Construction method and application of nasal mucosa neuroendocrine cell local specificity ablation model

Abstract

The application discloses a construction method of a nasal mucosa neuroendocrine cell local specificity ablation model and application thereof. Ascl1 Cre Mice are crossed to obtain Rosa26-LSL-DTR Ascl1 Cre Rosa26-LSL-DTR Double-hybrid mice, white diphtheria toxin receptor is specifically expressed in Ascl1 positive cells by using a Cre-loxP system. Adult mice are locally dripped with diphtheria toxin through a nasal cavity to induce nasal mucosa Ascl1 positive neuroendocrine cell specific ablation, and gene expression is verified by Ascl1 immunofluorescence and RT-PCR detection. Ascl1, Calca The application has the advantages of strong tissue specificity, small side effect, inducible operation at an adult stage, good repeatability and the like, and can be applied to pathogenesis research of chronic sinusitis, type 2 airway inflammation and related immune diseases, development of a targeted intervention strategy and drug screening and evaluation.​

Description

Technical Field

[0001] This invention relates to the fields of biomedicine and ear, nose and throat diseases, specifically to a method for constructing a localized ablation model of nasal mucosal neuroendocrine cells and its application. Background Technology

[0002] Chronic rhinosinusitis (CRS) is a group of chronic airway diseases characterized by persistent inflammation of the nasal cavity and sinus mucosa, characterized by prolonged course, high recurrence rate, and strong clinical heterogeneity. Among these, chronic rhinosinusitis with predominantly type 2 inflammatory responses, especially chronic rhinosinusitis with nasal polyps (CRSwNP), often presents with eosinophilic infiltration, goblet cell metaplasia, and abnormally elevated levels of type 2 inflammatory factors such as IL-4, IL-5, and IL-13. Currently, its pathogenesis is not fully understood, and effective research models and intervention strategies targeting key pathogenic cells are lacking.

[0003] In recent years, with the development of single-cell sequencing technology and spatial transcriptomics, rare cell populations in the airway epithelium have gradually attracted attention. Among them, neuroendocrine cells (NECs) are a type of rare chemoreceptor cells distributed in the airway epithelium, with functions such as secreting neuropeptides and bioactive amines, sensing external stimuli, and regulating local immune responses. NECs can express marker molecules such as achaete-scute family bHLH transcription factor 1 (ASCL1), calcitonin gene-related peptide (CGRP), and chromogranin A (CHGA), playing an important role in maintaining airway homeostasis, regulating inflammation, and tissue repair. Studies have found that in asthma models, lower airway NECs can act on type 2 innate lymphoid cells (ILC2) by secreting CGRP, promoting type 2 inflammatory responses. However, current research on the function of nasal mucosal NEC in chronic sinusitis is still limited, and its specific mechanism of action in type 2 upper airway inflammation remains unclear.

[0004] Currently, research on respiratory NEC function mainly relies on gene knockout or induced cell ablation strategies. For example, while systemic Ascl1 knockout mice can block NEC development, because Ascl1 is also expressed in neurons, systemic knockout easily induces abnormal nervous system development, leading to perinatal lethality, making it impossible to obtain adult mice for nasal mucosal NEC function assessment. To avoid this lethality, some studies use gene knockout-based... Shh cre Conditional knockout of Ascl1 during lung development, while yielding surviving mice, occurs during the embryonic lung bud initiation stage and cannot achieve inductive regulation in the adult stage. Furthermore, existing studies have applied… Ascl1 CreERT2 Rosa26-LSL-DTA In mice, combined with local nasal instillation of 4-hydroxytamoxifen, induced NEC death was achieved. However, this model has been mainly reported in studies of the lower airways such as the lungs and trachea, and its applicability to the nasal mucosa is still unclear. Furthermore, the DTA-mediated cell killing in this model is irreversible, making it impossible to assess functional recovery after NEC clearance.

