A protein expression vector and a method for enhancing the expression activity of membrane proteins

By constructing the start-stop degenerate codon TCGGATCCGAATTCATGA on a protein expression vector, protein expression was restarted using ribosome translocation, which solved the problems of host strain growth inhibition and low catalytic activity caused by membrane protein expression in traditional methods, and achieved a significant improvement in membrane protein expression activity.

CN122256389APending Publication Date: 2026-06-23SUZHOU LEAD BIOTECH CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SUZHOU LEAD BIOTECH CO LTD
Filing Date
2024-12-23
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Traditional inducible protein overexpression protocols lead to host strain growth inhibition and central metabolic disorders. Furthermore, the expression process of membrane proteins generates numerous inclusion bodies with low catalytic activity. Existing translation-coupling strategies exhibit significant differences in expression effects for different types of membrane proteins.

Method used

By constructing the start-stop degenerate codon TCGGATCCGAATTCATGA on a protein expression vector, protein expression was restarted using ribosome translocation, significantly reducing the protein expression rate, providing sufficient time for membrane protein folding and anchoring, and enhancing membrane protein expression activity.

Benefits of technology

It significantly improves the expression activity and overall expression level of membrane proteins, reduces the adverse effects of traditional induction expression protocols, and is applicable to a variety of membrane protein expression systems.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005203529100000121
    Figure BDA0005203529100000121
  • Figure BDA0005203529100000131
    Figure BDA0005203529100000131
  • Figure BDA0005203529100000141
    Figure BDA0005203529100000141
Patent Text Reader

Abstract

The present application is based on the principle of protein termination-restart translation of ribosome shift, and provides a cloning method which can be used for improving the expression activity of membrane protein. The method is to construct a start-termination degenerate codon on a protein expression vector, and to restart the protein expression by using the ribosome shift phenomenon after the accidental termination of protein expression, so as to significantly reduce the protein expression rate, provide sufficient time for the folding and anchoring of membrane protein, and significantly improve the cloning method of membrane protein expression activity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a gene expression vector and a method for enhancing the expression activity of membrane proteins. Background Technology

[0002] Membrane proteins are proteins found in biological membranes, playing a crucial role in their function. They mainly include glycoproteins, carrier (channel) proteins, and enzymes, and can be classified into peripheral membrane proteins, integrated membrane proteins, and lipid-anchored proteins, accounting for approximately 30% of the total coding in the genome. As common immune recognition proteins and catalytically active components, the high-activity overexpression of membrane proteins is of great significance in fields such as biocatalysis.

[0003] Traditional inducible protein overexpression protocols have been widely used for recombinant protein expression, but overexpression of membrane proteins often leads to growth inhibition and central metabolic disorders in the host strain, and the expression burden varies with the type and level of the overexpressed protein. To address the challenge of membrane protein expression, the study "Susan, S. et al. Optimizing membrane protein overexpression in the Escherichia coli strain Lemo21(DE3). Journal of Molecular Biology. 2012, 423, 4, 648-659" constructed a Lemo21(DE3) strain containing a plasmid encoding a T7 lysozyme (an inhibitor of T7 RNAP) gene under the control of a rhamnose promoter. By regulating T7 RNA polymerase activity through T7 lysozyme, the ratio of correctly inserted membrane proteins to those not inserted into the cytoplasmic membrane was optimized to increase membrane protein production and reduce the adverse effects of overexpression. The study also included "Dumon-Seignovert, L. et al. The toxicity of recombinant proteins in Escherichia coli: a comparison of overexpression in BL21(DE3), C41(DE3) and C43(DE3). Protein Expression and...". “Purification. 2004, 37, 203–206.” The C43(DE3) strain was obtained through screening. Mutations in its genome enabled the C43(DE3) host to efficiently express toxic and membrane proteins. However, the two expression strategies mentioned above showed different effects on the expression of different types of membrane proteins, and the expression process of membrane proteins generated more inclusion bodies, resulting in relatively low overall catalytic activity.

