Rice high resistant starch molecular marker, rice mutant osbeii b gene and its identification method, application and primer

Abstract

The application belongs to the technical field of rice molecular genetics and breeding, and discloses a rice high-resistance starch molecular marker, a rice mutant OsBEIIb gene and an identification method, application and primer thereof. The molecular marker is AATC base deletion located at 19358023-19358026 of chromosome 2 of rice, which is significantly linked to the high-resistance starch content trait of rice grains. The application further provides a rice mutant OsBEIIb gene containing the molecular marker, and a PCR primer and a KASP gene typing primer for detecting the molecular marker. By using the molecular marker and primer of the application, the gene typing of the rice to be tested can be carried out, and the high-resistance starch rice plant containing the marker can be accurately and efficiently identified and screened. The method is simple in operation and high in throughput, can greatly shorten the breeding period of the high-resistance starch rice and reduce the breeding cost, and has important application value for functional rice germplasm innovation and variety improvement.

Description

Technical Field

[0001] This invention belongs to the field of rice molecular genetics breeding technology, and particularly relates to a molecular marker, mutant gene and its identification method, application and primers related to high resistant starch content in rice. Background Technology

[0002] With the improvement of living standards in my country, excessive intake of high-sugar, high-fat, and refined carbohydrates has led to a trend of younger onset and higher incidence of chronic metabolic diseases, such as type 2 diabetes. Diabetes not only requires long-term medication, but its complications also seriously threaten human health. Therefore, shifting from "clinical treatment" to "daily dietary prevention and intervention," and using improved staple food structures to help control postprandial blood glucose, has become a major public health issue requiring collaborative research from the medical, nutritional, and agricultural breeding communities. Among many dietary intervention components, resistant starch (RS) has attracted much attention due to its unique physicochemical properties. Unlike conventional starch, which is easily and completely digested in the small intestine, resistant starch is difficult to degrade and digest by pancreatic amylase in the stomach and small intestine, and can directly enter the large intestine where it is fermented by intestinal microbiota. This fermentation not only produces short-chain fatty acids beneficial to the intestinal mucosa, but also effectively slows down the rate of carbohydrate conversion to glucose, thereby significantly reducing postprandial blood glucose peaks. Therefore, developing daily foods rich in resistant starch is of great significance to the vast number of diabetic patients.

[0003] Currently, low glycemic index (GI) foods for diabetics on the market mainly rely on post-processing. These high-resistant starch functional foods are mostly made by extracting starch from corn, potatoes, or green bananas, followed by complex physical denaturation or chemical modification, resulting in high costs and prices. For diabetic patients who require long-term strict dietary control, the economic cost of adjunctive therapy will increase significantly, making it extremely difficult to achieve true widespread adoption among the general public. Rice, as the traditional staple food for more than half of my country's population, presents a significant challenge. If rice rich in resistant starch could be cultivated directly from the source—agricultural cultivation—allowing patients to achieve dietary intervention through daily consumption of white rice, it would be the optimal solution and the lowest-cost path to address this public health concern. However, the vast majority of rice varieties in nature have an RS content of less than 1%, making it extremely difficult to directly screen for high-resistant starch germplasm resources that meet the standards for functional agriculture from existing mainstream rice varieties. Therefore, creating new high RS rice varieties is an urgent problem that functional rice breeding needs to solve. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a highly efficient, accurate, and easy-to-operate method, application, and primers for identifying highly resistant starch rice molecular markers, mutant genes, and their identification.

[0005] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:

[0006] In a first aspect, the present invention provides a rice high-resistant starch molecular marker, the nucleotide sequence of which is shown in SEQ ID No:1; the rice high-resistant starch molecular marker is an Indel marker, which is significantly correlated with the resistant starch content of rice grains. Taking the IRGSP-1.0 version genome of Nipponbare rice as a reference genome, the nucleotide sequence of the high-resistant starch molecular marker contains an AATC deletion at positions 19358023-19358026 on chromosome 2 of rice, hereinafter referred to as "molecular marker RS-19358022".

[0007] Preferably, the rice high-resistant starch molecular marker is obtained by amplification using primers as shown in SEQ ID No:4~5: 19358022-F: 5'-TTGATCGTGGAATAGCATTGCATAA-3'; 19358022-R: 5'-AAGTTACCAGGTCAAATCTTCGACG-3'; This primer can amplify the chromosomal region containing the marker, thus identifying the presence of highly resistant starch molecular markers.

[0008] Secondly, the present invention provides a rice mutant. OsBEIIb Gene, the rice mutant OsBEIIb The gene sequence is based on chromosome 2 of Nipponbare rice. OsBEIIb The gene sequence is the basic sequence, on which the AATC deletion is located at positions 19358023-19358026 on chromosome 2 of rice.

