Use of Hsap_1847317_1SS12GA_R+1 in preparation of product for detecting tumor immunotherapy resistance
By detecting the expression level of Hsap_1847317_1SS12GA_R+1, the problem of predicting immunotherapy resistance in non-small cell lung cancer was solved, enabling highly accurate adjustment of individualized treatment plans and improving patients' quality of life and survival.
Patent Information
- Application Number
- CN202610272492.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-06
- Publication Date
- 2026-06-23
AI Technical Summary
Current technologies lack effective non-invasive molecular markers for predicting immunotherapy resistance in non-small cell lung cancer, leading to drug resistance in patients after treatment. This limits the clinical application value of immune checkpoint inhibitors and increases economic burden and toxic side effects.
Using Hsap_1847317_1SS12GA_R+1 as piRNA, the expression level of Hsap_1847317_1SS12GA_R+1 in the blood of patients was detected by high-throughput sequencing and real-time quantitative polymerase chain reaction technology to predict drug resistance to immunotherapy in non-small cell lung cancer.
The expression of Hsap_1847317_1SS12GA_R+1 is significantly upregulated, exhibiting high sensitivity and specificity. This allows for early identification of immunotherapy resistance, providing a basis for adjusting individualized treatment plans and improving patients' quality of life and survival.
Smart Images

Figure CN122256508A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to the application of Hsap_1847317_1SS12GA_R+1 in the preparation of products for detecting drug resistance to tumor immunotherapy. Background Technology
[0002] The incidence and mortality rates of lung cancer are rising year by year, making it the leading cause of malignant tumors and seriously threatening human health. In recent years, the emergence of immune checkpoint inhibitors has brought a revolutionary breakthrough in the treatment of lung cancer, enabling patients with advanced non-small cell lung cancer (NSCLC) to achieve a 5-year overall survival (OS) of up to 20%. Monoclonal antibodies targeting programmed cell death protein 1 (PD-1) and its ligand 1 (PD-L1) have shown clear therapeutic responses and survival benefits in clinical practice. Currently, PD-1 inhibitors and PD-L1 inhibitors have become the standard first-line treatment for patients with driver gene-negative NSCLC, and some PD-1 and PD-L1 inhibitors have been approved for marketing in lung cancer indications.
[0003] Although PD-1 / PD-L1 inhibitors have achieved significant clinical efficacy in the treatment of NSCLC, their objective response rate remains limited, with only 15-20% of patients achieving a durable treatment response without developing resistance. Most patients develop varying degrees of resistance after receiving immunotherapy, including primary resistance (ineffectiveness upon initial treatment) and acquired resistance (initial effectiveness followed by relapse), ultimately leading to disease progression and treatment failure. This issue severely limits the clinical value of immune checkpoint inhibitors and imposes unnecessary economic burdens and toxic side effects on patients. Therefore, accurately predicting patient responsiveness to immunotherapy before or early in treatment, and identifying potentially beneficial patient populations, is crucial for achieving precision medicine and personalized treatment.
[0004] Recent studies have revealed that non-coding RNAs in exosomes, including long non-coding RNAs (lncRNAs), microRNAs (miRNAs), and circular RNAs (circRNAs), are closely related to the proliferation, migration, invasion, and immunosuppression of various cancers, and can mediate tumor immune escape through multiple mechanisms. Non-coding RNAs in blood have advantages such as ease of detection, minimal invasiveness, and repeatable sampling, and are considered highly promising non-invasive tumor markers with significant clinical translational value. piRNAs are very stable and not easily degraded by ribonucleases; piRNAs are also considered promising diagnostic biomarkers for human malignancies (such as colon cancer, breast cancer, and lung cancer). However, systematic research on specific piRNA biomarkers for predicting immunotherapy resistance in NSCLC is currently lacking. Therefore, it is necessary to further explore and identify non-invasive molecular biomarkers that can effectively predict immunotherapy resistance in non-small cell lung cancer, providing a scientific basis for personalized precision treatment in clinical practice. Summary of the Invention
[0005] The main objective of this invention is to propose the application of Hsap_1847317_1SS12GA_R+1 in the preparation of products for detecting tumor immunotherapy resistance, aiming to provide a non-invasive molecular marker that can effectively predict immunotherapy resistance in non-small cell lung cancer, thereby achieving the goal of personalized precision treatment.
