Use of a wnt5b inhibitor in the preparation of a medicament for the treatment of fibrous dysplasia of the bone
Patent Information
- Application Number
- CN202611049112.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-15
- Publication Date
- 2026-08-18
AI Technical Summary
[0004]综上所述,目前FD治疗方式以手术为主,但复发率较高,现有药物主要通过抑制破骨细胞发挥作用,但对成骨功能恢复有限,进一步开发新的治疗靶点具有重要意义
[0024] This invention experimentally demonstrates that WNT5B is a downstream effector molecule of GNAS mutations, significantly highly expressed in FD lesion tissues, and inhibits osteoblast activity and promotes osteoclast differentiation through the WNT5B/SPP1 axis. Therefore, WNT5B can serve as a molecular target for FD drug screening. Specific candidate drug screening can be achieved by detecting the effect of compounds on WNT5B gene expression; for example, compounds that can inhibit WNT5B expression can be considered as candidate drugs for FD treatment.
Smart Images

Figure CN122582274A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of WNT5B inhibitors in the preparation of drugs for the treatment of fibrous dysplasia of bone. Background Technology
[0002] Fibrosoid dysplasia (FD), also known as fibrous osteodysplasia, is a benign intraosseous lesion caused by a somatic gain-of-function mutation in the GNAS gene. GNAS gene mutations lead to persistent activation of the Gαs-cAMP signaling pathway, causing normal bone cells to be replaced by abnormally proliferating fibrous tissue and poorly ossified woven bone. Simultaneously, the production of large amounts of cytokines can abnormally activate the RANK (receptor activator of nuclear factor κB) / RANKL (RANK ligand, a key osteoclast differentiation factor) pathway, resulting in increased osteoclast activation and bone resorption, thus further developing and expanding the FD lesion. The craniofacial region is the most commonly affected area by FD. Craniofacial fibrosoid dysplasia (CFD) often presents clinically as a painless, progressive, non-inflammatory mass. Depending on the affected location and organs, it can manifest as various symptoms such as skull bulging deformity, exophthalmos, decreased vision, hearing loss, facial paralysis, nasal congestion, and tooth displacement, severely impacting the patient's facial function, appearance, and mental health.
[0003] Currently, surgery is the primary treatment for osteonecrosis (FD), but the recurrence rate after surgery is as high as 50%, and multiple surgeries are often insufficient to restore a satisfactory facial appearance. Regarding drug therapy, bisphosphonates are widely used to treat FD by inhibiting osteoclast activity, but randomized placebo-controlled studies have shown limited efficacy. IL-6 receptor monoclonal antibodies (such as tocilizumab) have shown some efficacy in case reports, but the latest randomized controlled trials have not confirmed their effectiveness. Anti-RANKL antibodies (such as denosumab) have shown in clinical trials to relieve bone pain and increase bone density, but there are risks of complications such as osteonecrosis of the mandible and hypocalcemia, and rebound hypercalcemia may occur after discontinuation of the drug.
[0004] In summary, current treatment for osteodystrophy (FD) is mainly surgical, but the recurrence rate is high. Existing drugs mainly work by inhibiting osteoclasts, but have limited effect on restoring osteogenic function. Therefore, further development of new therapeutic targets is of great significance. Summary of the Invention
[0005] This invention provides inhibitors targeting WNT5B, including antibody or nucleic acid inhibitors, and applies them to the treatment of FD, thereby providing a treatment regimen that can simultaneously improve bone formation disorders and inhibit bone resorption in FD.
[0006] The specific technical solution adopted in this invention is as follows:
[0007] In a first aspect, the present invention provides the use of a WNT5B inhibitor in the preparation of a medicament for treating fibrous dysplasia of bone. The medicament uses a WNT5B inhibitor as its active ingredient, which inhibits disease progression or postoperative recurrence by suppressing bone resorption (reversing the promoting effect of FD disease cells on osteoclast differentiation) and promoting bone formation (restoring the osteogenic activity of FD disease cells).
[0008] Preferably, the WNT5B inhibitor is selected from any of the following:
[0009] (1) Anti-WNT5B antibody or its antigen-binding fragment;
[0010] (2) Nucleic acid inhibitors targeting WNT5B;
[0011] (3) The combination of (1) and (2) above.
[0012] Furthermore, the anti-WNT5B antibody is a neutralizing antibody that can specifically bind to the WNT5B protein and inhibit its binding to the receptor.
