatched with sgRNA1 by no more than 3 bases. Detailed Implementation

[0029] Unless otherwise defined, the technical or scientific terms used herein shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains. The terms “first,” “second,” and similar terms used in the specification and claims of this patent application do not indicate any order, quantity, or importance, but are merely used to distinguish different components. Similarly, the terms “an” or “a” and similar terms do not indicate a limitation of quantity, but rather indicate the presence of at least one.

[0030] As used herein, the term "adenine base editor" is an artificially designed gene-editing tool, a fusion protein complex formed by molecular linkages of an adenine deaminase domain, a Cas9 protein or a variant thereof, and a uracil glycosylation inhibitor (UGI). Its function is to directionally deaminate adenine (A) on the target DNA strand using deaminase, converting it to hypoxanthine (I), thereby achieving A→G base substitution during DNA replication or repair, independent of DNA double-strand breaks (DSBs).

[0031] As used herein, the term "sgRNA" is a man-made single-stranded RNA molecule fused together with a CRISPR array (crRNA) and a trans-activating crRNA (tracrRNA) via a linker sequence. It guides an adenine base editor (ABE) or a CRISPR-related protein (such as a Cas9 variant) to specifically recognize and bind to a target DNA site. Its function is to achieve precise localization through complementary pairing of the spacer sequence with the target DNA and to activate the editor's function through the interaction of the tracrRNA domain with the Cas9 protein.

[0032] The term "adenine base editing system" refers to a combination of an adenine base editor, a gene-targeting sgRNA, and a delivery vector, used to achieve precise A→G base editing in cells or organisms. Common delivery vectors for adenine base editing systems include viral vectors (such as AAV), non-viral vectors (such as lipid nanoparticles LNP), or in vitro delivery reagents (such as electrotransduction devices).

[0033] The term "truncated mutation" refers to a genetic variation occurring in the coding region of a gene, resulting in the premature appearance of a stop codon (such as TAA, TAG, or TGA) in the transcribed mRNA, thus producing a truncated protein that is shorter than the normal protein during translation. Such mutations are usually caused by nonsense mutations or frameshift mutations, causing the protein to lose all or part of its function. In this article, the truncated mutation Q1338 in APC is discussed. This indicates that a missense mutation (CAG to TAG) occurred at the glutamine codon at position 1338 of the APC gene, causing premature termination of translation.

[0034] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the described embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0035] Example 1: ABE base editing corrects APC truncated mutations in colorectal cancer cells in vitro To verify that the ABE base editing system can correct APC truncated mutations in colorectal cancer cells in vitro, this embodiment analyzed and organized the mutation information of colorectal cancer cell lines in the CCLE database, screening out 29 colorectal cancer cell lines with only SNV mutations in their APC variants, and the most common base substitution type was C>T ( Figure 1 (AB). Genomic DNA was extracted from in vitro cell culture and amplified by PCR (primer sequences: Primer-F: GGATGTAATCAGACGACACAGGAAGC, SEQ ID NO: 3; Primer-R: GGCTCATCGAGGCTCAGAGCAC, SEQ ID NO: 4). Sanger sequencing revealed that the APC mutation site in the SW480 / SW620 cell line was Q1338. (CAG to TAG) ( Figure 1 CD).

[0036] sgRNAs were designed targeting mutation sites in the SW480 APC gene (exemplary sgRNAs are shown in SEQ ID NO:1 (CCCTACAGTCTGCTGGATTTGG) or SEQ ID NO:2 (ACCCTACAGTCTGCTGGATTTGG), as follows. Figure 1E) ABE8e plasmid and the corresponding sgRNA plasmid were co-transfected in SW480 cells. The transfection conditions were as follows: 200,000 cells per well in a 24-well cell plate, transfected 16-20 hours after plating; transfection was performed in the form of plasmids, with 750 ng of ABE8e plasmid and 250 ng of sgRNA plasmid added to each well, and then transfected with 2 μL of jetPRIME transfection reagent (catalog number: 101000046, Polyplus Inc.). 72 hours after transfection, genomic DNA was extracted from the cells, and the target fragment was amplified by two rounds of PCR and the product was purified. The primers for the first round of PCR were SEQ ID NO: 21 (ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNGGTCAGCTGAAGATCCTGTGAG) and SEQ ID NO: 22 (TGGAGTTCAGACGTGTGCTCTTCCGATCTCTGCTAAACATGAGTGGGGTCTCCTG), and the primers for the second round of amplification were the library construction primers.