[0006] To achieve the above objectives, this invention proposes the application of Hsap_1847317_1SS12GA_R+1 in the preparation of products for detecting resistance to tumor immunotherapy, wherein the immunotherapy is immune checkpoint inhibitor therapy, and the nucleotide sequence of Hsap_1847317_1SS12GA_R+1 is shown in SEQ ID NO.1.
[0007] Preferably, the detection product is any one of in vitro diagnostic reagents, reagent kits, and detection systems.
[0008] Preferably, the immune checkpoint inhibitor is a PD-L1 inhibitor or a PD-1 inhibitor.
[0009] Preferably, the immunotherapy resistance includes primary resistance and / or secondary resistance.
[0010] Preferably, the test samples for the product include at least one of tissue samples, cell samples, body fluid samples, and excrement.
[0011] Preferably, the body fluid sample includes at least one of blood, lymph, cerebrospinal fluid, and pleural effusion.
[0012] Preferably, the sample to be tested is a blood sample.
[0013] The present invention also proposes a biomarker for predicting or assisting in the diagnosis of PD-1 inhibitor immunotherapy resistance in non-small cell lung cancer, the biomarker being Hsap_1847317_1SS12GA_R+1, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0014] Preferably, the expression level of Hsap_1847317_1SS12GA_R+1 in the blood of patients resistant to immunotherapy is significantly higher than the expression level in the blood of patients before immunotherapy resistance.
[0015] The present invention also proposes a kit for detecting resistance to PD-1 inhibitor immunotherapy in non-small cell lung cancer, the kit comprising reagents for specifically detecting the expression level of Hsap_1847317_1SS12GA_R+1, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) In the technical solution provided by this invention, through a systematic three-stage research process of screening-training-validation, Hsap_1847317_1SS12GA_R+1 was found to be closely related to immunotherapy resistance in non-small cell lung cancer for the first time, and it was confirmed that it can serve as a highly efficient detection biomarker. The results showed that the expression level of Hsap_1847317_1SS12GA_R+1 was significantly upregulated by about 10-fold in the blood of patients after immunotherapy resistance (P<0.0001), demonstrating excellent statistical significance. Furthermore, ROC curve analysis verified that Hsap_1847317_1SS12GA_R+1 has excellent clinical diagnostic performance: the AUC is as high as 0.944, the specificity is 0.94, and the sensitivity is 0.84, providing a high-precision molecular biomarker for the early identification of tumor immunotherapy resistance, filling the gap in the field of lack of reliable predictive tools.
[0017] (2) By monitoring the Hsap_1847317_1SS12GA_R+1 level, clinicians can promptly detect trends in immunotherapy resistance, providing objective evidence for adjusting treatment plans and optimizing medication strategies. This avoids delaying treatment and incurring unnecessary economic burdens for patients due to continuous use of ineffective drugs. This invention provides a powerful tool for achieving personalized precision medicine in immunotherapy for non-small cell lung cancer, and is of great significance for improving patients' quality of life and prolonging their survival. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 This figure shows the expression of Hsap_1847317_1SS12GA_R+1 before and after resistance to immunotherapy in non-small cell lung cancer during the training phase of this invention.
[0020] Figure 2 This is a graph showing the expression of Hsap_1847317_1SS12GA_R+1 before and after resistance to immunotherapy in non-small cell lung cancer during the verification phase of this invention.
[0021] Figure 3 This is a graph showing the ROC curve results during the verification phase of this invention.
[0022] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation
[0023] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially. Furthermore, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0024] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.
[0025] Example 1: Subject Sample Collection Blood samples were collected from patients with non-small cell lung cancer (NSCLC) who developed PD-1 inhibitor resistance at the Department of Thoracic Oncology, Second Affiliated Hospital of Zunyi Medical University, between October 2020 and July 2023. Three groups of blood samples were collected before and after PD-1 inhibitor resistance was used for screening with Illumina high-throughput sequencing (RAN-seq); three groups were used for training to detect differential piRNA expression; and 50 groups were used for validation to verify the significance of differential piRNA expression. This human blood sample experimental study was approved by the Ethics Committee of the Second Affiliated Hospital of Zunyi Medical University, and informed consent was obtained from all participants and their families.
