A dual-link connector and its introduction method and application

By introducing a dual-linker method, a controllable anchoring complex is constructed by using complementary pairing of long and short nucleic acid chains to form a directed annealing process. This solves the problems of linker dimerization and unstable yield of nucleic acid molecule end linkers in low-input or highly fragmented samples, and achieves efficient library construction and nucleic acid detection.

CN122303222APending Publication Date: 2026-06-30ACCURATE BIOTECHNOLOGY(HUNAN) CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ACCURATE BIOTECHNOLOGY(HUNAN) CO LTD
Filing Date
2026-03-31
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing technologies for constructing end adapters for nucleic acid molecules, especially for small RNA, circulating free RNA, FFPE-derived RNA and other degraded or highly fragmented samples, have problems such as increased adapter dimers, reduced library complexity and enhanced sequence bias. Especially when carrying complex functional modules, the adapter self-aggregation tendency and enzymatic window have significant effects, resulting in unstable yields.

Method used

A dual-linker introduction method is adopted, which constructs a controllable anchoring complex by complementary pairing of long and short nucleic acid chains to form a directional annealing process. The adapter is incorporated using DNA ligase and/or DNA polymerase, including a continuous anchoring-repair-sealing process in a reaction vessel, which is adaptable to different sample types and sequencing platforms.

Benefits of technology

It improves the directionality and structural controllability of adapter incorporation, reduces the tendency of adapter self-pairing and mismatched ligation byproducts, adapts to library construction for low-input or high-fragmentation samples, is compatible with different sequencing platforms and workflows, and improves the efficiency and stability of nucleic acid detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention discloses a dual-linker head, its introduction method, and its applications, relating to the field of biotechnology. The dual-linker head of this invention comprises a long nucleic acid chain and a short nucleic acid chain; the long nucleic acid chain includes a first guide sequence and a support sequence; the long nucleic acid chain is complementary to the short nucleic acid chain through the support sequence; the first guide sequence is 2-30 nt long; the first guide sequence is used to complementarily pair with a second guide sequence at the end of the target nucleic acid. This dual-linker head can freely carry various nucleic acid or nucleic acid aptamer functional modules and is compatible with different sample types, different sequencing platforms, and one-tube or step-by-step workflows. After the end of the target nucleic acid forms or exposes a second guide sequence complementary to the first guide sequence, the dual-linker head can undergo directional annealing with the target nucleic acid to construct a controllable anchoring complex, and further complete the adapter incorporation under the action of DNA ligase and / or DNA polymerase.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a dual-linkage head, its introduction method, and its application. Background Technology

[0002] The introduction of nucleic acid molecule end adapters is a crucial step in high-throughput sequencing library construction, nucleic acid capture and enrichment, molecular cloning, and various nucleic acid detection protocols. For small RNA, circulating cell-free RNA (cfRNA), FFPE-derived RNA, body fluid-derived RNA, and other degraded or highly fragmented samples, conventional adapter introduction methods often suffer from reduced efficiency, increased adapter dimers, decreased library complexity, and enhanced sequence bias due to low starting amounts, short fragments, diverse end structures, and complex inhibitors.

[0003] In existing technologies, one approach primarily relies on RNA or DNA ligases to directly ligate pre-made adapters to the ends of target molecules; another approach relies on template conversion, transposition, or other enzymatic methods to introduce subsequent amplification sites. Each of these approaches has its advantages under different application conditions, but they can also be influenced by the combined effects of substrate terminal chemical state, terminal base composition, local secondary structure, adapter structural complexity, enzymatic window, and operational complexity. Particularly when the dual-link adapter carries more complex functional modules, such as universal amplification sites, platform-specific adapters, barcodes, UMIs, capture sites, aptamer sequences, or promoter sequences, the secondary structure tendency of the adapter molecule itself, its annealing kinetics with the target nucleic acid, adapter self-aggregation tendency, and the substrate recognition behavior of polymerases or ligases all change significantly. Simply following conventional end-ligation approaches can easily lead to problems such as adapter dimers, byproduct molecules, chimera, non-specific initiation of elongation, or unstable yields.

[0004] Therefore, a more platform-based universal nucleic acid adapter incorporation strategy is still needed. Summary of the Invention

[0005] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention also provides a dual-link header.

[0006] This invention proposes a method for introducing a dual-link header.

[0007] This invention also provides a method for constructing a library from a target nucleic acid.

[0008] The present invention also provides the application of the above-described introduction method, the above-described method, or the above-described dual-linked head in the preparation of sequencing libraries, nucleic acid capture and enrichment, cell sorting, in vitro transcription template construction, nucleic acid labeling, or nucleic acid detection.

[0009] The present invention also provides a reagent kit comprising the above-described dual-link head.

[0010] According to a first aspect of the present invention, a dual-link head includes a long nucleic acid chain and a short nucleic acid chain; The long nucleic acid chain includes a first guide sequence and a support sequence; the long nucleic acid chain is complementary to the short nucleic acid chain through the support sequence. The first guide sequence is 2-30 nt long; the first guide sequence is used to complement the second guide sequence at the end of the target nucleic acid.