[0037] Next-generation sequencing (NGS) was used to detect the base editing effect at the target site. Results showed that the mutation site produced approximately 30% editing (…). Figure 2 AC).

[0038] Single-clone selection and amplification were performed on transfected SW480 cells. The single-clone selection method involved digesting SW480 cells into a single-cell suspension 72 hours after transfection, adjusting the cell density to 50,000 cells / mL, and transferring 2 μL of the cell suspension to 20 mL of complete culture medium. After gentle mixing, 200 μL of the suspension was seeded into each well of a 96-well cell plate. The cells were cultured at 37°C for 12-14 days. Wells showing clear colony formation were amplified under a microscope. Genomic DNA was then extracted, and the target fragment was amplified by PCR. Single-clone verification was performed using Sanger sequencing, ultimately yielding a stable APC-edited SW480 single-clone cell line capable of passaging. Figure 2 D).

[0039] To verify whether the obtained APC gene-edited single-cell clones restored the expression of the full-length APC protein, this example used Western blotting to detect the full-length APC protein in two obtained single-cell lines with corrected APC truncation mutations. The control WT cells were SW480 cells identified as having unedited APC after single-cell selection. The method involved cell culture, extraction of cell proteins using RIPA lysis buffer, Western blotting, incubation with anti-APC C-terminal protein antibody (catalog number: MAB3786, Merck), incubation with fluorescent secondary antibody, and development. The results showed that the full-length APC protein was restored in SW480 cells with corrected APC mutations. Figure 2E). It is evident that ABE base editing technology can be used to correct the Q1338 nucleotide sequence of the APC gene in SW480. Mutation restores the expression of full-length APC protein.

[0040] To investigate the effect of APC editing on the proliferation capacity of SW480 cells, this embodiment performed cell proliferation assays on two monoclonal cell lines with corrected APC truncation mutations. The control WT cells were SW480 cells identified as unedited APC cells through monoclonal selection. The experimental methods employed were an EdU incorporation assay and flow cytometry detection of the proliferation marker Ki67. The EdU incorporation assay involved plating the three cell types mentioned above in this embodiment into 96-well plates, resuspending the cells to 500,000 cells / mL, adding 100 μL of the suspension to each well, and incubating overnight at 37ºC. When the cell density reached approximately 70%, EdU was diluted to 20 µM with complete cell culture medium, and 100 µL of EdU working solution was added to each well. Incubation continued at 37ºC for 3 hours to ensure complete EdU incorporation into the newly synthesized DNA. After Edu labeling, subsequent fixation and staining were performed according to the Edu detection instructions (reagent catalog number: C0017S, Beyotime). Finally, images were taken using a fluorescence microscope, and positive cells were analyzed and counted using ImageJ software. The flow cytometry detection of Ki67 followed these steps: cell counting was performed on each of the three cell types, and 1×10⁻⁶ cells were collected from each. 6 Cells were centrifuged in 1.5 mL EP tubes, the supernatant was discarded, and the cells were washed twice with 1 mL of pre-chilled PBS. Then, 75% ethanol was added dropwise with vortexing, and the cells were fixed overnight at -20°C. The next day, the cells were washed twice again with pre-chilled PBS, and 100 µL of flow cytometry working solution was added to each tube to resuspend the cells. 2 µL of anti-Ki67 antibody conjugated with APC was added, and the cells were incubated at room temperature in the dark for 30 minutes. Afterward, the cells were washed once with PBS, resuspended in 200 µL of flow cytometry working solution, and detected using a BD FACSCanto II flow cytometer. The results were analyzed using FlowJo software, and the percentage of positive cells was calculated. Both detection methods showed that compared with the unedited SW480 monoclonal line (WT), the proliferation capacity of the two edited SW480 monoclonal lines (Clone#1 and Clone#2) was significantly reduced. Figure 3 ).