[0009] The above-mentioned rice mutants OsBEIIb The gene, preferably, has the nucleotide sequence of its CDS region as shown in SEQ ID No:2 and the protein sequence it encodes as shown in SEQ ID No:3.

[0010] Thirdly, the present invention provides a method for determining whether rice carries the molecular marker RS-19358022 or the rice mutant. OsBEIIbThe gene identification method includes the following steps: using the rice genomic DNA to be tested as a template, PCR amplification is performed using KASP genotyping primers. If only a FAM signal is obtained, the sample does not carry the molecular marker RS-19358022 or the rice mutant. OsBEIIb Gene; if FAM / HEX signal is obtained, the sample carries the molecular marker RS-19358022 or a rice mutant. OsBEIIb The gene is heterozygous; if only the HEX signal is obtained, the sample carries the molecular marker RS-19358022 or a rice mutant. OsBEIIb Genes, and in a homozygous state; The nucleotide sequences of the KASP genotyping primers are shown in SEQ ID No: 6-8: 19358022-KF: 5'-GAAGGTGACCAAGTTCATGCTGATCTACCTTTTATTTTGCAGAATGGATTG-3'; 19358022-KH: 5'-GAAGGTCGGAGTCAACGGATTGATCTACCTTTTATTTTGCAGAATGGATTT-3'; 19358022-KC: 5'-ATTTGGAAGTACTTGTGGAGCTCT-3'.

[0011] Fourthly, the present invention provides the highly resistant starch molecular marker (molecular marker RS-19358022) or the rice mutant. OsBEIIb Application of genes in breeding highly resistant starch rice.

[0012] The above-described application, preferably, involves a method comprising the following steps: using a rice-containing high-resistant starch molecular marker or a rice mutant. OsBEIIb The highly resistant starch-producing material was used as the donor parent, and other materials to be improved were used as the recipient parents. Crossing was performed to obtain F1, and F1 plants were planted to obtain F2 generation. The individual plants of the F2 generation were then identified to determine whether they carried the aforementioned highly resistant starch molecular marker or the aforementioned rice mutant. OsBEIIb Genes carrying the aforementioned high-resistance starch molecular marker or the aforementioned rice mutant OsBEIIb Single plants carrying the gene are propagated and reproduced for multiple generations, repeating the above process until the offspring acquire genetically stable, homozygous high-resistance starch molecular markers or the rice mutant. OsBEIIb A single plant of the gene is used to obtain the high-resistant starch rice.

[0013] More preferably, the material to be improved is the indica rice variety R402.

[0014] Fifthly, the present invention provides PCR primers for the rice high-resistance starch molecular marker (molecular marker RS-19358022), the nucleotide sequences of which are shown in SEQ ID No:4~5: 19358022-F: 5'-TTGATCGTGGAATAGCATTGCATAA-3'; 19358022-R: 5'-AAGTTACCAGGTCAAATCTTCGACG-3'.

[0015] Sixthly, the present invention provides a method for identifying whether rice carries the aforementioned highly resistant starch molecular marker (molecular marker RS-19358022) or the aforementioned rice mutant. OsBEIIb KASP genotyping primers for the gene, the nucleotide sequences of which are shown in SEQ ID No: 6-8: 19358022-KF: 5'-GAAGGTGACCAAGTTCATGCTGATCTACCTTTTATTTTGCAGAATGGATTG-3'; 19358022-KH: 5'-GAAGGTCGGAGTCAACGGATTGATCTACCTTTTATTTTGCAGAATGGATTT-3'; 19358022-KC: 5'-ATTTGGAAGTACTTGTGGAGCTCT-3'.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention provides a molecular marker for breeding rice with high resistance to starch. It utilizes a molecular marker with AATC deletion at positions 19358023-19358026 on rice chromosome 2 to rapidly identify rice with high resistance to starch, reducing the workload of breeding rice with high resistance to starch and shortening the breeding cycle. It provides technical support for the simple, rapid and high-throughput application of molecular marker-assisted breeding technology for the improvement of rice with high resistance to starch. 2. This invention provides a method and PCR primers and KASP genotyping primers for identifying the molecular marker RS-19358022, which can accurately genotype different individuals of the Indel discovered by sequencing, further improving the accuracy and efficiency of existing innovative germplasm screening and identification, and is easy to operate; 3. This invention also provides an application of using the molecular marker RS-19358022 to breed highly resistant starch rice, which has achieved significant technical results and ultimately obtained improved lines of highly resistant starch rice varieties. This not only saves identification time and costs, but also facilitates crop improvement and germplasm innovation of highly resistant starch rice varieties, which has significant progressive significance. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a diagram showing the PCR amplification results of the molecular marker RS-19358022 in Example 1 of this invention; A: heterozygous mutant; B: homozygous mutant.

[0019] Figure 2 This is a comparison chart of the resistant starch content of RS-R202 and its wild-type control material in Example 1 of the present invention.

