SNP molecular markers related to growth traits of yaks and their application in breeding
By detecting the SNP molecular markers of the yak DICER1 gene, especially the nucleotide sequence at position 64402305 on chromosome 17, yak individuals with the TT genotype were screened for breeding. This solved the problem of insufficient growth performance in yaks, significantly improved their weight and body shape, and promoted the development of the yak industry.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS
- Filing Date
- 2026-05-21
- Publication Date
- 2026-06-30
Smart Images

Figure CN122303448A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology detection technology, and in particular to SNP molecular markers related to growth traits in yaks and their application in breeding. Background Technology
[0002] Yaks are mainly concentrated in the Qinghai-Tibet Plateau and surrounding high-altitude, cold regions. They are the only cattle breed capable of generating economic benefits from pasture resources in these areas, providing local herders with the vast majority of their production and livelihood resources. This is of great significance to the economic development of Tibetan areas and the improvement of herders' living standards. However, yaks have long lived in high-altitude, oxygen-deficient conditions with a dry season lasting up to six months, resulting in smaller body weight and size, and lower milk and meat production performance compared to other yaks and ordinary cattle. Therefore, protecting and developing yak genetic resources, improving yak growth performance, and promoting the development of the yak industry are of great importance.
[0003] Single nucleotide polymorphisms (SNPs), often referred to as third-generation DNA genetic markers, are polymorphisms caused by the substitution of a single nucleotide in the genome sequence. They offer advantages such as high distribution density, stable heritability, and the ability to be analyzed automatically. Substitution refers to the substitution between purine bases (A and G) and pyrimidine bases (T and C). SNPs appearing in coding regions can affect gene function, leading to changes in biological traits, and thus can serve as biomarkers associated with certain traits. SNP analysis is widely used in livestock research and can serve as a potential molecular marker to assist in livestock breeding, thereby improving livestock production and reproductive performance.
[0004] The DICER1 gene encodes the Dicer protein, a ribonuclease belonging to the IIIb family of RNases. This RNase is a crucial endonuclease for the generation of single-stranded mature miRNAs and small interfering RNAs (siRNAs) from stem-loop precursor microRNAs. By encoding an endonuclease, the DICER1 gene participates in the processing and maturation of miRNAs and siRNAs, thereby regulating the expression of numerous target genes at the posttranscriptional level. DICER1 is indispensable in early embryonic development; its absence often leads to embryonic arrest or even death. It also participates in the development of the muscle, nervous, and reproductive systems by regulating cell differentiation and organogenesis. Furthermore, DICER1 can influence cell proliferation, metabolism, and individual growth rate by affecting key growth regulatory pathways such as IGF and mTOR, thus impacting animal body size and production performance. Screening for individuals with superior DICER1 genotypes can aid in the breeding of yak breeds with better growth traits, thereby improving the economic benefits of yak farming. Summary of the Invention
[0005] The purpose of this invention is to provide SNP molecular markers related to yak growth traits and their application in breeding, so as to solve the problems existing in the prior art.
[0006] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of the present invention is an SNP molecular marker related to the growth traits of yak. The SNP molecular marker is located at position 64402305 on chromosome 17 of the yak genome, and is the nucleotide sequence shown in SEQ ID NO.1. The 501st base of the nucleotide sequence is C or T. The yak reference genome version for the SNP molecular marker is Bosgu_v3.0, and the EuroPean Nucleotide Archive accession number is GCA_005887515.1.
[0007] The second technical solution of the present invention is a primer set for specific detection of the SNP molecular marker, which consists of an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.
[0008] The third technical solution of the present invention is a kit for specifically detecting the SNP molecular marker, comprising the primer set.
[0009] The fourth technical solution of the present invention involves the application of the SNP molecular marker, the primer set, or the reagent kit, wherein the application is any one of the following: (1) Application in detecting growth traits in yaks; (2) Application in the preparation of products for detecting growth traits of yaks; (3) Application in assisted breeding of yak growth traits.
[0010] The fifth technical solution of this invention is a method for detecting growth traits in yaks, comprising the following steps: (1) Extract genomic DNA from the yak to be tested; (2) The genomic DNA is amplified by PCR using the primer set or the kit to obtain PCR amplification products; (3) Perform genotyping detection on the PCR amplification products, and judge the growth traits of the yak to be tested based on the genotyping results.
[0011] The sixth technical solution of the present invention is a method for breeding a new breed of yak with excellent growth traits, comprising the following steps: (1) extracting genomic DNA from the yak to be tested; (2) The genomic DNA is amplified by PCR using the primer set or the kit to obtain PCR amplification products; (3) The PCR amplification products were subjected to genotyping detection, and yak individuals with the TT genotype were selected for breeding.
