Multiplex nucleic acid rapid detection method for reproductive tract pathogens based on rpa-cr ispr cas12a technology and application

By combining RPA-CRISPR/Cas12a technology, rapid single-tube multiplex nucleic acid detection of HPV, UU, CT, and MG has been achieved, solving the problems of long detection time, low sensitivity, and insufficient specificity in existing technologies, and achieving rapid, sensitive, and specific multiplex detection results.

CN122279103APending Publication Date: 2026-06-26HENAN PROVINCE HOSPITAL OF TCM THE SECOND AFFILIATED HOSPITAL OF HENAN UNIV OF TCM
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HENAN PROVINCE HOSPITAL OF TCM THE SECOND AFFILIATED HOSPITAL OF HENAN UNIV OF TCM
Filing Date
2026-04-07
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing technologies are insufficient for rapid, accurate, and multiple detection of reproductive tract pathogens, especially HPV, UU, CT, and MG. Furthermore, existing methods suffer from problems such as long detection times, the need for sophisticated instruments, low sensitivity, or insufficient specificity.

Method used

Combining RPA-CRISPR/Cas12a technology, isothermal amplification is performed using RPA technology, and specific identification and detection are performed using the CRISPR/Cas12a system, enabling single-tube multiplex nucleic acid detection of HPV, UU, CT, and MG. A dual signal amplification and closed reaction design are adopted to avoid cross-contamination.

Benefits of technology

It enables rapid, sensitive, and specific multiplex nucleic acid detection, reducing detection time by more than 50%, improving sensitivity and specificity, and is suitable for point-of-care testing and on-site screening, while reducing the false positive rate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122279103A_ABST
    Figure CN122279103A_ABST
Patent Text Reader

Abstract

This invention discloses a rapid multiplex nucleic acid detection method and application for reproductive tract pathogens based on RPA-CRISPR / Cas12a technology, belonging to the field of biodetection technology. The method uses HPV, UU, CT, and MG as detection targets. It designs and screens corresponding RPA primers and crRNAs targeting the specific target genes of each pathogen, optimizing the optimal primer pairs such as HPV-F2 / R2 and the optimal crRNAs such as HPV-crRNA2. Furthermore, it optimizes the CRISPR / Cas12a reaction system with a Cas12a to crRNA molar ratio of 0.9:1 and a final concentration of 500 nM for the fluorescent ssDNA reporter molecule. This integrates RPA isothermal amplification with CRISPR / Cas12a targeted detection, constructing a closed two-stage reaction system to achieve single-tube multiplex detection. This method can complete the test within 45 minutes. The detection limit for HPV / CT / MG is 10 copies / µL, and for UU it is 10² copies / µL. It has no specific cross-reactivity, and the clinical validation shows up to 100% consistency with qPCR. It does not require sophisticated instruments, and the endpoint detection method can be adapted to rapid on-site testing and can also be extended to other nucleic acid testing scenarios.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a rapid detection method and application of multiplex nucleic acids for reproductive tract pathogens based on RPA-CRISPRCas12a technology. Background Technology

[0002] Genital tract infections are a global public health problem caused by various pathogens such as bacteria, viruses, mycoplasma, and chlamydia. World Health Organization data shows that more than 300 million new cases of genital tract infections are reported globally each year, with HPV, UU, CT, and MG accounting for over 60% of these infections, and the rate of mixed infections reaching 20%-30%. These infections often present with atypical symptoms, and if not diagnosed and treated promptly, they can lead to serious complications such as infertility, premature birth, cervical cancer, and pelvic inflammatory disease. Furthermore, lower genital tract infections in women have a synergistic effect with persistent infection with high-risk HPV, significantly increasing the risk of cervical lesions.