[0011] The dual-link header according to embodiments of the present invention has at least the following beneficial effects: The dual-linker header in this embodiment can freely carry various nucleic acid or nucleic acid aptamer functional modules and is compatible with different sample types, different sequencing platforms, and one-tube or step-by-step workflows. After the ends of the target nucleic acid are formed or exposed with a second guide sequence complementary to the first guide sequence, the dual-linker header can undergo directional annealing with the target nucleic acid to construct a controllable anchoring complex, and further complete the adapter incorporation under the action of DNA ligase and / or DNA polymerase. According to some embodiments of the present invention, the effective complementary pairing length between the first guide sequence and the second guide sequence is 3 nt to 6 nt. For example, it can be 3 nt, 4 nt, 5 nt or 6 nt.

[0012] According to some embodiments of the present invention, the length of the support sequence is 15 nt-120 nt. Preferably, it is 20 nt-80 nt. For example, it can be 15 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt, 60 nt, 65 nt, 70 nt, 75 nt, 80 nt, 85 nt, 90 nt, 95 nt, 100 nt, 105 nt, 110 nt, 115 nt or 120 nt.

[0013] According to some embodiments of the present invention, the first guide sequence is 2-30 nt long. Preferably, it is 2-12 nt. More preferably, it is 3-6 nt. A first guide sequence that is too short will reduce annealing stability and orientation, while a first guide sequence that is too long may increase mismatch bonding, joint self-pairing, and local secondary structure problems. This facilitates a controllable anchoring-repairing-sealing process. For example, the first guide sequence can be 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, or 30 nt long.

[0014] According to some embodiments of the present invention, the nucleic acid long chain comprises a first guide sequence and a support sequence sequentially from 5' to 3'; or, comprises a support sequence and a first guide sequence sequentially from 5' to 3'.

[0015] According to some embodiments of the present invention, the first guide sequence includes at least one of a homopolymer tail consisting of consecutive identical nucleotide residues and an enriched sequence tail.

[0016] According to some embodiments of the present invention, the first guide sequence is oligodeoxyguanine and / or oligodeoxyguanine, and the second guide sequence is complementary oligodeoxycytosine.

[0017] According to some embodiments of the present invention, the dual linker is at least one of DNA, RNA, and DNA / RNA chimera.

[0018] According to some embodiments of the present invention, the first guide sequence may be located at the 3' protrusion, 5' protrusion, or an exposed single-chain region inside the dual-link head.

[0019] A method for introducing a dual-link header according to a second aspect embodiment of the present invention includes the following steps: A1. To form or expose a second guide sequence at the ends of the target nucleic acid; A2. The target nucleic acid is ligated to the double linker described in the first aspect embodiment by at least one of DNA ligase and DNA polymerase.

[0020] The introduction method according to embodiments of the present invention has at least the following beneficial effects: The method described in this embodiment involves forming or exposing a second guide sequence at the end of the target nucleic acid, followed by directional annealing using the first guide sequence of the dual-linker head to achieve complementary pairing, thereby constructing a controllable anchoring complex and improving the directionality and structural controllability of the adapter incorporation. Subsequently, DNA polymerase completes, repairs, extends, and / or replaces strands in the anchoring complex, and / or DNA ligase seals the gaps to complete the adapter incorporation. Compared to methods that rely solely on pre-made protrusions and direct splicing by ligase, this invention, through a reaction path of "anchoring to form an intermediate first, followed by repair / sealing to complete the incorporation," enables the dual-linker head to achieve directional incorporation even when carrying multiple functional modules, and reduces the tendency for byproducts such as adapter self-pairing and mismatched ligation. Complementary pairing of the short nucleic acid strand with the support sequence provides a stable double-stranded support region and improves the consistency of the pre-annealed dual-linker head in transport, lyophilization, or premixed systems. This method allows the dual-linker head to freely carry multiple nucleic acid or nucleic acid aptamer functional modules and is compatible with different sample types, different sequencing platforms, and single-tube or step-by-step workflows.

[0021] According to some embodiments of the present invention, the supporting sequence includes functional modules; the functional modules include at least one of the following: sequencing platform adapter, universal primer site, platform index sequence, barcode, UMI, capture probe binding sequence, aptamer sequence, linker sequence, restriction endonuclease recognition site, promoter sequence, reporter probe sequence, and secondary structure regulatory sequence.

[0022] According to some embodiments of the present invention, the functional module includes a universal site, a variable region, and a platform-specific region; wherein, the variable region is used to carry barcodes and / or UMIs, the platform-specific region is configured according to the requirements of the sequencing platform (such as Illumina, MGI, etc.), and the universal site is used to reduce the complexity of the amplification system. For example, the functional module may include a universal amplification primer binding site P (e.g., ATCACGACGCTCTTCCGATCT or its functional equivalent sequence), a variable region V, and a platform-specific region S; wherein V may contain UMIs (e.g., N10) and / or barcodes (e.g., N6), and S is configured according to the read structure of the sequencing platform. Exemplarily, the long nucleic acid chain can be represented as: 5'-[first guide sequence]-[P]-[N10]-[N6]-[S]-3', and the short nucleic acid chain and the supporting sequence complementarily pair to form a double-stranded support region. The above are merely examples and do not constitute a limitation on specific sequences.

[0023] According to some embodiments of the present invention, the functional module has modified nucleotides and / or linkage modifications. The modifications are selected from at least one of 2'-O-methyl, 2'-F, phosphothioester bonds, methylphosphonate bonds, and LNA.