[0026] Immunotherapy resistance criteria: In the treatment population, resistance is divided into primary resistance and secondary resistance. Primary resistance refers to patients who have never achieved clinical benefit after receiving immunotherapy, specifically: treatment duration ≥ 6 weeks, with the best response being progressive disease (PD) or stable disease (SD) (maintenance time < 6 months). Secondary resistance refers to patients who initially achieved clinical benefit after receiving immunotherapy, but subsequently experienced disease progression, specifically: treatment duration ≥ 6 months, with the best response initially achieving complete remission (CR) or partial remission (PR), or stable disease (SD ≥ 6 months), followed by disease progression (PD) after maintaining clinical benefit for 6 months or longer.
[0027] Inclusion criteria: Patients with non-small cell lung cancer diagnosed by pathology or cytology, older than 18 years, and able to receive PD-1 inhibitor therapy, regardless of treatment stage (treatment-naïve, post-relapse, etc.). Clinical characteristics of the subjects are shown in Table 1.
[0028] Note: The screening phase refers to the same patient before and after drug resistance, while the training and validation phases refer to different patients before and after drug resistance.
[0029] Example 2: Screening of piRNA biomarkers In the initial screening stage, blood samples from three patients with non-small cell lung cancer (NSCLC) before immunotherapy resistance and three patients with NSCLC after immunotherapy resistance were randomly selected for Illumina high-throughput sequencing (performed by Heyuan Biotechnology (Shanghai) Co., Ltd.). The experimental procedure was performed according to the standard steps provided by Illumina, including library preparation and sequencing experiments. Small RNA sequencing library preparation was performed using TruSeq Small RNA Sample Prep Kits (Illumina, San Diego, USA). First, a truncated T4 RNA ligase 2 (T4RNA Ligase 2) was used to sequentially ligate an adenylated single-stranded DNA 3' adapter and 5' adapter to small RNA. The 5' end of the 3' adapter is rAPP, and the 3' end is amino-protected, which can reduce the self-ligation of small RNA. The truncated T4 RNA ligase 2 does not require ATP during the ligation reaction, only the pre-adenylated adapter, thus reducing the self-ligation of small RNA and adapter sequences. The 5' adapter was designed to capture small RNA with a 5' phosphate group. Small RNA sequences with 5' and 3' linkers were reverse transcribed using RT primers complementary to the 3' end, followed by PCR amplification of cDNA sequences. The PCR product, approximately 150 bp in length, was recovered using a 6% polyacrylamide Tris-borate-EDTA gel, completing library preparation. The constructed library was sequenced using an Illumina HiSeq 2000 / 2500, with single-end reads of 1 x 50 bp. The raw sequences were quality-scored using Illumina's built-in standards, obtaining Q30 data with a quality score of ≥30. Impure sequences (N-characteristic sequences) resulting from sample preparation, sequencing adapters, and optical digital processing by the sequencing instrument were cleaned up, and compared against common RNA sequences (such as mRNA sequences, RFam (rRNA, tRNA, snRNA, snoRNA) and repetitive sequences) to remove identical sequences. Subsequently, length selection was performed, retaining sequences in the 25-37 nt range. In the analysis, the lengths of the 5' and 3' ends and the presence of two mismatches within the sequence are allowed. The obtained sequence data are compared with the piRNA database (https: / / www.smallrnagroup.uni-mainz.de / ). The piRNAs that can be perfectly matched are the known reported piRNAs. If the detected sequence meets the following criteria: 1) it can be aligned to the genome sequence of this species only once; 2) the length is between 25-37 nt; 3) the first base is T; 4) the copy number is greater than 3 in at least one sample; then these sequences are newly predicted piRNAs.Among the high-quality known candidate piRNAs obtained, Hsap_1847317_1SS12GA_R+1 (the sequence of Hsap_1847317_1SS12GA_R+1 is TGAACGCGCCCGATCTCGTCTGATC, SEQ ID NO.1) was selected for verification. Hsap_1847317_1SS12GA_R+1 refers to the sequence Hsap-1847317 recorded in miRBase, which has one extra base on the right end compared to this sequence, with the 12th base replaced by an A instead of a G.