[0012] Based on the above technical solution, the present invention has the following technical effects: This invention analyzes the correlation between locus genotypes and yak growth traits, identifying SNP loci associated with these traits. The SNP molecular markers are located at position 64402305 on chromosome 17 of the yak reference genome Bosgu_v3.0 EuroPean Nucleotide Archive accession number GCA_005887515.1, with a mutation of C or T. Based on genotyping, individual yak genotypes were classified into CC, CT, and TT. Yaks with genotype TT had significantly higher body weight and height than those with genotypes CT and CC (P<0.05). Yaks with genotype TT also had significantly higher body length and chest circumference than those with genotype CC (P<0.05). PCR and gene sequencing can be used to quickly identify corresponding traits, which can be used for molecular marker-assisted breeding of yaks. It is not limited by yak breed or age. Therefore, in production, individuals with the TT genotype at this locus can be selected as parents for large-scale breeding, which greatly accelerates the accuracy and effectiveness of selection of yak growth traits and improves the economic benefits of yak breeding. Attached Figure Description
[0013] Figure 1 These are sequencing peak diagrams for three genotypes in this embodiment of the invention. Wherein, a represents the CC genotype, b represents the CT genotype, and c represents the TT genotype. Detailed Implementation
[0014] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.
[0015] This invention provides an SNP molecular marker related to growth traits in yaks. The SNP molecular marker is located at position 64402305 on chromosome 17 of the yak genome, and is the nucleotide sequence shown in SEQ ID NO.1, where the 501st base of the nucleotide sequence is C or T. The yak reference genome version for the SNP molecular marker is Bosgu_v3.0, and the EuroPean Nucleotide Archive accession number is GCA_005887515.1.
[0016] In some specific implementations, the SNP molecular markers include genotypes CC, CT, and TT.
[0017] This invention also provides a primer set for the specific detection of the SNP molecular marker, consisting of an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.
[0018] This invention also provides a kit for specifically detecting the SNP molecular marker, including the primer set.
[0019] This invention also provides applications of the SNP molecular marker, the primer set, or the kit, wherein the application is any one of the following: (1) Application in detecting growth traits in yaks; (2) Application in the preparation of products for detecting growth traits of yaks; (3) Application in assisted breeding of yak growth traits.
[0020] In some specific implementations, the growth traits include at least one of body weight, body height, body length, and chest circumference.
[0021] This invention also provides a method for detecting growth traits in yaks, comprising the following steps: (1) Extract genomic DNA from the yak to be tested; (2) The genomic DNA is amplified by PCR using the primer set or the kit to obtain PCR amplification products; (3) Perform genotyping detection on the PCR amplification products, and judge the growth traits of the yak to be tested based on the genotyping results.
[0022] In some specific implementation schemes, the method for judging the growth traits of the yaks to be tested based on the genotyping results is as follows: the weight and height of yak individuals with genotype TT are significantly higher than those with genotypes CT and CC; the body length and chest circumference of yak individuals with genotype TT are significantly higher than those with genotype CC.
[0023] This invention also provides a method for breeding a new yak breed with excellent growth traits, comprising the following steps: (1) Extract genomic DNA from the yak to be tested; (2) The genomic DNA is amplified by PCR using the primer set or the kit to obtain PCR amplification products; (3) The PCR amplification products were subjected to genotyping detection, and yak individuals with the TT genotype were selected for breeding.
[0024] This invention utilizes multiple primer pairs designed sequentially to amplify yak DNA via PCR using the DICER1 gene fragment (SEQ ID NO.1), followed by gene sequencing. Genotyping analysis of the target fragment amplified by one primer pair (SEQ ID NO.2 and SEQ ID NO.3) revealed a single SNP site with three genotypes. Analysis using MEGA 11.0 and BioEdit software identified the SNP site located at nucleotide 501 of the SEQ ID NO.1 fragment. Further analysis using SPSS 25.0 software revealed the correlation between the genotype of the mutation site and growth traits in individual yaks. The results showed that yaks with genotype TT had significantly higher body weight and height than those with genotypes CT and CC (P<0.05). Furthermore, yaks with genotype TT had significantly higher body length and chest circumference than those with genotype CC (P<0.05).
[0025] Example 1 SNP site identification (1) Sample collection of Tianzhu white yak This invention uses the Tianzhu White Yak breed as the testing subject, collecting blood samples from 536 Tianzhu White Yaks in Xiamiaoergou Village, Dachaigou Town, Tianzhu Tibetan Autonomous County, Wuwei City, Gansu Province. Growth performance of the Tianzhu White Yaks was measured, including weight, height, body length, and chest circumference. 4ml of blood was collected from the jugular vein using EDTA anticoagulant blood collection tubes and stored at -20℃.
