A mannose 6-phosphate phosphatase mutant and application thereof

By mutating specific amino acid sites and optimizing the multi-enzyme catalytic system of mannose 6-phosphate dephosphorase, the problems of low extraction and conversion rates in mannose preparation were solved, achieving efficient preparation of mannose and mannitol.

CN122303191APending Publication Date: 2026-06-30TIANJIN YEAHE BIOTECHNOLOGY CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TIANJIN YEAHE BIOTECHNOLOGY CO LTD
Filing Date
2021-12-07
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing methods for preparing mannose suffer from problems such as low extraction rate, high energy consumption, numerous byproducts, complex purification procedures, and low conversion rate. In particular, the catalytic specificity and activity of mannose-6-phosphate dephosphorase are insufficient, resulting in low efficiency in the bio-production of mannose.

Method used

By screening and optimizing specific amino acid sites of mannose 6-phosphate dephosphorase, mutants were obtained to improve their catalytic specificity and activity. Combined with a multi-enzyme catalytic system, including glucose phosphate mutase, bifunctional enzymes and other coenzymes, the reaction conditions were optimized to improve the efficiency of mannose production.

Benefits of technology

The method achieved highly efficient mannose production with a conversion rate of 96%, and converted it into mannitol through chemical catalysis, which significantly improved the preparation efficiency and purity of mannose.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

This invention discloses a mannose-6-phosphate dephosphorase mutant with high catalytic specificity and / or activity. The mutant was obtained through extensive screening with single-point mutations, and further combined mutations were obtained through saturation mutations. Experiments show that, compared to the wild type, the mutant's catalytic activity can be increased by up to nearly 20 times, and the mannose content in the reaction system is increased to 96%. Therefore, this invention has high application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of biocatalysis and biotechnology, and more specifically to a mannose 6-phosphate dephosphorase mutant with high catalytic specificity and activity, and its application in the synthesis of mannose. Background Technology

[0002] D-Mannose is a low-calorie monosaccharide with a sweetness approximately 60% that of sucrose. It is a 2-epimer for D-glucose and an aldehyde-ketone isomer for fructose. Studies have shown that mannose possesses various physiological functions, including inducing the expression of anti-inflammatory cytokines and inhibiting tumor cell growth; promoting insulin secretion and controlling type 1 diabetes; and promoting the proliferation of beneficial gut bacteria. Furthermore, mannose serves as an important precursor in the synthesis of D-mannitol, vitamins, and antitumor drugs.

[0003] Currently, the preparation of D-mannose mainly relies on extraction from plant tissues and microbial cell walls, or chemical isomerization using glucose as a substrate. The former suffers from low extraction rates and high energy consumption, while the latter faces limitations such as numerous byproducts and complex subsequent purification operations. In recent years, with the discovery of more and more enzymes (including lythose isomerase, mannose isomerase, and cellobiose 2-position epimerase), researchers have begun to study the green conversion of mannose using enzymatic catalysis. However, these isomerization reactions have low conversion rates, not exceeding 25%, due to thermodynamic equilibrium limitations. On the other hand, if sucrose or starch is used as a substrate, G1P is generated under the catalysis of phosphorylase (GP / SP), and then G6P is obtained by catalysis of phosphoglucose mutase (PGM). G6P is then generated by phosphoglucose isomerase (PGI) and phosphomannose isomerase (PMI) reactions, respectively, to produce F6P and M6P. Finally, mannose 6-phosphate dephosphorase (M6PP) hydrolyzes the phosphate groups to obtain mannose. This route is thermodynamically driven and theoretically can achieve 100% conversion. Patent WO2018169957A1 discloses a method for synthesizing mannose from inexpensive raw materials such as starch and sucrose; however, the patent text does not explicitly specify the enzyme activity and specificity data of the phosphatase used. Although it describes an example of synthesizing mannose using a multi-enzyme system, it does not provide specific conversion rate values, making its authenticity questionable. Patent CN201910126884.8 also discloses the conversion of mannose from inexpensive raw materials such as starch, sucrose, and glucose; however, the mannose-6-phosphate involved in this patent has low activity, only 1.8 U / mg, and produces byproducts of glucose and fructose. Therefore, improving the catalytic specificity and efficiency of M6PP is crucial for the bioprocessing of mannose. Summary of the Invention

[0004] This invention obtains a mannose 6-phosphate dephosphorase mutant with high catalytic specificity and / or activity through a large number of screening experiments.

