A composite material having photothermal effect and peroxidase-like function and its use for biosensors

Abstract

This invention belongs to the field of biosensor fabrication methods, specifically relating to a composite material with photothermal effect and peroxidase-like function, and its application in biosensors. The composite material with photothermal effect and peroxidase-like function is AuNPs / Cu. 2‑x Se. Composite material AuNPs / Cu 2‑x Se was used to prepare a photothermal-colorimetric dual-mode biosensor based on magnetic separation. This magnetically separated photothermal-colorimetric dual-mode biosensor is used to detect the SRB aprA gene. The AuNPs / Cu of this invention possesses both photothermal effect and peroxidase-like dual functions. 2‑ x Se materials can generate photothermal signals. When preparing biosensors, they can simultaneously catalyze the generation of oxTMB, which has a significant photothermal effect, thereby synergistically amplifying the photothermal detection signal with oxTMB. The absorbance of the solution corresponding to oxTMB is used as a colorimetric signal to achieve excellent dual-mode analysis.

Description

Technical Field

[0001] This invention belongs to the field of biosensor fabrication methods, specifically relating to a composite material with photothermal effect and peroxidase-like function and its application in biosensors. Background Technology

[0002] Developing marine resources and promoting the coastal economy are of great strategic significance to my country's national economy. However, marine corrosion seriously restricts the healthy service and safe operation of marine facilities such as marine equipment and marine engineering platforms, attracting widespread attention in the field of marine engineering. Material corrosion caused by microorganisms and their metabolic products is called microbial corrosion. Statistics show that 20% of corrosion in the marine environment is caused by microorganisms. Among the many corrosive marine microorganisms, sulfate-reducing bacteria (SRB) frequently appear in the metal corrosion of marine engineering equipment and are among the most widespread and highly corrosive microorganisms in microbial corrosion research.

[0003] Common SRB detection methods include the maximum probable number method (MPN), polymerase chain reaction (PCR), and immunoassay, but these methods typically suffer from drawbacks such as complex operation, long processing time, insufficient sensitivity, and poor environmental adaptability. With the rapid development of nanotechnology and biosensing technology, biosensor technology utilizes SRB metabolites, cellular structures, and characteristic genetic material as recognition targets, significantly improving detection efficiency and accuracy. However, current biosensing strategies mostly focus on single targets or detection modes, making it difficult to meet the needs for multiplex validation and interference resistance in complex environments. Therefore, there is an urgent need to develop more sensitive and specific SRB detection technologies.

[0004] Among various colorimetric detection systems, the most commonly used is the TMB-H₂O₂-nanomaterial catalytic system. After TMB is oxidized to oxTMB, the system changes color, generating a colorimetric signal that is easily identifiable by the naked eye and can be measured by absorbance. Simultaneously, oxTMB has been confirmed as a photothermal active material, exhibiting photothermal properties driven by near-infrared lasers. It is noteworthy that some nanomaterials may possess both photothermal and nanozyme activities; they can generate photothermal signals themselves and simultaneously catalyze the production of oxTMB with a photothermal effect. However, reports on their dual-mode photothermal and colorimetric detection characteristics are scarce. Summary of the Invention

[0005] To address the necessity of SRB detection and the limitations of traditional detection methods, this invention aims to provide a composite material with photothermal effect and peroxidase-like function, and its application in a biosensor. The photothermal-colorimetric dual-mode biosensor based on magnetic separation can achieve rapid, intuitive, sensitive, and specific detection of the SRB aprA gene.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A composite material with photothermal effect and peroxidase-like function, wherein the composite material is AuNPs / Cu 2- x Se.

[0007] A method for preparing the composite material includes the following steps: Step 1: Cu 2-x Se preparation: SeO2 solution was dispersed in CTAB solution and mixed with ascorbic acid solution; CuSO4·5H2O and ascorbic acid mixed solution were added to the reaction system to react and obtain Cu. 2-x Se; Step 2: AuNPs / Cu 2-x Se preparation: Cu 2-x When a Se dispersion is added to a HAuCl4 solution, the reaction yields AuNPs / Cu. 2-x Se.