[0013] Furthermore, the nucleic acid inhibitor is selected from siRNA, shRNA, or antisense oligonucleotides, and is designed to target the coding region or 3' untranslated region of the WNT5B gene. Specifically, the sequence of the siRNA can be selected from any of the following:
[0014] (i) Justice chain: 5'-GACCCGAGAUGUUUAUCAUTT-3' (SEQ ID NO.1); Antisense chain: 5'-AUGAUAAACAUCUCGGGUCTT-3' (SEQ ID NO.2);
[0015] (ii) Justice chain: 5'-GCAGGGCUGUGUAUAAGAUTT-3' (SEQ ID NO.3); Antisense chain: 5'-AUCUUAUACACAGCCCUGCTT-3' (SEQ ID NO.4);
[0016] (iii) Justice chain: 5'-CGAGAGAAGAACUUUGCCATT-3' (SEQ ID NO.5); Antisense chain: 5'-UGGCAAAGUUCUUCUCUCGTT-3' (SEQ ID NO.6).
[0017] Preferably, the dosage form of the drug is selected from injections, liposomes, nanoparticles, or sustained-release formulations.
[0018] Preferably, the drug is administered via local injection or systemic injection.
[0019] Secondly, the present invention provides a pharmaceutical composition for treating fibrous dysplasia of bone, the pharmaceutical composition comprising a WNT5B inhibitor and a pharmaceutically acceptable carrier. Wherein:
[0020] The WNT5B inhibitor is selected from any one of (1)-(3) above. Preferably, the WNT5B inhibitor is a siRNA with a sequence selected from any one of (i)-(iii) above.
[0021] The term "pharmaceutically acceptable" means that when the carrier is appropriately administered to animals or humans, it will not produce adverse, allergic, or other adverse reactions. In one specific embodiment, the pharmaceutically acceptable carrier is a cationic liposome.
[0022] Thirdly, this invention provides the application of WNT5B as a drug target in screening candidate drugs for the treatment of fibrous dysplasia of bone.
[0023] The present invention has the following beneficial effects:
[0024] This invention experimentally demonstrates that WNT5B is a downstream effector molecule of GNAS mutations, significantly highly expressed in FD lesion tissues, and inhibits osteoblast activity and promotes osteoclast differentiation through the WNT5B / SPP1 axis. Therefore, WNT5B can serve as a molecular target for FD drug screening. Specific candidate drug screening can be achieved by detecting the effect of compounds on WNT5B gene expression; for example, compounds that can inhibit WNT5B expression can be considered as candidate drugs for FD treatment.
[0025] WNT5B is located at a key node in the communication between fibroblasts, osteoblasts, and osteoclasts. The technical solution of this invention targets WNT5B and can act on multiple major cell types in FD lesions simultaneously. By blocking the inhibitory effect of WNT5B on osteogenic formation and the promoting effect on osteoclast formation, it synergistically restores the balance between bone formation and bone resorption, providing a new and specific treatment strategy for FD. Attached Figure Description
[0026] Figure 1 In Example 1 of this invention, single-cell RNA sequencing and hematoxylin-eosin (HE) staining revealed cellular heterogeneity in FD (fibroblast dysplasia). Specifically: (A) Workflow of single-cell RNA sequencing for FD. (B) Uniform manifold approximate projection (UMAP) map of human FD tissue. (C) UMAP map of cluster identities in human FD. (D) Feature map showing the expression of several identified cell type-specific marker genes in the major cell population. Red indicates the highest gene expression, and blue indicates low or no expression. (E) HE staining results. White arrows point to trabeculae, yellow arrows to abnormal trabeculae, and black arrows to fibrous tissue. Scale bar: 200 μm.
[0027] Figure 2 Example 1 of this invention describes the expression of WNT5B in FD patient tissues. Specifically: (A) UMAP plot of WNT5A and WNT5B expression concentrations. (B, C) Western blot and qRT-PCR results of WNT5B expression in maxillofacial FD lesion tissues and healthy human jawbone tissues. (D) Qualitative and quantitative results of WNT5B immunohistochemical staining in maxillofacial FD lesion tissues and healthy human jawbone tissues.
[0028] Figure 3 Example 2 of this invention analyzes the functional characteristics of FD lesion cells. (A, B) Results of cell scratch assay and CCK8 cell proliferation activity assay between FD lesion-derived cells and normal bone-derived cells. Data are expressed as absorbance at 450 nm. n=3 per group, scale bar: 200 μm. (C) Results of ALP activity staining assay. Low-magnification scale bar: 1 mm, high-magnification scale bar: 500 μm. (D) qRT-PCR detection results, n=3 per group. (E) Immunohistochemical staining results of osteopontin (SPP1) in maxillofacial FD lesion tissue. Low-magnification scale bar: 200 μm, high-magnification scale bar: 50 μm.
[0029] Figure 4 Example 3 of this invention describes the regulation of WNT5B expression and downstream ALP expression by the GNAS (R201C) mutation. Specifically: (A) HS-5 cells were transfected with R201C-mutant GNAS gene overexpression lentivirus (R201C group) and GNAS gene overexpression lentivirus (wt group), respectively. qRT-PCR was used to detect changes in the expression levels of CRABP1, GPC3, and WNT5B in the cells (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). (B) Transwell assay results of in vitro cell culture. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, scale bar: 100 μm. (C) ALP activity staining and Western blot results.
