Rice accase mutant gene e2079d and application thereof

Abstract

This invention relates to the field of agricultural biotechnology, specifically to a rice ACCase mutant gene E2079D and its applications. The invention provides a rice ACCase mutant gene E2079D, which is a mutation at position 6237 of the wild-type rice ACCase gene. Substances containing this mutant gene exhibit excellent resistance to acetyl-CoA inhibitor herbicides. When the mutant gene is transferred into wild-type rice, it confers resistance to acetyl-CoA inhibitor herbicides. Field spraying results at the three-leaf stage of rice show that mutant rice containing this mutant gene can maintain normal growth and development even with concentrations of 4 times higher than that of glyphosate, and its seed setting rate and growth period remain unaffected. In contrast, wild-type plants show chlorosis and yellowing at only 1 times the concentration, gradually withering after 5 days until the entire plant dies.

Description

Technical Field

[0001] This invention relates to the field of agricultural biotechnology, specifically to a rice ACCase mutant gene E2079D and its applications. Background Technology

[0002] Rice is the staple food for more than half of the world's population, and its safe production and stable supply are directly related to national food security and social stability. In the rice paddy ecosystem, weeds, due to their strong environmental adaptability and reproductive capacity, fiercely compete with crops for light, water, nutrients, and space, which can lead to rice yield losses of up to 10%-50%, seriously restricting the achievement of high-yield, high-quality, and high-efficiency production goals, and posing a key obstacle to the promotion of simplified cultivation models (such as direct-seeded rice).

[0003] To combat weed infestations, chemical weeding has become an indispensable core management measure in modern agriculture due to its high efficiency, convenience, and economy. Among them, acetyl-CoA carboxylase (ACCase) inhibitors are an important class of selective herbicides. These herbicides specifically inhibit the activity of cytoplasmic ACCase in gramineous plants, blocking the first key step in fatty acid biosynthesis—the conversion of acetyl-CoA to malonyl-CoA—which in turn disrupts the synthesis of lipid components in the cell membrane system, ultimately leading to suppressed weed growth and death. These herbicides are widely used in the control of gramineous weeds due to their high efficiency, low toxicity, long application window, and relative safety for subsequent crops. However, while effectively killing weeds, chemical herbicides may also pose certain phytotoxic risks to rice crops, affecting their normal growth and development, as well as their final yield and quality. Therefore, breeding rice varieties with endogenous resistance is considered a fundamental strategy for achieving "weed control without yield reduction" and environmental friendliness.

[0004] Currently, the main approaches to breeding rice varieties resistant to ACCase inhibitors include: 1. Traditional mutagenesis and large-scale phenotypic screening, which is time-consuming, labor-intensive, and has limited germplasm resources; 2. Transgenic technology to introduce exogenous resistance genes, which can obtain good resistance, but its biosafety controversies and strict commercialization regulations limit its application prospects.

[0005] In recent years, precision biotechnology, represented by gene editing, has provided new ideas for herbicide-resistant breeding. However, the success of this strategy highly depends on the precise discovery and functional verification of resistance-related mutation sites. Currently, although some rice ACCase mutation sites have been studied, the resistance levels, effects on enzyme function, and application potential in practical breeding vary. In particular, some novel mutation sites with potentially high resistance and minimal impact on rice growth still need to be discovered. Therefore, against the backdrop of increasingly severe weed resistance and the urgent need for simplified rice cultivation, discovering novel, efficient, and safe resistance mutation sites from the endogenous OsACC gene in rice, and creating new breeding materials with practical value based on these sites, has significant scientific and applied value for developing new herbicide-resistant rice varieties, ensuring the sustainability of chemical weed control in paddy fields, and safeguarding food security. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a rice ACCase mutant gene E2079D. This rice ACCase mutant gene possesses a novel mutation site, exhibits significant resistance to acetyl-CoA carboxylase inhibitor herbicides, and also demonstrates excellent resistance to acetyl-CoA carboxylase inhibitor herbicides at 4 times the recommended concentration.

[0007] Therefore, the present invention provides the following technical solution:

[0008] In a first aspect, the present invention provides a rice ACCase mutant gene E2079D in an optional embodiment, wherein the rice ACCase mutant gene is a nucleotide sequence of the wild-type rice ACCase gene with a mutation at position 6237.

[0009] Furthermore, the rice ACCase mutant gene E2079D is a wild-type rice ACCase gene whose nucleotide sequence is changed from G to T at position 6237, as shown in SEQ ID NO.2, resulting in a change in the corresponding encoded amino acid sequence from glutamic acid (E) to aspartic acid (D).