[0008] Specifically: Step 1: Cu 2-x Se preparation: SeO2 solution was dispersed in CTAB solution and mixed with ascorbic acid solution. The mixture was stirred at 20℃-25℃ for 10-20 min, and the color of the mixture changed from colorless to orange. A light green solution produced by rapidly mixing CuSO4·5H2O and ascorbic acid solution was added to the reaction system, and the color changed from orange to brown. After reacting in a water bath at 30-40℃ for 3-4 h, a dark brown solution was formed, indicating the formation of Cu. 2-x Se nanoparticles. The prepared nanoparticles were centrifuged to remove excess CTAB and ascorbic acid.

[0009] Step 2: AuNPs / Cu 2-x Se preparation: Cu 2-x Se dispersion was added to a HAuCl4 solution (HAuCl4 volume fraction 0.01%-0.02%), and the reaction mixture was stirred at 25-35℃ for 3-4 h to obtain AuNPs / Cu. 2-x Se. Centrifuge for 5-10 min to purify AuNPs / Cu. 2-x Se.

[0010] In step 1, the volume ratio of SeO2, CTAB and ascorbic acid solution is 1-2:180-200:4-5, preferably 1:45:4; The molar ratio of SeO2, CTAB and ascorbic acid solution is 100-200 mM: 0.25-0.3 mM: 400-500 mM; The volume ratio of CuSO4·5H2O to ascorbic acid solution in the mixed solution is 1-2:4-5, preferably 1:4; The molar ratio of CuSO4·5H2O to ascorbic acid solution in the mixed solution of CuSO4·5H2O and ascorbic acid is 0.1-0.2M : 0.4-0.5M; In step 2, Cu 2-x The volume ratio of Se to HAuCl4 solution is 1.5-2:8-10.

[0011] One application of the aforementioned composite material, the AuNPs / Cu composite material 2-x Se was used to prepare a photothermal-colorimetric dual-mode biosensor based on magnetic separation.

[0012] The AuNPs / Cu with photothermal effect and peroxidase-like function described above 2-x Se material was modified into hairpin DNA, and the other end of the hairpin DNA was bound to a magnetic bead to obtain a photothermal-colorimetric dual-mode biosensor based on magnetic separation.

[0013] The fabrication method of the photothermal-colorimetric dual-mode biosensor based on magnetic separation is as follows: Step 1: H hair clip - AuNPs / Cu 2-x Se material solution preparation: The hairpin H solution was heated at 90-95℃ for 5-10 min, then cooled in an ice bath for 5-10 min, and then incubated at 20℃-25℃ for 1-2 h; the hairpin H solution was then mixed with AuNPs / Cu 2-x Mix with Se solution and incubate for 2-4 hours. Centrifuge the product for 20-30 minutes and wash with PBS. Unbound hairpin H atoms are completely removed, yielding H hairpin-AuNPs / Cu. 2-x SE materials; Hairpin H and AuNPs / Cu 2-x Se volume ratio: 1:10; Step 2: Combine the magnetic beads with the H-hairpin-AuNPs / Cu prepared in Step 1. 2-x Se material solution was added to buffer (containing TE buffer, NaCl, and Tween), and incubated with shaking at 20℃-25℃ for 30-40 min. The magnetic beads were washed with buffer and collected by magnetic separation using a magnetic rack to obtain a photothermal-colorimetric dual-mode biosensor based on magnetic separation.

[0014] Magnetic beads, H hairpins - material solution to buffer volume ratio: 1-1.2:1.8-2:3-3.2; The aforementioned photothermal-colorimetric dual-mode biosensor based on magnetic separation is used to detect the SRB aprA gene.

[0015] The method for detecting the SRB aprA gene is as follows: A photothermal-colorimetric dual-mode biosensor based on magnetic separation is constructed. The three-dimensional probe TWJ is prepared by heating 5 μM L-stranded DNA to 90-95 °C for 10-15 min to obtain stable TWJ. The target DNA forms a DNA nanoloop with the TWJ. The HCR reaction triggers the cleavage of the sensor structure, releasing the material label. Magnetic separation is used to obtain a supernatant containing the bifunctional material for TMB oxidation. The absorbance of the solution and the temperature change are used as sensor signal outputs for photothermal-colorimetric dual-mode quantitative analysis of the SRB aprA gene.

