A Quinoa SSR Molecular Marker Primer Set and Its Application in DNA Fingerprinting
By developing a primer set of SSR molecular markers for quinoa and capillary electrophoresis technology, a high-resolution DNA fingerprint map was constructed, which solved the problems of low efficiency and insufficient accuracy in quinoa variety identification, and realized the accurate identification of quinoa germplasm resources and the breeding of new varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHENGDU VOCATIONAL COLLEGE OF AGRI SCI & TECH
- Filing Date
- 2026-07-07
- Publication Date
- 2026-08-04
AI Technical Summary
Current technologies for identifying quinoa varieties are inefficient, costly, and lack precision, leading to serious issues of mixed and counterfeit quinoa varieties, which hinders the development of the industry.
We developed a quinoa SSR molecular marker primer set, combined with core SSR primers and capillary electrophoresis technology, to construct a high-resolution quinoa DNA fingerprint for accurate identification of quinoa germplasm resources.
It enables precise and rapid identification of quinoa germplasm resources, provides efficient and accurate variety differentiation capabilities, and supports quinoa germplasm discovery and new variety breeding.
Smart Images

Figure CN122503546A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and in particular to a quinoa SSR molecular marker primer set and its application in DNA fingerprinting. Background Technology
[0002] Quinoa ( Chenopodium quinoa Quinoa (2n=4x=36) is an annual dicotyledonous crop belonging to the genus *Chenopodium* of the family Amaranthaceae, originating in the Andes Mountains of South America. It exhibits salt tolerance, drought resistance, and tolerance to poor soil conditions, and is widely distributed across various ecological environments in South America. Its grains are rich in various essential amino acids, earning it the local nickname "mother of grains." Not only are the grains highly nutritious, but the leaves and stems also contain significant nutritional value, making them a source of high-quality silage. With the expansion of quinoa cultivation, the demand for quinoa varieties is increasing. However, the prevalence of homonyms and synonyms within quinoa varieties is significant. Mixed varieties and the sale of inferior, counterfeit seeds are frequent occurrences in quinoa-producing areas, harming the legitimate rights of quinoa breeders, causing economic losses to quinoa farmers, and negatively impacting the downstream quinoa processing industry, ultimately jeopardizing the healthy development of the quinoa industry. Therefore, establishing an accurate, rapid, and stable method for identifying quinoa varieties is highly beneficial for the utilization of quinoa resources and the protection of new varieties.
[0003] Phenotypic identification and molecular marker identification are commonly used methods for germplasm identification. Crop phenotypic identification is easily affected by external environmental interference and suffers from drawbacks such as long identification cycles, significant human subjective bias, and high experimental costs. Therefore, phenotypic identification has certain limitations in practical applications. Molecular markers, on the other hand, have been widely used in germplasm identification, genetic diversity assessment, and fingerprinting due to their high variability and stability, short processing time, and low cost. Molecular markers include RFLP, RAPD, SSR, and SNP, among which SSR markers, due to their high polymorphism, good stability, multiple alleles, co-dominance, abundant quantity, and simple operation, have been selected by the International Union for the Protection of New Plant Varieties (UPOV) as the preferred marker for plant variety molecular identification and molecular fingerprinting.
[0004] DNA fingerprinting, with its high individual specificity and environmental stability, has become a method for molecular identification of varieties. It identifies varieties based on differences in genetic loci, using the DNA variation sites within the organism itself. However, for quinoa, only a research team from Qinghai University has currently constructed fingerprint profiles for 96 quinoa materials using 18 pairs of SSR markers. This profile, based on polyacrylamide gel electrophoresis data and constructed using 0 and 1 structures, has limited resolution, making it impossible to compare profiles from different batches, and the marker localization on chromosomes is unclear. Currently, no research has been reported on constructing large-scale DNA fingerprint profiles for quinoa germplasm resources by screening core SSR primers and combining them with capillary electrophoresis.
