A primer group, a kit and a detection method for rapid visual detection of soil antibiotic resistance gene TEM-1

By combining RPA primer sets and CRISPR/Cas12a enzyme digestion system, rapid and visual detection of the antibiotic resistance gene TEM-1 in soil was achieved, solving the problems of complex detection methods, long cycle and insufficient sensitivity in existing technologies. It is suitable for rapid on-site screening and risk warning.

CN122303411APending Publication Date: 2026-06-30INSTITUTE OF ENVIRONMENT AND SUSTAINABLE DEVELOPMENT IN AGRICULTURE CAAS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610482813.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-13
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing technologies for detecting the antibiotic resistance gene TEM-1 in soil rely on complex instruments, are cumbersome to operate, have long detection cycles, and lack sufficient sensitivity, making it difficult to meet the needs of rapid on-site screening.

Method used

Using RPA primers and a CRISPR/Cas12a restriction enzyme system, combined with visualization detection technology, the target gene is rapidly amplified at room temperature via RPA amplification reaction, and the Cas12 chromatography test strip is used for visualization detection, simplifying the operation and improving sensitivity and specificity.

Benefits of technology

It enables rapid detection of the antibiotic resistance gene TEM-1 in soil at room temperature without the need for sophisticated equipment, improving detection efficiency and sensitivity, and is suitable for rapid on-site screening and risk warning.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303411A_ABST
    Figure CN122303411A_ABST
Patent Text Reader

Abstract

This disclosure provides a primer set, kit, and their application for rapid visual detection of the soil antibiotic resistance gene TEM-1, as well as a rapid visual detection method. The primer set can rapidly amplify the target gene at room temperature without relying on thermal cycling instruments. The matching crRNA and probe set are precisely matched with the CRISPR / Cas12a restriction enzyme system, significantly improving the detection specificity and sensitivity, and can effectively identify low-abundance target genes in soil. It effectively solves the pain points of existing technologies, such as complex operation, long detection cycle, and high equipment dependence, and provides practical and efficient technical support for the routine monitoring and risk warning of antibiotic resistance genes in the soil environment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of environmental microbial nucleic acid technology, specifically to a primer set, reagent kit, and detection method for rapid visual detection of the soil antibiotic resistance gene TEM-1. Background Technology

[0002] The widespread use of antibiotics in medical treatment, animal husbandry, and agricultural production has greatly improved the efficiency of disease prevention and control and production benefits. However, it has also led to a large amount of antibiotics entering the soil environment through excretion and waste. As an important reservoir of antibiotic resistance genes (ARGs), soil ARGs can spread among microorganisms through horizontal gene transfer. This process not only reduces the clinical efficacy of antibiotics but may also be transmitted through the food chain, ultimately threatening human health. Therefore, rapid and accurate detection of ARGs in soil is of great significance for environmental risk assessment and pollution control.

[0003] Currently, the main detection methods for ARGs include conventional PCR and real-time quantitative PCR. Conventional PCR is cumbersome, requiring gel electrophoresis verification, has a long detection cycle, and limited sensitivity. While qPCR offers quantitative advantages, it relies on sophisticated thermal cycling equipment, resulting in high detection costs and demanding high operator skills, making it unsuitable for rapid on-site screening. Furthermore, existing detection technologies based on RPA (recombinase polymerase amplification) and CRISPR / Cas systems still suffer from problems such as inappropriate primer and crRNA combinations, low amplification efficiency, and insufficient specificity in resistance gene detection. This makes it difficult to meet the detection sensitivity requirements for low-abundance resistance genes, and the development of visual detection systems is still immature, limiting their widespread application in large-scale on-site testing.

[0004] For typical high-risk ARGs in the soil environment (such as TEM-1 type β-lactam antibiotic resistance genes), there is an urgent need to develop a detection technology that is easy to operate, rapid, sensitive and visualized, without the need for complex instruments, in order to solve the shortcomings of existing detection methods in terms of field applicability, detection efficiency and sensitivity, and to achieve efficient screening and risk warning of ARGs in soil. Summary of the Invention

[0005] The purpose of this disclosure is to provide a rapid detection scheme for the soil antibiotic resistance gene TEM-1, which solves the problems of existing detection technologies relying on complex instruments, cumbersome operation, and long detection cycles. It enables rapid detection without the need for precision equipment at room temperature, and has high sensitivity and detection efficiency.