[0026] (2) Isolation, extraction and purification of genomic DNA Genomic DNA was extracted from blood samples of Tianzhu white yaks using the TIANamP Blood Genomic DNA Kit; DNA quality and concentration were determined by 1.5% agarose gel electrophoresis and Thermo Scientific Nano DroP 2000c.
[0027] (3) Primer design and screening Based on the DICER1 gene of Tianzhu white yak published by Ensemble (accession number: ENSBGRG00000016499), multiple primer pairs were designed on its DNA sequence using Primer 5.0 software. PCR amplification was performed on Tianzhu white yak DNA samples, and the gene sequencing results were analyzed. A pair of primers containing an SNP site was selected, and its primer sequence information is as follows: F: 5'-CTGCCTCCAATGCCAGAGAC-3' (SEQ ID NO. 2); R: 5'-TCTTGCAGGTTTTTGTTTTCCTCAT-3' (SEQ ID NO. 3).
[0028] (4) PCR amplification of the target gene fragment The PCR reaction system consisted of 25 μL: 12.5 μL of 2× Taq PCR Mix, 1 μL of DNA template (100 ng / μL), 1 μL each of upstream and downstream primers (10 μmol / L), and 9.5 μL of enzyme-free sterile water.
[0029] PCR amplification program: 94 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 30 s, 59 ℃ annealing for 30 s, 72 ℃ extension for 1 min, 30 cycles; 72 ℃ extension for 5 min, cooling at 4 ℃. After amplification, the amplification products were detected by electrophoresis on a 1.5% agarose gel.
[0030] (5) Gene sequencing The PCR reaction solution, after passing the tests, was sent to Shanghai Sangon Biotech Co., Ltd. for bidirectional Sanger sequencing. The amplified target sequence is shown in SEQ ID NO.1, and the SNP site is located at position 501 of the sequence shown in SEQ ID NO.1. The sequencing peak diagram at the mutation site is shown below. Figure 1 As shown.
[0031] SEQ ID NO.1: AAAAAGAAAGTACATTTTTAAAGAGTGAAAGGGAGTCAAGCTCCAGCAGGACCAGCTCATCAAGCACAAAACACAGTAAGAATTTAGAAGGAGGTAGAAATGTGATGTAAGTCAAGGGGTACAAAGTTATAAGAATAAGTTCTGAGGCTCTAATGTATACCATGGTGACTACAGCTAATAATATGGTAGTGAATACTCAAAGTTGCTGAGAATTCGTCAGCATTCTCATCACACACACAAAAAGT TAACTATGTGAGGAGATATATATATATATATGGCTATATATATATATACACACACACATATACATAGGGCTTCCCTGGTGGCTCAGAGGTTAAAGCACCTGCCTCCAATGCCAGAGACCCGGGTTT GATCCCTGGGTCGGGAAGATCCCCTGGAGAAGGAAATGGTAACCCACTCCAGTATTCTTGCCTGGAGAATCCCATGGACGGAGAAGCCTGGTAGGCTACAGTCCACGGGGTCGCAAAGAGTCTGACA CGACTGAGCGACTTCACTGGAGATAGATAGATATATATATAACTATTCTGGTCTTGGTTGATCAGTCTGCAACGTCAGTGTGTGTCAAATCATCAGAGTGTACTGTTTATTTCCAATTATTCCTTATAAAGTTAAAAACTTATGAGGAAAACAAAAACCTGCAAGATTATCAGCATTTCTGTTTCAATGATCTATTGCTGTATAATAAAACACCATAAAATGTGGCACTCAAAAAAAGTCTCAATTTGTTA TTTTTCATAATTCTGTGAGACAGGAATTCAGGCAGGGTTCAAGCTGGGTGGTTCTTCTGCTCCACATGCAATAGGCAGGGATCACTCACTCCTCTGGCTTCAGCAGGCAGCCACCTAGATATCAC TGTGGAGTCTGACTCCTGAATGCTCCTCTCCTTTTTCTCTTCCCGCCCGCCTCCCACTTCATTCAGTCTTCCATCTTCAGTTACTTTTCAGCAGGCCACTGGCTCCCACAGAGCACAAAAGCAGA.
[0032] Note: The underlined positions are SNP sites.
[0033] Example 2 Correlation between different genotypes of SNP molecular marker sites and growth traits (1) Genotyping All individuals underwent steps (4) and (5) of Example 1 to determine their specific genotypes based on gene sequencing results. Three genotypes were detected in the test population, and the genotype frequencies and allele frequencies are shown in Table 1.