[0005] The lack of SSR molecular markers for quinoa variety identification in existing technologies, coupled with low resolution of molecular fingerprint spectra, leads to problems such as low efficiency, high cost, and insufficient accuracy in quinoa variety identification. This fails to fundamentally solve the industrial problems caused by the chaotic state of quinoa varieties. Based on the above two points, this invention aims to develop a set of SSR primers for identifying quinoa resource materials, and combine core SSR primers with capillary electrophoresis to construct molecular fingerprint spectra of quinoa, thereby building a rapid, accurate, and cost-effective molecular identification system for quinoa varieties. Summary of the Invention
[0006] The purpose of this invention is to provide a quinoa SSR molecular marker primer set and its application in DNA fingerprinting, in order to solve the problems existing in the prior art. This invention provides a quinoa SSR molecular marker primer set with nucleotide sequences as shown in SEQ ID NO.1-50, which provides reliable theoretical and technical support for the accurate identification and innovation of quinoa germplasm resources, the protection of new quinoa variety rights, and variety breeding.
[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides a quinoa SSR molecular marker primer set, comprising the following primer pairs: The nucleotide sequences of primer pairs CACSSR009 (as shown in SEQ ID NO. 1-2), CACSSR016 (as shown in SEQ ID NO. 5-6), CACSSR028 (as shown in SEQ ID NO. 9-10), CACSSR036 (as shown in SEQ ID NO. 13-14), CACSSR040 (as shown in SEQ ID NO. 15-16), CACSSR045 (as shown in SEQ ID NO. 17-18), CACSSR051 (as shown in SEQ ID NO. 21-22), CACSSR059 (as shown in SEQ ID NO. 23-24), CACSSR062 (as shown in SEQ ID NO. 25-26), CACSSR070 (as shown in SEQ ID NO. 27-28), and CACSSR079 (as shown in SEQ ID NO. 31-32) are as shown in SEQ ID NO. 1-2. Primer pairs CACSSR088 shown in SEQ ID NO. 33-34, CACSSR090 shown in SEQ ID NO. 35-36, CACSSR106 shown in SEQ ID NO. 39-40, CACSSR112 shown in SEQ ID NO. 41-42, CACSSR116 shown in SEQ ID NO. 43-44, CACSSR128 shown in SEQ ID NO. 47-48, and CACSSR139 shown in SEQ ID NO. 49-50.
[0008] Furthermore, it also includes the following primer pairs: The nucleotide sequences are as shown in primer pairs CACSSR015 (SEQ ID NO. 3-4), CACSSR020 (SEQ ID NO. 7-8), CACSSR034 (SEQ ID NO. 11-12), CACSSR049 (SEQ ID NO. 19-20), CACSSR076 (SEQ ID NO. 29-30), CACSSR103 (SEQ ID NO. 37-38), and CACSSR119 (SEQ ID NO. 45-46).
[0009] This invention also provides an application of the above-mentioned quinoa SSR molecular marker primer set in the preparation of products for identifying quinoa germplasm resources.
[0010] Furthermore, the product is a reagent kit.
[0011] The present invention also provides a product for identifying quinoa germplasm resources, comprising the above-mentioned quinoa SSR molecular marker primer set.
[0012] This invention also provides an application of the above-described quinoa SSR molecular marker primer set or the above-described product in any of the following: (1) Analyze the genetic diversity of quinoa; (2) Identification of quinoa germplasm resources; (3) Analyze the kinship of quinoa.
[0013] This invention also provides a method for identifying quinoa germplasm resources, comprising the following steps: Genomic DNA was extracted from the quinoa samples to be tested; The genomic DNA was amplified by PCR using the quinoa SSR molecular marker primer set described above, and the PCR products were collected. The PCR products were subjected to capillary electrophoresis detection, and the germplasm resources of the quinoa samples to be tested were identified based on the results of the capillary electrophoresis detection.
[0014] This invention also provides the application of the above-mentioned quinoa SSR molecular marker primer set or the above-mentioned product in constructing a quinoa DNA fingerprint.
[0015] This invention also provides a method for constructing a quinoa DNA fingerprint, comprising the following steps: Genomic DNA was extracted from the quinoa samples to be tested; The genomic DNA was amplified by PCR using the quinoa SSR molecular marker primer set described above, and the PCR products were collected. The PCR products were subjected to capillary electrophoresis detection, and the quinoa DNA fingerprint was constructed based on the results of the capillary electrophoresis detection.
[0016] Furthermore, the PCR amplification procedure is as follows: Pre-denaturation at 94℃ for 2 min; denaturation at 94℃ for 40 s, annealing at 65℃ for 30 s, extension at 72℃ for 45 s, decreasing by 1℃ for each cycle, for a total of 10 cycles; denaturation at 94℃ for 40 s, annealing at 55℃ for 30 s, extension at 72℃ for 45 s, for a total of 30 cycles; extension at 72℃ for 5 min, and storage at 4℃.