[0003] Highly efficient and accurate detection technology is the core of reproductive tract infection prevention and control, but existing detection technologies have significant bottlenecks: traditional pathogen culture methods are the gold standard for diagnosis, but HPV cannot be cultured efficiently in vitro, and the culture conditions for UU, CT, and MG are demanding, with a cycle of 3-7 days, and extremely high requirements for experimental conditions and operators; serological testing methods are simple to operate, but have a long window period and low sensitivity, and cannot distinguish between current and past infections; polymerase chain reaction (PCR) and its derivative technologies have high sensitivity and specificity, but rely on sophisticated thermal cycling instruments, and the detection time is 2-4 hours, which is difficult to meet the needs of rapid point-of-care testing and on-site screening, and multiplex PCR is also prone to problems such as primer dimerization and cross-reaction; single recombinase polymerase isothermal amplification (RPA) technology does not require thermal cycling and has a rapid reaction, but it cannot distinguish pathogens with extremely high sequence similarity, and the amplification products need to be combined with subsequent technologies for visualization interpretation; single CRISPR-Cas technology has high specificity, but relies on sufficient nucleic acid templates, and its sensitivity is insufficient when used alone.

[0004] Therefore, developing a technology and application that requires no sophisticated instruments, allows for rapid detection, and enables the accurate detection of multiple reproductive tract pathogens simultaneously has become crucial for addressing the needs of clinical diagnosis and public health screening. Summary of the Invention

[0005] The purpose of this invention is to provide a rapid detection method and application for multiplex nucleic acids of reproductive tract pathogens based on RPA-CRISPRCas12a technology, so as to achieve rapid single-tube multiplex detection of four pathogens: HPV, UU, CT, and MG.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0007] A rapid multiplex nucleic acid detection method for reproductive tract pathogens based on RPA-CRISPR / Cas12a technology uses human papillomavirus (HPV), ureaplasma urealyticum (UU), chlamydia trachomatis (CT), and mycoplasma genitalium (MG) as detection targets. This method integrates recombinase polymerase isothermal amplification (RPA) technology with CRISPR / Cas12a technology. RPA technology is used to amplify the target nucleic acids at an isothermal temperature, and then the CRISPR / Cas12a system is used to specifically identify and detect the amplified products, achieving multiplex nucleic acid detection for four reproductive tract pathogens. The specific steps include:

[0008] S1: Target gene selection and construction of recombinant plasmid standards

[0009] The L1 capsid protein gene of HPV, the 16S rRNA gene of UU, the ompA gene of CT, and the 16S rRNA gene of MG were selected as detection targets. All of the above target genes met the criteria of high conservation within the species, no homology with other pathogens, GC content of 40%-60%, and no complex secondary structure. Reference sequences of each target gene (HPV-L1: NC_001526, UU-16srRNA: NR_041710, CT-ompA: NC_000117, MG-16srRNA: NR_104952) were downloaded from the NCBIGenBank database. After analyzing the conserved regions using MEGA11 software, DNA fragments containing the target sequences were synthesized and cloned into the pUC57 vector to construct recombinant plasmid standards. These standards were verified by sequencing and used as positive controls and sensitivity detection standards.

[0010] S2: RPA primer screening and establishment of multiplex RPA amplification system

[0011] S2.1: Based on the RPA primer design principles (length 30-35nt, GC content 30%-70%, amplicon 100-200bp, etc.), three pairs of candidate RPA primers were designed for the conserved regions of each target gene. The primer sequences are shown in Table 1.

[0012] S2.2: Using 10³ copies / µL of recombinant plasmid as a template, the RPA reaction system was prepared according to Table 2. The reaction was carried out at a constant temperature of 39℃ for 20 min. Fluorescence signals were collected by a real-time fluorescence PCR instrument, and the primer pairs with the shortest fluorescence curve start-up time were selected as the optimal primer pairs, namely HPV-F2 / R2, UU-F2 / R2, MG-F1 / R1, and CT-F3 / R3.

[0013] S2.3: The concentration of the optimal primer pairs was optimized, and the final concentrations of each primer in the multiplex RPA amplification system were determined to be: HPV-F2 / R2 3 μM, UU-F2 / R2 1.5 μM, MG-F1 / R1 4.5 μM, and CT-F3 / R3 1.5 μM. A 50 μL multiplex RPA reaction system was prepared according to this concentration, and amplification was carried out at 39℃ for 20 min to achieve simultaneous and efficient amplification of four target genes.