[0041] To verify the changes in the expression of WNT signaling pathway-related molecules after correcting the APC gene truncation mutation and restoring full-length APC protein expression in SW480 cells, Western blotting, immunofluorescence (IF) assays, and nucleocytic separation experiments were used to verify the altered accumulation levels of β-catenin, a key molecule in the WNT signaling pathway. The anti-β-catenin antibody (catalog number: 8480S, CST) used in Western blotting and IF was diluted 1:1000 and 1:200, respectively. Immunoblotting and immunofluorescence procedures were performed according to the prescribed steps. In Western blotting, GAPDH was used as an internal control. In the IF assay, phalloidin staining indicated the cytoskeleton, DAPI staining indicated the nucleus, and Cy3-anti-Rabbit was used as the secondary antibody to indicate β-catenin protein. The nucleocytic separation experiment was performed according to the kit instructions (catalog number: 78833, Thermo Scientific). After separating the cytoplasmic and nuclear proteins, Western blotting was used to detect changes in the distribution of β-catenin protein in the nucleus and cytoplasm. α-Tublin was used as a cytoplasmic internal control, and LaminB1 as a nuclear internal control. Western blotting, inductively coupled plasma (WB), and nuclear-cytoplasmic separation experiments all showed a significant decrease in the accumulation level of β-catenin, a key molecule in the WNT signaling pathway, and a significant reduction in its nuclear translocation. Figure 4 AC).

[0042] Furthermore, changes in the mRNA accumulation levels of WNT signaling pathway-related genes (CTNNB1, AXIN2, MYC, CCND1, CCND2, TCF7, LEF1) were detected by RT-qPCR. Cellular RNA was extracted and reverse transcribed (catalog number: R323-01, Novizan) to generate cDNA. Real-time quantitative PCR (catalog number: Q331-02, Novizan) was performed using the cDNA as a template to detect gene expression. Primer list is shown in Table 1. Results showed no significant change in the mRNA level of the CTNNB1 gene encoding β-catenin protein. Figure 4 D) The mRNA accumulation levels of downstream target genes (AXIN2, MYC, CCND1, CCND2) of the WNT signaling pathway were significantly reduced, and the TCF7 / LEF1 mRNA accumulation level was also significantly lower than that of wild-type cells. Figure 4D). Changes in the protein levels of non-phosphorylated β-catenin (i.e., active β-catenin, catalog number: 8814S, CST), c-MYC (catalog number: C3956, Merck), CCND1 (catalog number: 2922S, CST), and CCND2 (catalog number: 3741S, CST) were detected by Western blotting, with GAPDH as an internal control. Protein level changes were consistent with mRNA level changes. Figure 4 E).

[0043] Table 1

[0044] Example 2: In vivo delivery of ABE system to induce regression of colorectal cancer xenograft tumors To systematically evaluate the therapeutic effect of lipid nanoparticle (LNP) delivery of ABE8e targeting and repairing the APC gene in colorectal cancer, this study constructed a mouse subcutaneous xenograft model using SW480-Luc cells stably expressing luciferase. An LNP-delivered ABE8e system was constructed by encapsulating ABE8e mRNA and its corresponding modified sgRNA (SEQ ID NO:1), with LNP-encapsulated eGFP mRNA serving as a negative control. The experimental procedure is as follows: Figure 5 As shown in Figure A: First, a xenograft tumor model was established in NOD-SCID mice by subcutaneous injection of SW480-Luc cells. On day 10 post-inoculation (after tumor formation), the tumor-bearing mice were randomly divided into two groups: a treatment group and a control group. LNPs containing ABE8e and sgRNA were administered into the tumors of the mouse models. Given the relatively short half-life of mRNA, a second dose was given on day 7 after the first LNP injection. Each group consisted of 12 mice. On day 2 after the second injection, some mice in each group were sacrificed to collect tumor tissue. Next-generation sequencing was used to analyze the APC gene editing efficiency and DNA off-target effects. Subsequently, tumor volume and mouse weight changes were monitored every two days. In vivo IVIS imaging analysis was performed on day 20 after the first treatment, and observation continued until all mice in the control group reached the humanitarian endpoint. Survival curves for the two groups were plotted.