[0005] The present invention provides a mannose 6-phosphate dephosphorase mutant with high catalytic specificity and / or activity, which has mutations at the following amino acid sites or combinations thereof relative to SEQ ID NO.1: position 18, position 43, position 47, position 48, position 51, position 63, position 64, and position 125.

[0006] Preferably, it has mutations at the following amino acid sites or combinations thereof relative to SEQ ID NO.1: the 18th position is mutated to K, Q or S, the 43rd position is mutated to H, L or Y, the 47th position is mutated to L, T or F, the 48th position is mutated to I, L or V, the 51st position is mutated to I, K or T, the 63rd position is mutated to L, T or H, the 64th position is mutated to T, Y or S, and the 125th position is mutated to D, F or G.

[0007] More preferably, it contains, relative to SEQ ID NO.1, a combination of mutations at the following amino acid sites: mutations simultaneously at positions 18 and 43; mutations simultaneously at positions 18 and 47; mutations simultaneously at positions 18 and 48; mutations simultaneously at positions 18 and 51; mutations simultaneously at positions 18 and 63; mutations simultaneously at positions 18 and 64; mutations simultaneously at positions 18 and 125; mutations simultaneously at positions 43 and 47; mutations simultaneously at positions 43 and 48; mutations simultaneously at positions 43 and 51; mutations simultaneously at positions 43 and 63; mutations simultaneously at positions 43 and 64; mutations simultaneously at positions 43 and 125; and mutations simultaneously at positions 47 and 48. Mutations exist simultaneously at positions 48 and 51; simultaneously at positions 48 and 63; simultaneously at positions 48 and 64; simultaneously at positions 48 and 125; simultaneously at positions 51 and 63; simultaneously at positions 51 and 64; simultaneously at positions 51 and 125; simultaneously at positions 63 and 64; simultaneously at positions 63 and 125; simultaneously at positions 64 and 125; simultaneously at positions 18, 48, and 51; simultaneously at positions 18, 51, and 63; simultaneously at positions 18, 48, and 63; simultaneously at positions 18, 48, and 64. Mutations; mutations exist simultaneously at positions 18, 48, and 125; mutations exist simultaneously at positions 48, 51, and 63; mutations exist simultaneously at positions 48, 51, and 64; mutations exist simultaneously at positions 48, 51, and 125; mutations exist simultaneously at positions 51, 63, and 64; mutations exist simultaneously at positions 51, 63, and 125; mutations exist simultaneously at positions 63, 64, and 125; mutations exist simultaneously at positions 18, 48, 51, and 63; mutations exist simultaneously at positions 18, 48, 51, and 64; mutations exist simultaneously at positions 18, 48, 51, and 125; mutations exist simultaneously at positions 48, 51, and 63. Mutations exist simultaneously at positions 48, 51, 63, and 125; mutations exist simultaneously at positions 48, 51, 63, and 64; mutations exist simultaneously at positions 48, 51, 63, and 125; mutations exist simultaneously at positions 51, 63, 64, and 125; mutations exist simultaneously at positions 18, 43, 48, 51, and 63; mutations exist simultaneously at positions 18, 43, 48, 51, and 64; mutations exist simultaneously at positions 18, 43, 48, 51, and 125; mutations exist simultaneously at positions 48, 51, 63, 64, and 125.Mutations exist simultaneously at positions 18, 48, 51, 63, 64, and 125; mutations also exist simultaneously at positions 18, 47, 48, 51, 63, 64, and 125.

[0008] This invention provides the application of the mannose 6-phosphate dephosphorase mutant with high catalytic specificity and / or activity in the synthesis of mannose.

[0009] Specifically, starch, maltodextrin, sucrose, and glucose are used as substrates.

[0010] Preferably, when maltodextrin is used as the substrate, the reaction system consists of maltodextrin and Mg. 2+ Dextran phosphorylase, glucose phosphate mutase, bifunctional enzyme glucose phosphate isomerase / mannose phosphate isomerase, and mannose 6-phosphate dephosphorase mutants with high catalytic specificity and / or activity as described.