[0014] S3: crRNA Design and Screening

[0015] Based on the TTTN protospacer neighbor motif (PAM) recognized by the Cas12a protein, two crRNAs for each pathogen were designed on the target sequence amplified by RPA, as shown in Table 5. The optimal RPA primer pairs selected in step 2 were cross-combined with each crRNA, and the combinations with the strongest fluorescence signals were screened by CRISPR / Cas12a fluorescence experiments, namely HPV-F2 / R2+HPV-crRNA2, UU-F2 / R2+UU-crRNA2, MG-F1 / R1+MG-crRNA2, and CT-F3 / R3+CT-crRNA2.

[0016] S4: Optimization of the CRISPR / Cas12a reaction system

[0017] S4.1: Prepare a 31.5 μL RPA-CRISPR basic reaction system, including 1.5 μL Cas12a (1 μM), 1.5 μL crRNA (1 μM), 2.13 μL 10×NEBuffer, 1.5 μL ssDNA-reporter (10 μM), 21 μL enzyme-free water, and 3 μL RPA amplification product;

[0018] S4.2: The molar ratio of Cas12a to crRNA was optimized through orthogonal experiments, and the optimal ratio was determined to be 0.9:1;

[0019] S4.3: The optimal final concentration for screening fluorescent ssDNA reporter molecules was determined to be 500 nM, at which point the signal-to-noise ratio of the detection system was highest.

[0020] S5: RPA-CRISPR Combined Detection

[0021] Take 3 μL of the LRPA amplification product obtained in step S2 and add it to the optimized 28.5 μL CRISPR / Cas12a reaction system. After thorough mixing, incubate at 39℃ for 20 min. Collect the fluorescence signal every 30 s using a real-time fluorescence PCR instrument. Determine the presence of pathogens in the sample based on the changes in fluorescence signal: if a significant fluorescence signal jump occurs, it is determined to be positive for the corresponding pathogen; if no fluorescence signal jump occurs, it is determined to be negative.

[0022] S6: Clinical Sample Testing

[0023] Nucleic acid was extracted from clinical vaginal secretion samples using the magnetic bead method. The extracted nucleic acid was used as a template and parallel detection was performed using the RPA-CRISPR detection method and real-time fluorescent PCR kit of this invention. The sample detection results were determined based on the fluorescence signal results, and the sensitivity, specificity, and consistency with the gold standard of the detection method were calculated.

[0024] Table 1 RPA primer sequence information

[0025] Pathogen Primer Name Sequence (5'→3') Target Gene HPV-16 HPV-F1 GCCAGTTCAAATTATTTTCCTACACCTAGTGGTT L1 HPV-R1 ATAAACTGTAAATCATATTCCTCCCCATGTCGT HPV-F2 GCTTTGGTGCTATGGACTTTACTACATTACAGG HPV-R2 TATTTGGGCATCAGAGGTAACCATAGAACCAC HPV-F3 TTACCTCTGATGCCCAAATATTCAATAAACCTT HPV-R3 AATAAACTGTAAATCATATTCCTCCCCATGTCG UU UU-F1 TTGAATAAGTATCGGCTAACTATGTGCCAGCAG 16srRNA UU-R1 TCTTCCATATATCTACGCATTTTACCGCTCCAC UU-F2 ATTAGATACCCTAGTAGTCCACACCGTAAACGA UU-R2 TAACCCAACATCTCACGACACGAGCTGACGA UU-F3 ATAGGATTAGATACCCTAGTAGTCCACACCGTA UU-R3 CAGGCACATCATTTAATGCGTTAGCTACAACAC CT CT-F1 TTAGTATTTGCCGCTTTGAGTTCTGCTTCCTCC OmpA CT-R1 GGCTTGGCACCCATCTGAAATTCTTTATTCACA CT-F2 TCCTGCTGAACCAAGCCTTATGATCGACGGAA CT-R2 AGGCTTGGCACCCATCTGAAATTCTTTATTCACA CT-F3 ATTAGTATTTGCCGCTTTGAGTTCTGCTTCCTCC CT-R3 AAAACAAAGTCTCCGTAGTAACCAACACGCAT MG MG-F1 ATTTGAATAAGTAACGACTAACTATGTGCCAGCAG 16srRNA MG-R1 TAATCCTATTTGCTCCCCACACTTTCAAGCCTA MG-F2 ATTTGAATAAGTAACGACTAACTATGTGCCAGCAG MG-R2 GTTCTTCCATATATCTACGCATTTCACCGCTCC MG-F3 TCGCAAGAATGAAACTCAAACGGAATTGACGG MG-R3 TTAACCCAACATCTCACGACACGAGCTGACGA