[0010] Furthermore, the rice ACCase mutant gene E2079D is a wild-type rice ACCase gene whose nucleotide sequence is changed from G to C at position 6237, as shown in SEQ ID NO.3, resulting in a change in the corresponding encoded amino acid sequence from glutamic acid (E) to aspartic acid (D).

[0011] The nucleotide sequence of the wild-type rice ACCase gene E2079D is shown in SEQ ID NO.1.

[0012] Secondly, in an optional embodiment, the present invention provides an expression cassette containing the aforementioned rice ACCase mutant gene E2079D.

[0013] Thirdly, in an optional embodiment, the present invention provides a recombinant vector containing the above-mentioned rice ACCase mutant gene E2079D.

[0014] Fourthly, in an optional embodiment, the present invention provides a recombinant cell containing the aforementioned rice ACCase mutant gene E2079D.

[0015] Fifthly, in optional embodiments, the present invention provides the application of the above-mentioned rice ACCase mutant gene E2079D, the above-mentioned expression cassette, the above-mentioned recombinant vector, or the above-mentioned recombinant cells in the application of plant anti-acetyl-CoA carboxylase inhibitor herbicides.

[0016] In a sixth aspect, the present invention, in an optional embodiment, provides a method for obtaining plants resistant to acetyl-CoA carboxylase inhibitors, comprising the following steps:

[0017] (1) To make the plant contain the above-mentioned rice ACCase mutant gene E2079D; or,

[0018] (2) To induce plants to express mutant proteins containing the above-mentioned rice ACCase mutant gene E2079D.

[0019] Preferably, it also includes

[0020] (3) To make the plant contain the above expression cassette; or,

[0021] (4) To make the plant contain the above-mentioned recombinant carrier; or,

[0022] (5) Make the plant contain the above-mentioned recombinant cells.

[0023] Preferably, the rice ACCase mutant gene E2079D is introduced into the plant through gene editing, transgenic processes, hybridization, backcrossing, or asexual reproduction, so that the plant contains the rice ACCase mutant gene E2079D, the expression cassette, the recombinant vector, or the recombinant cells; or, the plant is made to express a mutant protein containing the rice ACCase mutant gene E2079D, thereby giving the plant resistance to acetyl-CoA carboxylase inhibitor herbicides.

[0024] Furthermore, CRISPR-mediated guided editing is used to accrete plants with resistance to acetyl-CoA carboxylase inhibitor herbicides. The acetyl-CoA carboxylase inhibitor herbicides are selected from one or more of quizalofop-P-ethyl, quizalofop-P-ethyl, clethodim, and chlorpyrifos.

[0025] In a seventh aspect, the present invention, in an optional embodiment, provides a method for identifying plants that possess acetyl-CoA carboxylase inhibitors, comprising the following steps:

[0026] (1) Extract DNA from plant tissues and test whether the plant contains the above-mentioned rice ACCase mutant gene E2079D;

[0027] (2) Identify whether the plant expresses a protein containing the rice ACCase mutant gene E2079D.

[0028] Eighthly, in an optional embodiment, the present invention provides a method for controlling weeds in paddy fields, comprising the following steps:

[0029] Apply the effective dose or four times the effective dose of herbicides to plants that are resistant to acetyl-CoA carboxylase inhibitors.

[0030] The herbicide is selected from one or more of quizalofop-P-ethyl, clethodim, ketadiazon, or chlorpyrifos.

[0031] The nucleotide sequence of SEQ ID NO.1 is shown below:

[0032]

[0033] The nucleotide sequence of SEQ ID NO.2 is shown below:

[0034]

[0035] The nucleotide sequence of SEQ ID NO.3 is shown below:

[0036]

[0037] Compared with the prior art, the present invention has one of the following beneficial effects:

[0038] 1. Substances containing the mutant gene E2079D of this invention exhibit excellent resistance to acetyl-CoA inhibitor herbicides. When the mutant gene E2079D is transferred into wild-type rice, the wild-type rice develops resistance to acetyl-CoA inhibitor herbicides. Field spraying results at the three-leaf stage of rice show that mutant rice containing the mutant gene E2079D of this invention can maintain normal growth and development even with concentrations of 4 times or more of herbicides like glyphosate, and its seed setting rate and growth period remain unaffected. In contrast, wild-type plants show chlorosis and yellowing at only 1 times the concentration, gradually withering after 5 days until the entire plant dies. Attached Figure Description

[0039] Figure 1 This is a schematic diagram of the expression cassette carrier construction process in Embodiment 1 of the present invention;

[0040] Figure 2 This is a schematic diagram of the mutation site variation in the mutant plant obtained in Example 1 of the present invention;