[0011] More preferably, the reaction system further includes isoamylase and / or 4-glucan transferase, wherein the isoamylase is derived from *Sulfolobustokodaii*, with gene number ST0928 on KEGG; and the glucan transferase is derived from *Thermococcus litoralis*, with gene number OCC_10078 on KEGG. More preferably, the reaction system further includes glucokinase and polyphosphokinase; wherein the glucokinase is derived from *Thermobifida fusca*, with gene number Tfu_1811 on KEGG; and the polyphosphokinase is derived from *Thermus thermophilus*, with gene number TT_C0637 on KEGG.

[0012] In another embodiment, when sucrose is used as a substrate, the reaction system contains the following enzymes: sucrose phosphorylase, glucose phosphate mutase, bifunctional enzymes glucose phosphate isomerase / mannose phosphate isomerase, glucose isomerase, glucokinase, and the mannose 6-phosphate dephosphorase mutant with high catalytic specificity and / or activity; preferably, the reaction system contains sucrose and Mg. 2+ ATP, as well as sucrose phosphorylase, glucose phosphorylation isotope, bifunctional enzymes glucose phosphate isomerase / mannose phosphate isomerase, glucose isomerase, glucokinase, and mannose 6-phosphate dephosphorase mutants with high catalytic specificity and / or activity.

[0013] Preferably, when sucrose is used as the substrate, the reaction system comprises the substrate, sucrose phosphorylase, glucose phosphorylation isotope, bifunctional enzyme glucose phosphate isomerase / mannose phosphate isomerase, glucose isomerase, glucokinase, and the mannose 6-phosphate dephosphorase mutant with high catalytic specificity and / or activity.

[0014] In a specific implementation, the reaction is carried out at 50-60℃ for 16-32 hours; after the reaction is completed, the reaction is terminated by heating in a boiling water bath.

[0015] Furthermore, the present invention provides a method for preparing mannitol, which uses the mannose obtained by the above application to hydrogenate mannitol by chemical catalysis. Preferably, the catalyst used is Pd / C, and the reaction conditions are: temperature 100-130℃, gas pressure 50 Ba, hydrogen gas is introduced into the reaction system, and the reaction time is 20-48 h.

[0016] Through extensive screening, mutants with single point mutations were obtained. Further, combinatorial mutations were obtained through saturation mutations. Experiments showed that, compared to the wild type, the catalytic activity of the mutants could be increased by up to nearly 20 times, and the mannose content in the reaction system increased to 96%. Therefore, this invention has high application value. Detailed Implementation

[0017] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention, and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0018] Example 1: Expression and Activity Evaluation of M6PP 1. A mannose-6-phosphate dephosphorase gene fragment (Ts38H-M6PP) derived from Thermotoga sp. 38H was synthesized by Nanjing GenScript Biotech Co., Ltd., and its corresponding amino acid sequence is shown in SEQ ID NO.1 (nucleotide sequence is shown in SEQ ID NO.2), and recombined into the pET21a vector.

[0019] 2. The recombinant plasmid pET21a-Ts38H was transformed into the Escherichia coli expression host BL21(DE3) to obtain the prokaryotic expression strain.

[0020] 3. The recombinant strain containing the recombinant plasmid pET21a-Ts38H was inoculated into 2 mL of LB medium for overnight activation to obtain a seed culture. This seed culture was then transferred to LB medium at a 1% inoculum and cultured until OD600 = 0.6-0.8. Protein expression was induced by adding 0.5 mM IPTG. The strain was collected by centrifugation, and the cells were resuspended in 50 mM TEA (pH = 7.5) buffer. The cells were then sonicated at 14000 rpm for 30 min to obtain the supernatant. Purification was performed using Ni column affinity chromatography, followed by ultrafiltration using a 10 kDa ultrafiltration tube to obtain concentrated and purified wild-type and mutant proteins.

[0021] The M6PP enzyme activity assay system is as follows: 20 mM M6P, 5 mM Mg 2+ Add 50 mM TEA buffer (pH = 7.5), then add 50-100 μg / mL of purified protein and react at 55℃ for 10-20 min. After the reaction is complete, add 1 μL of 10% H2SO4 to terminate the reaction. The product formation is determined by high-performance liquid chromatography (HPLC). The HPLC analysis conditions are as follows: Agilent HPLC 1200, Sugar-Pak column, column temperature: 80℃, mobile phase: ddH2O, flow rate: 0.4 mL / min, injection volume: 10 μL.