[0026] Table 2 RPA reaction system (50µL)

[0027] Component Dosage Forward Primer (10µM) 2.4µL Reverse Primer (10µM) 2.4µL Primer-free rehydration buffer 29.5µL Template + enzyme-free water 11.7µL (1µL template + 10.7µL water) Magnesium acetate (280mM) 2.5µL SYBRGreenI 1.5µL (final concentration 0.6×)

[0028] Table 3 RPA-CRISPR reaction system (31.5µL)

[0029] Components Amount added (31.5µL) Cas12a (1 μM) 1.5µL crRNA (1 μM) 1.5µL 10×NEBuffer 2.1 3µL ssDNA-reporter (10 μM) 1.5µL Nuclease-free water 21µL RPA amplification products 3µL

[0030] Table 4 Grouping of CRISPR / Cas12a trans-cleavage activity verification;

[0031] Grouping HPV-L1 Cas12a crRNA ssDNA-reporter 1 + + + + 2 - + + + 3 + - + + 4 + + - + 5 + + + -

[0032] Table 5 crRNA sequence information

[0033] Pathogens crRNA name crRNA sequence (5'→3') HPV-16 HPV-crRNA1 UAAUUUCUACUAAGUGUAGAU-TTTAATAGGGCTGGTACTGTTGGTGAA HPV-crRNA2 UAAUUUCUACUAAGUGUAGAU-TTTCACCAACAGTACCAGCCCTATTAA UU UU-crRNA1 UAAUUUCUACUAAGUGUAGAU-TTTGACATCTATTGCGACGCTATAGAA UU-crRNA2 UAAUUUCUACUAAGUGUAGAU-TTTGACAATACACGTAGAACCTTACCT CT CT-crRNA1 UAAUUUCUACUAAGUGUAGAU-TTTCGGCGGAGATCCTTGCGATCCTTG CT-crRNA2 UAAUUUCUACUAAGUGUAGAU-TTTCAAAACACGGTCGAAAACAAAGTC MG MG-crRNA1 UAAUUUCUACUAAGUGUAGAU-TTTACGCCCAATAAATCCGGATAACGC MG-crRNA2 UAAUUUCUACUAAGUGUAGAU-TTTGGTAGAGAGTCCTGGAACTCCATG

[0034] Table 6. Optimized CRISPR / Cas12a reaction system (10 µL) with Cas12a to crRNA ratio / fluorescent ssDNA reporter molecule concentration.

[0035] Components Volume (µL) Cas12a (1 μM) X crRNA (1 μM) Y 10×NEBuffer 2.1 0.8 Fluorescent ssDNA reporter molecule (50 pM) 0.48 Nuclease-free water 6.72-XY DNA template 2 Total volume 10

[0036] Table 7 Comparison of RPA-CRISPR and qPCR detection results based on 48 clinical samples;

[0037] Detection methods index HPV(qPCR)+ HPV(qPCR)- UU(qPCR)+ UU(qPCR)- MG(qPCR)+ MG(qPCR)- CT(qPCR)+ CT(qPCR)- Multiplex RPA+CRISPR + 16 0 10 0 9 0 8 0 - 2 30 0 40 1 40 2 40

[0038] The present invention has the following beneficial effects:

[0039] The integration of technologies enables dual signal amplification: the deep integration of RPA isothermal amplification technology and CRISPR / Cas12a trans-cutting technology not only leverages the advantages of RPA, such as no need for thermal cycling, rapid response, and low instrument requirements, but also combines the characteristics of CRISPR / Cas12a, such as high specificity and precise target recognition, to achieve dual amplification of the detection signal and significantly improve detection sensitivity and specificity.