[0016] The main testing steps include the following: The method for obtaining the supernatant containing the bifunctional material using magnetic separation is as follows: a mixture of TWJ and target fragments of different concentrations is added to a magnetic bead dispersion (a photothermal-colorimetric dual-mode biosensor based on magnetic separation), co-incubated at 37-40℃, the hairpins at the top of the magnetic beads are opened for 2-3 hours, and then the ends of the H chains of the hairpins are digested with Nt.BstNB I enzyme for 1-1.5 hours to release the material labeling chain. The supernatant is obtained by magnetic separation using a magnetic rack.

[0017] The supernatant containing the bifunctional material was added to H2O2, TMB and PBS and reacted in the dark for 10-20 minutes. The solution was then divided into two parts for two detection modes.

[0018] The dosage of Nt.BstNB I enzyme is 5-10 μL, the dosage of H2O2 is 100-200 μL at a concentration of 20 mM, the dosage of TMB is 200-300 μL at a concentration of 1.5 mM, and the dosage of PBS is 400-500 μL at a concentration of 10 mM.

[0019] Photothermal mode detection: The solution is subjected to photothermal detection using an 808nm near-infrared light source (1W). The light-on time is 280-320s, and the temperature change value is recorded using a temperature sensor.

[0020] Colorimetric detection: The absorption spectrum of the solution is collected by using an ELISA reader with a scanning range of 400-800 nm to obtain the characteristic absorbance value corresponding to 650 nm.

[0021] The principle of the photothermal-colorimetric dual-mode biosensor based on magnetic separation for detecting the SRB aprA gene described in this invention is as follows: AuNPs / Cu 2-x Se materials possess both photothermal effects and peroxidase-like functions, combining AuNPs / Cu 2-xSe material was used to modify hairpin DNA, with biotin modified at the other end of the hairpin DNA, enabling it to bind to streptavidin-modified magnetic beads. The target DNA participated in the formation of DNA nanoloops, which were cleaved with the assistance of endonucleases, releasing the material label. The cleavage cycle was triggered by the HCR reaction, resulting in an enhanced signal response. Magnetic separation was used to obtain a supernatant containing the bifunctional material for TMB oxidation. The absorbance of the solution was used as the colorimetric mode signal, AuNPs / Cu 2-x The temperature change in the system, influenced by the interaction of Se and oxTMB, serves as a photothermal mode signal. When the target fragment, the aprA gene, is absent, DNA nanorings cannot form, and the material marker is not cleaved and released. Therefore, the supernatant collected by magnetic separation contains no material, preventing TMB oxidation and resulting in low temperature change and absorbance. When the aprA gene is present, the material marker is cleaved and released through DNA nanoring formation, with the release amount correlated with the target concentration. Collecting the material in the supernatant via magnetic separation catalyzes TMB oxidation, significantly increasing both temperature change and absorbance. Therefore, both the system temperature change (ΔT) and absorbance (A) are positively correlated with the aprA gene concentration. The aprA gene content can be determined through the linear relationship between ΔT and the logarithmic concentration of the aprA gene; similarly, the aprA gene content can be determined through the linear relationship between A and the logarithmic concentration of the aprA gene.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) The AuNPs / Cu of the present invention has dual functions of photothermal effect and peroxidase-like properties. 2-x Se materials can generate photothermal signals. When preparing biosensors, they can simultaneously catalyze the generation of oxTMB, which has a significant photothermal effect, thereby synergistically amplifying the photothermal detection signal with oxTMB and achieving excellent dual-mode analysis. (2) The photothermal-colorimetric dual-mode biosensor based on magnetic separation of the present invention has the advantages of fast response speed of colorimetric method, naked-eye visual detection and low background signal and intuitive signal of photothermal detection. Through mutual verification of the two modes, it provides stronger anti-interference and more reliable results. (3) The photothermal-colorimetric dual-mode biosensor based on magnetic separation of the present invention utilizes magnetic separation technology to rapidly and effectively extract and separate materials, reducing losses during the collection process and lowering background interference. At the same time, through the synergistic magnetic separation and HCR mechanism, it achieves efficient target enrichment and signal amplification, enhancing the sensitivity and responsiveness of the biosensor; (4) The photothermal-colorimetric dual-mode biosensor based on magnetic separation of the present invention uses temperature change value and absorbance value to detect the concentration of aprA gene in SRB in a dual mode. It has the advantages of low cost, easy signal detection, high operability and reliable results, which improves the intuitiveness of the detection results and the convenience of detection. Attached Figure Description