[0004] In molecular biology, translational coupling primarily refers to the physical or functional link between the translation processes of one gene and another in prokaryotes (such as bacteria). This link allows the expression of multiple genes to be coordinated, typically within the same operon. An operon is a unit of gene expression regulation in prokaryotes, containing multiple functionally related genes that are transcribed as a whole into a polycistronic mRNA. Translational coupling ensures the synthesis of multiple functionally related proteins in appropriate proportions. In cellular metabolism, many enzymes work together. For example, in metabolic pathways, if a series of enzymes are encoded by different genes within the same operon, translational coupling can ensure the synthesis of these enzymes in appropriate amounts, guaranteeing efficient metabolic pathways and preventing the accumulation of intermediate products or interruption of a step due to enzyme deficiency. Through the start-stop codon degeneracy TE-RE (termination-restart translation) mechanism (ATGA and TGATG types, with ATGA being the most common), ribosome translocation occurs, thereby introducing translational coupling and enabling the regulation of downstream protein expression in prokaryotes. The expression of the downstream sequence requires the presence of an SD-like sequence near the C-terminus of the upstream sequence for significant downstream protein expression. The termination-restart translation mechanism is as follows... Figure 1 As shown.

[0005] Taking the cloning construction of pET-27b(+) vectors as an example, when using EcoRI cut sites, it is usually necessary to add an extra base before the target gene sequence during primer design to ensure that the target gene expression process is normal. Summary of the Invention

[0006] To address the aforementioned issues, this invention provides a cloning method for enhancing membrane protein expression activity based on the protein termination-restart translation principle of ribosome translocation. This method involves constructing start-stop degenerate codons on a protein expression vector and restarting protein expression by utilizing ribosome translocation after unexpected termination of expression. This significantly reduces the protein expression rate, providing sufficient time for membrane protein folding and anchoring, thereby significantly enhancing membrane protein expression activity.

[0007] Based on this, the present invention provides a membrane protein expression vector, wherein the membrane protein expression vector is a recombinant plasmid with termination-restart translation characteristics, and the recombinant plasmid contains the TCGGATCCGAATTCATGA sequence.

[0008] Furthermore, the TCGGATCCGAATTCATGA sequence is introduced using an EcoRI restriction site via a primer, which does not add any extra bases before the target gene sequence.

[0009] Furthermore, the recombinant plasmid is a pET plasmid; preferably pET-27b(+) or pET-20b(+).

[0010] Furthermore, the membrane protein is selected from: glycoproteins, carrier (channel) proteins, or enzymes, such as amino acid deaminases.

[0011] Another aspect of the present invention provides a method for enhancing the expression activity of membrane proteins, the method comprising: constructing a recombinant plasmid as described above, transfecting the recombinant plasmid into a host cell, and inducing the host cell to overexpress the membrane protein.

[0012] Furthermore, the step of constructing the recombinant plasmid as described above includes:

[0013] The double-digested pET plasmid and the product of PCR amplification using the target membrane protein gene as a template were cloned and ligated. The PCR amplification product was obtained by amplification using an upstream primer sequence containing the CGGATCCGAATTCATG sequence and a downstream primer sequence.

[0014] Furthermore, the double enzyme digestion sites are EcoRI and HindIII.

[0015] The special sequence discovered in this invention that enhances the expression activity of membrane proteins does not require additional bases at the EcoRI cleavage site of plasmids such as pET-27b(+), forming the aforementioned nucleotide sequence TCGGATCCGAATTCATGA. Using the cloning method proposed in this invention, the expression of catalytically active membrane proteins with the initiating ATGA nucleotide sequence introduced after the EcoRI cleavage site in protein expression vectors such as pET-27b(+) can be significantly improved. The overall expression level is controlled, and the activity is significantly enhanced compared to traditional induction expression schemes that lack termination-restart translation characteristics in various modified hosts. Furthermore, this method is applicable to various membrane protein expression systems.

[0016] Instruction manual illustrations

[0017] Figure 1 A diagram illustrating the termination-restart translation mechanism.

[0018] Figure 2 The images were verified by SDS-PAGE protein gel electrophoresis after collecting different induced expression bacteria.

[0019] Figure 3 The image shows the SDS-PAGE protein gel electrophoresis results after the bacteria were collected to verify the expression. Detailed Implementation

[0020] To provide a clearer understanding of the technical features, objectives, and effects of the present invention, specific embodiments of the present invention are now described.