[0030] Figure 5In Example 4 of this invention, inhibiting WNT5B expression can restore osteogenic differentiation activity in FD diseased cells. Specifically: (A) qRT-PCR results (n=3 per group) and ALP activity staining results (ALP activity staining icon scale: 1 mm; in the semi-quantitative detection of ALP activity, n = 3 per group, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). (B) Violin plots and UMAP plots of single-cell sequencing of FD diseased tissue and healthy human jawbone tissue. Red indicates the highest gene expression, and blue indicates low expression or no expression.
[0031] Figure 6 Example 5 of this invention illustrates the inhibition of WNT5B's reversible effect on osteoclast differentiation in FD lesion cells. (A) TRAP staining results. (B) qRT-PCR detection results (*P < 0.05, **P < 0.01, ***P < 0.001). Detailed Implementation
[0032] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the reagents used in the following embodiments are all commercially available conventional reagents, and the experimental procedures involved are all conventional procedures in the art unless otherwise specified.
[0033] Example 1: Detection of WNT5B expression in FD patient samples
[0034] We collected surgically removed lesion tissue samples (n=3) and normal jawbone tissue samples (n=3) from FD patients.
[0035] Patient inclusion criteria: (1) diagnosed with fibrous dysplasia of bone; (2) aged 18 years or older; (3) consulted and underwent surgical treatment in the Department of Oral and Maxillofacial Surgery during the study period; (4) postoperative pathology report confirmed fibrous bone structure abnormality.
[0036] Exclusion criteria: (1) minor patients; (2) postoperative pathology report indicating malignant transformation; (3) presence of cognitive or behavioral disorders.
[0037] Experimental methods:
[0038] 1. Single-cell RNA sequencing: Single-cell suspensions were prepared from fresh craniofacial FD tissue samples (n=3) and sequenced using a 10X Genomics Chromium System. A total of 49,329 cells were obtained, and cluster analysis was performed using Seurat software. The methodology is as follows: Figure 1 As shown in Figure A.
[0039] 2. Hematoxylin-eosin (HE) staining: Surgically removed lesion tissue and normal jawbone tissue from FD patients were fixed in 4% paraformaldehyde for 24 hours, followed by decalcification, graded ethanol dehydration, xylene clearing, and paraffin embedding. Paraffin sections with a thickness of 4-5 μm were prepared. After dewaxing, the sections were stained with hematoxylin for 5-10 minutes and rinsed with running water; then separated with 1% hydrochloric acid ethanol and rinsed with running water; finally, counterstained with eosin for 1-3 minutes and rinsed with running water. After graded ethanol dehydration and xylene clearing, the sections were mounted with neutral resin. The sections were observed under an optical microscope to compare the bone structure differences between normal jawbone tissue and craniofacial FD tissue.
[0040] 3. Western Blot Detection: Frozen disease lesion tissue and normal jawbone tissue from healthy individuals were collected. Total protein was extracted using RIPA lysis buffer (containing protease inhibitors). After determining the protein concentration, 20-30 µg of protein sample was taken and separated by SDS-PAGE gel electrophoresis. The sample was then blocked with 5% skim milk powder at room temperature for 1 hour. Primary antibody (anti-WNT5B antibody, 1:1000, ABclonal; internal control: anti-β-actin antibody, 1:5000, Proteintech) was added and incubated overnight at 4°C. After thorough washing, the appropriate HRP-labeled secondary antibody was added and incubated at room temperature for 1 hour. Development was performed using ECL chemiluminescence buffer, and protein bands were detected using a chemiluminescence imaging system.
[0041] 4. qRT-PCR: FD lesion tissue and normal jawbone tissue from healthy individuals were collected. Tissue RNA was extracted, reverse transcribed into cDNA, and quantitative PCR was performed using WNT5B specific primers, with β-actin as an internal control.
[0042] 5. Immunohistochemistry: After dewaxing, antigen retrieval, and blocking, tissue sections were incubated with anti-WNT5B antibody (1:1000, ABclonal, #A8313) overnight at 4°C, developed with DAB, and counterstained with hematoxylin.
[0043] Experimental results:
[0044] Single-cell sequencing results showed that human FD tissue cells could be divided into 13 different clusters based on gene expression profiles. Figure 1 B), each cluster has a relatively independent distribution area in the UMAP space, suggesting that FD lesion tissue has significant cellular heterogeneity; Figure 1 C further identified these 13 clusters as types including chondrocytes, endothelial cells, fibroblasts, NK cells, osteoblasts, osteoclasts, osteoclast precursor cells, smooth muscle cells, and T cells. Figure 1 The feature map of D shows that each cell type has a specific marker gene expression profile, which verifies the accuracy of cell type annotation and provides a cell atlas basis for subsequent screening of key regulatory molecules; Figure 2 UMAP feature maps of A show that WNT5B is highly expressed in fibroblast and osteoblast clusters.