[0040] Single-tube multiplex detection avoids cross-contamination: By optimizing the primer and crRNA combination and reaction system, simultaneous detection of four pathogens, HPV, UU, CT and MG, can be achieved in a single tube. At the same time, a two-stage reaction device with a completely closed process is designed to physically separate RPA amplification and CRISPR / Cas12a detection, effectively avoiding cross-contamination of amplification products and reducing the false positive rate.

[0041] Rapid testing, adaptable to on-site scenarios: The entire testing process, from sample nucleic acid extraction to result interpretation, can be completed within 45 minutes, which is more than 50% shorter than the traditional PCR technology testing time. Moreover, only a portable constant temperature device is needed to complete the reaction, without the need for precision thermal cycling instruments. It is suitable for point-of-care testing in hospitals, primary healthcare institutions, and on-site public health screening.

[0042] High sensitivity and low detection limit: The detection method of this invention has a minimum detection limit of 10 copies / µL for HPV, CT, and MG, and a minimum detection limit of 10² copies / µL for UU, which can achieve accurate detection of low-copy pathogens and meet the needs of early clinical infection diagnosis.

[0043] High specificity and no cross-reaction: The selected RPA primers and crRNAs are highly targeted, producing specific reactions only to the nucleic acid sequences of the target pathogens. They do not cross-react with common clinical interfering bacteria such as Gardnerella vaginalis, Neisseria gonorrhoeae, and Escherichia coli, and there is no mutual interference among the four pathogens, making the detection results accurate and reliable. Attached Figure Description

[0044] Figure 1 Fluorescence curves for RPA primer screening of target sequences for HPV-L1, UU-16srRNA, MG-16srRNA and CT-opmA;

[0045] Figure 2 Fluorescence curves of primer concentrations at the lowest detection limits for HPV-L1, UU-16srRNA, MG-16srRNA, and CT-opmA;

[0046] Figure 3 Fluorescence curves for optimized primer concentrations of HPV-L1, UU-16srRNA, MG-16srRNA, and CT-opmA;

[0047] Figure 4 The specific fluorescence curves of the multiplex RPA nucleic acid detection method for HPV-L1, UU-16srRNA, MG-16srRNA and CT-opmA are shown.

[0048] Figure 5Fluorescence curves to verify the trans-cleavage activity of CRISPR / Cas12a;

[0049] Figure 6 Fluorescence curves for screening crRNAs of HPV-L1, UU-16srRNA, MG-16srRNA, and CT-opmA;

[0050] Figure 7 Fluorescence curves for the optimized ratio of Cas12a to crRNA;

[0051] Figure 8 Optimized fluorescence curves for fluorescent ssDNA reporter molecule concentrations;

[0052] Figure 9 Sensitivity fluorescence curves for RPA-CRISPR detection of HPV-L1, UU-16srRNA, MG-16srRNA and CT-opmA;

[0053] Figure 10 Fluorescence curves for cross-reactivity of HPV-L1, UU-16srRNA, MG-16srRNA and CT-opmA detected by RPA-CRISPR;

[0054] Figure 11 This is a fluorescence curve of the clinical sample test results. Detailed Implementation

[0055] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0056] Example 1: Screening of RPA primers

[0057] Primer preparation: Prepare a 10 μM stock solution of all RPA primers in Table 1 using TE buffer, aliquot and store at -20℃;

[0058] Template preparation: Dilute the constructed HPV-L1, UU-16srRNA, CT-ompA, and MG-16srRNA recombinant plasmid standards to 10³ copies / µL as reaction templates, and use enzyme-free water as a negative control;

[0059] Reaction system configuration: Configure a 50 μL LPA reaction system according to Table 2, with 3 replicate wells for each primer pair;

[0060] Reaction conditions: After thoroughly mixing the prepared reaction system, place it in a real-time fluorescence PCR instrument and react at 39℃ for 20 min, collecting fluorescence signals every 20 s;

[0061] Result determination: Based on the fluorescence curves, the primer pairs with the shortest fluorescence jump time and the smallest Ct value were selected as the optimal primer pairs. The results were HPV-F2 / R2, UU-F2 / R2, MG-F1 / R1, and CT-F3 / R3. Figure 1 As shown, Figure 1 All three candidate primer pairs for each pathogen could amplify the target sequence, but there were significant differences in the fluorescence curve start time and Ct value. The primer pair with the smallest Ct value was selected as the optimal primer pair.