[0024] According to some embodiments of the invention, the second guide sequence is 2-50 nt long. Preferably, the second guide sequence includes an effective anchoring segment (preferably 2-12 nt, more preferably 3-6 nt) for complementary pairing with the first guide sequence, and optionally further includes a redundant tail segment (e.g., a homo-tailing / rich segment) to increase the probability of forming an anchoring complex under end-tailing or end-heterogeneous conditions. For example, the second guide sequence can be 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, 30 nt, 31 nt, 32 nt, 33 nt, 34 nt, 35 nt, 36 nt, 37 nt, 38 nt, 39 nt, 40 nt, 41 nt, 42 nt, 43 nt, 44 nt, 45 nt, 46 nt, 47 nt, 48 nt, 49 nt, or 50 nt.

[0025] According to some embodiments of the present invention, the length of the support sequence is 15 nt-120 nt. Preferably, it is 20 nt-80 nt. For example, it can be 15 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt, 60 nt, 65 nt, 70 nt, 75 nt, 80 nt, 85 nt, 90 nt, 95 nt, 100 nt, 105 nt, 110 nt, 115 nt or 120 nt.

[0026] According to some embodiments of the present invention, the first guide sequence is 2-30 nt long. Preferably, it is 2-12 nt. More preferably, it is 3-6 nt. A first guide sequence that is too short will reduce annealing stability and orientation, while a first guide sequence that is too long may increase mismatch bonding, joint self-pairing, and local secondary structure problems. This facilitates a controllable anchoring-repairing-sealing process. For example, the first guide sequence can be 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, 26 nt, 27 nt, 28 nt, 29 nt, or 30 nt long.

[0027] According to some embodiments of the present invention, the effective complementary pairing length between the first guide sequence and the second guide sequence is 3 nt to 6 nt. For example, it can be 3 nt, 4 nt, 5 nt or 6 nt.

[0028] According to some embodiments of the present invention, the nucleic acid long chain comprises a first guide sequence and a support sequence sequentially from 5' to 3'; or, comprises a support sequence and a first guide sequence sequentially from 5' to 3'.

[0029] According to some embodiments of the present invention, the first bootstrap sequence and / or the second bootstrap sequence each independently include the following sequences: (1) A homopolymeric sequence consisting of at least one of poly(dA), poly(dT), poly(dC), poly(dG), poly(dU), poly(rA), poly(U), poly(rC), and poly(rG); (2) A hybrid sequence consisting of dA and rA bases; or dT, dU and U bases; or dC and rC bases; or dG and rG bases.

[0030] According to some embodiments of the present invention, the first guide sequence is oligodeoxyguanine and / or oligodeoxyguanine, and the second guide sequence is complementary oligodeoxycytosine.

[0031] According to some embodiments of the present invention, the first guide sequence includes at least one of a dG sequence and an rG sequence. The dG sequence and / or the rG sequence is 3 nt to 6 nt in length. For example, it can be 3 nt, 4 nt, 5 nt, or 6 nt.

[0032] According to some embodiments of the present invention, the second guide sequence includes at least one of a poly(dC) sequence and a poly(rC) sequence. The poly(dC) sequence and / or the poly(rC) sequence is 3 nt to 6 nt in length. For example, it can be 3 nt, 4 nt, 5 nt, or 6 nt.

[0033] According to some embodiments of the present invention, the dual linker is at least one of DNA, RNA, and DNA / RNA chimera.

[0034] According to some embodiments of the present invention, A2 includes: firstly, complementary annealing of the first guide sequence and the second guide sequence to form an anchoring complex, and then filling, repairing, extending and / or replacing the chain in the anchoring complex, and / or sealing the gap.

[0035] According to some embodiments of the present invention, the reaction of the introduction method is carried out continuously in a reaction vessel.

[0036] According to some embodiments of the present invention, the first guide sequence may be located at the 3' protrusion, 5' protrusion, or an exposed single-chain region inside the dual-link head.

[0037] According to some embodiments of the present invention, the DNA polymerase is capable of completing, repairing, extending, and / or substituting strands in an anchoring complex containing a target nucleic acid with a second guide sequence and a double-linked head. The DNA polymerase has little or no 3'-5' proofreading exonuclease activity to avoid over-cutting of complementary pairs in the first and second guide sequences, thus preventing damage to the anchoring complex. The DNA polymerase includes at least one of the following: Klenow fragment (3'-5' exo-), Bst DNA polymerase, phi29 DNA polymerase, and Taq DNA polymerase.

[0038] According to some embodiments of the present invention, the DNA ligase is capable of sealing gaps or nicks in the anchoring complex of a target nucleic acid having a second guide sequence and a double-linked head. The DNA ligase includes T4 DNA ligase.

[0039] According to some embodiments of the present invention, the target nucleic acid includes at least one of RNA, DNA, and DNA / RNA chimera.

[0040] According to some embodiments of the present invention, the target nucleic acid includes chain nucleic acid and / or circular nucleic acid.

[0041] According to some embodiments of the present invention, the target nucleic acid includes at least one of single-stranded nucleic acid molecules and double-stranded nucleic acid molecules.