[0020] Figure 3 This is a KASP genotyping diagram of the F2 population using the molecular marker RS-19358022 in Example 1 of the present invention; wherein, blue dots: FAM signal, wild type; green dots: HEX signal, homozygous mutant; red dots: FAM / HEX signal, heterozygous mutant.

[0021] Figure 4 This is a comparison chart of RS content in wild-type (WT) and homozygous mutant (mt) grains in Example 1 of the present invention.

[0022] Figure 5 This is a comparison chart of the resistant starch content of RS-R402 and its wild-type control material in Example 2 of the present invention. Detailed Implementation

[0023] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0024] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0025] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0026] Example 1: A rice high-resistance starch molecular marker, rice mutant OsBEIIb Genes and their identification methods.

[0027] 1. Creation of molecular markers for highly resistant starch Using high-energy heavy ion beams ( 12 C 6+ A hybrid rice restorer line (R202) with high amylose (AC) content was irradiated. M1 generation seeds after irradiation were grown to the tillering stage. DNA pools were constructed by sampling 300 plants at a time, and the DNA was then analyzed using rice... OsBEIIb Exon capture primers were used to perform mixed-pool exon capture and targeted deep sequencing. After filtering, the sequencing data were compared with the Nipponbare genome (IRGSP-1.0) as a reference sequence. One Indel variant was found in pool 3, namely the deletion of AATC at positions 19358023-19358026 on chromosome 2 of rice.

[0028] The nucleotide sequence of the obtained rice high-resistant starch molecular marker (hereinafter referred to as "molecular marker RS-19358022") is shown in SEQ ID No:1: AATGGATTTTCCAAGAGCTCCACAAGTACTTCCAAATGGTAAATTCATCCCAGGGAATAACAACAGTTATGATAAATGCCGTCGAAGATTTGACCTG.

[0029] The obtained rice mutant OsBEIIb The gene, whose CDS region nucleotide sequence is shown in SEQ ID No:2:

[0030] This rice mutant OsBEIIb The protein sequence encoded by the gene is shown in SEQ ID No:3: .

[0031] PCR primers were developed to target the aforementioned Indel mutation, namely 19358022-F and 19358022-R (as shown in SEQ ID No: 4~5). Single plants from pool 3 were amplified using these PCR primers. Sanger sequencing results identified a double peak at position 19358023 in the second plant of row 78 of the R202 M1 population. Figure 1A). In the M2 population with the above mutation, Sanger sequencing results showed a deletion of AATC at bases 19358023-19358026. Figure 1 B), a homozygous mutant single plant was identified and named RS-R202.

[0032] Harvest OsBEIIb The content of resistant starch in mature seeds of homozygous mutant single plants (RS-R202) and wild-type materials (R202) was accurately determined using the Megazyme kit and spectrophotometry. The resistant starch content of RS-R202 was significantly higher than that of the original control. Figure 2 ).

[0033] 2. Linkage verification between molecular markers and traits F1 generation was obtained by crossing RS-R202 (high AC, high RS) with R-7 (high AC, low RS). F1 generation was planted and F2 generation was harvested. F2 generation was then planted in the field to obtain the F2 population. KASP primers were designed, namely 19358022-KF, 19358022-KH, and 19358022-KC (as shown in SEQ ID No: 6~8), and genotyping of the F2 population was performed using KASP primers. Figure 3 If only the FAM signal is obtained, the sample does not carry the RS-19358022 molecular marker; if the FAM / HEX signal is obtained, the sample carries the RS-19358022 molecular marker and is in a heterozygous state; if only the HEX signal is obtained, the sample carries the RS-19358022 molecular marker and is in a homozygous state.

[0034] One hundred plants were randomly selected from both homozygous mutant and wild-type genotypes. After the rice was fully mature, the individual plants were harvested, threshed, and milled. The content of resistant starch was accurately determined using the Megazyme kit and spectrophotometry. The experiment showed that the molecular marker 19358022 carried by RS-R202 was completely linked to the phenotype and exhibited high RS characteristics, which can be used for the rapid breeding of high-resistant starch rice.

[0035] Example 2: The RS-19358022 molecular marker or rice mutant obtained in Example 1 OsBEIIb The application of genes in breeding highly resistant starch rice, specifically using the characteristics of the RS-19358022 molecular marker to select highly resistant starch rice, includes the following steps: The indica rice variety R402 (high AC, low RS) was crossed with RS-R202 (high AC, high RS) to obtain F1. F1 was then planted to obtain F2 generation. The genotype of the RS-19358022 marker was identified in individual plants of the F2 generation using KASP primers 19358022-KF, 19358022-KH, and 19358022-KC (as shown in SEQ ID Nos: 6~8). Agronomic traits of plants carrying the RS-19358022 molecular marker were evaluated. Superior plants were selected for seed production and propagation for multiple generations, repeating the above process until genetically stable plants carrying the homozygous RS-19358022 marker were obtained, thus yielding high-resistant starch rice, named RS-R402. After RS-R402 and the wild-type control were fully mature, individual plants were harvested, threshed, and milled into brown rice. The content of resistant starch was accurately determined using the Megazyme kit and spectrophotometry. The content of resistant starch in RS-R402 grains was significantly higher than that in the control material. Figure 5 ).