[0006] To achieve the above objectives, the first aspect of this disclosure provides a primer set for rapid visual detection of the soil antibiotic resistance gene TEM-1, the primer set comprising RPA primer pairs; The RPA primer pair includes the upstream primer TEM-1-F and the downstream primer TEM-1-R; TEM-1-F:5′ GAACCGGAGCTGAATGAAGCCATACCAAAC 3′SEQ ID NO.1, TEM-1-R:5′ AAACCAGCCAGCCGGAAGGGCCGAGCGCAG 3′SEQ ID NO.2.

[0007] On the other hand, this disclosure provides a kit for rapid visual detection of the soil antibiotic resistance gene TEM-1, the kit comprising the aforementioned primer set.

[0008] Optionally, the kit includes crRNA that specifically recognizes the target gene, a set of probes for visualization detection, Cas12a protein, a recombinase polymerase amplification reaction system, a reaction buffer, and a Cas12 chromatography test strip.

[0009] The sequence of the crRNA is 5′ UAAUUUCUACUCUUGUAGAUCGCAACGUUGUUGCCAUUGCUGC 3′SEQID NO.3; The probe set includes probes for real-time fluorescence PCR detection and / or probes for visual test strip detection; the sequence of the probe for real-time fluorescence PCR detection is 5'-6-FAM-TTTTTTTTTTTT-BHQ1-3'SEQ ID NO.4, and the sequence of the probe for visual test strip detection is 5'-6-FAM-TTTTTTTTTTTT-Biotin-3'SEQ ID NO.5.

[0010] Optionally, the recombinase polymerase amplification reaction system includes reaction powder, A Buffer, and B Buffer; the reaction buffer includes C Buffer.

[0011] Optionally, the preparation method of the Cas12 chromatography test strip includes: coating AuNP-labeled anti-FAM antibody onto the conjugate pad, sequentially distributing streptavidin and goat anti-rabbit IgG antibody onto the nitrocellulose membrane to form a control line and a test line, and then assembling the absorbent pad, sample pad, conjugate pad and nitrocellulose membrane onto a plastic backing plate, cutting and drying for storage.

[0012] On the other hand, this disclosure provides the application of the above primer set in the preparation of a reagent for detecting the soil antibiotic resistance gene TEM-1.

[0013] On the other hand, this disclosure provides a rapid visualization detection method for the soil antibiotic resistance gene TEM-1, which includes the following steps: S1. Extract total DNA from soil samples; S2. Using the primer set described in the first aspect of this disclosure, the total DNA is subjected to an RPA amplification reaction to obtain RPA amplification products; S3. Add the RPA amplification product to the detection system and react at 30-40℃ for 25-35 minutes; S4. The results are observed by fluorescence signal detection or Cas12 chromatography test strips to achieve visual determination of the target gene.

[0014] Optionally, in step S3, the detection system includes 20-30 μL of RPA reaction product, 0.8-1.2 μL of 8-12 μM fluorescent probe, 0.8-1.2 μL of 1500 nM Cas12a protein, and 0.8-1.2 μL of 8-12 μM crRNA; The sequence of the crRNA is 5′ UAAUUUCUACUCUUGUAGAUCGCAACGUUGUUGCCAUUGCUGC 3′SEQID NO.3; The probe set includes probes for real-time fluorescence PCR detection and / or probes for visual test strip detection; the sequence of the probe for real-time fluorescence PCR detection is 5'-6-FAM-TTTTTTTTTTTT-BHQ1-3'SEQ ID NO.4, and the sequence of the probe for visual test strip detection is 5'-6-FAM-TTTTTTTTTTTT-Biotin-3'SEQ ID NO.5.

[0015] Through the above technical solution, this disclosure provides a primer set, kit, and its application and rapid visualization detection method for the rapid visualization detection of the soil antibiotic resistance gene TEM-1. The primer set can rapidly amplify the target gene at room temperature without relying on thermal cycling instruments. The matching crRNA and probe set are precisely matched with the CRISPR / Cas12a restriction enzyme system, which significantly improves the detection specificity and sensitivity, and can effectively identify low-abundance target genes in soil. It effectively solves the pain points of existing technologies such as complex operation, long detection cycle and high equipment dependence, and provides practical and efficient technical support for the routine monitoring and risk warning of antibiotic resistance genes in the soil environment.