[0045] Hematoxylin-eosin (HE) staining results Figure 1 E) shows that normal jawbone tissue exhibits a regular trabecular structure and a clear medullary cavity; while primary and recurrent FD tissues of the craniofacial region show typical pathological features, namely, the replacement of normal bone structure with a large amount of proliferating fibrous tissue and abnormal trabecular morphology. In the figure, white arrows point to trabeculae, yellow arrows point to abnormal trabeculae, and black arrows point to fibrous tissue. These morphological features histologically confirm the presence of abnormal fibrous-bone structure in FD lesions, consistent with the single-cell sequencing results of this invention (…). Figure 1 B-1D together revealed the cellular and structural heterogeneity of FD lesion tissue.
[0046] Western blot results showed that ( Figure 2 B), the expression level of WNT5B protein in FD lesion tissue was significantly higher than that in normal jawbone tissue. qRT-PCR results showed ( Figure 2 C), the WNT5B mRNA level in the case group was 4.5 times that in the control group of healthy individuals (P<0.001).
[0047] Immunohistochemical staining results showed ( Figure 2 D), WNT5B was highly expressed in FD. WNT5B protein was mainly expressed in spindle stromal cells (fibroblasts) and osteoblast-like cells in the lesion. The staining intensity in the case group was significantly higher than that in the control group (P<0.001).
[0048] The results of this embodiment reveal cellular heterogeneity in FD and confirm that WNT5B is highly expressed in FD patient samples.
[0049] Example 2: Functional Characteristics Analysis of FD Lesion Cells
[0050] Primary bone marrow stromal cells were isolated from diseased tissues of FD patients and bone tissues of healthy individuals. The proliferation, migration, and osteogenic differentiation abilities of primary bone marrow stromal fibroblasts (FD-derived cells) and normal bone marrow stromal cells (Normal BMSCs) from healthy individuals were compared as experimental subjects.
[0051] Experimental methods:
[0052] Primary cell isolation and culture: Fresh FD tissue and normal jawbone tissue (derived from orthognathic surgery patients) were minced, digested with collagenase, sieved, and seeded into αMEM medium (containing 10% FBS, 100 U / mL penicillin, and 100 μg / mL streptomycin) and cultured at 37°C with 5% CO2. Cells were passaged when they reached 80-90% confluence, and experiments were conducted using 3-5 passages of cells.
[0053] Proliferation experiment: Cells were seeded in 96-well plates at 2000 cells per well. After culturing for 1, 3, 5 and 7 days, CCK-8 reagent was added and incubated for 2 hours. The absorbance was measured at 450 nm.
[0054] Scratch assay: Cells were seeded in 12-well plates until confluence, scratched with 200 μL pipette tip, and the suspended cells were washed away with PBS. The migration distance was observed after 24 hours of culture.
[0055] Osteogenic differentiation ALP staining experiment: Cells were cultured in osteogenic induction medium (containing 50 μg / mL ascorbic acid, 10 mM β-glycerophosphate sodium, and 100 nM dexamethasone) and ALP staining was performed after 14 days.
[0056] qRT-PCR detection of osteogenic markers: detection of expression levels of RUNX2, SPP1, and ALP.
[0057] SPP1 Immunohistochemical Staining: Paraffin sections (4-5 μm thick) of lesion tissue from FD patients and normal bone tissue from healthy individuals were dewaxed and hydrated. Antigen retrieval was performed using pepsin solution at 37°C for approximately 20 minutes. Endogenous peroxidase activity was blocked with 3% H2O2 solution, and non-specific binding sites were blocked with 3% bovine serum albumin (BSA) solution. Anti-osteopontin (SPP1) antibody (Affinity, China) was added, and the mixture was incubated overnight at 4°C. Staining was performed using DAB substrate, and cell nuclei were counterstained with hematoxylin. After dehydration and clearing, the slides were mounted and observed under a light microscope.