[0062] Example 2: Establishment and optimization of multiplex RPA amplification system

[0063] Primer concentration gradient settings: The optimal primer pairs screened in Example 1 were set with concentration gradients of 10 μM, 5 μM, 2.5 μM, 1.25 μM, 1 μM, 0.5 μM, and 0.25 μM, respectively, to keep the upstream and downstream primer concentrations of each pathogen consistent.

[0064] Determination of minimum detection concentration: Using a recombinant plasmid mixture of 10² copies / µL as the reaction template, RPA reaction systems with different concentration gradients were prepared according to Table 2. The reaction was carried out at 39℃ for 20 min, and fluorescence signals were collected to determine the minimum detection concentration for each primer pair: HPV-F2 / R2 1 μM, UU-F2 / R2 0.5 μM, MG-F1 / R1 1.25 μM, CT-F3 / R3 0.5 μM. Figure 2 As shown, Figure 2 The results show that no obvious fluorescence curve jump occurs for each primer pair at a specific concentration, providing a basis for subsequent optimization of primer concentrations in the multiplex RPA system.

[0065] Multiplex RPA primer concentration optimization: Based on the minimum detection concentration, concentration gradients of 2, 3, 4, and 5 were set to configure multiplex RPA reaction systems. The reactions were carried out at 39℃ for 20 min, and fluorescence signals were collected. The results showed that at 3 times the minimum detection concentration, all four pathogens exhibited obvious positive fluorescence curves with similar Ct values, indicating consistent amplification efficiency. The final concentrations of each primer in the multiplex RPA system were determined to be: HPV-F2 / R2 3 μM, UU-F2 / R2 1.5 μM, MG-F1 / R1 4.5 μM, and CT-F3 / R3 1.5 μM. Figure 3 As shown, Group A has a 2-fold minimum detection primer concentration, Group B has a 3-fold minimum detection primer concentration, Group C has a 4-fold minimum detection primer concentration, and Group D has a 5-fold minimum detection primer concentration. In Group B, all four pathogens showed obvious positive fluorescence curves and had similar Ct values, indicating consistent amplification efficiency.

[0066] Specificity verification: Using recombinant plasmids of four pathogens and genomic DNA of Gardnerella vaginalis, Neisseria gonorrhoeae, and Escherichia coli as templates, amplification was performed using an optimized multiplex RPA system. The results showed that only the four target pathogens exhibited fluorescent signals, while interfering bacteria and non-corresponding target sequences showed no fluorescent signals, demonstrating the good specificity of the multiplex RPA system. Figure 4 As shown in the figure, Figure A shows the reaction results of primers for four pathogens with non-corresponding target sequences, and Figure B shows the reaction results of the multiplex RPA system with Gardnerella vaginalis, Neisseria gonorrhoeae, and Escherichia coli genomic DNA. No fluorescence signal was detected in any of the results, which proves that the multiplex RPA system has good specificity.

[0067] Example 3: Design and Screening of crRNA

[0068] crRNA synthesis and preparation: Two crRNAs for each pathogen were synthesized according to the sequences in Table 5, dissolved and diluted to 10 μM with enzyme-free water, aliquoted and stored at -80℃.

[0069] Primer-crRNA combination screening: The optimal primer pairs from Example 1 were cross-combined with each crRNA, at a ratio of 10... 5 Recombinant plasmid copies / µL was used as a template for RPA amplification. 3μL of the amplification product was added to the CRISPR / Cas12a pre-reaction system (10×Buffer 3μL, FQReporter (10μM) 1.5μL, crRNA (1μM) 1.5μL, LbCas12a (1μM) 1.5μL, enzyme-free water to make up to 31.5μL), and reacted at 39℃ for 20min. Fluorescence signal was collected.

[0070] Results determination: The optimal primer-crRNA combinations were selected based on the strongest fluorescence signal and the highest Ct value, namely HPV-F2 / R2+HPV-crRNA2, UU-F2 / R2+UU-crRNA2, MG-F1 / R1+MG-crRNA2, and CT-F3 / R3+CT-crRNA2. Figure 6 As shown, the optimal combination of crRNA2 of each pathogen with the corresponding optimal primer pair results in a stronger fluorescence signal and a higher Ct value.