[0022] Example 2: Construction and Screening of Mutant Libraries 1. The primers used in designing error-prone PCR are as follows: P1: GAAGGAGATATACATATGTACCGTGTTTTC P2:GTGGTGGTGCTCGAGACCGTCCAGGCAGTC 2. Using the M6PP gene synthesized in Example 1, i.e., the recombinant plasmid pET21a-Ts38H, as a template, PCR amplification was performed using the primers and random mutagenesis PCR kit described above. The PCR product and pET21a vector were treated with restriction endonucleases NdeI and XhoI and ligated, and transformed into Escherichia coli BL21(DE3) competent cells. The cells were plated on LB plates (containing 100 μg / mL ampicillin) and incubated overnight at 37°C. After transformants appeared, a single transformant was picked up with a sterile toothpick and transferred to a 96-well plate. 1 mL of LB liquid medium was added to each well, and the plates were incubated at 37°C for 6 h. Then, IPTG was added to a final concentration of 0.5 mM, and the temperature was lowered to 16°C for induction overnight.

[0023] 3. Centrifuge the 96-well plate cultured above, collect the bacterial cells, resuspend them in 50mM TEA (pH=7.5), add lysozyme, treat at 37℃ for 1h, and repeat freeze-thaw twice to obtain E. coli cell lysate containing M6PP mutant.

[0024] 4. Take 60 μL of the above E. coli cell lysate, heat at 70℃ for 30 min, and centrifuge to obtain the supernatant crude enzyme solution.

[0025] Screening revealed that amino acid mutations at positions 18, 43, 47, 48, 51, 63, 64, and 125 significantly affected catalytic specificity. Saturation mutations were then performed on these positions: using the recombinant plasmid pET21a-MaGGP as a template, saturation mutations were performed at positions 18, 47, 48, 51, 63, 64, 149, 125, and 178. Using a pair of primers containing the mutation sites, full-plasmid PCR amplification was performed with a high-fidelity enzyme to obtain the recombinant plasmids with the specified mutation sites. The amplification products were digested with DpnI enzyme at 37°C for 2 hours, then transformed into E. coli BL21(DE3) competent cells, plated on LB agar plates (containing 100 μg / mL ampicillin), and incubated overnight at 37°C. One hundred positive clones were selected from each site.

[0026] A mutation site screening system was established based on crude enzyme solution. The screening system was as follows: 10 g / L maltodextrin, 5 mM Mg 2+ 10 mM pH 6.5 PBS was used to add 2 U / mL each of dextran phosphorylase GP, glucose phosphate mutase PGM, and bifunctional enzymes glucose phosphate isomerase / mannose phosphate isomerase PGI / PMI, followed by 50 μL of the above cell lysis buffer. The reaction was carried out at 55 °C for 6 h. After the reaction, 1 μL of 10% H2SO4 was added to terminate the reaction. The yield and proportion of each component in the product were determined by HPLC. At the end of the reaction, three products were present in the reaction system: mannose, fructose, and glucose. If the mutant has high catalytic specificity for mannose 6-phosphate, the proportion of mannose in the reaction system will be increased. Therefore, the specificity can be calculated by calculating the proportion of mannose in the total sugar. The mutants shown in Table 1 were obtained through screening, and their specificity was significantly improved compared with the wild type.

[0027] The system contains glucan phosphorylase GP, which catalyzes the conversion of maltodextrin to glucose-1-phosphate; glucose phosphate mutase PGM, which catalyzes the conversion of glucose-1-phosphate to glucose-6-phosphate; bifunctional enzymes glucose phosphate isomerase / mannose phosphate isomerase PGI / PMI, which can directly catalyze the conversion of glucose-6-phosphate to mannose-6-phosphate; and mannose-6-phosphate phosphatase M6PP, which catalyzes the dephosphorylation of mannose-6-phosphate to mannose. In this invention, glucan phosphorylase is derived from *Thermotoga maritima*, with the gene number TM1168 on KEGG; glucose phosphate mutase is derived from *Thermotoga maritima*, with the gene number TM0769 on KEGG; the bifunctional enzyme glucose phosphate isomerase / mannose-6-phosphate isomerase PGIMPI is selected from *Dictyoglomus thermophilum*, with the UniProt designation B5YEP3; and mannose-6-phosphate phosphatase is selected from the Ts38H-M6PP mutant.