[0034] Table 1. Genotypes and allele frequencies of the DICER1 gene SNP locus in Tianzhu white yak.
[0035] Genotyping of blood DNA samples from 536 Tianzhu white yaks using PCR and gene sequencing revealed three genotypes at the DICER1 gene SNP molecular marker site: homozygous CC, heterozygous CT, and homozygous TT. The frequencies of the three genotypes were 0.493 (CC), 0.409 (CT), and 0.099 (TT).
[0036] (2) Association analysis between SNP genotype and growth trait phenotypic values To determine whether the SNP marker prepared in this invention is related to the differences in growth traits of Tianzhu white yaks, least squares statistical correlation analysis was performed on the three genotypes of the SNP locus at position 501 on the fragment of SEQ ID NO.1 and the phenotypic values of body weight, body height, body length, and chest circumference of Tianzhu white yaks using SPSS 25.0 software. The association between the genotype of this SNP locus and the growth traits was calculated, and the results are shown in Table 2.
[0037] Table 2. Association analysis of DICER1 gene polymorphism and growth traits in Tianzhu white yak.
[0038] Note: Different lowercase superscript letters indicate significant differences (P<0.05), and * indicates significant differences (P<0.05).
[0039] The model used is as follows: Y j =μ+G j +e j ; where Y j G represents the observed growth trait value. j The genetic effect of genotype j; μ e represents the overall mean of each trait; j This indicates the random residual effect. Differences between groups were tested using LSD multiple comparisons, and the results are expressed as Mean ± SD.
[0040] Table 2 shows that the polymorphism at locus 64402305 on chromosome 17 of Tianzhu white yaks was significantly correlated with body weight, height, body length, and chest circumference (P<0.05). Specifically, Tianzhu white yaks with genotype TT had significantly higher body weight and height than those with genotypes CT and CC (P<0.05). Furthermore, Tianzhu white yaks with genotype TT had significantly higher body length and chest circumference than those with genotype CC (P<0.05).
[0041] This embodiment identified a SNP marker significantly associated with the growth traits of Tianzhu white yaks. Therefore, selecting individuals with the dominant genotype will help improve the growth traits of Tianzhu white yaks. The mutation site of this invention can be used as a potential genetic marker to improve the growth performance of Tianzhu white yaks for auxiliary selection.
[0042] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. A SNP molecular marker associated with a growth trait of a yak, characterized in that, The SNP molecular marker is located at position 64402305 on chromosome 17 of the yak genome, and is the nucleotide sequence shown in SEQ ID NO.1, where the 501st base is C or T. The yak reference genome version for the SNP molecular marker is Bosgu_v3.0, and the EuroPean Nucleotide Archive accession number is GCA_005887515.
1.
2. The SNP molecular marker of claim 1, wherein, The SNP molecular markers include genotypes CC, CT, and TT.
3. A primer set for specifically detecting the SNP molecular marker according to claim 1 or 2, characterized in that, It consists of an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.
3.
4. A kit for specific detection of the SNP molecular marker according to claim 1 or 2, characterized in that, Includes the primer set described in claim 3.
5. The application of the SNP molecular marker of claim 1 or 2, the primer set of claim 3, or the kit of claim 4, characterized in that, The application is any one of the following: (1) Application in detecting growth traits in yaks; (2) Application in the preparation of products for detecting growth traits of yaks; (3) Application in assisted breeding of yak growth traits.
6. The application according to claim 5, characterized in that, The growth traits include at least one of body weight, body height, body length, and chest circumference.
7. A method for detecting growth traits in yaks, characterized in that, Includes the following steps: (1) Extract genomic DNA from the yak to be tested; (2) The genomic DNA is amplified by PCR using the primer set of claim 3 or the kit of claim 4 to obtain PCR amplification products; (3) Perform genotyping detection on the PCR amplification products, and judge the growth traits of the yak to be tested based on the genotyping results.
8. The method according to claim 7, characterized in that, The method for judging the growth traits of the yaks to be tested based on the genotyping results is as follows: the weight and height of yaks with genotype TT are significantly higher than those with genotypes CT and CC; the body length and chest circumference of yaks with genotype TT are significantly higher than those with genotype CC.
9. A method for breeding a new yak breed with superior growth traits, characterized in that, Includes the following steps: (1) Extract genomic DNA from the yak to be tested; (2) The genomic DNA is amplified by PCR using the primer set of claim 3 or the kit of claim 4 to obtain PCR amplification products; (3) The PCR amplification products were subjected to genotyping detection, and yak individuals with the TT genotype were selected for breeding.