[0058] Experimental results:
[0059] Figure 3 The scratch test results of A showed that the migration ability of FD lesion cells was significantly enhanced compared with that of normal bone tissue cells (scratch healing rate: 78.5% vs 35.2%, P<0.001). Figure 3 The proliferation experiment of B showed that the proliferation activity of FD lesion cells was higher than that of normal bone tissue cells (7-day OD value: 1.86±0.21 vs 1.32±0.18, P<0.01). Figure 3The ALP staining results (blue) of C showed that the alkaline phosphatase activity of FD lesion cells was significantly lower than that of normal BMSCs in healthy individuals (the staining intensity reflects ALP activity, representing early osteogenic differentiation), indicating that the osteogenic activity of FD lesion cells was significantly reduced. Figure 3 The qRT-PCR results of D showed that the expression of osteogenic markers RUNX2, SPP1 and ALP in FD diseased cells was significantly lower than that in normal BMSCs, decreasing by 62.3%, 71.5% and 58.7% respectively (P<0.01). Figure 3 Immunohistochemical results of E showed significantly reduced SPP1 expression in FD tissue. SPP1 expression activity represents late osteogenic differentiation, confirming poor ossification in the lesion tissue. The results of this example confirm that primary FD lesion cells exhibit osteogenic differentiation disorder.
[0060] Example 3: Regulation of WNT5B expression by GNAS mutation
[0061] Using the human bone marrow stromal cell line HS-5 (ATCC, CRL-3611) as the experimental subject and a fibroblast model, we constructed a GNAS (R201C) mutant lentiviral vector and transfected HS-5 bone marrow stromal cells to reveal the logical relationship of "FD-GNAS mutation-WNT5B".
[0062] Experimental methods:
[0063] 1. Lentiviral construction: The GNAS(R201C) mutant sequence was cloned into a lentiviral vector, co-transfected with the packaging plasmid into 293T cells, and the viral supernatant was collected.
[0064] 2. Cell transfection: HS-5 cells (ATCC, CRL-3611) were seeded in 6-well plates, and viral supernatant and polybrene were added. The medium was changed after 48 hours, and stable transfected cells were selected with puromycin.
[0065] 3. qRT-PCR detection: RNA was extracted from cells, and the expression levels of GNAS, CRABP1, GPC3, and WNT5B were detected by qRT-PCR.
[0066] 4. Transwell assay: HS-5 control group, wild-type group, and GNAS(R201C) mutant group cells in logarithmic growth phase were resuspended in serum-free medium and then cultured at 2 x 10⁻⁶ cells / well. 4Cells were seeded into the upper chamber of a Transwell chamber (8.0 μm pore size, Corning). Complete culture medium containing 20% FBS was added to the lower chamber. The chambers were incubated at 37°C with 5% CO2 for 24 hours. Unmigrated cells in the upper chamber were wiped away with a cotton swab. Cells in the lower chamber were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and observed under a microscope. The HS-5 control group consisted of untransfected HS-5 cells (ctr); the wild-type group consisted of HS-5 cells transfected with the GNAS wild-type gene lentivirus (wt); and the GNAS(R201C) mutant group consisted of HS-5 cells transfected with the GNAS(R201C) mutant lentivirus (R201C).
[0067] 5. Design of siRNA to knock down WNT5B protein expression: The following siRNA sequence (denoted as si-WNT5B) was designed targeting the human WNT5B gene:
[0068] Chain of Justice: 5'-GACCCGAGAUGUUUAUCAUTT-3' (SEQ ID NO.1);
[0069] Antonym: 5'-AUGAUAAACAUCUCGGGUCTT-3' (SEQ ID NO.2).
[0070] Using Lipofectamine RNAiMAX transfection reagent, with a final siRNA concentration of 50 nM, GNAS(R201C) mutant cells were transfected with si-WNT5B and blank siRNA (si-ctr) for 48 hours to obtain the si-WNT5B transfected group and the si-ctr group. Cells transfected with si-WNT5B and si-ctr were then collected, and total protein was extracted using RIPA lysis buffer. Proteins were separated by SDS-PAGE and electroporated onto PVDF membranes. Immunoblotting was performed using anti-WNT5B antibody (1:1000) and anti-β-actin antibody (1:5000) to verify the knockdown effect of siRNA on WNT5B protein.
[0071] 6. Osteoblastic differentiation ALP staining experiment: Wild-type (wt), R201C mutant, si-WNT5B transfected, and si-ctr cells were cultured in osteogenic induction medium (containing 50 μg / mL ascorbic acid, 10 mM β-glycerophosphate sodium, and 100 nM dexamethasone) for 14 days, followed by ALP staining. ALP is alkaline phosphatase, an early marker enzyme for osteoblast differentiation.
[0072] Experimental results:
[0073] like Figure 4As shown in Figure A, compared with wild-type cells, the expression of WNT5B and fibroblast markers CRABP1 and GPC3 was significantly increased in GNAS(R201C) mutant cells, suggesting that WNT5B is a downstream effector molecule of GNAS activating mutation.