Claims

1. A highly resistant starch molecular marker for rice, characterized in that, Its nucleotide sequence is shown in SEQ ID No:

1.

2. The rice high-resistance starch molecular marker according to claim 1, characterized in that, The rice high-resistance starch molecular marker was obtained by amplification using the following primers: 19358022-F: 5'-TTGATCGTGGAATAGCATTGCATAA-3'; 19358022-R:5'-AAGTTACCAGGTCAAATCTTCGACG-3'.

3. A rice mutant OsBEIIb Genes, characterized by, The rice mutant OsBEIIb Genes from chromosome 2 of Nipponbare rice OsBEIIb The gene sequence is the basic sequence, on which the AATC deletion is located at positions 19358023-19358026 on chromosome 2 of rice.

4. The rice mutant according to claim 3 OsBEIIb Genes, characterized by, The nucleotide sequence of its CDS region is shown in SEQ ID No:

2.

5. Whether a type of rice contains the rice high-resistant starch molecular marker as described in any one of claims 1-2 or the rice mutant as described in any one of claims 3-4. OsBEIIb A method for identifying genes, characterized in that, The process includes the following steps: using the rice genomic DNA to be tested as a template, PCR amplification is performed using KASP genotyping primers. If only FAM signal is obtained, the sample does not carry the rice high-resistance starch molecular marker or the rice mutant. OsBEIIb Gene; if FAM / HEX signal is obtained, the sample carries the rice high-resistance starch molecular marker or the rice mutant. OsBEIIb The gene is heterozygous; if only the HEX signal is obtained, the sample carries the rice high-resistance starch molecular marker or the rice mutant. OsBEIIb Genes, and in a homozygous state; The nucleotide sequences of the KASP genotyping primers are as follows: 19358022-KF: 5'-GAAGGTGACCAAGTTCATGCTGATCTACCTTTTATTTTGCAGAATGGATTG-3'; 19358022-KH: 5'-GAAGGTCGGAGTCAACGGATTGATCTACCTTTTATTTTGCAGAATGGATTT-3'; 19358022-KC: 5'-ATTTGGAAGTACTTGTGGAGCTCT-3'.

6. A rice high-resistance starch molecular marker as described in any one of claims 1-2 or a rice mutant as described in any one of claims 3-4 OsBEIIb Application of genes in breeding highly resistant starch rice.

7. The application according to claim 6, characterized in that, The method of application includes the following steps: using a rice high-resistant starch molecular marker containing any one of claims 1-2 or any one of claims 3-4. OsBEIIb The highly resistant starch-producing material was used as the donor parent, and other materials to be improved were used as the recipient parents. Crossing was performed to obtain F1, and F1 plants were planted to obtain F2 generation. The individual plants of the F2 generation were then identified to determine whether they carried the aforementioned highly resistant starch molecular marker or the aforementioned rice mutant. OsBEIIb Genes carrying the aforementioned high-resistance starch molecular marker or the aforementioned rice mutant OsBEIIb Single plants carrying the gene are propagated and reproduced for multiple generations, repeating the above process until the offspring acquire genetically stable, homozygous high-resistance starch molecular markers or the rice mutant. OsBEIIb A single plant of the gene is used to obtain the high-resistant starch rice.

8. The application according to claim 6, characterized in that, The material to be improved is the indica rice variety R402.

9. A PCR primer for a rice high-resistance starch molecular marker as described in any one of claims 1-2, characterized in that, Its primer sequences are as follows: 19358022-F: 5'-TTGATCGTGGAATAGCATTGCATAA-3'; 19358022-R:5'-AAGTTACCAGGTCAAATCTTCGACG-3'.

10. A method for identifying whether rice carries the rice high-resistant starch molecular marker as described in any one of claims 1-2 or the rice mutant as described in any one of claims 3-4. OsBEIIb KASP genotyping primers for genes, characterized in that, The nucleotide sequences of the KASP genotyping primers are as follows: 19358022-KF: 5'-GAAGGTGACCAAGTTCATGCTGATCTACCTTTTATTTTGCAGAATGGATTG-3'; 19358022-KH: 5'-GAAGGTCGGAGTCAACGGATTGATCTACCTTTTATTTTGCAGAATGGATTT-3'; 19358022-KC: 5'-ATTTGGAAGTACTTGTGGAGCTCT-3'.

Images