[0017] The present invention discloses the following technical effects: Based on 170 quinoa germplasm resources, this invention screened and obtained a quinoa SSR molecular marker primer set consisting of 25 pairs of SSR primers, the nucleotide sequences of which are shown in SEQ ID NO.1-50. This invention also used this primer set to perform genetic diversity analysis and population genetic structure assessment on the 170 quinoa germplasm resources, further screening out 18 core primer pairs, and using these core primers to construct a quinoa DNA fingerprint.
[0018] Existing fingerprint patterns are constructed based on polyacrylamide gel electrophoresis data using a 0 and 1 format, which has limitations such as limited resolution, incomparability of patterns from different batches of samples, and unclear chromosome positioning of the markers used. In contrast, the fingerprint pattern constructed using the SSR markers developed in this invention offers higher resolution, clearer chromosome positioning of the markers, and allows for rapid and accurate comparison and identification of patterns from different batches of samples. Based on these characteristics, this invention can provide reliable theoretical and technical support for the precise identification of quinoa germplasm resources, germplasm discovery and innovation, new variety breeding, and variety rights protection. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 Electrophoretic gel images of CACSSR028 primers on a portion of quinoa material; where AH is labeled LM102, LM104, LM105, LM107, LM110, LM111, LM112 and LM116 respectively; Figure 2 The image shows the capillary electrophoresis peaks of the CACSSR028 primer in a portion of quinoa material; where AH represents LM102, LM104, LM105, LM107, LM110, LM111, LM112 and LM116 respectively. Figure 3 This is a cluster analysis diagram of 170 quinoa samples based on 25 pairs of SSR primers; Figure 4 This is a QR code of 170 quinoa DNA fingerprints based on 18 pairs of SSR primers. Detailed Implementation
[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included within the scope of this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.
[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0026] The materials used in this invention are: 170 portions of quinoa material, the sample numbers and names are shown in Table 1.
[0027] Table 1. Quinoa Sample Numbers and Names Reagents: SSR primers were synthesized by Chengdu Qingke Biotechnology Co., Ltd.; 2×T5 Super PCR Mix (PAGE), DNA marker, etc. were purchased from Chengdu Qingke Biotechnology Co., Ltd.; CTAB, agarose, etc. were all domestically produced analytical grade.
[0028] Example 1 DNA Extraction DNA was extracted from quinoa varieties using the CTAB method. DNA purity was assessed by 1.0% agarose gel electrophoresis, and the purity and concentration were determined using a NanoDrop ND-1000 UV-Vis spectrophotometer. The DNA concentration was diluted to 50 ng / μL and stored at -20℃ for later use.
[0029] CTAB Method: Take 1-2 g of fresh, tender young leaves of quinoa and rapidly grind them into powder in liquid nitrogen. Place the powder in a 1.5 mL centrifuge tube, then add approximately 500 µL of preheated 95℃ 2×CTAB extraction buffer and mix well. Place the centrifuge tube in a 65℃ constant temperature water bath for 1 hour, gently mixing 2-3 times during this period. Remove the centrifuge tube and cool to room temperature. Then add an equal volume of chloroform:isoamyl alcohol (V / V=24:1), mix thoroughly, let stand for 5-10 min, and centrifuge at 10000 rpm for 15 minutes. Collect the supernatant. Add an equal volume of pre-cooled isopropanol, gently mix, and place in a -20℃ refrigerator for at least 2 hours. Centrifuge at 10000 rpm for 10 min, discard the supernatant, add 500 µL of 70% ethanol to wash, let stand for 20 min and discard the 70% ethanol, then wash with anhydrous ethanol for 20 min and discard the anhydrous ethanol. Air dry at room temperature, add 300-500 mL of sterile water... µL, fully dissolved and stored at 4℃ for later use.