[0028] Mutants exhibiting enhanced catalytic specificity were screened and sequenced to identify the amino acid mutations at corresponding positions. These mutant proteins were then purified using a nickel column, and their enzyme activity against M6P was measured to further identify sites with enhanced catalytic activity (Table 1).

[0029] Table 1. Mutants with enhanced catalytic specificity and activity

[0030] As can be seen from the results in Table 1, positions 18, 43, 47, 48, 51, 63, 64 and 125 in the amino acid sequence have a significant impact on enzyme catalytic activity and specificity, with an increase of 1.8-4.5 times in the activity against mannose 6-phosphate. Using the above mutants, the mannose content in the reaction system increased from 77% to 89% compared to the control.

[0031] Example 3, Combinatorial Mutation The above sites were subjected to combined saturation mutations, and the mannose content and enzyme activity were determined using the method described in Example 2. The results are shown in Table 2.

[0032] Table 2. Combined mutants with significantly improved catalytic specificity and activity.

[0033]

[0034]

[0035]

[0036] As shown in Table 2, after combining saturation mutations at positions 18, 43, 47, 48, 51, 63, 64, and 125 in the amino acid sequence, the catalytic activity was further enhanced compared to the wild type, with the highest increase being nearly 20 times; the mannose content in the reaction system was increased to 96%.

[0037] Example 4: Synthesis of mannose using maltodextrin as a substrate via the M6PP mutant Using the mutant obtained in Example 3, maltodextrin and glycerol were converted to glycerol glucoside. The reaction system was as follows: 100 g / L maltodextrin, 5 mM Mg 2+ 10 mM pH 6.5 PBS was prepared, with 10 U / mL each of GP, PGM, PGI / MPI, and M6PP mutant added. To further improve the conversion rate, isoamylase IA (which catalyzes the debranching of starch to produce amylose) and 4-glucantransferase (which catalyzes the polymerization of maltobiose and maltotriose to produce dextrins with higher degree of polymerization, facilitating the catalysis of glucan phosphorylase GP) were also added. The isoamylase was derived from *Sulfolobustokodaii* (KEGG ID ST0928), and the glucantransferase was derived from *Thermococcus litoralis* (KEGG ID OCC_10078). The reaction was carried out at 55 °C for 24 h. After the reaction, the reaction was terminated by heating in a boiling water bath at 100 °C for 10 min, and the results were analyzed by high-performance liquid chromatography (HPLC).

[0038] Table 3 Comparison of starch preparation results for mannose and mannitol

[0039] As shown in Table 3, when the obtained mutants were applied to the maltodextrin to mannose production system, the mannose yield was higher than that of the wild type compared with the control, reaching a maximum of 91 g / L.

[0040] In addition, the obtained mannose was hydrogenated to mannitol by chemical catalysis. The catalyst used was Pd / C, and the reaction conditions were: temperature 100-130 degrees Celsius, gas pressure 50 Ba, hydrogen gas was introduced into the reaction system, and the reaction was carried out for 20-48 hours. At the end of the reaction, the sample was analyzed by liquid phase.

[0041] The results are shown in Table 3. Almost all of the mannose in the reaction system was converted into mannitol, and the conversion rate of the hydrogenation reaction reached 93-96%.

[0042] To further improve the conversion rate, glucokinase and polyphosphokinase were added to the reaction system. Glucokinase was derived from *Thermobifida fusca*, with the gene ID Tfu_1811 on KEGG; polyphosphokinase was derived from *Thermus thermophilus*, with the gene ID TT_C0637 on KEGG. Both genomic DNAs were available from the ATCC website (www.atcc.org). These four genes were obtained from their respective genomic DNAs via PCR using different primers and then cloned into the pET21 vector using enzyme digestion and ligation methods, resulting in the corresponding expression vectors pET21-PPK and pET21-PPGK.

[0043] When the above three enzymes were added to the reaction system, the mannose yield in all reaction systems increased to 90 g / L, and the final conversion rate exceeded 90% (Table 3), with the highest reaching 97%.