[0030] Example 3: Validation of piRNA biomarkers During the training phase, blood samples from three patients with non-small cell lung cancer before and three patients with non-small cell lung cancer after developing immune resistance were selected. Quantitative real-time polymerase chain reaction (qRT-qPCR) was used to validate the candidate piRNAs screened in the initial screening phase, confirming differences in the expression of Hsap_1847317_1SS12GA_R+1.
[0031] During the validation phase, qRT-qPCR technology was used to re-validate the expression of Hsap_1847317_1SS12GA_R+1 in another independent set of samples (validation set, including blood samples from 50 NSCLC patients before and after resistance to PD-1 inhibitor immunotherapy).
[0032] Sample preparation and PCR detection were performed as follows: 1) Blood Sample Preparation 1) Draw 5 mL of whole blood using a lancet and EDTA anticoagulant tube, gently invert to mix, store at 4 ℃, and proceed to the next step within 1 hour. 2) Transfer the extracted whole blood into a 15 mL centrifuge tube, add 2 volumes of RNAiso Plus to the sample, invert and mix 15 times, and let stand on ice for 10 min. 3) Place the samples symmetrically into a centrifuge at 4 ℃ and centrifuge at 12000 rpm for 10 min; 4) Gently aspirate the supernatant and transfer it into a new EP tube.
[0033] II) Total RNA Extraction 1) Add RNA extraction auxiliary reagent (purchased from Guangzhou Saiguo Biotechnology Co., Ltd.) to the supernatant at a ratio of 5:1, mix thoroughly until the solution turns milky white, and let stand on ice for 15 minutes; 2) Place the samples symmetrically into a centrifuge at 4 ℃ and centrifuge at 12000 rpm for 10 min; 3) Remove the EP tube. You will see that it consists of three layers: the bottom organic phase is dark, the middle protein layer is white, and the supernatant (containing RNA) is transparent. 4) Aspirate the supernatant into a new EP tube in small, repeated amounts; 5) Add isopropanol to the supernatant, with a volume of 0.5 times that of RNAiso Plus. Invert the EP tube to mix thoroughly and let it stand on ice for 10 minutes. 6) Centrifuge at 12000 rpm for 10 min at 4 ℃. A white precipitate (i.e., total RNA) will appear at the bottom of the EP tube. 7) Carefully tilt the EP tube and discard the supernatant; prepare 75% ethanol with anhydrous ethanol and RNase-free DEPC water at a ratio of 3:1, add 1 mL to the EP tube, and wash the EP tube wall by inverting it. 8) Centrifuge at 7500 rpm for 5 min at 4℃; 9) Repeat steps 7)-8) once; 10) Place the EP tube in a vent to dry the RNA precipitate for 15 min, add 20 μl of RNase-free DEPC water to dissolve the RNA, measure the concentration with a spectrophotometer, and store it in a -80℃ freezer.
[0034] (iii) Reverse transcription 1) Primer dilution: Take Bulge-Loop™ miRNA RT Primer (20μM) (Guangzhou Ruibo Biotechnology Co., Ltd., C10211), add an appropriate amount of RNase-free H2O, and prepare Bulge-Loop™ miRNA RT Primer (5μM). 2) Reaction conditions: After mixing the reaction system according to Table 2, centrifuge briefly. The reaction program is: 42℃ for 60 minutes, 70℃ for 10 minutes.
[0035] Table 2 Reverse transcription reaction system (prepared on ice) Note: 1) The use of internal reference primer U6 is consistent with the miRNA detection method; 2) Each miRNA and internal reference U6 requires separate reverse transcription.
[0036] IV) piRNA detection 1) Primer design: The internal reference primers U6 and human Hsap_1847317_1SS12GA_R+1 required for the experiment were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd.
[0037] 2) RT-PCR: The cDNA obtained in step 3) is used for PCR amplification reaction, strictly following the reagent Bulle-Loop procedure. TM Follow the instructions in the miRNA qRT-PCR Starter Kit manual, and perform the detection according to the reaction system in Table 3 and the reaction procedure in Table 4. Perform 3 replicates for each sample.