[0023] Figure 1 This is a schematic diagram illustrating the construction and detection process of the dual-mode biosensor provided in an embodiment of the present invention; Figure 2 TMB (a), a mixture of TMB and H2O2 (b), AuNPs / Cu 2-x Se and H2O2 mixture (c), AuNPs / Cu 2- x Se and TMB mixture (d) and AuNPs / Cu 2-x UV-Vis absorption spectrum of Se mixed with H2O2 and TMB (e); Figure 3 For HRP and AuNPs / Cu 2-x UV-Vis absorption spectrum of Se in the presence of TMB and H2O2 (A); HRP and AuNPs / Cu 2-x Photothermal properties of Se in the presence of TMB and H2O2 (B); Figure 4 The dual-mode biosensor provided in this embodiment of the invention utilizes photothermal signals (A) and colorimetric signals (B) when magnetic separation is not used. Figure 5 The following are examples of the dual-mode biosensor provided in this invention: temperature change values ​​at different target concentrations (A); linear relationship between target concentration and temperature change values ​​(B); absorbance values ​​at different target concentrations (C); and linear relationship between target concentration and absorbance (D). Figure 6 The detection selectivity diagram of the dual-mode biosensor provided in the embodiments of the present invention: photothermal mode (A), colorimetric mode (B); Figure 7 The detection stability diagram of the dual-mode biosensor provided in the embodiments of the present invention: photothermal mode (A), colorimetric mode (B); Figure 8 The detection repeatability diagram of the dual-mode biosensor provided in the embodiments of the present invention: photothermal mode (A), colorimetric mode (B). Detailed Implementation

[0024] The present invention will be further illustrated by specific embodiments below, which will help those skilled in the art to have a more comprehensive understanding of the present invention, but will not limit the present invention in any way.

[0025] The main instruments used in the embodiments of this invention, and other experimental conditions not specifically specified, were performed according to standard procedures or the recommendations of the instrument manufacturers. DNA sequences were purchased from Qingdao Ruiboxingke Biotechnology Co., Ltd., and Nt.BstNB I enzyme was purchased from Jiangsu Yugong Biotechnology Co., Ltd.

[0026] This invention prepares AuNPs / Cu with photothermal effect and peroxidase-like function. 2-x This invention utilizes a Se material to obtain a photothermal-colorimetric dual-mode biosensor based on magnetic separation. The method involves a DNA nanoring formed with the participation of target DNA, triggering a cleavage cycle through an HCR reaction. This releases the material label, and magnetic separation yields a supernatant containing the bifunctional material for TMB oxidation. The absorbance of the solution serves as the colorimetric mode signal, while the temperature change of the system serves as the photothermal mode signal. This method enables rapid, intuitive, sensitive, and specific dual-mode detection of the SRBaprA gene.

[0027] Example 1 AuNPs / Cu composite material with photothermal effect and peroxidase-like function 2-x Preparation of Se: Step 1: Cu 2-x Se preparation: 50 μL of SeO2 solution (0.2 M) was dispersed in 9 mL of CTAB (0.27 mM) aqueous solution and mixed with 200 μL of ascorbic acid solution (0.4 M). The mixture was stirred at 25 °C for 15 min, and the color of the mixture changed from colorless to orange. A light green solution produced by rapidly mixing CuSO4·5H2O (200 μL, 0.1 M) and ascorbic acid solution (800 μL, 0.4 M) was added to the reaction system, and the color changed from orange to brown. After reacting in a water bath at 35 °C for 3 h, a dark brown solution was formed, indicating the formation of Cu. 2-x Se nanoparticles. The prepared nanoparticles were centrifuged at 10,000 rpm to remove excess CTAB and ascorbic acid.