[0016] Other features and advantages of this disclosure will be described in detail in the following detailed description section. Attached Figure Description

[0017] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings: Figure 1 This is a comparison image of agarose gel electrophoresis of RPA amplification products from the examples and comparative examples; Figure 2 This is a comparison chart of the fluorescence signal parabolas and detection times of the examples and comparative examples; Figure 3 This is a table of fluorescence value (RFU) detection data for the examples; Figure 4 This is a table of comparative fluorescence value (RFU) detection data; Figure 5 These are comparison images of the actual test strips in the embodiment and the comparative example. Figure 6 It is a visual chart for judging the color development results of the test strip; Figure 7 It consists of agarose gel electrophoresis images and fluorescence signal detection data. Detailed Implementation

[0018] The following provides a detailed description of specific embodiments of this disclosure. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit this disclosure.

[0019] The first aspect of this disclosure provides a primer set for rapid visual detection of the soil antibiotic resistance gene TEM-1, the primer set comprising RPA primer pairs; The RPA primer pair includes the upstream primer TEM-1-F and the downstream primer TEM-1-R; TEM-1-F:5′ GAACCGGAGCTGAATGAAGCCATACCAAAC 3′SEQ ID NO.1, TEM-1-R:5′ AAACCAGCCAGCCGGAAGGGCCGAGCGCAG 3′SEQ ID NO.2.

[0020] On the other hand, this disclosure provides a kit for rapid visual detection of the soil antibiotic resistance gene TEM-1, the kit comprising the primer set as described in claim 1.

[0021] Optionally, the kit includes crRNA that specifically recognizes the target gene, a set of probes for visualization detection, Cas12a protein, a recombinase polymerase amplification reaction system, a reaction buffer, and a Cas12 chromatography test strip.

[0022] The crRNA sequence is 5' UAAUUUCUACUCUUGUAGAUCGCAACGUUGUUGCCAUUGCUGC 3'SEQID NO.3; The probe set includes probes for real-time fluorescence PCR detection and / or probes for visual test strip detection; the sequence of the probe for real-time fluorescence PCR detection is 5'-6-FAM-TTTTTTTTTTTT-BHQ1-3'SEQ ID NO.4, and the sequence of the probe for visual test strip detection is 5'-6-FAM-TTTTTTTTTTTT-Biotin-3'SEQ ID NO.5.

[0023] Optionally, the recombinase polymerase amplification reaction system includes reaction powder, A Buffer, and B Buffer; the reaction buffer includes C Buffer.

[0024] Optionally, the preparation method of the Cas12 chromatography test strip includes: coating AuNP-labeled anti-FAM antibody onto the conjugate pad, sequentially distributing streptavidin and goat anti-rabbit IgG antibody onto the nitrocellulose membrane to form a control line and a test line, and then assembling the absorbent pad, sample pad, conjugate pad and nitrocellulose membrane onto a plastic backing plate, cutting and drying for storage.

[0025] On the other hand, this disclosure provides the application of the above primer set in the preparation of a reagent for detecting the soil antibiotic resistance gene TEM-1.

[0026] On the other hand, this disclosure provides a rapid visualization detection method for the soil antibiotic resistance gene TEM-1, which includes the following steps: S1. Extract total DNA from soil samples; S2. Using the primer set described in the first aspect of this disclosure, the total DNA is subjected to an RPA amplification reaction to obtain RPA amplification products; S3. Add the RPA amplification product to the detection system and react at 30-40℃ for 25-35 minutes; S4. The results are observed by fluorescence signal detection or Cas12 chromatography test strips to achieve visual determination of the target gene.

[0027] Optionally, in step S3, the detection system includes 20-30 μL of RPA reaction product, 0.8-1.2 μL of 8-12 μM fluorescent probe, 0.8-1.2 μL of 1500 nM Cas12a protein, and 0.8-1.2 μL of 8-12 μM crRNA; The sequence of the crRNA is 5′ UAAUUUCUACUCUUGUAGAUCGCAACGUUGUUGCCAUUGCUGC 3′SEQID NO.3; The probe set includes probes for real-time fluorescence PCR detection and / or probes for visual test strip detection; the sequence of the probe for real-time fluorescence PCR detection is 5'-6-FAM-TTTTTTTTTTTT-BHQ1-3'SEQ ID NO.4, and the sequence of the probe for visual test strip detection is 5'-6-FAM-TTTTTTTTTTTT-Biotin-3'SEQ ID NO.5.