[0038] Note: The U6 internal reference was tested using the U6 Reverse Primer.
[0039] Example 4: Detection Results During the screening phase, the top 5 differentially expressed piRNAs from the high-throughput sequencing data were selected, and preliminary validation was performed during the training phase. Differential expression of Hsap_1847317_1SS12GA_R+1 was found. Results are as follows... Figure 1 As shown, compared with the control group before drug resistance, the expression level of Hsap_1847317_1SS12GA_R+1 in non-small cell lung cancer after immunotherapy resistance was significantly upregulated by about 10-fold (P=0.001), and the trend was consistent with the sequencing results.
[0040] In the validation phase, this invention further validated the significance of Hsap_1847317_1SS12GA_R+1 expression in an independent validation set (including blood samples from 50 NSCLC patients before and after resistance to PD-1 inhibitor immunotherapy). The results are as follows: Figure 2 As shown, compared with the control group before resistance, the expression level of Hsap_1847317_1SS12GA_R+1 was significantly upregulated by approximately 6-fold in a large sample of non-small cell lung cancer patients who had developed resistance to immunotherapy (P < 0.0001). Furthermore, ROC curves (receiver operating characteristic) were used, and the AUC (area under the curve) was used to validate the predictive performance of this lung cancer immunotherapy resistance-specific clinical indicator. Results are as follows... Figure 3 As shown in Table 5, the AUC of Hsap_1847317_1SS12GA_R+1 in the validation phase was 0.944, the maximum Yoden index was 0.78, the specificity was 0.94, and the sensitivity was 0.84, indicating that Hsap_1847317_1SS12GA_R+1 can be used as a biomarker for detecting resistance to tumor immunotherapy (P < 0.001).
[0041] The outcome variable to be tested is piRNA expression level. The outcome variable piRNA expression level must have at least one binding value between the positive and negative real-state groups.
[0042] a. Assuming nonparametric properties; b. Null hypothesis: True region = 0.5.
[0043] The above results indicate that Hsap_1847317_1SS12GA_R+1 has high predictive efficacy and clinical application value, and can serve as a potential novel biomarker for non-small cell lung cancer patients who have developed resistance to immunotherapy, thereby enabling individualized and visualized prediction of the status of non-small cell lung cancer patients who have developed resistance to immunotherapy.
[0044] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention.
Claims
1. The application of Hsap_1847317_1SS12GA_R+1 in the preparation of products for detecting resistance to tumor immunotherapy, characterized in that, The immunotherapy is an immune checkpoint inhibitor therapy, and the nucleotide sequence of Hsap_1847317_1SS12GA_R+1 is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The testing product can be any one of in vitro diagnostic reagents, reagent kits, or testing systems.
3. The application according to claim 1, characterized in that, The immune checkpoint inhibitor is a PD-L1 inhibitor or a PD-1 inhibitor.
4. The application according to claim 1, characterized in that, The immunotherapy resistance includes primary resistance and / or secondary resistance.
5. The application according to claim 1, characterized in that, The test samples for the product include at least one of the following: tissue samples, cell samples, body fluid samples, and excrement.
6. The application according to claim 5, characterized in that, The body fluid sample includes at least one of blood, lymph, cerebrospinal fluid, and pleural effusion.
7. The application according to claim 6, characterized in that, The sample being tested is a blood sample.
8. A biomarker for predicting or assisting in the diagnosis of resistance to PD-1 inhibitor immunotherapy in non-small cell lung cancer, characterized in that, The biomarker is Hsap_1847317_1SS12GA_R+1, and its nucleotide sequence is shown in SEQ ID NO.
1.
9. The biomarker according to claim 8, characterized in that, The expression level of Hsap_1847317_1SS12GA_R+1 in the blood of patients resistant to immunotherapy was significantly higher than that in patients before immunotherapy resistance.
10. A kit for detecting resistance to PD-1 inhibitor immunotherapy in non-small cell lung cancer, characterized in that, The kit includes reagents for the specific detection of Hsap_1847317_1SS12GA_R+1 expression levels, the nucleotide sequence of which is shown in SEQ ID NO.1.