[0044] Example 5: Synthesis of mannose using sucrose as a substrate by the M6PP mutant An in vitro multi-enzyme catalytic system was established to convert sucrose into mannose. The reaction system included sucrose phosphorylase SP, which catalyzes the conversion of sucrose into glucose-1-phosphate and fructose; PGM; PGIMPI; M6PP and its mutant as shown in Example 4; glucose isomerase GI, which catalyzes the conversion of fructose into glucose; glucokinase GK, which catalyzes the conversion of glucose into glucose-6-phosphate; and polyphosphoric acid kinase PPK, which catalyzes the reaction of polyphosphates and ADP to regenerate ATP.

[0045] Sucrose phosphorylase, derived from *Bifidobacterium* adolescentis, with the KEGG designation A0ZZH6, underwent codon optimization to obtain codons preferred by *E. coli*. The resulting gene was then sent to Jiangsu Genewise Biotechnology Co., Ltd. for gene synthesis and construction into the expression vector pET-21a. This plasmid was transformed into *E. coli* BL21(DE3) (Invitrogen, Carlsbad, CA) for protein expression and purification.

[0046] The following reaction system was established: 30 mM phosphate buffer (pH 7.0), 5 mM magnesium chloride, 5 mM ATP, 250 mM polyphosphate, sucrose concentration of 100 g / L, SP dosage of 10 U / mL, PGM dosage of 10 U / mL, PGIMPI dosage of 10 U / mL, M6PP dosage of 10 U / mL, GI dosage of 10 U / mL, PPGK dosage of 10 U / mL, and PPK dosage of 10 U / mL. The catalytic reaction was carried out at 55 °C for 24-48 hours, and the final sample was analyzed by liquid chromatography.

[0047] Liquid chromatography results showed that the mutants described in Example 3 could all convert sucrose into mannose, and the mannose concentrations all exceeded 90 g / L (Table 4), with a conversion rate exceeding 90%.

[0048] Table 4 Comparison of results in the preparation of mannose and mannitol from sucrose.

[0049] Using the chemical catalytic hydrogenation method described in Example 4, mannitol obtained from sucrose preparation was hydrogenated to obtain mannitol with a conversion rate of over 90%.

[0050] The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiments. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A mutant mannose-6-phosphate dephosphorase with high catalytic specificity and / or activity, characterized in that, It contains mutations at the 51st amino acid site relative to SEQ ID NO.1, or at the 51st amino acid site, as well as mutations at the following amino acid sites or combinations thereof: 18th, 43rd, 47th, 48th, 63rd, 64th, and 125th.

2. The mannose-6-phosphate dephosphorase mutant as described in claim 1, characterized in that, It has mutations at only the following amino acid sites or combinations thereof relative to SEQ ID NO.1: the 18th position is mutated to K, Q or S, the 43rd position is mutated to H, L or Y, the 47th position is mutated to L, T or F, the 48th position is mutated to I, L or V, the 51st position is mutated to I, K or T, the 63rd position is mutated to L, T or H, the 64th position is mutated to T, Y or S, and the 125th position is mutated to D, F or G.

3. The mannose-6-phosphate dephosphorase mutant as described in claim 2, characterized in that, It contains the following combinations of amino acid site mutations relative to SEQ ID NO.1: mutations at positions 18 and 43 simultaneously; mutations at positions 18 and 47 simultaneously; mutations at positions 18 and 48 simultaneously; mutations at positions 18 and 51 simultaneously; mutations at positions 18 and 63 simultaneously; mutations at positions 18 and 64 simultaneously; mutations at positions 18 and 125 simultaneously; mutations at positions 43 and 47 simultaneously; mutations at positions 43 and 48 simultaneously; mutations at positions 43 and 51 simultaneously; mutations at positions 43 and 63 simultaneously; mutations at positions 43 and 64 simultaneously; mutations at positions 43 and 125 simultaneously; mutations at positions 47 and 48 simultaneously. Changes; simultaneous mutations at positions 48 and 51; simultaneous mutations at positions 48 and 63; simultaneous mutations at positions 48 and 64; simultaneous mutations at positions 48 and 125; simultaneous mutations at positions 51 and 63; simultaneous mutations at positions 51 and 64; simultaneous mutations at positions 51 and 125; simultaneous mutations at positions 63 and 64; simultaneous mutations at positions 63 and 125; simultaneous mutations at positions 64 and 125; simultaneous mutations at positions 18, 48, and 51; simultaneous mutations at positions 18, 51, and 63; simultaneous mutations at positions 18, 48, and 63; simultaneous mutations at positions 18, 48, and 64. Mutations are present at positions 18, 48, and 125; mutations are present at positions 48, 51, and 63; mutations are present at positions 48, 51, and 64; mutations are present at positions 48, 51, and 125; mutations are present at positions 51, 63, and 64; mutations are present at positions 51, 63, and 125; mutations are present at positions 63, 64, and 125; mutations are present at positions 18, 48, 51, and 63; mutations are present at positions 18, 48, 51, and 64; mutations are present at positions 18, 48, 51, and 125; mutations are present at positions 48, 51, and 64 ... Mutations are present simultaneously at positions 3 and 64; simultaneously at positions 48, 51, 63, and 125; simultaneously at positions 48, 51, 63, and 64; simultaneously at positions 48, 51, 63, and 125; simultaneously at positions 51, 63, 64, and 125; simultaneously at positions 18, 43, 48, 51, and 63; simultaneously at positions 18, 43, 48, 51, and 64; simultaneously at positions 18, 43, 48, 51, and 125; simultaneously at positions 48, 51, 63, 64, and 125.Mutations exist simultaneously at positions 18, 48, 51, 63, 64, and 125; mutations also exist simultaneously at positions 18, 47, 48, 51, 63, 64, and 125.