[0041] Figure 3 The figure shows the experimental results of applying 1x and 4x acetyl-CoA carboxylase inhibitor herbicides to two mutant plants and wild-type rice in Example 2 of the present invention. Detailed Implementation

[0042] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0044] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0045] Example 1

[0046] 1. Constructing a guided editing vector capable of realizing ACC mutant genes

[0047] Taking rice as an example, the nucleotide sequence ctacattcccatggctgcagag in SEQ ID NO.1 of the plant ACC gene was selected as the target site. The SpCas9 protein-mediated guided editing system pHUN422-PE2 was used, which can introduce pre-designed target mutations into the genome. Based on analysis from the plant pegRNA design website PlantPegDesigner (http: / / www.plantgenomeediting.net / ), the corresponding target SgRNA, RT, and PBS sequences were obtained. According to analysis from the pegRNA design and optimization tool pegLIT (https: / / peglit.liugroup.us / ), there is a corresponding 8 bp linker between the PBS sequence and evopreQ1 at each target site. Therefore, the pegRNA sequences for each mutation are as follows:

[0048] pegRNA1 that enables G to become T:

[0049] CTAATTCCCATGGCTGCAGGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCCCCTCCTCGTAGATCTGCAGCCATGGACCATTACTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA

[0050] pegRNA2 that enables G to become C:

[0051] CTAATTCCCATGGCTGCAGGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCCCCTCCTCGTAGGTCTGCAGCCATGGACCATTACTTGACCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA

[0052] The forward oligonucleotide chain of pegRNA and the reverse oligonucleotide chain that complements it are synthesized separately, and then annealed to form a double strand.

[0053] The pHUN422-PE2 vector was digested with BsaI restriction enzyme (provided by NEB) at 37°C for 4 hours, followed by inactivation at 65°C for 10 minutes, to obtain the backbone fragment for constructing the recombinant vector. The recombinant vector backbone fragment, insert fragment, and sgRNA scoffold were ligated end-to-end using the Golden Gate method (provided by NEB) and transformed into *E. coli*. Positive transformants were obtained by selecting plaques resistant to kanamycin but not spectinomycin. After sequencing verification, positive plasmids were extracted to construct recombinant vector plasmids for CRISPR / Cas9 targeting of the plant ACC gene, named pHUN422-PE2-ACC1 and pHUN422-PE2-ACC2. The vector map is shown below. Figure 1 Plant expression vectors were transformed into Agrobacterium tumefaciens EHA105 using the freeze-thaw method. Positive clones were obtained by colony PCR screening, and Agrobacterium tumefaciens containing pHUN422-PE2-ACC1 and pHUN422-PE2-ACC2 were obtained.

[0054] 2. Agrobacterium-mediated genetic transformation of rice

[0055] Mature and plump rice seeds are selected, and the husks are manually removed to obtain brown rice, which facilitates disinfectant penetration. First, the seeds are soaked in 70% ethanol for 1 minute for preliminary surface disinfection. Then, they are transferred to a 50% sodium hypochlorite solution containing 1 drop of Tween-20 (the stock solution has an effective chlorine concentration ≥4%) and shaken at 150 rpm for 40 minutes to thoroughly kill surface microorganisms. After disinfection, the seeds are thoroughly washed with sterile water at least five times until the solution is clear and odorless. The cleaned seeds are then placed in sterile water and soaked overnight at 4°C or room temperature to allow them to fully absorb water and soften, facilitating subsequent processing.

[0056] Inside a clean bench, under a stereomicroscope and with fine dissecting tools, the embryo is carefully and completely separated from the imbibed seed along the aleurone layer. The separated embryos are then inoculated onto callus induction medium, with 12-15 embryos evenly placed per 100mm culture dish. The inoculated culture dishes are then placed in a 30℃ dark incubator for approximately 11 days to induce dedifferentiation of embryonic cells to form primary callus.

[0057] Agrobacterium tumefaciens transformed with the recombinant expression vector was subjected to Agrobacterium-mediated genetic transformation. The specific steps are as follows:

[0058] (1) Pre-culture: After the initial culture is completed, under aseptic conditions, the newly formed, pale yellow granular callus tissue is carefully peeled off from the remaining endosperm, embryo, and other mother tissues with forceps. Select the primary callus tissue that is in good condition, divides vigorously, and has been completely debudded, and transfer it to freshly prepared induction medium for a pre-culture of 3-5 days.

[0059] This step aims to further enhance the metabolic activity and division potential of callus cells, thereby increasing their sensitivity to subsequent Agrobacterium infection (competent state), which is a key pretreatment to improve transformation efficiency.