[0042] According to some embodiments of the present invention, the method for forming the second guide sequence includes using at least one of a reverse transcriptase with terminal transfer activity, a terminal transferase with tailing activity, a DNA polymerase with terminal tailing activity, a tailing enzyme, a nucleic acid modifying enzyme, and a primer pre-set sequence. For example, after RNA is reverse transcribed into first-strand cDNA using random primers, the reverse transcriptase can add a short oligo-dC tail (second guide sequence) to the end of the cDNA, thereby providing an anchoring site for a subsequent double-stranded header carrying a complementary oligo-G overhang (first guide sequence).

[0043] According to some embodiments of the present invention, when the enzyme used in A2 includes DNA ligase, the reaction system includes ATP and a congestant.

[0044] According to some embodiments of the present invention, when the enzyme used in A2 includes DNA polymerase, the reaction system includes a congesting agent.

[0045] According to some embodiments of the present invention, the crowding agent includes at least one of PEG and dextran. The PEG includes, but is not limited to, PEG8000 or PEG6000.

[0046] According to some embodiments of the present invention, the final concentration of ATP in the reaction system is 0.05 mM-5 mM. Preferably, it is 0.2 mM-2 mM. For example: it can be 0.05 mM, 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.5 mM, 0.6 mM, 0.7 mM, 0.8 mM, 0.9 mM, 1 mM, 1.1 mM, 1.2 mM, 1.3 mM, 1.4 mM, 1.5 mM, 1.6 mM, 1.7 mM, 1.8 mM, 1.9 mM, 2.0 mM, 2.1 mM, 2.2 3.0 mM, 2.3 mM, 2.4 mM, 2.5 mM, 2.6 mM, 2.7 mM, 2.8 mM, 2.9 mM, 3.0 mM, 3.1 mM, 3.2 mM, 3.3 mM, 3.4 mM, 3.5 mM, 3.6 mM, 3.7 mM, 3.8 mM, 3.9 mM, 4.0 mM, 4.1mM, 4.2mM, 4.3mM, 4.4mM, 4.5mM, 4.6mM, 4.7mM, 4.8mM, 4.9mM or 5.0mM.

[0047] According to some embodiments of the present invention, the final concentration of the congestant in the reaction system is 1%-25% (w / v). Preferably, it is 2% (w / v)-15% (w / v). For example, it can be 2% (w / v), 3% (w / v), 4% (w / v), 5% (w / v), 6% (w / v), 7% (w / v), 8% (w / v), 9% (w / v), 10% (w / v), 11% (w / v), 12% (w / v), 13% (w / v), 14% (w / v), 15% (w / v), 16% (w / v), 17% (w / v), 18% (w / v), 19% (w / v), 20% (w / v), 21% (w / v), 22% (w / v), 23% (w / v), 24% (w / v), or 25% (w / v).

[0048] According to some embodiments of the present invention, the DNA polymerase is reacted at a temperature of 15℃-37℃ for a duration of 5 min-120 min. Preferably, it is reacted at 20℃-30℃ for 10 min-40 min. For example, the operating temperature of the DNA polymerase can be 15℃, 16℃, 17℃, 18℃, 19℃, 20℃, 21℃, 22℃, 23℃, 24℃, 25℃, 26℃, 27℃, 28℃, 29℃, 30℃, 31℃, 32℃, 33℃, 34℃, 35℃, 36℃, or 37℃; the operating time can be 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, 35 min, 40 min, 45 min, 50 min, 55 min, 60 min, 65 min, 70 min, 75 min, 80 min, 85 min, 90 min, 95 min, 100 min, 105 min, 110 min, 115 min, or 120 min.

[0049] According to some embodiments of the present invention, the DNA ligase is reacted at a temperature of 10℃-37℃ for 5-120 min. Preferably, it is reacted at 20℃-30℃ for 10-40 min. For example, the operating temperature of the DNA ligase can be 10℃, 11℃, 12℃, 13℃, 14℃, 15℃, 16℃, 17℃, 18℃, 19℃, 20℃, 21℃, 22℃, 23℃, 24℃, 25℃, 26℃, 27℃, 28℃, 29℃, 30℃, 31℃, 32℃, 33℃, 34℃, 35℃, 36℃, or 37℃; the operating time can be 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, 35 min, 40 min, 45 min, 50 min, 55 min, 60 min, 65 min, 70 min, 75 min, 80 min, 85 min, 90 min, 95 min, 100 min, 105 min, 110 min, 115 min, or 120 min.

[0050] A method for constructing a library from a target nucleic acid according to a third aspect embodiment of the present invention includes the following steps: B1. Form or expose a second guide sequence at the ends of the target nucleic acid; B2. Under the action of at least one of DNA ligase and DNA polymerase, the target nucleic acid is ligated with the double linker described in the first aspect embodiment to obtain a complex mixture; B3. Perform PCR amplification on the complex mixture to construct the library.

[0051] The method according to embodiments of the present invention has at least the following beneficial effects: The methods described in this embodiment are adapted to the processing of low-input samples (≤10 ng RNA or ≤1 ng RNA) and / or highly fragmented samples (DV200≤70%), and are applicable to library construction, nucleic acid labeling, capture and detection of small RNA, cfRNA, degraded RNA, FFPE sample RNA, lncRNA and other low-input or fragmented samples.