[0030] Example 2: SSR Primer Development and PCR Amplification SSR primer development: Using the published quinoa transcriptome sequences in the NCBI database, whole-genome scanning and screening of quinoa SSR loci were performed using the MISA script (http: / / pgrc.ipk-gatersleben.de / misa / ) and the SSRminer program in TBtools software to obtain quinoa SSR loci. Primers were designed for these loci using Primer 3 software. The criteria for screening SSR loci were: 1. The core sequence was highly conserved in the quinoa genome data; 2. The number of repeating motifs at the SSR locus (≥6 repeating dinucleotides; ≥5 repeating trinucleotides, tetranucleotides, pentanucleotides, and hexanucleotides). The parameters used in Primer 3 primer design included: primer length controlled between 18-25 bases to ensure specific primer-template binding; GC content maintained between 40%-60% for stable annealing; Tm values set between 55-65℃, with a Tm difference of no more than 2℃ between forward and reverse primers; and PCR product length ranging from 70 bp to 500 bp. Furthermore, Primer Premier 5 software was used to evaluate and eliminate the possibility of primers forming secondary structures or dimers between primers, ensuring the efficiency and specificity of subsequent PCR amplification. Finally, 167 pairs of SSR primers were successfully designed and synthesized at Chengdu Qingke Biotechnology Co., Ltd., and purified using PAGE.
[0031] SSR primer screening: Using genomic DNA from four representative quinoa materials (LM001, LM006, LM085, and LM155) as templates, PCR amplification was performed using 167 primer pairs. The PCR amplification system and procedure are as follows: The PCR amplification system consisted of: 2.0 μL template DNA (20 ng / μL), 1.0 μL forward primer (10 μmol / L), 1.0 μL reverse primer (10 μmol / L), 10 μL 2×T5 Super PCR Mix (PAGE), and ddH2O to a final volume of 20 μL.
[0032] The PCR program was as follows: 94℃ pre-denaturation for 2 min, 1 cycle; 94℃ denaturation for 40 s, 65℃ annealing for 30 s, 72℃ extension for 45 s, decreasing by 1℃ for each cycle, for a total of 10 cycles; 94℃ denaturation for 40 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, for a total of 30 cycles; 72℃ extension for 5 min, and storage at 4℃.
[0033] The amplified products were analyzed by capillary electrophoresis using a QIAxcel Advanced fully automated nucleic acid and protein analyzer. The amplification results were observed, analyzed, and compared. Primers that successfully amplified in all four template DNAs with single and clear bands were selected for the next stage of experiments.
[0034] Example 3: SSR marker molecular identification of quinoa germplasm resources Using Example 2, 25 pairs of SSR primers were screened and used for molecular identification of 170 quinoa germplasm resources. The SSR primer sequences are shown below. PCR amplification and capillary electrophoresis analysis were performed according to the method provided in Example 2. The resolution results of eight quinoa germplasm resources (LM102, LM104, LM105, LM107, LM110, LM111, LM112, and LM116) in primer CACSSR028 are shown below. Figure 1 and Figure 2 .
[0035] Primer name: CACSSR009, fragment size: 122-150 bp; Forward primer sequence: CTGCCTGACCAGATAGTACAGG, SEQ ID NO.1; Reverse primer sequence: CGCGTTGTTAGCTCTGTAGAG, SEQ ID NO.2.
[0036] Primer name: CACSSR015, fragment size: 189-261 bp; Forward primer sequence: TGTTGAGTGCACCTAACTGG, SEQ ID NO.3; Reverse primer sequence: AATTTTGTGTGACCGCGCGGG, SEQ ID NO.4.
[0037] Primer name: CACSSR016, fragment size: 122-164 bp; Forward primer sequence: GTCATTGGAGTAGTAGATGTCC, SEQ ID NO.5; Reverse primer sequence: ATGCGAAGTACTTCGAACAATG, SEQ ID NO.6.
[0038] Primer name: CACSSR020, fragment size: 192-498 bp; Forward primer sequence: TAACGTGTCCCTCAGAATGA, SEQ ID NO.7; Reverse primer sequence: TTACCGTCTCTTCAGTCGCT, SEQ ID NO.8.
[0039] Primer name: CACSSR028, fragment size: 206-278 bp; Forward primer sequence: TTCACCCCTTACACTAGGCC, SEQ ID NO.9; Reverse primer sequence: TGTAATCATCTGAGAGGTAA, SEQ ID NO.10.
[0040] Primer name: CACSSR034, fragment size: 160-409 bp; Forward primer sequence: GGCCTGGTACGCATTTCTT, SEQ ID NO.11; Reverse primer sequence: GACTAATCCTCAACGACTCT, SEQ ID NO.12.