[0021] Example 1: Materials and Methods

[0022] Reagents: DNA polymerase (PrimeSTAR Max DNA Polymerase) and DpnI endonuclease were purchased from TaKaRa; plasmid extraction kit was purchased from Axygen; L-valine was purchased from Shanghai Macklin, catalog number L820396-100g; L-glutamate monosodium glutamate was purchased from Aladdin, catalog number S108801-50g; L-leucine was purchased from Aladdin, catalog number L104898-25g; tris(hydroxymethyl)aminomethane was purchased from BioFroxx, catalog number 1115GR500; 2,4-dinitrophenylhydrazine (DNPH) was purchased from Aladdin, catalog number D112074-25g; sodium ketoisovalerate was purchased from Bid Pharmaceutical, catalog number BD174285; α-ketoglutarate was purchased from Aladdin, catalog number K105571-100g; α-ketoisocaproic acid was purchased from Shanghai Macklin, catalog number M813122-5g.

[0023] Vectors and strains: The expression vectors used were pET-27b(+), pET-20b(+), and pET-28a(+). The plasmids were purchased from Novagen. The host cells used were Escherichia coli BL21(DE3), purchased from Tiangen Biotech (Beijing) Co., Ltd.

[0024] Sequencing and primer synthesis were completed by Suzhou Hongxun Biotechnology Co., Ltd.; gene synthesis was completed by General Biotechnology.

[0025] LB medium: 10g peptone, 5g yeast extract, 10g sodium chloride, distilled water to a final volume of 1L.

[0026] Protein expression: The aforementioned single colonies were activated on LB agar medium, and then single colonies were inoculated into LB liquid medium (containing 50 mg / L kanamycin) and incubated at 37°C with shaking for 12 h. 1 mL of the culture was transferred to 50 mL of fresh LB liquid medium (containing 50 mg / L kanamycin) and incubated at 37°C with shaking until the OD600 reached approximately 0.6. IPTG (final concentration 0.1 mM) was then added and incubated at 25°C for 12 h to induce protein expression.

[0027] Enzyme activity assay system: The final concentration of L-amino acids in the reaction solution is 5 g / L. Typically, 250 mg of L-amino acids is weighed and dissolved in 49 mL of pH 9.0 20 mM Tris-HCl buffer, and vortexed until completely dissolved. The reaction vessel is a 5 mL centrifuge tube. Before the reaction, place a rotor (olive-shaped, 3 mm in diameter, 6 mm in length) in each tube and dispense 980 μL of the above reaction solution. Turn on the thermostatic magnetic stirrer and set the temperature to 30 °C. After the temperature reaches the set value, add 20 μL of the mixed enzyme fermentation broth to each tube. Place the centrifuge tube on a float plate, keep the cap open, and place it in a thermostatic water bath to start the reaction. Set the rotation speed to 800 rpm. The reaction time is 30 min.

[0028] Colorimetric system: Weigh 40 mg of 2,4-dinitrophenylhydrazine into an Erlenmeyer flask, add 5 mL of concentrated hydrochloric acid, then add 95 mL of water and sonicate to dissolve. Prepare a 10 g / L keto acid stock solution corresponding to the oxidation of the tested L-amino acids. The standard curve concentrations are 0 / 0.01 / 0.05 / 0.1 / 0.15 / 0.2 / 0.5 g / L keto acids. Stepwise dilute the keto acid stock solution to the corresponding concentrations for later use. After the above reaction system has reacted for 30 min, pour the reaction solution from a 5 mL centrifuge tube into a 2 mL centrifuge tube and centrifuge. Take 200 μL of the supernatant and dilute it 5 times in 800 μL of water. Aliquot the diluted reaction solution into clean microplates, 200 μL per well. At the same time, aliquot the keto acid standard curve solution into microplates, 200 μL per well. Dispense 150 μL of 2,4-dinitrophenylhydrazine chromogenic solution into each blank well. Transfer 20 μL of reaction solution and standard curve to the chromogenic solution. Shake at 1200 rpm for at least 1 min. After shaking, transfer 30 μL of 10M NaOH to each well using a multi-pipe syringe. Shake at 1200 rpm for at least 1 min. A color change will occur in the chromogenic solution at this point. Set the microplate reader to fixed-point reading at a wavelength of 520 nm. After shaking, take the reading and compare with the standard curve to obtain the enzyme activity of the fermentation broth. The chromogenic system is shown in Table 1.