[0028] Step 2: AuNPs / Cu 2-x Se preparation: 2 mL (1 mg·mL⁻¹) -1 Cu 2-x The Se NPs dispersion was added to 8 mL of HAuCl4 (HAuCl4 volume fraction 0.01%) solution, and the reaction mixture was stirred at 30 °C for 3 h to obtain AuNPs / Cu 2- x Se. Purify AuNPs / Cu by centrifugation at 10000 rpm for 10 min. 2-x Se.

[0029] Example 2 Construction of a photothermal-colorimetric dual-mode biosensor based on magnetic separation: Step 1: Preparation of H hairpin material solution: The hairpin H solution was heated at 95°C for 5 min, then rapidly cooled in an ice bath for 5 min, and then incubated at 25°C for 1.5 h. 100 μL of hairpin H solution (5 μM) was mixed with 1 mL (1 mg / mL) of AuNPs / Cu prepared in Example 1. 2-x Se was mixed and incubated with gentle shaking at 37°C for 3 hours. The product was centrifuged at 12000 rpm for 30 minutes. After washing three times with PBS (10 mM, pH 7.4), unbound hairpin H was completely removed, yielding H hairpin-AuNPs / Cu. 2-x Se materials.

[0030] Step 2: As Figure 1 As shown, 100 μL of magnetic beads (10 mg / mL) and 180 μL of H hairpin-AuNPs / Cu were mixed. 2-x The Se material dispersion was added to 320 μL of buffer (containing TE buffer, 1 M NaCl, and 0.1% Tween) and incubated at 25 °C with shaking for 30 min. The magnetic beads were washed three times with buffer and then magnetically separated using a magnetic rack to obtain a photothermal-colorimetric dual-mode biosensor based on magnetic separation.

[0031] Example 3 The SRB aprA gene was detected using the photothermal-colorimetric dual-mode biosensor electrode based on magnetic separation, as described in Example 2. Preparation of the triaxial probe TWJ: as follows Figure 1 As shown, 5 μM L-stranded DNA was heated to 90 °C for 15 min to obtain stable TWJ.

[0032] Magnetic separation to obtain supernatant: such as Figure 1 As shown, 20 μL of a mixture of TWJ and different concentrations of target fragments was added to a magnetic bead dispersion (a photothermal-colorimetric dual-mode biosensor based on magnetic separation), and co-incubated at 39 °C with the hairpins on the top of the magnetic beads opened for 2 h. Subsequently, Nt. BstNB I enzyme (5 μL, 8 U·μL) was added. -1 The hairpin H-chain termini were digested at 55°C for 1 hour to release the material-labeled chains. Magnetic separation was then performed to obtain the supernatant.

[0033] Supernatant treatment: such as Figure 1 As shown, the obtained supernatant was added to 100 μL H2O2 (20 mM), 200 μL TMB (1.5 mM), and 400 μL PBS (10 mM, pH=5), and reacted in the dark for 15 min. The above solution was divided into two parts for two detection modes.

[0034] Photothermal mode detection: such as Figure 1 As shown, photothermal detection of the solution was performed using an 808nm near-infrared light source (1W). The light was switched on for 300s, and the temperature change was recorded using a temperature sensor.

[0035] Colorimetric mode detection: such as Figure 1 As shown, the absorption spectrum of the solution was collected using an ELISA reader with a scanning range of 400-800 nm, and the characteristic absorbance value corresponding to 650 nm was obtained.