[0052] According to some embodiments of the present invention, the target nucleic acid is derived from small RNA samples, cfRNA samples, FFPE samples, plasma / serum samples, degraded RNA samples, lncRNA samples, cell lysates, or tissue samples.

[0053] According to some embodiments of the present invention, the target nucleic acid is RNA; the steps include the following steps at the end of the target nucleic acid: The target nucleic acid is fragmented, and the fragmented nucleic acid is reverse transcribed to form a second guide sequence at the 3' end of the first-strand cDNA.

[0054] According to some embodiments of the present invention, the reaction of the method is carried out continuously in a reaction vessel. The target nucleic acid is RNA, and in the same reaction vessel, reverse transcription of the target nucleic acid is performed to form a first-strand cDNA, a second guide sequence is formed at the end of the first-strand cDNA, and a double-linked header is incorporated sequentially.

[0055] According to some embodiments of the present invention, methods for fragmenting the target nucleic acid include, but are not limited to, mechanical shearing, ultrasonication, or heat treatment under high concentration of alkali metal ions.

[0056] According to some embodiments of the present invention, the method for fragmenting the target nucleic acid is to heat-treat the target nucleic acid under a high concentration of alkali metal ions; the heat treatment temperature is 94℃-98℃, and the heat treatment time is 1 min-10 min. For example, the temperature can be 94℃, 95℃, 96℃, 97℃, or 98℃; the time can be 1 min, 2 min, 3 min, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, or 10 min.

[0057] According to some embodiments of the present invention, the reverse transcription is performed using random primers, oligodT primers, miRNA-specific primers, or a mixture of random primers with universal primer sites. N6 or N9 random primers are preferred.

[0058] According to some embodiments of the present invention, the PCR amplification in B3 employs an i5 / i7 paired-end amplification system. The number of cycles is 8-22 cycles; preferably 14-18 cycles.

[0059] According to some embodiments of the present invention, the library includes at least one of the following: a mall RNA library, a cfRNA library, a degraded RNA library, a lncRNA library, a whole transcriptome library, a targeted amplification library, a nucleic acid capture library, and a nucleic acid detection probe introduction product.

[0060] The dual-link head described in the first aspect of the fourth aspect of the present invention, the introduction method described in the second aspect, or the method described in the third aspect may be used in the preparation of sequencing libraries, nucleic acid capture and enrichment, cell sorting, in vitro transcription template construction, nucleic acid labeling, or nucleic acid detection. For example, when the functional module in the double-stranded segment of the dual-link head is an aptamer sequence, the dual-link head or method can be used to construct nucleic acid tools that bind to proteins, small molecules, or cell surface molecules; when the functional module is a capture probe binding site, the dual-link head or method can be used for targeted enrichment, nucleic acid capture, and detection probe introduction; when the functional module is a promoter sequence, the dual-link head or method can be used for in vitro transcription template construction.

[0061] According to some embodiments of the present invention, the sequencing library is applicable to sequencing platforms including at least one of Illumina, MGI, Ion Torrent, PacBio, and Nanopore.

[0062] A reagent kit according to a fifth aspect of the present invention includes the aforementioned dual-link head.

[0063] The kit also includes at least one of the following: reaction buffer, ATP, crowding agent, reverse transcriptase, RNase inhibitor, dNTP, magnetic bead purification system, amplification primers, and instructions for use.

[0064] Other features and advantages of the invention will be set forth in the description which follows, and will be apparent in part from the description, or may be learned by practicing the invention. Attached Figure Description

[0065] Figure 1 A schematic diagram of the process for incorporating a double linker by anchoring the guide sequence and then repairing it with polymerase and / or sealing it with ligase.

[0066] Figure 2 Agarose gel electrophoresis images of library PCR products under different incorporation modes. (A) Ligase-dominated mode; (B) Polymerase-dominated mode; (C) Polymerase-ligase co-operation mode. Lane M in each sub-image: GLDNA Marker 2000; Lane 1: Double linker I; Lane 2: Double linker II; Lane 3: Negative control.

[0067] Figure 3 This is a distribution diagram of Bioanalyzer fragments in the library products of dual-linker I and dual-linker II in ligase-dominated mode. A: Dual-linker I; B: Dual-linker II.

[0068] Figure 4 This is a distribution diagram of Bioanalyzer fragments in the library products of dual-linker I and dual-linker II in polymerase-dominated mode. A: Dual-linker I; B: Dual-linker II.

[0069] Figure 5 This is a Bioanalyzer fragment distribution diagram of the library products of dual-linker I and dual-linker II in a ligase-polymerase co-operation mode. A: Dual-linker I; B: Dual-linker II.

[0070] Figure 6 This diagram illustrates the sequencing data annotation composition of library products in ligase-dominated mode using dual-linker I and dual-linker II. A: Dual-linker I; B: Dual-linker II.

[0071] Figure 7 This diagram illustrates the sequencing data annotation composition of library products with dual-linker I and dual-linker II in polymerase-dominated mode. A: Dual-linker I; B: Dual-linker II.

[0072] Figure 8 This diagram illustrates the sequencing data annotation of library products from dual-linker I and dual-linker II libraries in a ligase-polymerase co-operation mode. A: Dual-linker I; B: Dual-linker II.