[0074] like Figure 4 As shown in B, compared with the wild-type group and the control group, the migration ability of HS-5 cells transfected with GNAS(R201C) mutation was significantly enhanced, and the number of cells that migrated to the lower chamber was significantly increased, suggesting that GNAS(R201C) mutation can promote the migration activity of HS-5 cells, which is consistent with the phenotype of enhanced migration ability of primary FD lesion cells in previous studies.
[0075] ALP active staining assay showed ( Figure 4 C) HS-5 cells transfected with the GNAS(R201C) mutant gene (R201C group) had lower ALP levels than wild-type wt group cells. However, knocking down WNT5B expression with si-WNT5B (verified by Western blot) increased ALP levels in HS-5 cells transfected with the GNAS(R201C) mutant gene and promoted osteogenic differentiation.
[0076] This embodiment uses HS-5 cells and transfects the GNAS mutant gene to confirm that WNT5B is upregulated downstream of the GNAS gene mutation; and preliminarily confirms the effectiveness of siRNA knockdown of WNT5B expression and the promoting effect of WNT5B knockdown on osteoblast differentiation.
[0077] Example 4: Inhibition of WNT5B can restore osteogenic differentiation activity of FD lesion cells
[0078] Given that there is currently no universally accepted standard animal model for FD (fibrillary dysplasia) that can be used for preclinical drug testing, this embodiment uses primary FD disease cells as the experimental subject and designs WNT5B siRNA for cell transfection to evaluate the regulatory effect of WNT5B inhibitors on osteogenic impairment in FD.
[0079] Experimental methods:
[0080] 1. Osteogenic Differentiation Detection: Using Lipofectamine RNAiMAX transfection reagent, with a final siRNA concentration of 50 nM, primary FD disease cells were transfected with the same si-WNT5B and blank siRNA as in Example 3, designated as the si-WNT5B group and si-ctr group, respectively. Forty-eight hours after transfection, cells were cultured in osteogenic induction medium for three days. Cell RNA was extracted, and the expression levels of SPP1 and ALP in both groups were detected by qRT-PCR. After 14 days of culture in osteogenic induction medium, the medium was discarded, and the cells were fixed with 4% paraformaldehyde for 30 minutes. Staining was performed according to the BCIP / NBT ALP staining kit (Beyotime, China), and the cells were observed under a microscope for semi-quantitative detection of ALP activity.
[0081] 2. Detection of the rescue effect of recombinant WNT5B protein: Primary FD disease cells were transfected with si-WNT5B (si-WNT5B group). 48 hours after transfection, the cells were cultured for 14 days in osteogenic induction medium supplemented with recombinant WNT5B (purchased from R&D Systems), and then ALP staining and semi-quantitative analysis were performed again.
[0082] 3. Comparison of violin plots and UMAP plots of single-cell sequencing of FD lesion tissue and healthy human jawbone tissue: Analysis of violin plots and UMAP plots of WNT5B and SPP1 expression in major subpopulations of each cell cluster, with red indicating the highest gene expression and blue indicating low or no expression.
[0083] Experimental results:
[0084] like Figure 5 As shown in Figure A, transfection of primary FD disease cells with si-WNT5B to knock down WNT5B expression significantly restored the mRNA levels of early osteogenic markers ALP and late osteogenic marker SPP1 compared to the si-ctr control group. ALP activity staining and semi-quantitative experiments showed that inhibiting WNT5B expression in FD disease cells with si-WNT5B significantly upregulated ALP staining intensity. However, the addition of recombinant WNT5B protein significantly antagonized this si-WNT5B-mediated osteogenic recovery effect, thus confirming that inhibiting WNT5B can partially restore osteogenic differentiation activity in FD disease cells and upregulate the expression of osteogenic genes SPP1 and ALP.
[0085] like Figure 5 As shown in B, further comparison of single-cell sequencing violin plots and UMAP plots of FD lesion tissue and healthy human jawbone tissue revealed that WNT5B and SPP1 were both highly expressed in the major osteoblast subpopulations, with key overlap between osteogenic differentiation-related expression regions and cell subpopulations.
[0086] This embodiment uses primary FD disease cells. Knockdown and rescue experiments confirm that inhibiting WNT5B expression can significantly restore osteogenic activity of primary FD disease cells, reverse the osteogenic impairment phenotype of FD, and promote bone formation. Combined with Examples 1-3, this confirms the key role of WNT5B in osteogenic impairment of primary FD disease cells.
[0087] Example 5: Inhibition of WNT5B can reverse the promoting effect of FD disease cells on osteoclast differentiation.
[0088] Given that there is currently no universally accepted standard animal model for FD (fibroblastic disease) that can be used for preclinical drug testing, this embodiment uses a co-culture model of primary FD-derived cells and osteoclast precursor cells (preCP) to evaluate the regulatory effect of WNT5B inhibitors on the osteoclast process in FD lesion tissue.