[0041] Primer name: CACSSR036, fragment size: 201-243 bp; Forward primer sequence: TTGTCGGGACTATTACCCAAT, SEQ ID NO.13; Reverse primer sequence: CATTTACATGGACGCTAAGG, SEQ ID NO.14.
[0042] Primer name: CACSSR040, fragment size: 102-125 bp; Forward primer sequence: TCTCTACCTTCAACGCCAGCA, SEQ ID NO.15; Reverse primer sequence: GCACATACTTGTAGGAGGTAG, SEQ ID NO.16.
[0043] Primer name: CACSSR045, fragment size: 149-188 bp; Forward primer sequence: AAGCTACGCTAGCCCTGT, SEQ ID NO.17; Reverse primer sequence: CTGGTATTAGTGATACCGAT, SEQ ID NO.18.
[0044] Primer name: CACSSR049, fragment size: 131-399 bp; Forward primer sequence: AGAGCCAGTGGTACCAGTT, SEQ ID NO.19; Reverse primer sequence: CCATCCAAATGCACCCCTTCAGG, SEQ ID NO.20.
[0045] Primer name: CACSSR051, fragment size: 191-239 bp; Forward primer sequence: CCGCAGGTGGCCCAGGGAACA, SEQ ID NO.21; Reverse primer sequence: GTGAATAGGTGGCTCGGCTAT, SEQ ID NO.22.
[0046] Primer name: CACSSR059, fragment size: 136-194 bp; Forward primer sequence: CATGCGCACCGTGAGACTAT, SEQ ID NO.23; Reverse primer sequence: ATCTTAATGCGATGTCTTAAC, SEQ ID NO.24.
[0047] Primer name: CACSSR062, fragment size: 88-160 bp; Forward primer sequence: CCGATATCGCATGTCTATCTCGATT, SEQ ID NO.25; Reverse primer sequence: CACCCTTGTGAGGATAGCCAGAATCC, SEQ ID NO.26.
[0048] Primer name: CACSSR070, fragment size: 142-159 bp; Forward primer sequence: TGCCCGCTCAATATCAACATGC, SEQ ID NO.27; Reverse primer sequence: AATCTCGCTGTCATATATCG, SEQ ID NO.28.
[0049] Primer name: CACSSR076, fragment size: 127-181 bp; Forward primer sequence: CGGACATCGGTTCTCAAGCT, SEQ ID NO.29; Reverse primer sequence: AGGTCAATCAGCTCATGGCC, SEQ ID NO.30.
[0050] Primer name: CACSSR079, fragment size: 168-264 bp; Forward primer sequence: CGCCGAGTTCACCTAGCAA, SEQ ID NO.31; Reverse primer sequence: GCAACTGCTGTCAAATATA, SEQ ID NO.32.
[0051] Primer name: CACSSR088, fragment size: 170-222 bp; Forward primer sequence: TGAGTATGTTGAAGAACATGTGAAA, SEQ ID NO.33; Reverse primer sequence: GTCAGTTCCTAGATACAATAGACAACC, SEQ ID NO.34.
[0052] Primer name: CACSSR090, fragment size: 108-431 bp; Forward primer sequence: CATATGCGGCGCTATGCTATCTG, SEQ ID NO.35; Reverse primer sequence: GAAATGGTCTAGCACATCTTC, SEQ ID NO.36.
[0053] Primer name: CACSSR103, fragment size: 175-221 bp; Forward primer sequence: AATGCTAGTGACATAATCACCT, SEQ ID NO.37; Reverse primer sequence: GGGATAGGTGTACTGAGACA, SEQ ID NO.38.
[0054] Primer name: CACSSR106, fragment size: 177-201 bp; Forward primer sequence: TCTCGATACTGGCAGATTGCTG, SEQ ID NO.39; Reverse primer sequence: ATACGAATGTCGCTGCACCATCA, SEQ ID NO.40.
[0055] Primer name: CACSSR112, fragment size: 209-239 bp; Forward primer sequence: CGACGTCCCGTCAAACTTGACC, SEQ ID NO.41; Reverse primer sequence: GAAGATTGGACCCAGTTCATGTAAA, SEQ ID NO.42.