[0029] Table 1

[0030] Colorimetric system Mother liquor concentration Add volume of 200 μL to the system DNPH 0.4g / L 150μL reaction solution / 20μL NaOH 10M 30μL

[0031] Example 2: Construction of recombinant plasmids with a cloning scheme featuring termination-restart translation characteristics

[0032] The amino acid deaminase used in this embodiment is derived from *Proteus myxofaciens*, named PmyxoLAAD (Uniprot accession number A0A158RFS7), with its amino acid sequence shown in SEQ ID NO:1, its nucleotide sequence shown in SEQ ID NO:2, and its codon-optimized nucleotide sequence shown in SEQ ID NO:3. The pET28a-PmyxoLAAD gene (codon-optimized, nucleotide sequence SEQ ID NO:3) was directly synthesized from universal biosynthesized vector into the pET28a(+) vector, with NdeI / HindIII restriction sites. The primers used for gene extraction are shown in Table 2. Using pET27b plasmid as a template, the pET27b plasmid was double-digested with restriction endonucleases NdeI and HindIII, and the digestion product P1 was purified and recovered. Primers 27b-PmyxoLAAD-F and PmyxoLAAD-R were designed, and PCR amplification was performed using the aforementioned PmyxoLAAD gene (SEQ ID No:3) as a template, with the addition of 0.05mM or 0.1mM Mn2+. The PCR amplification product P2 was purified and recovered. P1 and P2 were cloned and ligated using a seamless cloning kit from Langjing, and the products were transformed into E. coli DH5α, plated on LB agar medium (containing 50 mg / L kanamycin), and single colonies were cultured in LB liquid medium (containing 50 mg / L kanamycin). After colony PCR screening and sequencing verification, the recombinant plasmid pET27b-PmyxoLAAD was obtained. This recombinant plasmid is a cloning scheme containing the special sequence TCGGATCCGAATTCATGA, which has termination-restart translation characteristics.

[0033] Example 3: Construction of recombinant plasmids for cloning schemes without termination-restart translation characteristics

[0034] Using the same protocol, double-digested pET20b(+) or pET27b(+) was used as fragment ①. The PCR products amplified by primers 20b / 27b-PmyxoLAAD-gF and PmyxoLAAD-R, which have an additional base g, were used as fragment ②. Cloning and ligation were performed using a seamless cloning kit to obtain recombinant plasmids pET20b-g-PmyxoLAAD and pET27b-g-PmyxoLAAD. The special sequence TCGGATCCGAATTCATGA in the corresponding plasmid and pET28a-PmyxoLAAD plasmid was destroyed by the additional base g, becoming TCGGATCCGAATTCgATGA. Neither of them has the termination-restart translation characteristic cloning protocol. The primers for constructing the PmyxoLAAD plasmid are shown in Table 2.

[0035] Table 2

[0036] Primer name Primer sequence 27b-PmyxoLAAD-F CGGATCCGAATTCATGAACATCAGCCG 20b / 27b-PmyxoLAAD-gF CGGATCCGAATTCgATGAACATCAGCCG PmyxoLAAD-R GCGGCCGCAAGCTTTTATTTTTTAAAGCG

[0037] Example 4: Construction of plasmid for validation of the termination-restart translation feature cloning scheme:

[0038] The amino acid deaminases used in this embodiment are derived from Proteus vulgaris and Proteus mirabilis, and are named PvLAAD (NCBI reference sequence WP_198624437) and PmirLAAD (Uniprot accession number A0A2P1DPZ3), respectively. Their amino acid sequences are shown in SEQ ID NO:4 and 5, and their nucleotide sequences are shown in SEQ ID NO:6 and 7, respectively. Referring to the schemes in Examples 3 and 4, plasmids pET27b-PvLAAD and pET27b-PmirLAAD, which introduce the special sequence TCGGATCCGAATTCATGA and possess translation termination-restart characteristics, and plasmids pET28a-PvLAAD, pET20b-g-PvLAAD, pET27b-g-PvLAAD, pET28a-PmirLAAD, pET20b-g-PvLAAD, and pET27b-g-PvLAAD, which do not possess the corresponding characteristics, were obtained. The primers for constructing the PvLAAD and PmirLAAD plasmids are shown in Table 3.