[0089] 1. Establishment of the co-cultivation model:
[0090] Primary FD-derived cells (denoted as FD-Fb) were isolated from the lesion tissue of FD patients as a source of WNT5B secretion.
[0091] CD14+ monocytes were isolated from the peripheral blood of healthy volunteers and differentiated into preCPs under the induction of M-CSF (25 ng / mL, R&D Systems, USA).
[0092] FD-Fb or healthy human bone marrow stromal fibroblasts (NHDF) were seeded in the lower chamber of Transwell, and preCPs were seeded in the upper chamber (0.4 μm pore size) to establish a non-contact co-culture system, so that primary FD lesions could secrete and release WNT5B to act on preCP cells.
[0093] 2. Experimental Groups:
[0094] Negative control group: NHDF + preCP;
[0095] Positive control group: NHDF + preCP + 50 ng / mL RANKL (R&D Systems, USA);
[0096] Model group: FD-Fb + preCP;
[0097] Recombinant WNT5B proteome: NHDF + preCP + 50 ng / mL RANKL + recombinant WNT5B protein (100 ng / mL, R&D Systems, USA);
[0098] siWNT5B group (i.e. WNT5B knockdown group): FD-Fb +preCP transfected with WNT5B siRNA (SEQ ID NO.1-2);
[0099] Among them, RANKL is an essential activator for osteoclast formation experiments. RANK (nuclear factor κB receptor activator) can promote the transformation of osteoclast precursor cells into osteoclasts through RANKL (RANK ligand, a key osteoclast differentiation factor).
[0100] After 7 days of co-culture, cells from the upper chamber were collected for TRAP staining to count the number of TRAP-positive multinucleated cells, and the expression of osteoclast marker genes NFATC1, CTSK, and TRAP was detected by qRT-PCR.
[0101] 3. Experimental Results:
[0102] TRAP staining results showed ( Figure 6 A): No obvious osteoclast differentiation was observed in the negative control group, while obvious osteoclast differentiation was observed in the positive control group. The osteoclast differentiation of the model group and the positive control group showed a relatively consistent trend. The number of osteoclasts in the model group was increased compared with the negative control group, suggesting that FD-Fb can induce osteoclast differentiation through paracrine induction. The number of osteoclasts in the recombinant WNT5B protein group was increased compared with the positive control group, while the number of osteoclasts in the siWNT5B group was decreased compared with the model group.
[0103] qRT-PCR detection of the expression of osteoclast marker genes NFATC1, CTSK, and TRAP showed that ( Figure 6 B): The expression of osteoclast marker genes (NFATc1, CTSK, TRAP) in the model group and the positive control group showed a significant increasing trend compared with the negative control group; the expression level of osteoclast marker genes in the recombinant WNT5B protein group was further enhanced, showing a significant difference, while the expression level of osteoclast-related genes in the siWNT5B group was significantly lower than that in the model group.
[0104] The above results confirm that WNT5B can promote osteoclast differentiation, and inhibiting WNT5B can reverse the promoting effect of FD disease cells on osteoclast differentiation and inhibit bone resorption.
[0105] The results of Examples 3-5 confirm that WNT5B inhibitors (siRNAs with sequences as shown in SEQ ID NO. 1-2) can block the inhibitory effect of WNT5B on osteogenic formation and the promoting effect on osteoclastosis, thereby achieving the therapeutic goal of FD. Furthermore, the inventors have demonstrated that two siRNAs with sequences as shown in SEQ ID NO. 3-4 and SEQ ID NO. 5-6 can also effectively inhibit WNT5B expression, and therefore can also be considered as candidate drugs for the treatment of FD.
[0106] Example 6: Types and preparation of WNT5B inhibitors
[0107] The above examples demonstrate the efficacy of inhibiting WNT5B in treating functional fibrosis (FD). This document provides some applicable regimens for WNT5B inhibitors, as detailed below:
[0108] Anti-WNT5B antibodies: Monoclonal antibodies can be prepared using hybridoma technology, phage display technology, etc. Animals are immunized with WNT5B protein, and antibodies that specifically bind to WNT5B and neutralize its activity are screened. Further humanization can be used to obtain clinically suitable humanized antibodies.
[0109] Nucleic acid inhibitors: Nucleic acid inhibitors such as siRNA, shRNA or ASO are designed to target WNT5B. The inhibitors are mixed with cationic liposomes at a mass ratio of 1:3 to prepare nanoparticles. The resulting formulation has a particle size of about 120 nm and an encapsulation efficiency of about 85%. Effective inhibition is achieved through local injection and systemic injection.