[0036] Feasibility characterization of a photothermal-colorimetric dual-mode biosensor based on magnetic separation: Verification of AuNPs / Cu 2-x Se exhibits peroxidase-like activity. For example... Figure 2 As shown, only when all three substances H2O2, TMB, and AuNPs / Cu are added... 2-x When Se was applied, the solution turned blue and showed a characteristic absorption peak at 650 nm, while other control groups did not show corresponding color changes or absorption peaks, proving that AuNPs / Cu 2-x The nanozyme activity of Se was then compared with that of horseradish peroxidase (HRP), such as... Figure 3 As shown in Figure A, the absorbance peak shapes of the two solutions are similar, proving that AuNPs / Cu 2-x Se exhibits peroxidase properties similar to HRP.

[0037] Verify the photothermal performance of the system. For example... Figure 3 As shown in B, AuNPs / Cu were added. 2-x The temperature change of the system after Se addition was significantly higher than that of the solution system with added HRP. This indicates that AuNPs / Cu 2-x Se exerts its peroxidase activity to oxidize TMB to photothermally active oxTMB, while AuNPs / Cu 2-x Se itself exhibits photothermal activity, and the photothermal activity of the two is superimposed, thereby enhancing the photothermal signal.

[0038] The feasibility of magnetic separation methods in constructing biosensors was verified. The effects of having and not having magnetic separation on photothermal and colorimetric signals were compared, such as... Figure 4 The results in A and B show that magnetic separation has a significant impact on the signal. Without magnetic separation, the photothermal and colorimetric signals show a significant decrease. The application of the magnetic separation method is beneficial for the enrichment of materials.

[0039] Example 4 Construct a standard curve of signal value versus SRB aprA gene concentration: In the photothermal mode, the temperature change (ΔT) of the system was measured without the introduction of the target aprA gene. With the target aprA gene introduced, the ΔT values ​​of systems containing different concentrations of the aprA gene were measured. Figure 5 As shown in A; In colorimetric mode, the absorbance value (A) of the system is recorded when the target aprA gene is not introduced; when the target aprA gene is introduced, the A value of systems containing different concentrations of the aprA gene is measured, such as... Figure 5 As shown in C; The photothermal test background solution was 10 mM PBS, the light-on time was 300 s, and the temperature change (ΔT) was recorded using a temperature sensor. The colorimetric test absorption spectrum scan range was 400-800 nm, and the characteristic absorbance value corresponding to 650 nm was recorded.

[0040] Plot the standard curves of ΔT value versus logarithmic concentration of aprA and A value versus logarithmic concentration of aprA.

[0041] Characterization of the detection performance of the photothermal-colorimetric dual-mode biosensor: Photothermal and colorimetric tests were performed on systems with different concentrations of the aprA gene. In the presence of the aprA gene, the material marker was cleaved and released through the formation of DNA nanoloops, and the release amount was correlated with the target concentration. The material in the supernatant was collected by magnetic separation, thereby catalyzing the oxidation of TMB, resulting in a significant increase in both temperature change and absorbance. Therefore, both the system temperature change (ΔT) and absorbance (A) were positively correlated with the aprA gene concentration.

[0042] like Figure 5 B, Within the range of 1 fM to 1 nM, there is a strong linear correlation between the logarithmic concentration of the target aprA gene and the ΔT value, with the linear regression equation being ΔT = 1.93 log c +35.3 (R) 2 =0.995), LOD is 0.46fM (S / N=3).

[0043] like Figure 5 The values ​​of D and A showed a good linear correlation with the logarithmic concentration of the aprA gene in the range of 1 fM to 1 nM, with the linear regression equation being A = 0.036 log c +0.707 (R) 2 =0.998), LOD is 0.43fM (S / N=3).

[0044] aprA fragment sequence: 5'-GAAATGCGTGAAGGCCGTGGCC-3' Hairpin H sequence: 5'-SH C6-CTCCTTCTGAGCAACCCCTCAGAAATCGCC-TEG-Biotin-3' L chain sequence: 5'-SH C6-GCCGTGGCCGAGGAAGACTCTCGGCCACGGCCTTCACGCATTTCGAGGAAGACTCTCGAAATTTTTTTCTAGCACGCTGAGGAAGACTCTCAGGCCACGGT-3'.