[0028] The present disclosure is further described in detail below through examples. All raw materials used in the examples are commercially available.

[0029] Example 1 This example illustrates the preparation of primer pairs, crRNA, and probes for detecting the soil antibiotic resistance gene TEM-1.

[0030] RPA primer pairs, crRNA, and fluorescent probes for detecting the soil antibiotic resistance gene TEM-1 were synthesized according to the following sequences. The synthesis process employed conventional nucleic acid synthesis techniques, and the purity was verified by HPLC to be ≥98%. RPA upstream primer TEM-1-F: 5' GAACCGGAGCTGAATGAAGCCATACCAAAC 3′ (SEQ ID NO.1) RPA downstream primer TEM-1-R: 5' AAACCAGCCAGCCGGAAGGGCCGAGCGCAG 3′ (SEQ ID NO.2); crRNA: 5' UAAUUUCUACUCUUGUAGAUCGCAACGUUGUUGCCAUUGCUGC 3′ (SEQ ID NO.3); Probe for real-time fluorescence PCR detection: 5'-6-FAM-TTTTTTTTTTTT-BHQ1-3' (SEQ ID NO.4) Probe for visual test strip detection: 5'-6-FAM-TTTTTTTTTTTT-Biotin-3' (SEQ ID NO.5).

[0031]

[0032] Example 2 This embodiment illustrates the assembly of the reagent kit, which includes the following components: RPA primer pairs prepared in Example 1 (all at 10 μM); crRNA prepared in Example 1 (at 10 μM); fluorescent probe set prepared in Example 1 (all at 10 μM); Cas12a protein (at 1500 nM); recombinase polymerase amplification reaction system: including reaction powder, A Buffer, B Buffer; reaction buffer: C Buffer; Cas12-specific chromatography test strips.

[0033] The preparation process of the Cas12-specific chromatography test strip is as follows: (1) Apply AuNP-labeled anti-FAM antibody to the binding pad for subsequent signal staining; (2) Using the BioDot-XYZ3060 distribution system, 2 mg / mL of streptavidin and 1 mg / mL of goat anti-rabbit IgG antibody were sequentially distributed on a nitrocellulose (NC) membrane at a ratio of 1 μL / cm to form a control line (C line) and a detection line (T line), respectively. (3) Assemble the absorbent pad, sample pad, conjugate pad and NC membrane sequentially on the plastic backing plate, with each component overlapping by 1.5-2 mm; (4) Use a CM4000 cutting machine to cut the assembled whole into strips 3 mm wide; (5) Place the cut test strips into a plastic bag, dry them at room temperature, and then seal and store them at 4°C for later use.

[0034] Example 3 This example illustrates the rapid visualization detection process for the soil antibiotic resistance gene TEM-1.

[0035] (1) Total DNA extraction from soil samples: Soil microbial DNA extraction kit (commercially available conventional product) was used to extract total DNA from the soil samples to be tested according to the kit instructions. After extraction, the samples were stored at -20℃ for later use.

[0036] (2) RPA amplification reaction: The RPA amplification reaction system was constructed (total volume 50.0 μL): 1 tube of reaction powder, 25 μL of A Buffer, 2.0 μL of 10 μM TEM-1-F primer, 2.0 μL of 10 μM TEM-1-R primer, 18.5 μL of total soil DNA sample and enzyme-free water, and 2.5 μL of B Buffer; After gently shaking and mixing the above system, instantly centrifuge to collect the liquid to the bottom of the tube; Incubate at a constant temperature of 37°C for 30 minutes to complete the amplification of the target gene TEM-1 and obtain the RPA amplification product.