[0060] (2) Infection and co-culture: The frozen Agrobacterium strain carrying the target expression vector was taken out from the -80℃ freezer, streaked on YEP solid medium containing the corresponding antibiotic, and incubated upside down at 28℃ for 2 days for activation. Single colonies were picked and inoculated into liquid medium, and cultured at 28℃ and 200 rpm with shaking until the late logarithmic growth stage (OD600≈1.0-1.5). The bacterial cells were collected by centrifugation and resuspended in an equal volume of infection solution (usually AA liquid medium with 100 μM acetylsyl syringone added). The bacterial concentration was adjusted to the optimal infection concentration of OD600=0.1-0.2 using a spectrophotometer.

[0061] (3) Take about 2 grams of pre-cultured high-quality callus tissue and place it in a sterile centrifuge tube. Add the prepared Agrobacterium suspension to ensure the tissue is completely submerged. Place the centrifuge tube on a shaker and oscillate at a low speed (about 50-100 rpm) for 15-20 minutes to promote full contact and adsorption of Agrobacterium with the cells at the callus wound site. After infection, filter the bacterial solution through a sterile sieve and gently absorb excess bacterial solution from the surface of the callus tissue with multiple layers of sterile filter paper to prevent excessive growth of Agrobacterium. Subsequently, spread the callus tissue evenly on the co-culture medium and co-culture at a constant temperature of 23°C in the dark for 48 hours.

[0062] (3) Recovery: After co-culture, all callus tissues were transferred to recovery culture medium. During the transfer, the callus tissue particles were gently separated with sterile forceps to ensure that they were evenly distributed and did not overlap, so as to facilitate aeration and prevent cross-contamination. Recovery culture was carried out in a dark environment at 30°C for 3-5 days to allow the cells subjected to infection stress to recover to a normal physiological state and start division.

[0063] (4) Screening: After recovery culture, carefully select plump, healthy golden or pale yellow new callus particles under a stereomicroscope. Transfer them to a screening medium containing a specific screening agent (0.25 mg / L haloxyfop-R-methyl is used in this system), placing approximately 25 particles per dish. Then, conduct screening culture at 30°C in the dark for 2-3 weeks. During this period, cells that have not successfully integrated the exogenous gene (i.e., the screening agent resistance gene) will gradually die and turn brown due to sensitivity to the herbicide; successfully transformed cells will continue to divide and proliferate, forming independent, vigorously growing resistant callus clones. Regular observation is required, and completely browned or contaminated tissue should be removed promptly.

[0064] (5) Differentiation: Resistant callus clones that maintained vigorous growth after multiple rounds of screening were grouped and labeled according to different clonal origins. Each culture dish was divided into regions, with callus from the same clone placed in one region. The culture dishes were placed in an artificial climate chamber at 30°C with a photocycle of 16 hours of light (intensity of about 3000 lux) / 8 hours of darkness. After 3-4 weeks of culture, green buds gradually differentiated on the surface of the callus tissue and developed into small green shoots.

[0065] (6) Rooting: When the green shoots grow to 2-3 cm in height, cut them off from the base along with a small amount of callus tissue and transfer them to a rooting medium containing no selection agent but with a low concentration of auxin (such as NAA). Continue to culture under the same photoperiod conditions for 2-3 weeks to induce root development and form complete regenerated seedlings. During this period, extract genomic DNA and perform PCR identification on the seedlings, and then transplant them to the field.

[0066] 3. Mutation site analysis of rice mutants containing acetyl-CoA carboxylase-resistant herbicides

[0067] After genetic transformation in rice, 51 plants of pHUN422-PE2-ACC1 and 18 plants of pHUN422-PE2-ACC2 were obtained. To verify the mutation status of the target site in the plants, DNA was extracted from the leaves of each plant using the CTAB method, and a pair of primers was used to amplify the upstream and downstream sequences of the target sequence.

[0068] FP: CTGGCTCGACTATTGTTGAG;

[0069] RP: CTCAGCATAGCACTCAATG.

[0070] The amplified products were sent to Invitrogen for genome sequencing. Comparison of the sequencing results with the wild-type Nipponbare ACCase gene revealed a homozygous mutation in the ACCase gene in these 33 mutant rice plants. The rice containing pHUN422-PE2-ACC1 had a mutation at position 6237, changing from G to T (see [link to relevant documentation]). Figure 2 The nucleotide sequence of the mutated ACCase gene is shown in SEQ ID NO.2, and it is named ACC1. Rice containing pHUN422-PE2-ACC2 has a mutation at position 6237, changing from G to C (see [link to relevant documentation]). Figure 2 The nucleotide sequence of the mutated ACCase gene is shown in SEQ ID NO.3, and it is named ACC2.