[0045] Genomic DNA next-generation sequencing analysis of the collected tumor tissues showed that the APC target sites were edited efficiently in vivo, with an editing efficiency ranging from 45% to 93%, and an average efficiency of 71%. Figure 5 (A and 5B). Subcutaneous tumor volume recording and IVIS in vivo imaging results both showed that, compared with the control group, subcutaneous tumor growth was significantly inhibited in mice treated with LNP-delivered ABE8e-sgRNA. Figure 5CE). These results indicate that the LNP-mediated ABE system has a good antitumor effect in vivo, and there was no significant difference in body weight change between the two groups of mice during treatment. Figure 5 E), indicating that this treatment did not cause significant systemic toxicity at the experimental dose. Furthermore, all mice in the LNP-eGFP treatment control group (n = 7) reached the humanitarian endpoint (tumor volume >1500 mm³) approximately before day 60; in contrast, mice in the LNP-ABE8e treatment group showed significantly improved survival, sustained inhibition of tumor growth, and even complete remission (CR, 2 / 7) in some cases. Figure 4-5 Off-target effects are one of the main concerns regarding the in vivo application of gene editing technologies. Therefore, targeted therapies were investigated. APC Potential off-target sites of sgRNA1 (SEQ ID NO: 1) of the gene were identified. Results showed that among 15 off-target sites with 3 or fewer mismatches with sgRNA1 (predicted off-target site information is shown in Table 2), the A-to-G conversion rate was only at the background level. Figure 5 I). This indicates that ABE8e-mediated gene editing is efficient and precise.

[0046] Table 2. Possible off-target site sequences of sgRNA1

[0047] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered illustrative and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the scope of the invention. No reference numerals in the claims should be construed as limiting the scope of the claims.

[0048] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This description is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A system for editing adenine bases targeting the APC gene in colorectal cancer, characterized in that, It comprises: a) an adenine base editor; and b) an sgRNA that specifically binds to the APC gene, wherein the target sequence of the sgRNA is located in a truncated mutant region of the APC gene; preferably, the truncated mutant region is located in codons 1286–1513 of the APC gene.

2. The adenine base editing system according to claim 1, wherein the editor comprises: i) an adenine deaminase domain; ii) a DNA-binding protein or a variant thereof; preferably, the DNA-binding protein is a CRISPR protein, a zinc finger protein, or a transcription activator-like effector (TALE); more preferably, the DNA-binding protein is a CRISPR protein.

3. The adenine base editing system according to claim 2, wherein, (a) The CRISPR protein is selected from the group consisting of: Cas9, nCas9(D10A), nCas9(H840A), dCas9, Cas9-NG, SpG-Cas9, SpRY, xCas9, SaCas9, SaCas9-KKH, CjCas9, Cas12a, Cas12b, Cas12f, or engineered variants of the above proteins that have enhanced specificity or broadened PAM recognition capabilities; and / or (b) The adenine deaminase is selected from the group consisting of: ABE7.9, ABE7.10, ABE8e, ABE8.20, ABE9, or TadA homologs from prokaryotes, or phage-assisted variants that have high activity, high fidelity, or narrow editing windows.

4. The adenine base editing system according to claims 1-3, which corrects premature stop codons on APC mutant proteins.

5. The adenine base editing system of claim 4, wherein the correction comprises restoring the expression of full-length APC protein.

6. A pharmaceutical composition, characterized in that, The invention comprises the adenine base editing system according to any one of claims 1-5, and a pharmaceutically acceptable delivery vector; preferably, the delivery vector is selected from lipid nanoparticles or adeno-associated virus (AAV).

7. A method for in vitro repair of APC gene truncated mutations in colorectal cancer, characterized in that, include: Using the adenine base editing system according to any one of claims 1-5 in vitro cells, APC truncation mutations are corrected.

8. A kit for preparing drugs for the treatment of colorectal cancer, characterized in that, It comprises: a) the adenine base editing system according to any one of claims 1-5; and optionally b) a specification for delivering said system to target cells.

9. The use of the adenine base editing system according to any one of claims 1-5 in the preparation of a medicament for inhibiting colorectal cancer.

10. An in vitro cell model for inhibiting colorectal cancer through base editing, characterized in that, The truncated mutation of the APC gene in the cell model has been repaired by the method described in claim 7.