[0073] Figure 9 This diagram illustrates the sequencing coverage of library products from dual-linker I and dual-linker II libraries in ligase-dominated mode. A: Dual-linker I; B: Dual-linker II.

[0074] Figure 10 This diagram illustrates the sequencing coverage of library products from dual-linker I and dual-linker II libraries in polymerase-dominated mode. A: Dual-linker I; B: Dual-linker II.

[0075] Figure 11 This diagram illustrates the sequencing coverage of library products from dual-linker I and dual-linker II libraries in a ligase-polymerase co-operation mode. A: Dual-linker I; B: Dual-linker II.

[0076] Figure 12This is a comparison of the number of gene types detected by different incorporation modes of the double-linker II method and the Takara template conversion method (reference group). In the figures: A: Comparison between the ligase-dominated mode and the Takara template conversion method; B: Comparison between the polymerase-dominated mode and the Takara template conversion method; C: Comparison between the polymerase-ligase synergistic mode and the Takara template conversion method. Detailed Implementation

[0077] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0078] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0079] In the description of this invention, the use of terms such as "first," "second," etc., is for the purpose of distinguishing technical features only and should not be construed as indicating or implying relative importance, or implicitly indicating the number of technical features indicated, or implicitly indicating the order of the technical features indicated.

[0080] The terms "preferred," "more preferably," etc., used in this invention refer to embodiments of the invention that provide certain beneficial effects under certain circumstances. However, other embodiments may also be preferred under the same or other circumstances. Furthermore, the description of one or more preferred embodiments does not imply that other embodiments are unavailable, nor is it intended to exclude other embodiments from the scope of this invention.

[0081] When a numerical range is disclosed herein, the range is considered continuous and includes the minimum and maximum values ​​of the range, as well as every value between the minimum and maximum values. Furthermore, when the range refers to integers, it includes every integer between the minimum and maximum values ​​of the range. Additionally, when multiple ranges are provided to describe a feature or characteristic, the ranges may be combined. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges to which they are incorporated.

[0082] The term "polymerase-dominated mode" refers to a process in which DNA polymerase is primarily responsible for completing, repairing, extending, and / or replacing strands in the anchored complex during the incorporation of the double linker, thereby forming a continuously amplifiable structure.

[0083] The term "ligase-dominated mode" refers to a mode in which the nick is sealed primarily by DNA ligase after the anchoring complex is formed.

[0084] The term "polymerase-ligase synergistic mode" refers to the joint work of DNA polymerase and DNA ligase in the same or continuous system to achieve the incorporation of double linkers.

[0085] Unless otherwise defined, all scientific and technical terms in this specification shall have the same meaning as commonly understood by one of ordinary skill in the art. Nucleotide sequences are written from the 5' end to the 3' end.

[0086] Example 1 This example provides a dual-link head I, which is prepared by mixing an equimolar amount of a long nucleic acid chain with a nucleic acid sequence as shown in SEQ ID NO: 1 and a short nucleic acid chain with a nucleic acid sequence as shown in SEQ ID NO: 2, and then heating and denaturing (heating at 90°C for 5 min) in a salt buffer (10 mM Tris-HCl, 50 mM NaCl and 1.0 mM DTT, pH 8.0) followed by slow cooling and annealing.

[0087] ATCACGACGCTCTTCCGATCT rGrGrG (SEQ ID NO: 1); AGATCGGAAGAGCGTCGTGAT (SEQ ID NO: 2).

[0088] The underlined portion of the nucleic acid chain is a supporting sequence, specifically a universal amplification primer binding site (P5 end Read 1 sequencing primer binding site), used to bind universal amplification primers during library amplification and Read 1 sequencing primers during sequencing; this supporting sequence is complementary to the other strand of the adapter (the strand containing SEQ ID NO: 2). The unlabeled portion is the first guide sequence, used to form protrusions and target the target nucleic acid.

[0089] Example 2 This example provides a dual-link head II, which is prepared by mixing an equimolar amount of a long nucleic acid chain with a nucleic acid sequence as shown in SEQ ID NO: 3 and a short nucleic acid chain with a nucleic acid sequence as shown in SEQ ID NO: 2, and then heating and denaturing (heating at 90°C for 5 min) in a salt buffer solution (10 mM Tris-HCl, 50 mM NaCl and 1.0 mM DTT, pH 8.0) followed by slow cooling and annealing.

[0090] ATCACGACGCTCTTCCGATCT dGdGdG (SEQ ID NO: 3); The underlined portion of the nucleic acid chain is a supporting sequence, specifically a universal amplification primer binding site (P5 end Read 1 sequencing primer binding site), used to bind universal amplification primers during library amplification and Read 1 sequencing primers during sequencing; this supporting sequence is complementary to the other strand of the adapter (the strand containing SEQ ID NO: 2). The unlabeled portion is the first guide sequence, used to form protrusions and target the target nucleic acid.

[0091] Example 3 This example utilizes ligase-based nucleic acid adapter incorporation and library construction. Using 293T total RNA as the input sample, first-strand cDNA was obtained through fragmentation and reverse transcription with random primers. Short oligo-dC tails were formed using reverse transcriptase terminal transfer activity, followed by annealing and anchoring using a double-linked head containing complementary oligo-G overhangs. Finally, T4 DNA ligase was added in the presence of ATP and PEG8000 for sealing. The steps are as follows: (1) Sample processing and fragmentation: The fragmentation / annealing system was prepared according to the system shown in Table 1 and heat-treated at 94℃ for 5 min.