[0037] Both positive and negative controls were set up: Positive control reaction system (total volume 50.0 μL): 1 tube of reaction powder, 25 μL of A Buffer, 4.0 μL of C Buffer, 13.5 μL of enzyme-free water, 5 μL of TEM-1 positive standard, 2.5 μL of B Buffer, incubated at 37°C for 30 minutes; Negative control reaction system (total volume 50.0 μL): 1 tube of reaction powder, 25 μL of A Buffer, 2.0 μL of 10 μM TEM-1-F primer, 2.0 μL of 10 μM TEM-1-R primer, 18.5 μL of negative control sample and enzyme-free water, 2.5 μL of B Buffer, incubated at 37 °C for 30 minutes.

[0038] (3) CRISPR / Cas12a detection reaction Construct the detection system (total volume 28μL): 25μL RPA amplification product, 1μL 10μM fluorescent probe (select probes for real-time fluorescent PCR or test strips according to detection requirements), 1μL 1500 nM Cas12a protein, and 1μL 10μM crRNA. After mixing the system, place it in a constant temperature environment of 37°C for 30 minutes. If using a probe for real-time fluorescence PCR, detect the fluorescence signal once per minute using a real-time fluorescence PCR instrument during the reaction.

[0039] (4) Result determination Fluorescence signal detection: If the real-time fluorescence PCR instrument detects a significant fluorescence signal peak (RFU value significantly higher than the negative control), it is judged as positive, indicating that the sample contains the TEM-1 resistance gene; if there is no fluorescence signal peak, it is judged as negative. Test strip testing: Dilute the enzyme digestion product after CRISPR / Cas12a reaction at a ratio of 1:100, take 50 μL and load it onto the sample pad of the Cas12 dedicated chromatography test strip, incubate for 3 minutes and observe: If both the control line (C line) and the test line (T line) are colored, it is judged as positive; if only the control line (C line) is colored and the test line (T line) is not colored, it is judged as negative; if the control line (C line) is not colored, it means that the test strip is invalid and needs to be tested again.

[0040] Comparative Example 1 This comparative experiment used conventional primers and crRNA combinations for detection: the same detection kit and detection procedure as the example were used, only the following components were replaced: RPA upstream primer: 5' GTCGCCCTTATTCCCTTTTTTG 3'SEQ ID NO.7, RPA downstream primer: 5' TAGTGTATGCGGCGACCGAG 3'SEQ ID NO.8; crRNA: 5' UAAUUUCUACUAAGUGUAGAUGGGGAAAUGUGCGCGGAACCCCU 3'SEQ ID NO.9, Soil samples were subjected to TEM-1 gene detection according to the steps in Example 3, and the amplification efficiency, fluorescence signal intensity and detection time, and color development effect of the test strip were recorded.

[0041] Experimental results Amplification efficiency: Agarose gel electrophoresis results are as follows Figure 1 As shown, the band brightness of the RPA amplification product in the embodiment is significantly higher than that in the comparative example, indicating that the primer pair of this disclosure has better amplification efficiency. Fluorescent signals: such as Figure 2 As shown in the figure, the parabolic curve of the fluorescence signal detected by the real-time fluorescence PCR instrument indicates that the fluorescence signal peak of the example is higher, the rise rate is faster, and the detection time is shorter; combined with Figure 3-4 The fluorescence data showed that the RFU value of the primer and crRNA combination in the example (primer 1 + crRNA1) was significantly higher than that of the control group (primer 2 + crRNA2). The RFU value of some positive samples reached 1412.92-2567.23, while the fluorescence signal intensity of the control group was weak (the RFU value of some samples was only 729.54), and the detection time was prolonged. Test strip detection: such as Figure 5 As shown, the positive samples in Example 3 all showed clear double bands (C line + T line), while the negative samples only showed the C line. The results were intuitive and accurate. In the comparative example, the T line of the positive samples was lighter in color and had low recognition, indicating that its detection sensitivity or specificity was poor.

[0042] Sensitivity determination: Construct a standard plasmid for the TEM-1 gene and calculate its copy number. The plasmid is then subjected to 10... 10 -10 -4 The samples were serially diluted to copies / μL and detected according to the RPA amplification and CRISPR / Cas12a detection procedure in Example 3, with a negative control included. Results showed no specific signal was detected at the 1 copies / μL concentration gradient and in the negative sample, while a positive signal was consistently detected at the 10 copies / μL concentration gradient. Therefore, the detection limit for the TEM-1 gene in this method is 10 copies / μL. Specificity and sensitivity verification: such as Figure 6-7 As shown, the primer pairs in the example combined with crRNA showed high specificity and no false positive results. Furthermore, sensitivity experiments verified that the low abundance of the TEM-1 gene could be detected.