4. The application of the mannose 6-phosphate dephosphorase mutant with high catalytic specificity and / or activity as described in any one of claims 1 to 3 in the synthesis of mannose, preferably using starch, maltodextrin, sucrose, or glucose as substrates.

5. The application as described in claim 4, characterized in that, When maltodextrin is used as a substrate, the reaction system consists of maltodextrin and Mg. 2+ Dextran phosphorylase, glucose phosphate mutase, bifunctional enzyme glucose phosphate isomerase / mannose phosphate isomerase, and mannose 6-phosphate dephosphorase mutants with high catalytic specificity and / or activity as described in any one of claims 1 to 3.

6. The application as described in claim 5, characterized in that, The reaction system also includes isoamylase and / or 4-glucantransferase. Preferably, the isoamylase is derived from *Sulfolobustokodaii*, with gene number ST0928 on KEGG; the glucantransferase is derived from *Thermococcus litoralis*, with gene number OCC_10078 on KEGG. More preferably, the reaction system also includes glucokinase and polyphosphokinase. Preferably, the glucokinase is derived from *Thermobi fida fusca*, with gene number Tfu_1811 on KEGG; the polyphosphokinase is derived from *Thermus thermophilus*, with gene number TT_C0637 on KEGG.

7. The application as described in claim 4, characterized in that, When sucrose is used as a substrate, the reaction system contains the following enzymes: sucrose phosphorylase, glucose phosphate mutase, bifunctional enzymes glucose phosphate isomerase / mannose phosphate isomerase, glucose isomerase, glucokinase, and a mannose 6-phosphate dephosphorase mutant with high catalytic specificity and / or activity as described in any one of claims 1 to 3; preferably, the reaction system contains sucrose and Mg. 2+ ATP, as well as sucrose phosphorylase, PGM, PGIMPI, glucose isomerase, glucokinase, and mannose 6-phosphate dephosphorase mutants with high catalytic specificity and / or activity as described in any one of claims 1 to 3.

8. The application as described in claim 4, characterized in that, When sucrose is used as a substrate, the reaction system comprises the substrate, sucrose phosphorylase, glucose phosphorylation mutase, bifunctional enzyme glucose phosphate isomerase / mannose phosphate isomerase, glucose isomerase, glucokinase, and a mannose 6-phosphate dephosphorase mutant with high catalytic specificity and / or activity as described in any one of claims 1 to 3.

9. The application as described in any one of claims 4 to 8, characterized in that, React at 50-60℃ for 16-32 hours; after the reaction is complete, stop the reaction by heating in a boiling water bath.

10. A method for preparing mannitol, characterized in that, Mannitol is obtained by hydrogenating mannose obtained from the application described in any one of claims 4 to 9 via a chemical catalytic method. Preferably, the catalyst used is Pd / C, and the reaction conditions are: temperature 100-130°C, gas pressure 50 Ba, hydrogen gas is introduced into the reaction system, and the reaction time is 20-48 h.