[0092] Table 1

[0093] The nucleic acid sequence of the 3'-N6 Primer is A(idSp)T(idSp)ACGTGTGCTCTTCCGATCTNNNNNN (SEQ ID NO: 4); where idSp represents the internal deoxy spacer (dSpacer), which is used to introduce spacer sites inside the primer to regulate the local conformation of the primer and reduce unwanted extension or structural interference.

[0094] (2) Reverse transcription: Prepare the reverse transcription system according to the system shown in Table 2, and carry out the reverse transcription reaction according to the set reaction program (42℃ 90 min, 70℃ 10 min, 4℃ incubation) to obtain the RT reaction product.

[0095] Table 2

[0096] (3) Nucleic acid adapter incorporation: Nucleic acid adapters were prepared according to the system shown in Table 3 and incorporated into the system. The reaction was carried out according to the set reaction program (25℃ 30 min, 75℃ 10 min, 4℃ holding) to obtain the reaction product.

[0097] Table 3

[0098] (4) PCR amplification: Prepare the PCR amplification system according to the system shown in Table 4, and carry out the reaction according to the reaction procedure shown in Table 5 to construct the library.

[0099] Table 4

[0100] i5 Index primer: AATGATACGGCGACCACCGAGATCTACACGTACTGACACACTCTTTCCCTACACGACGCTCTTCCGATC*T (SEQ ID NO: 5); i7 Index primer: CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T (SEQ ID NO: 6); The asterisk (*) indicates that the phosphate diester bond at that position is modified by a thiophosphate.

[0101] Table 5

[0102] Example 4 In this example, polymerase-based incorporation of nucleic acid adapters and library construction were performed. During the end-conversion step, the Klenow fragment (3'-5' exo-) was added to complete, repair, and extend the anchoring complex (the complex of the DNA template and double-linker I or double-linker II). The steps were essentially the same as in Example 3, except that the reaction system in step (3) differed. The reaction system for step (3) in this example is shown in Table 6.

[0103] Table 6

[0104] Example 5: Incorporation of nucleic acid adapters and library construction in a polymerase-ligase co-operation mode In this example, polymerase-ligase synergistic synthesis was used for nucleic acid adapter incorporation and library construction. During the end-conversion step, the Klenow fragment (3'-5' exo-) and T4 DNA ligase were added simultaneously to complete and seal the annealing anchor complex. The steps were essentially the same as in Example 3, except that the reaction system in step (3) differed. The reaction system for step (3) in this example is shown in Table 7.

[0105] Table 7

[0106] Detection example The PCR products of the libraries from Examples 3-5 were subjected to agarose gel electrophoresis, sequenced on the Illumina platform, and analyzed.

[0107] like Figure 2-12 As shown. Among them, the Takara template conversion method was used to process 10 ng of 293T total RNA according to the method described in the patent "Method for Adding Aptamers to Nucleic Acids and Compositions for Carrying Out the Method" (Application No.: CN201480057094.4) [0099-0107], and then reverse transcription, template conversion and PCR amplification were performed to form a library.

[0108] The results showed that in the method of ligase-led nucleic acid adapter incorporation and library construction (Example 3), using double-linker I or double-linker II resulted in library yields of approximately 179.4 ng and 171.4 ng, respectively. Bioanalyzer analysis showed that the library fragments were mainly distributed in the range of approximately 200-500 bp. In sequencing quality control, Genes_FPKM_gt_0.1 reached 14373 and 15046, respectively. This indicates that stable and amplifiable libraries can be formed solely through annealing and ligase sealing, meeting the requirements for routine transcriptome library amplification and sequencing.

[0109] The results showed that in the polymerase-led method for nucleic acid adapter incorporation and library construction (Example 4), using dual-linker I or dual-linker II resulted in library yields of 226 ng and 258 ng, respectively. The library fragments were mainly distributed in the range of approximately 200-500 bp, corresponding to 15715 and 16335 genes (FPKM>0.1), respectively. This indicates that with a suitable guide sequence anchoring structure, the Klenow fragment (3'-5' exo-) alone can complete sufficient end-repair incorporation to support library formation, meeting the requirements of conventional transcriptome library amplification and sequencing.

[0110] The results showed that in the method of polymerase-ligase synergistic incorporation of nucleic acid adapters and library construction (Example 5), using dual-linker I or dual-linker II resulted in library yields of 252 ng and 374 ng, respectively, corresponding to Genes_FPKM_gt_0.1 values ​​of 17694 and 19000. Simultaneously, the library fragment distribution was concentrated in the approximately 200-500 bp range, demonstrating good sequencing region composition and coverage. These results indicate that when complex dual-linkers are first anchored using a short guide sequence, and then repaired by polymerase and sealed by ligase, using 293T total RNA as a sample and an input volume of 10 ng, excellent library performance can be obtained, meeting the requirements of conventional transcriptome library amplification and sequencing.