[0056] Primer name: CACSSR116, fragment size: 79-154 bp; Forward primer sequence: ATGACTCGTGCAACTGGAGTTG, SEQ ID NO.43; Reverse primer sequence: AGCGCCGACAACCGTAACTG, SEQ ID NO.44.
[0057] Primer name: CACSSR119, fragment size: 146-185 bp; Forward primer sequence: TGTACCCAACTAGGGAGAGTG, SEQ ID NO.45; Reverse primer sequence: TGCGCCTGCTCTTACTCGTCTC, SEQ ID NO.46.
[0058] Primer name: CACSSR128, fragment size: 171-231 bp; Forward primer sequence: CGAGTACCTTGAAAGACTGTGTTCGTT, SEQ ID NO.47; Reverse primer sequence: GCACCGCAGCTATTCATCCT, SEQ ID NO.48.
[0059] Primer name: CACSSR139, fragment size: 152-169 bp; Forward primer sequence: CCGTAGGCAATAATGTTACA, SEQ ID NO.49; Reverse primer sequence: GGCAGGCCAGTGAAGGCATCGAA, SEQ ID NO.50.
[0060] Statistical analysis was performed on the polymorphism parameters of the 25 SSR primer pairs shown above. The results are shown in Table 2. A total of 480 polymorphic bands were amplified. Each primer pair had 10-39 alleles (Na), with an average of 19.52 alleles per primer pair. The effective number of alleles (Ne) ranged from 2.732 to 16.038, with an average of 7.823. The Shannon information diversity index (I) ranged from 1.434 to 3.065, with an average of 2.249. The observed heterozygosity (Ho) ranged from 0.006 to 1, with an average of 0.501. The expected heterozygosity (He) ranged from 0.634 to 0.938, with an average of 0.841. This set of primers exhibited good polymorphism and is suitable for quinoa genetic diversity analysis and germplasm resource identification.
[0061] Table 2 SSR primer polymorphism information Using 25 pairs of SSR markers combined with capillary electrophoresis typing results from 170 quinoa resource materials, genetic distances between materials were calculated using NTSYS 2.1e software, and phylogenetic analysis was performed to construct a cluster diagram. Figure 3 The 170 quinoa accessions were divided into four subgroups (G1, G2, G3, and G4). Subgroup G1 included 7 quinoa materials, such as LM032 and LM015, accounting for 4.12% of the total; subgroup G2 included 6 quinoa materials, such as LM027 and LM014, accounting for 3.53% of the total; and subgroup G3 included 23 quinoa materials, such as LM092 and LM019, accounting for 13.52% of the total. The remaining materials were assigned to subgroup G4. In conclusion, the 25 pairs of SSR primers could clearly and effectively distinguish the 170 quinoa resources, indicating that the 25 pairs of SSR primers can effectively distinguish quinoa germplasm resources.
[0062] Example 4: Construction of fingerprint profiles for quinoa germplasm resources Based on the principle of minimizing the number of markers required to distinguish 170 quinoa germplasm resources, and considering indicators such as marker polymorphism, chromosome distribution, and banding stability, 18 core primer pairs (CACSSR009, CACSSR016, CACSSR028, CACSSR036, CACSSR040, CACSSR045, CACSSR051, CACSSR059, CACSSR062, CACSSR07 ...66, CACSSR070, CACSSR045, CACSSR046, CACSSR045, CACSSR051, CACSSR059, CACSSR062, CACSSR070, CACSSR045, CACSSR066, CACSSR070, CACSSR0 Molecular fingerprints of 170 quinoa accessions (CACSSR088, CACSSR090, CACSSR106, CACSSR112, CACSSR116, CACSSR128, CACSSR139) were constructed according to the following rules: material name + SSR marker name + amplified fragment size (smaller fragment first, larger fragment last). These fingerprints were then converted into QR codes using QR code software to facilitate quinoa germplasm identification, resource management, and phylogenetic analysis. The QR codes for the 170 quinoa germplasm accessions are shown below. Figure 4 As shown.
[0063] The fingerprint spectrum described above can distinguish varieties (lines) of 170 quinoa germplasm resources. Each variety (line) has a unique fingerprint spectrum, which has higher accuracy, higher repeatability and higher specificity than existing fingerprint spectra.