[0071] Example 2

[0072] Experiment on spraying herbicides with rice mutants that resist acetyl-CoA carboxylase

[0073] The obtained rice materials containing the mutant gene were transplanted to the field, and T1 generation seeds were harvested. After the plants matured, they were mixed, dried, and stored. Subsequently, they were sown in Hefei during the regular season. After sampling and testing, mutant rice seedlings at the 3-4 leaf stage were selected and sprayed with 108 mg / L of high-efficiency glyphosate, which still showed normal growth; while wild-type rice died completely 5 days after the same treatment (see...). Figure 3 ).

[0074] To further verify the resistance level, mutant seeds were sown. When seedlings reached the 3-4 leaf stage, they were sprayed with a high-efficiency glyphosate at a concentration of up to 432 mg / L (equivalent to 4 times the recommended concentration). Fifteen days after treatment, both types of resistant seedlings remained green and continued to grow to 20-25 cm; in contrast, wild-type plants showed leaf chlorosis and even partial yellowing, with plant height only maintaining 6-10 cm (see [link to treatment]). Figure 3 Thirty days later, the mutant plants grew normally with bright green leaves, while the wild-type plants had all died, indicating that the mutant rice could tolerate four times the recommended concentration of the highly effective glyphosate herbicide.

[0075] Although the principles of the present invention have been described in detail above with reference to preferred embodiments, those skilled in the art should understand that the above embodiments are merely illustrative explanations of the implementation of the present invention and are not intended to limit the scope of the present invention. The details in the embodiments do not constitute a limitation on the scope of the present invention. Any obvious changes, such as equivalent transformations or simple substitutions, based on the technical solutions of the present invention without departing from the spirit and scope of the present invention fall within the protection scope of the present invention.

Claims

1. A rice ACCase mutant gene E2079D, characterized in that, The rice ACCase mutant gene E2079D is a mutation in the nucleotide sequence of the wild-type rice ACCase gene at position 6237.

2. The rice ACCase mutant gene according to claim 1, characterized in that, The rice ACCase mutant gene E2079D is the wild-type rice ACCase gene whose nucleotide sequence is mutated from G to T at position 6237, as shown in SEQ ID NO.

2.

3. The rice ACCase mutant gene according to claim 1, characterized in that, The rice ACCase mutant gene E2079D is the wild-type rice ACCase gene whose nucleotide sequence is mutated from G to C at position 6237, as shown in SEQ ID NO.

3.

4. An expression box, characterized in that, It includes the rice ACCase mutant gene E2079D as described in any one of claims 1-3.

5. A recombinant vector, characterized in that, It includes the rice ACCase mutant gene E2079D as described in any one of claims 1-3.

6. A recombinant cell, characterized in that, It includes the rice ACCase mutant gene E2079D as described in any one of claims 1-3.

7. The use of the rice ACCase mutant gene E2079D according to any one of claims 1-3, the expression cassette according to claim 4, the recombinant vector according to claim 5, or the recombinant cell according to claim 6 in the application of plant anti-acetyl-CoA carboxylase inhibitor herbicides.

8. A method for obtaining plants resistant to acetyl-CoA carboxylase inhibitors, characterized in that, Includes the following steps: (1) To make the plant contain the rice ACCase mutant gene E2079D as described in any one of claims 1-3; or, (2) To make the plant express a mutant protein containing the rice ACCase mutant gene E2079D as described in any one of claims 1-3.

9. The method for obtaining plants resistant to acetyl-CoA carboxylase inhibitors according to claim 8, characterized in that, Also includes (3) To make the plant contain the expression cassette as described in claim 4; or, (4) To make the plant contain the recombinant vector as described in claim 5; or, (5) To make the plant contain the recombinant cells as described in claim 6.

10. The method for obtaining plants resistant to acetyl-CoA carboxylase inhibitors according to claim 8 or 9, characterized in that, The rice ACCase mutant gene E2079D is used to induce plants to contain the rice ACCase mutant gene E2079D as described in any one of claims 1-3, the expression cassette as described in claim 4, the recombinant vector as described in claim 5, or the recombinant cell as described in claim 6 through gene editing, transgenic processes, hybridization, backcrossing, or asexual reproduction; or, the plants are made to express a mutant protein containing the rice ACCase mutant gene E2079D as described in any one of claims 1-3, thereby giving the plants resistance to acetyl-CoA carboxylase inhibitor herbicides.

Images