[0111] Using 293T total RNA as a sample and an input amount of 10 ng for comparison: the total number of genes detected in the ligase-dominated mode and the control group differed by less than 3% under the Genes_FPKM_gt_0.1 standard, with a high percentage of overlapping genes, indicating that the overall performance of the two groups was basically consistent; the difference in the total number of genes detected in the polymerase-dominated mode and the control group further narrowed (less than 1%), showing even higher consistency; the total number of genes detected in the polymerase-ligase synergistic mode was higher than that in the control group, and the number of genes specific to the experimental group increased, suggesting that the synergistic pathway can improve library complexity and detection coverage. In summary, the ligase-dominated mode, polymerase-dominated mode, and ligase-polymerase synergistic mode can all obtain amplifiable libraries under the same input conditions, which indicates the controllable anchoring complex formed by "guide sequence anchoring + dual-linker directional annealing"; while different terminal convertase pathways provide adjustable implementation modes for the same platform. Compared with the ligase-dominated mode and the polymerase-dominated mode, the ligase-polymerase synergistic mode has relatively higher overall performance.

[0112] The protrusion of double-linker I is rGrGrG, and the protrusion of double-linker II is dGdGdG. Both can anneal with the complementary guide sequence formed at the end of the target nucleic acid to form an anchoring complex. Due to the different types of sugar rings at the protrusions (rG is ribose, dG is deoxyribose), their chemical stability, enzymatic recognition preference, and annealing kinetics may differ. For ease of description, this application refers to the scheme containing rG protrusions as the "flexible protrusion scheme" and the scheme with whole DNA (dG) protrusions as the "stable protrusion scheme." The nucleotide composition and length of the protrusions can be used as adjustable parameters to adapt to different samples, different functional module complexities, and different enzymatic pathways.

[0113] The embodiments of the present invention have been described in detail above with reference to the examples. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention.

Claims

1. A dual-linker, characterized in that, The nucleic acid long chain and the nucleic acid short chain; The nucleic acid long chain comprises a first guide sequence and a support sequence; the nucleic acid long chain is complementary paired with the nucleic acid short chain through the support sequence; The first guide sequence is 2-30 nt long; the first guide sequence is used for complementary pairing with a second guide sequence at the end of a target nucleic acid.

2. The method for introducing a dual-linker according to claim 1, characterized in that, The method comprises the following steps: A1, forming or exposing a second guide sequence at the end of a target nucleic acid; The second guide sequence is complementary paired with the first guide sequence; A2, connecting the target nucleic acid with the double linker of claim 1 under the action of at least one of a DNA ligase and a DNA polymerase.

3. The introduction method according to claim 2, characterized in that, The support sequence comprises a functional module; the functional module comprises at least one of a sequencing platform adapter, a universal primer site, a platform index sequence, a barcode, a UMI, a capture probe binding sequence, an aptamer sequence, a linker sequence, a restriction enzyme recognition site, a promoter sequence, a reporter probe sequence, and a secondary structure regulating sequence; and / or, the DNA polymerase comprises at least one of a Klenow fragment (3'-5' exo-), a Bst DNA polymerase, a phi29 DNA polymerase, and a Taq DNA polymerase; and / or, the DNA ligase comprises a T4 DNA ligase; And / or, the method for forming the second guide sequence comprises using at least one of a reverse transcriptase with terminal transfer activity, a terminal transferase with tailing activity, a DNA polymerase with terminal tailing activity, a tailing enzyme, a nucleic acid modifying enzyme, and a primer preposition sequence.

4. The introduction method of claim 2, wherein, The second guide sequence is 2-50 nt long; preferably, the second guide sequence is 2-12 nt long; further preferably, the second guide sequence is 3-6 nt long.

5. The introduction method of claim 2, wherein, The support sequence is 15 nt-120 nt long; preferably, the effective complementary pairing length of the first guide sequence and the second guide sequence is 3 nt-6 nt.

6. The introduction method of claim 2, wherein, The first guide sequence and / or the second guide sequence respectively independently comprises the following sequence: (1) a homopolymer sequence composed of at least one of poly(dA), poly(dT), poly(dC), poly(dG), poly(dU), poly(rA), poly(U), poly(rC), and poly(rG); (2) a heteropolymer sequence composed of dA and rA bases; or, dT, dU and U bases; or, dC and rC bases; or, dG and rG bases; Preferably, the first guide sequence comprises at least one of a poly(dG) sequence and a poly(rG) sequence; Preferably, the second guide sequence comprises at least one of a poly(dC) sequence and a poly(rC) sequence.

7. The method of introduction of claim 2, wherein, The DNA polymerase has an action temperature of 15℃-37℃ and an action time of 5 min-120 min; and / or, the DNA ligase has an action temperature of 10℃-37℃ and an action time of 5-120 min.

8. The introduction method of claim 2, wherein, The reaction of the introduction method is continuously carried out in one reaction container.

9. A method of constructing a library of target nucleic acids, characterized by, The method comprises the following steps: B1, forming or exposing a second guide sequence at the end of a target nucleic acid; The second bootstrap sequence is complementary to the first bootstrap sequence; B2. Under the action of at least one of DNA ligase and DNA polymerase, the target nucleic acid is ligated to the double linker of claim 1 to obtain a complex mixture; B3. Perform PCR amplification on the complex mixture to construct the library.

10. A kit characterized in that, Includes the dual-link header as described in claim 1.

Citation Information

Patent Citations

  • CN105658815B