[0064] In summary, using the aforementioned 18 core primer pairs, the first DNA fingerprint information database containing 170 quinoa germplasm accessions was established, providing reliable technical support for the accurate identification and variety management of quinoa germplasm resources. At the same time, removing any one of the aforementioned 18 core primer pairs will cause the fingerprint system to become invalid, thus making it impossible to achieve accurate identification of quinoa germplasm resources.
[0065] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A quinoa SSR molecular marker primer set, characterized in that, Includes the following primer pairs: The nucleotide sequences of primer pairs CACSSR009 (as shown in SEQ ID NO. 1-2), CACSSR016 (as shown in SEQ ID NO. 5-6), CACSSR028 (as shown in SEQ ID NO. 9-10), CACSSR036 (as shown in SEQ ID NO. 13-14), CACSSR040 (as shown in SEQ ID NO. 15-16), CACSSR045 (as shown in SEQ ID NO. 17-18), CACSSR051 (as shown in SEQ ID NO. 21-22), CACSSR059 (as shown in SEQ ID NO. 23-24), CACSSR062 (as shown in SEQ ID NO. 25-26), CACSSR070 (as shown in SEQ ID NO. 27-28), and CACSSR079 (as shown in SEQ ID NO. 31-32) are as shown in SEQ ID NO. 1-2. Primer pairs CACSSR088 (shown in SEQ ID NO. 33-34), CACSSR090 (shown in SEQ ID NO. 35-36), CACSSR106 (shown in SEQ ID NO. 39-40), CACSSR112 (shown in SEQ ID NO. 41-42), CACSSR116 (shown in SEQ ID NO. 43-44), CACSSR128 (shown in SEQ ID NO. 47-48), and CACSSR139 (shown in SEQ ID NO. 49-50) are shown.
2. The quinoa SSR molecular marker primer set as described in claim 1, characterized in that, It also includes the following primer pairs: The nucleotide sequences are as shown in primer pairs CACSSR015 (SEQ ID NO. 3-4), CACSSR020 (SEQ ID NO. 7-8), CACSSR034 (SEQ ID NO. 11-12), CACSSR049 (SEQ ID NO. 19-20), CACSSR076 (SEQ ID NO. 29-30), CACSSR103 (SEQ ID NO. 37-38), and CACSSR119 (SEQ ID NO. 45-46).
3. The application of the quinoa SSR molecular marker primer set as described in claim 1 or 2 in the preparation of products for identifying quinoa germplasm resources.
4. The application as described in claim 3, characterized in that, The product in question is a reagent kit.
5. A product for identifying quinoa germplasm resources, characterized in that, Includes the quinoa SSR molecular marker primer set as described in claim 1 or 2.
6. The use of the quinoa SSR molecular marker primer set according to claim 1 or 2, or the product according to claim 5, in any of the following: (1) Analyze the genetic diversity of quinoa; (2) Identification of quinoa germplasm resources; (3) Analyze the kinship of quinoa.
7. A method for identifying quinoa germplasm resources, characterized in that, Includes the following steps: Genomic DNA was extracted from the quinoa samples to be tested; The genomic DNA was amplified by PCR using the quinoa SSR molecular marker primer set as described in claim 1 or 2, and the PCR products were collected. The PCR products were subjected to capillary electrophoresis detection, and the germplasm resources of the quinoa samples to be tested were identified based on the results of the capillary electrophoresis detection.
8. The application of the quinoa SSR molecular marker primer set of claim 1 or the product of claim 5 in constructing a quinoa DNA fingerprint.
9. A method for constructing a quinoa DNA fingerprint, characterized in that, Includes the following steps: Genomic DNA was extracted from the quinoa samples to be tested; The genomic DNA was amplified by PCR using the quinoa SSR molecular marker primer set as described in claim 1, and the PCR products were collected. The PCR products were subjected to capillary electrophoresis detection, and the quinoa DNA fingerprint was constructed based on the results of the capillary electrophoresis detection.
10. The method as described in claim 7 or the construction method as described in claim 9, characterized in that, The PCR amplification procedure is as follows: Pre-denaturation at 94℃ for 2 min; denaturation at 94℃ for 40 s, annealing at 65℃ for 30 s, extension at 72℃ for 45 s, decreasing by 1℃ for each cycle, for a total of 10 cycles; denaturation at 94℃ for 40 s, annealing at 55℃ for 30 s, extension at 72℃ for 45 s, for a total of 30 cycles; extension at 72℃ for 5 min, and storage at 4℃.