[0039] Table 3

[0040] Primer name Primer sequence 27b-PvLAAD-F CGGATCCGAATTCatgaaaatttcaag 20b / 27b-PvLAAD-gF CGGATCCGAATTCgatgaaaatttcaag PvLAAD-R CGGCCGCAAGCTTttatttcttaaaa 27b-PmirLAAD-F CGGATCCGAATTCatgaacatttcaag 20b / 27b-PmirLAAD-gF CGGATCCGAATTCgatgaacatttcaag PmirLAAD-R CGGCCGCAAGCTTttacttcttaaaa

[0041] Example 5: Corresponding plasmid expression and activity assay

[0042] Following the protocol of Example 1, the above plasmids were induced for expression and their activity was measured. For plasmids with specific cloning methods, the IPTG concentration of the inducer was verified (gradients of 0.01 mM, 0.05 mM, 0.1 mM, and 0.2 mM). The substrate for PmyxoLAAD was L-valine, and the standard curve was α-ketoisovalerate; the substrate for PvLAAD was L-leucine, and the standard curve was α-ketoisocaproic acid; the substrate for PmirLAAD was L-monosodium glutamate, and the standard curve was L-ketoglutarate. Different induced expression bacteria were collected and subjected to SDS-PAGE protein gel electrophoresis for verification. Figure 2 , Figure 2The protein gel correspondence is shown in Table 4. Several LAAD expression bacteria without termination-restart translation characteristics all showed clear bands, indicating successful construction. The obtained fermentation validation bacterial broths and the enzyme activity results measured according to Example 1 are shown in Tables 5-7. Table 5 shows the enzyme activity results of PmyxoLAAD fermentation validation, Table 6 shows the enzyme activity results of PvLAAD fermentation validation, and Table 7 shows the enzyme activity results of PmirLAAD fermentation validation. Relative enzyme activity refers to the percentage of the activity of the measured expression vector bacterial broth versus the activity of the same gene sequence expressed on pET28a (100-200% is represented by "+", 200-500% by "++", 500-1000% by "+++", and greater than 1000% by "++++"). The LAAD expression strain containing the special sequence TCGGATCCGAATTCATGA, which has termination-restart translation characteristics, did not show obvious protein gel bands. However, according to the enzyme activity verification results in Tables 5-7, it has better enzyme activity than the traditional expression system (pET28a / pET20b / pET27b).

[0043] Table 4

[0044] serial number Protein gel contents 1-4 pET27b-PmyxoLAAD(IPTG 0.01mM, 0.05mM, 0.1mM, 0.2mM) 5-8 pET27b-PvLAAD(IPTG 0.01mM, 0.05mM, 0.1mM, 0.2mM) 9 pET28a-PvLAAD 10 pET28a-PmyxoLAAD 11 pET28a-PmirLAAD 12 pET20b-g-PmyxoLAAD 13 pET20b-g-PvLAAD 14 pET20b-g-PmirLAAD 15 pET27b-g-PyxoLAAD 16 pET27b-g-PvLAAD 17-21 pET27b-PmirLAAD(IPTG 0.01mM, 0.05mM, 0.1mM, 0.2mM) 22 pET27b-g-PmirLAAD

[0045] Table 5

[0046] Verification of enzyme activity corresponding to cloning methods relative enzyme activity pET28a-PmyxoLAAD pET20b-g-PmyxoLAAD + pET27b-g-PmyxoLAAD ++ pET27b-PmyxoLAAD-0.01mM +++ pET27b-PmyxoLAAD-0.05mM +++ pET27b-PmyxoLAAD-0.1mM ++++ pET27b-PmyxoLAAD-0.2mM +++

[0047] Table 6

[0048]

[0049]

[0050] Table 7

[0051] Verification of enzyme activity corresponding to cloning methods relative enzyme activity pET28a-PmirLAAD pET20b-g-PmirLAAD + pET27b-g-PmirLAAD ++ pET27b-PmirLAAD-0.01mM ++ pET27b-PmirLAAD-0.05mM +++ pET27b-PmirLAAD-0.1mM +++ pET27b-PmirLAAD-0.2mM ++