[0043] The preferred embodiments of this disclosure have been described in detail above. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.

[0044] It should also be noted that the various specific technical features described in the above embodiments can be combined in any suitable manner without contradiction. To avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.

[0045] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.

Claims

1. A primer set for rapid visual detection of soil antibiotic resistance gene TEM-1, characterized in that, The primer set includes RPA primer pairs; The RPA primer pair includes the upstream primer TEM-1-F and the downstream primer TEM-1-R; TEM-1-F:5′ GAACCGGAGCTGAATGAAGCCATACCAAAC 3′SEQ ID NO.1, TEM-1-R: 5′ AAACCAGCCAGCCGGAAGGGCCGAGCGCAG 3′SEQ ID NO.2。 2. A kit for rapid visual detection of soil antibiotic resistance gene TEM-1, characterized in that, The kit includes the primer set as described in claim 1.

3. The kit of claim 2, wherein, The kit includes crRNA that specifically recognizes the target gene, a set of probes for visual detection, Cas12a protein, a recombinase polymerase amplification reaction system, a reaction buffer, and Cas12 chromatography test strips.

4. The kit according to claim 3, wherein, The sequence of the crRNA is 5' UAAUUUCUACUCUUGUAGAUCGCAACGUUGUUGCCAUUGCUGC 3' SEQ ID NO. 3; The probe set includes probes for real-time fluorescence PCR detection and / or probes for visual test strip detection; the sequence of the probe for real-time fluorescence PCR detection is 5'-6-FAM-TTTTTTTTTTTT-BHQ1-3'SEQ ID NO.4, and the sequence of the probe for visual test strip detection is 5'-6-FAM-TTTTTTTTTTTT-Biotin-3'SEQ ID NO.

5.

5. The kit according to claim 3, wherein, The recombinase polymerase amplification reaction system includes reaction powder, A Buffer, and B Buffer; the reaction buffer includes C Buffer.

6. The kit according to claim 3, wherein, The preparation method of the Cas12 chromatography test strip includes: coating AuNP-labeled anti-FAM antibody onto the conjugate pad, sequentially distributing streptavidin and goat anti-rabbit IgG antibody onto the nitrocellulose membrane to form a control line and a test line, and then assembling the absorbent pad, sample pad, conjugate pad and nitrocellulose membrane onto a plastic backing plate, cutting and drying for storage.

7. The application of the primer set described in claim 1 in the preparation of a reagent for detecting the soil antibiotic resistance gene TEM-1.

8. The use of the kit according to any one of claims 2-6 in the preparation of a soil antibiotic resistance gene TEM-1 detection reagent.

9. A rapid visual detection method for the soil antibiotic resistance gene TEM-1, characterized in that, The method includes the following steps: S1. Extract total DNA from soil samples; S2. Using the primer set described in claim 1, perform RPA amplification on the total DNA to obtain RPA amplification products; S3. Add the RPA amplification product to the detection system and react at 30-40℃ for 25-35 minutes; S4. The results are observed by fluorescence signal detection or Cas12 chromatography test strips to achieve visual determination of the target gene.

10. The visualization detection method according to claim 9, wherein, In step S3, the detection system includes 20-30 μL of RPA reaction product, 0.8-1.2 μL of 8-12 μM fluorescent probe, 0.8-1.2 μL of 1500 nM Cas12a protein, and 0.8-1.2 μL of 8-12 μM crRNA; The sequence of the crRNA is 5′ UAAUUUCUACUCUUGUAGAUCGCAACGUUGUUGCCAUUGCUGC 3′SEQ ID NO.3; The fluorescent probes include probes for real-time fluorescent PCR detection and / or probes for visual test strip detection; the sequence of the probe for real-time fluorescent PCR detection is 5'-6-FAM-TTTTTTTTTTTT-BHQ1-3'SEQ ID NO.4, and the sequence of the probe for visual test strip detection is 5'-6-FAM-TTTTTTTTTTTT-Biotin-3'SEQ ID NO.5.