[0071] Example 4: Optimization of the CRISPR / Cas12a reaction system

[0072] Trans-cleavage activity verification: Five groups of experiments were designed according to Table 4: Group 1 (HPV-L1 + Cas12a + crRNA + ssDNA-reporter), Group 2 (-HPV-L1), Group 3 (-Cas12a), Group 4 (-crRNA), and Group 5 (-ssDNA-reporter). The RPA-CRISPR reaction system was prepared according to Table 3 and reacted at 39℃ for 20 min. Fluorescence signals were collected. Only one group showed a significant fluorescence signal, demonstrating that the trans-cleavage activity of Cas12a requires activation by a ternary complex. Figure 5 As shown in the figure, only the experimental group containing HPV-L1, Cas12a, crRNA, and ssDNA-reporter showed obvious fluorescence signals, while the experimental groups with the other missing components did not show fluorescence signals, proving that the trans-cleavage activity of Cas12a requires activation by a ternary complex.

[0073] Optimization of the Cas12a to crRNA ratio: The molar ratios of Cas12a to crRNA were set to 1:1, 1:0.9, 0.9:1, 1:0.8, and 0.8:1. After preparing the reaction system according to Table 6, the reaction was carried out at 39℃ for 20 min, and fluorescence signals were collected. The results showed that the optimal ratio was 0.9:1, which resulted in the earliest fluorescence curve onset time and the smallest Ct value. Figure 7 As shown, when the ratio is 0.9:1, the fluorescence curve has the earliest start time and the smallest Ct value, which is the optimal molar ratio;

[0074] Optimization of fluorescent ssDNA reporter molecule concentration: Final concentrations of the fluorescent ssDNA reporter molecule were set to 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, and 700 nM. The reaction system was prepared according to Table 6, and the reaction was carried out at 39℃ for 20 min. Fluorescence signals were collected, and the signal-to-noise ratio (SNR) was calculated. The results showed that the SNR was highest at a concentration of 500 nM, which was the optimal concentration. Figure 8 As shown, the fluorescence signal and signal-to-noise ratio of the detection system are optimal at a concentration of 500 nM.

[0075] Example 5: Sensitivity and Specificity Validation of the RPA-CRISPR Detection Method

[0076] Sensitivity verification: Recombinant plasmid standards for four pathogens were diluted to 10⁻⁶. 5 10 4Concentration gradients of 10³, 10², 10, 5, and 2 copies / µL were used as templates for RPA amplification according to Table 2. The amplification was then performed using the optimized CRISPR / Cas12a system according to Table 3, and fluorescence signals were collected. The results showed that the detection limit for HPV-L1, MG-16srRNA, and CT-opmA was 10 copies / µL, and the detection limit for UU-16srRNA was 10² copies / µL. Figure 9 As shown, the detection limit of HPV-L1, MG-16srRNA, and CT-opmA is 10 copies / µL, and the detection limit of UU-16srRNA is 10² copies / µL.

[0077] Specificity verification: with 10 5 Using recombinant plasmids of four pathogens (copies / µL) as templates, RPA amplification was performed according to Table 2. The amplification products were then cross-reacted with crRNAs of other pathogens. The CRISPR / Cas12a system was prepared according to Table 3 and incubated at 39℃ for 20 min. Fluorescence signals were collected. The results showed that each crRNA only produced fluorescence signals to the amplification products of its corresponding target sequence, with no cross-reaction, demonstrating good specificity of the detection method. Figure 10 As shown, each crRNA only produces a fluorescent signal for the amplification product of the corresponding target sequence, with no cross-reaction.

[0078] Example 6 Clinical Sample Testing

[0079] Sample collection: 58 clinical vaginal secretion samples were collected from Henan Provincial Hospital of Traditional Chinese Medicine, including 18 HPV positive, 10 UU positive, 10 MG positive, 10 CT positive samples (verified by qPCR) and 10 samples of vaginal discharge with unexplained cleanliness grade IV.

[0080] Nucleic acid extraction: Nucleic acid was extracted from all samples using a magnetic bead-based nucleic acid extraction kit and stored at -20℃ for later use.