[0045] Example 5 Example 2: Validation of the selectivity, stability, and repeatability of the photothermal-colorimetric dual-mode biosensor: like Figure 6 As shown in A and 6B, apart from the target sequence and the mixture, at the same concentration, the interfering fragment signal values ​​for single-base mismatched sequences (SMT), triple-base mismatched sequences (TMT), and completely mismatched sequences (NCS) were all lower. This is attributed to their inability to form DNA nanoloops, thus ineffectively cleaving the material-modified magnetic beads. The results indicate that the two modes of this sensor exhibit strong selectivity for the target fragment.

[0046] The sensor prepared in Example 2 was stored at 4°C for 1, 2, and 3 weeks before colorimetric and photothermal tests were performed. Figure 7 As shown in Figures A and 7B, the signals in both modes were well preserved. After 3 weeks, the signal values ​​remained at 93.9% and 95.9% of their original values, respectively, indicating good storage stability of the dual-mode biosensor.

[0047] Three biosensors were fabricated in parallel to detect the target substance using photothermal and colorimetric methods. The results are as follows: Figure 8 As shown in A and 8B, the RSDs of the ΔT and A values ​​of the parallel-prepared biosensors were 3.33% and 3.24%, respectively, indicating reliable reproducibility of the two detection modes.

[0048] Single base mismatch sequence (SMT): 5'-GAGATGCGTGAAGGCCGTGGCC-3' Triple mismatch sequence (TMT): 5'-GAGATGCGTGACGGCCGTGACC-3' Completely mismatched sequence (NCS): 5'-TCCGCAAAGTCCTTAATGTAGT-3'.

[0049] Application examples Gene concentration was detected using actual cultured SRB strains. Target DNA was extracted from 2 mL of bacterial culture for PCR. The diluted PCR product was heated at 95 °C for 2 minutes and then rapidly cooled to obtain denatured ssDNA.

[0050] PCR primer 1 sequence: 5'-TGCCTGCGTAACCACATGAT-3' PCR primer 2 sequence: 5'-ATACCACAGCAACCGGAGTG-3' Using the methods in Examples 2 and 3, different concentrations of ssDNA were co-incubated with TWJ and magnetic beads, and the supernatant after enzyme digestion was obtained after magnetic separation. The obtained supernatant was then processed and subjected to photothermal and colorimetric tests, with temperature and absorbance as output signals. Simultaneously, qPCR was performed on actual samples, and the dual-mode results were compared with the qPCR method to verify its reliability. All tests were repeated three times.

[0051] The photothermal-colorimetric dual-mode bioassay for the aprA gene, based on Example 2, was used. The concentration of the target DNA was calculated using the obtained ΔT and A values ​​through the standard curve from Example 4, as shown in Table 1. The RSD range for the photothermal mode was 1.75 to 2.66%, with a recovery rate of 102.79 to 107.6%. The RSD range for the colorimetric mode was 2.46 to 2.74%, with a recovery rate of 91.83 to 104.35%.

[0052] As shown in Table 1, the results of the dual-mode detection method of the present invention are close to those of the qPCR method, which proves the reliability of the dual-mode detection method of the present invention. At the same time, the method of the present invention is more miniaturized and lower in cost than qPCR technology. Therefore, the dual-mode detection method of the present invention can be used for the quantification of aprA gene in actual samples.

[0053] Table 1. Comparison of dual-mode sensor and qPCR in detecting the aprA gene.

[0054] The results above demonstrate that the photothermal-colorimetric dual-mode biosensor constructed in this invention can be used for rapid and efficient detection of the aprA gene in SRB. The sensor combines photothermal and colorimetric detection modes and achieves efficient target enrichment and signal amplification through synergistic magnetic separation technology and HCR mechanism. This dual-mode biosensor combines the advantages of both modes, corrects errors caused by human operation and external conditions, and exhibits a lower LOD and a wider detection range than the qPCR method.

[0055] The above are merely exemplary embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A composite material with photothermal effect and peroxidase-like function, characterized in that: The composite material is AuNPs / Cu. 2-x Se.