[0052] Example 6: Extensibility of Special Sequences to Cloning Protocols

[0053] In Example 2, the PelB signal peptide sequence after RBS and before the target sequence in the pET27b-PmyxoLAAD plasmid was further deleted, while the TCGGATCCGAATTCATGA special sequence and termination-restart translation characteristics were retained to verify the universality of this special sequence. The primers used are shown in Table 8. Using the aforementioned pET27b-PmyxoLAAD plasmid as a template, PCR amplification was performed with 0.05 mM or 0.1 mM Mn2+. The PCR amplification product was purified and recovered, and then transformed into E. coli DH5α. The product was plated on LB agar (containing 50 mg / L kanamycin), and single colonies were cultured in LB liquid medium (containing 50 mg / L kanamycin). After screening by colony PCR and sequencing verification, the recombinant plasmid pET27b-PmyxoLAAD-del was obtained. This recombinant plasmid is based on the pET27b-PmyxoLAAD plasmid, with the PelB signal peptide deleted after RBS and before the target sequence, and still contains the special sequence TCGGATCCGAATTCATGA, which has the characteristics of terminating and restarting translation.

[0054] Table 8

[0055] Primer name Primer sequence 27b-PmyxoLAAD-del-F GGAGATATACATATGGATATCGGAATTAATTC PmyxoLAAD-R GCGGCCGCAAGCTTTTATTTTTTAAAGCG

[0056] Furthermore, referring to Example 5, the obtained recombinant plasmid pET27b-PmyxoLAAD-del was induced for expression and its activity was measured. The pET27b-PmyxoLAAD plasmid, which also contains the specific sequence TCGGATCCGAATTCATGA, and the pET28a-PmyxoLAAD plasmid, which does not have the specific sequence, were compared. The amount of IPTG added as the inducer was 0.1 mM. After collecting the above three induced expression bacteria, SDS-PAGE protein gel electrophoresis was performed to verify the expression. Figure 3 , Figure 3 The protein gel correspondence is shown in Table 9. The results of the various fermentation validation bacterial broths and the enzyme activity measured according to Example 1 are shown in Table 10. The relative enzyme activity refers to the percentage of the activity of the measured expression vector bacterial broth vs. the activity of the same gene sequence expressed on pET28a (100-200% is represented by "+", 200-500% by "++", 500-1000% by "+++", and greater than 1000% by "++++").

[0057] Table 9

[0058]

[0059]

[0060] Table 10

[0061] Verification of enzyme activity corresponding to cloning methods relative enzyme activity pET28a-PmyxoLAAD pET27b-PmyxoLAAD ++++ pET27b-PmyxoLAAD-del ++++

[0062] The present invention has been described in detail above, with the aim of enabling those skilled in the art to understand and implement the invention. However, this description should not be construed as limiting the scope of protection of the invention. Any similar changes or modifications made in accordance with the present invention should be covered within the scope of protection of the present invention.

Claims

1. A membrane protein expression vector, characterized in that, The membrane protein expression vector is a recombinant plasmid with termination-restart translation properties, and the recombinant plasmid contains the TCGGATCCGAATTCATGA sequence.

2. The membrane protein expression vector as described in claim 1, characterized in that, The TCGGATCCGAATTCATGA sequence was introduced using an EcoRI restriction site via a primer, which did not add any extra bases before the target gene sequence.

3. The membrane protein expression vector as described in claim 1, characterized in that, The recombinant plasmid is a pET plasmid.

4. The membrane protein expression vector as described in claim 3, characterized in that, The pET plasmid was selected from either pET-27b(+) or pET-20b(+).

5. The membrane protein expression vector as described in claim 1, characterized in that, The membrane protein is selected from: glycoproteins, carrier (channel) proteins, or enzymes.

6. The membrane protein expression vector as described in claim 5, characterized in that, The membrane protein is an amino acid deaminase.

7. A method for enhancing the expression activity of membrane proteins, the method comprising: Construct a recombinant plasmid as described in any one of claims 1-6, transfect the recombinant plasmid into a host cell, and induce the host cell to overexpress the membrane protein.

8. The method as described in claim 7, characterized in that, The steps for constructing the recombinant plasmid include: The double-digested pET plasmid and the product of PCR amplification using the target membrane protein gene as a template were cloned and ligated. The PCR amplification product was obtained by amplification using an upstream primer sequence containing the CGGATCCGAATTCATG sequence and a downstream primer sequence.

9. The method as described in claim 8, characterized in that, The double digestion sites are EcoRI and HindIII.