[0081] Parallel detection: The extracted nucleic acid was used as a template to perform parallel detection using the RPA-CRISPR detection method of the present invention (operated according to Tables 2 and 3) and the real-time fluorescent PCR kits for HPV, UU, MG, and CT.

[0082] Results Analysis: The method of this invention detected 16 positive HPV samples, 10 positive UU samples, 9 positive MG samples, and 8 positive CT samples, while all 10 samples with a cleanliness level of IV were negative. Table 7 compares the results of RPA-CRISPR and qPCR detection. The calculated detection sensitivity is: HPV 88.89%, UU 100%, MG 90%, CT 80%; the detection specificity is: HPV 93.75%, UU 100%, MG 97.56%, CT 95.24%; and the consistency with qPCR detection results is: HPV 95.83%, UU 100%, MG 98%, CT 96%. Figure 11 As shown, the method of the present invention has good clinical applicability. Among them, 16 HPV positive, 10 UU positive, 9 MG positive and 8 CT positive samples all showed obvious fluorescence signal initiation, and the detection results were highly consistent with the qPCR results.

[0083] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A rapid detection method for multiplex nucleic acids of reproductive tract pathogens based on RPA-CRISPRCas12a technology, characterized in that, Using human papillomavirus (HPV), ureaplasma urealyticum (UU), chlamydia trachomatis (CT), and mycoplasma genitalium (MG) as detection targets, this study integrates recombinant polymerase isothermal amplification (RPA) technology with CRISPR / Cas12a technology. The RPA technology is used to amplify the target nucleic acids at an isothermal temperature, and the CRISPR / Cas12a system is then used to specifically identify and detect the amplified products, thus achieving multiplex nucleic acid detection for four reproductive tract pathogens.

2. The detection method according to claim 1, characterized in that, The target gene for HPV detection is the L1 capsid protein gene, the target gene for UU detection is the 16S rRNA gene, the target gene for CT detection is the ompA gene, and the target gene for MG detection is the 16S rRNA gene.

3. The detection method according to claim 1, characterized in that, The primer pairs used for RPA amplification are: HPV-F2 / R2, UU-F2 / R2, MG-F1 / R1, and CT-F3 / R3, and the sequences of the primer pairs are shown in SEQ ID NO:1-2, SEQ ID NO:3-4, SEQ ID NO:5-6, and SEQ ID NO:7-8, respectively.

4. The detection method according to claim 1, characterized in that, The crRNAs used in the CRISPR / Cas12a system are HPV-crRNA2, UU-crRNA2, MG-crRNA2, and CT-crRNA2, and the sequences of the crRNAs are shown in SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, respectively.

5. The detection method according to claim 1, characterized in that, The RPA amplification reaction conditions were a constant temperature reaction at 39℃ for 15-20 min; the CRISPR / Cas12a detection reaction conditions were a constant temperature incubation at 39℃ for 20 min, with fluorescence signals collected every 30 s.

6. The detection method according to claim 1, characterized in that, In the CRISPR / Cas12a reaction system, the molar ratio of Cas12a protein to crRNA is 0.9:1, and the final concentration of the fluorescent ssDNA reporter molecule is 500 nM.

7. The detection method according to claim 1, characterized in that, In the multiplex RPA amplification system, the final concentration of HPV-F2 / R2 primers is 3 μM, the final concentration of UU-F2 / R2 primers is 1.5 μM, the final concentration of MG-F1 / R1 primers is 4.5 μM, and the final concentration of CT-F3 / R3 primers is 1.5 μM.

8. The detection method according to claim 1, characterized in that, The detection sensitivity of this method is as follows: the detection limit is 10 copies / µL for HPV, CT, and MG, and the detection limit is 10² copies / µL for UU.

9. The detection method according to claim 1, characterized in that, The entire detection process of this method is completed within 45 minutes, and a two-stage reaction device with a completely closed process is used to achieve physical separation between RPA amplification and CRISPR / Cas12a detection.

10. The use of the detection method according to any one of claims 1-9 in the preparation of nucleic acid detection reagents or kits for reproductive tract pathogens.