2. A method for preparing the composite material according to claim 1, characterized in that: Includes the following steps: Step 1: Cu 2-x Se preparation: SeO2 solution was dispersed in CTAB solution and mixed with ascorbic acid solution; CuSO4·5H2O and ascorbic acid mixed solution were added to the reaction system to react and obtain Cu. 2-x Se; Step 2: AuNPs / Cu 2-x Se preparation: Cu 2-x When a Se dispersion is added to a HAuCl4 solution, the reaction yields AuNPs / Cu. 2- x Se.

3. The method for preparing the composite material according to claim 2, characterized in that: In step 1, the volume ratio of SeO2, CTAB and ascorbic acid solution is 1-2:180-200:4-5; The molar ratio of SeO2, CTAB and ascorbic acid solution is 100-200 mM: 0.25-0.3 mM: 400-500 mM; The volume ratio of CuSO4·5H2O to ascorbic acid solution in the mixed solution of CuSO4·5H2O and ascorbic acid is 1-2:4-5. The molar ratio of CuSO4·5H2O to ascorbic acid solution in the mixed solution of CuSO4·5H2O and ascorbic acid is 0.1-0.2M : 0.4-0.5M; In step 2, Cu 2-x The volume ratio of Se to HAuCl4 solution is 1.5-2:8-10.

4. An application of the composite material according to claim 1, characterized in that: composite material AuNPs / Cu 2-x Se was used to prepare a photothermal-colorimetric dual-mode biosensor based on magnetic separation.

5. The application according to claim 4, characterized in that: The AuNPs / Cu with photothermal effect and peroxidase-like function as described in claim 1 2-x Se material was modified into hairpin DNA, and the other end of the hairpin DNA was bound to a magnetic bead to obtain a photothermal-colorimetric dual-mode biosensor based on magnetic separation.

6. The application according to claim 5, characterized in that: The fabrication method of the photothermal-colorimetric dual-mode biosensor based on magnetic separation is as follows: Step 1: H hair clip - AuNPs / Cu 2-x Se material solution preparation: The hairpin H solution was heated at 90-95℃ for 5-10 min, then cooled in an ice bath for 5-10 min, and then incubated at 20℃-25℃ for 1-2 h; the hairpin H solution was then mixed with AuNPs / Cu 2-x Mix with Se solution and incubate for 2-4 hours to obtain H hairpin-AuNPs / Cu 2-x SE materials; Step 2: Combine the magnetic beads with the H-hairpin-AuNPs / Cu prepared in Step 1. 2-x Se material solution was added to buffer and incubated with shaking at 20℃-25℃ for 30-40 min to obtain a photothermal-colorimetric dual-mode biosensor based on magnetic separation.

7. The application according to claim 5, characterized in that: The aforementioned photothermal-colorimetric dual-mode biosensor based on magnetic separation is used to detect the SRB aprA gene.

8. The application according to claim 7, characterized in that: The method for detecting the SRB aprA gene is as follows: the target DNA forms a DNA nanoloop with the triaxial probe TWJ, and the HCR reaction triggers the cleavage of the sensor structure, releasing the material label. The supernatant containing the bifunctional material is obtained by magnetic separation for TMB oxidation. The absorbance of the solution and the temperature change of the system are used as sensor signal outputs, respectively, and the SRB aprA gene is quantitatively analyzed in photothermal-colorimetric dual mode.

9. The application according to claim 8, characterized in that: The method for obtaining the supernatant containing bifunctional material using magnetic separation is as follows: a mixture of TWJ and target fragments of different concentrations is added to the magnetic bead dispersion and co-incubated at 37-40℃. The hairpins at the top of the magnetic beads are opened for 2-3 hours. Then, the ends of the hairpin H chains are digested with Nt.BstNB I enzyme for 1-1.5 hours to release the material labeling chain. The supernatant is obtained by magnetic separation using a magnetic rack.

10. The application according to claim 7, characterized in that: The supernatant containing the bifunctional material was added to H2O2, TMB and PBS and reacted in the dark for 10-20 minutes. The solution was then divided into two parts for two detection modes.

Images