[0110] Note: The primer sequences used for qRT-PCR detection in the above examples are as follows:
[0111] β-actin gene primer sequences: F: GGACTTCGAGCAAGAGATGG, R: AGCACTGTGTTGGCGTACAG;
[0112] WNT5B gene primer sequences: F: CGCTTCGCCAAGGAGTTTG, R: TGCCATCTTATACACAGCCT;
[0113] ALP gene primer sequences F: ACTGGTACTCAGACAACGAGAT, R: ACGTCAATGTCCCTGATGTTATG;
[0114] RUNX2 gene primer sequences: F: TCAACGATCTGAGATTTGTGGG, R: GGGGAGGATTTGTGAAGACGG;
[0115] SPP1 gene primer sequences: F: CTCCATTGACTCGAACGACTC, R: CAGGTCTGCGAAACTTCTTAGAT;
[0116] CRABP1 gene primer sequences F: ACGCAAGTGCAGGAGTTTAG, R: CGGGTCCAGTAGGTTTTGGG;
[0117] GPC3 gene primer sequences F: CAGTAAGGACTGTGGCCGAAT, R: AGCAGTACGTTCTCCATGTCAT;
[0118] GNAS gene primer sequences F: GCCTGCTACGAACGCTCCAAC, R: TCCTGATCGCTCGGCACATAGTC;
[0119] NFATC1 gene primer sequences: F: GAGTACACCTTCCAGCACCTT, R: TATGATGTCGGGGAAAGAGA;
[0120] CTSK gene primer sequences F: GAGGTGGTTCAGAAGATGAC, R: CCCAACAGGAACCACACT;
[0121] TRAP gene primer sequences F: GCTGTCCTGGCTCAAGAAAC, R: CCCACGCCATTCTCATCTTG.
[0122] This specific embodiment is merely an explanation of the present invention and is not intended to limit the present invention. Any changes made by those skilled in the art after reading the specification of the present invention, as long as they are within the scope of the claims of the present invention, will be protected by patent law.
Claims
1. Application of WNT5B inhibitors in the preparation of drugs for the treatment of fibrous dysplasia of bone.
2. The application according to claim 1, characterized in that, The WNT5B inhibitor is selected from any of the following: (1) anti-WNT5B antibody or its antigen-binding fragment; (2) nucleic acid inhibitor targeting WNT5B; (3) a combination of (1) and (2) above.
3. The application according to claim 2, characterized in that, The anti-WNT5B antibody is a neutralizing antibody that can specifically bind to the WNT5B protein and inhibit its binding to the receptor.
4. The application according to claim 2, characterized in that, The nucleic acid inhibitor is selected from siRNA, shRNA, or antisense oligonucleotides and is designed to target the coding region or 3' untranslated region of the WNT5B gene.
5. The application according to claim 4, characterized in that, The siRNA sequence is selected from any of the following: (i) Justice chain: 5'-GACCCGAGAUGUUUAUCAUTT-3'; Antisense chain: 5'-AUGAUAAACAUCUCGGGUCTT-3'; (ii) Justice chain: 5'-GCAGGGCUGUGUAUAAGAUTT-3'; Antisense chain: 5'-AUCUUAUACACAGCCCUGCTT-3'; (iii) Justice chain: 5'-CGAGAGAAGAACUUUGCCATT-3'; Antisense chain: 5'-UGGCAAAGUUCUUCUCUCGTT-3'.
6. The application according to claim 1, characterized in that, The drug uses a WNT5B inhibitor as its active ingredient. The WNT5B inhibitor inhibits bone resorption, promotes bone formation, and inhibits disease progression or postoperative recurrence.
7. The application according to claim 1, characterized in that, The dosage form of the drug is selected from injections, liposomes, nanoparticles, or sustained-release formulations; the drug is administered via local injection or systemic injection.
8. A pharmaceutical composition for treating fibrous dysplasia of bone, characterized in that, The pharmaceutical composition comprises a WNT5B inhibitor and a pharmaceutically acceptable carrier; the WNT5B inhibitor is selected from any of the following: (1) an anti-WNT5B antibody or an antigen-binding fragment thereof; (2) a nucleic acid inhibitor targeting WNT5B; (3) a combination of (1) and (2) above.
9. The pharmaceutical composition according to claim 8, characterized in that, The WNT5B inhibitor is a siRNA whose sequence is selected from any of the following: (i) Justice chain: 5'-GACCCGAGAUGUUUAUCAUTT-3'; Antisense chain: 5'-AUGAUAAACAUCUCGGGUCTT-3'; (ii) Justice chain: 5'-GCAGGGCUGUGUAUAAGAUTT-3'; Antisense chain: 5'-AUCUUAUACACAGCCCUGCTT-3'; (iii) Justice chain: 5'-CGAGAGAAGAACUUUGCCATT-3'; Antisense chain: 5'-UGGCAAAGUUCUUCUCUCGTT-3'.
10. Application of WNT5B as a drug target in screening candidate drugs for the treatment of fibrous dysplasia of bone.