[0005] Therefore, constructing an experimental system suitable for adult mice, with controllable local administration, high specificity to nasal mucosa tissue, few systemic side effects, reversible local ablation of NEC in the nasal mucosa, and applicable to the study of type 2 upper airway inflammation such as chronic sinusitis, is of great significance for elucidating the mechanism of NEC in regulating type 2 airway inflammation and finding relevant intervention strategies. Summary of the Invention

[0006] The purpose of this invention is to provide a method for constructing a local specific ablation model of nasal mucosal neuroendocrine cells and its application, so as to solve the problem that there is a lack of research models in the prior art that can achieve local specific NEC ablation of the nasal mucosa in adults and have high tissue specificity.

[0007] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides a method for constructing a localized ablation model of neuroendocrine cells in the nasal mucosa, comprising the following steps: (1) Fluorescent reporter mice Ascl1-Cre-tdTomato and Rosa26-LSL-DTR Mice were crossbred to obtain Ascl1 Cre Rosa26-LSL-DTR Double heterozygous progeny mice; wherein, the Ascl1 Cre Rosa26-LSL-DTR Cre recombinase in double heterozygous progeny mice mediates in Ascl1-positive cells Rosa26-LSL-DTR Removal of the LSL blocking sequence at the site leads to the expression of diphtheria toxin receptor DTR on the surface of Ascl1-positive cells; (2) For adultsAscl1 Cre Rosa26-LSL-DTR Diphtheria toxin (DT) was administered via nasal drops to double heterozygous mice to induce specific ablation of Ascl1-positive neuroendocrine cells in the nasal mucosa, thus establishing a local specific ablation model of nasal mucosal neuroendocrine cells.

[0008] Furthermore, in step (1), Ascl1 Cre Rosa26-LSL-DTR The genotypes of double heterozygous mice were identified by PCR amplification and agarose gel electrophoresis.

[0009] Furthermore, the primer pairs used in the PCR amplification include those for detection. Ascl1 Primer pairs for wild-type alleles, used for detection Ascl1 Cre Primer pairs for alleles and those used for detection Rosa26-LSL-DTR The primer combinations for alleles are shown in SEQ ID NO:1 to SEQ ID NO:7.

[0010] Furthermore, in step (2), the dosage of diphtheria toxin is 30-100 ng (preferably 50 ng) per mouse per administration, dissolved in sterile phosphate buffer, and administered in equal amounts through each nostril. The administration frequency is 1-3 times per week, and the duration of administration is 1-3 weeks.

[0011] Furthermore, the adult mice are 6-12 weeks old.

[0012] Furthermore, the ablation effect of the localized specific ablation model of nasal mucosal neuroendocrine cells is verified using one or more of the following methods: (a) Detection of the number of Ascl1-positive cells in nasal mucosal epithelium by Ascl1 immunofluorescence staining; (b) RT-PCR detection of nasal mucosal tissue Ascl1 Gene mRNA expression level; (c) RT-PCR detection of nasal mucosa tissue Calca Gene mRNA expression level.

[0013] The present invention also provides a method for constructing an eosinophilic chronic sinusitis model. Based on the local specific ablation model of nasal mucosal neuroendocrine cells constructed by the above method, an eosinophilic chronic sinusitis model is established by intranasal instillation of papain.

[0014] Furthermore, the papain administration regimen is as follows: the day of the first administration of diphtheria toxin is recorded as day 0, and 20 μL of papain solution with a concentration of 2 mg / mL is dripped into each nostril of the mouse on days 3, 4, 5 and days 10, 11, 12, 13 and 14.

[0015] Furthermore, the inflammation level of the eosinophilic chronic sinusitis model was assessed using one or more of the following methods: (a) HE staining to detect the degree of eosinophil infiltration in the nasal mucosa; (b) PAS staining to detect the degree of goblet cell metaplasia in the nasal mucosa; (c) RT-PCR detection of type 2 inflammatory factors in nasal mucosa tissue Il5 and / or Il13 mRNA expression levels.

[0016] The present invention also provides a method for constructing the above-mentioned local specific ablation model of nasal mucosal neuroendocrine cells, or the above-mentioned method for constructing the eosinophilic chronic sinusitis model, with applications in any of the following aspects: (a) To study the function of neuroendocrine cells in chronic sinusitis; (b) To investigate the role of neuroendocrine cells in type 2 airway inflammation; (c) To study the pathogenesis of neuroendocrine cell-related immune diseases; (d) Development of targeted intervention strategies for chronic sinusitis, type 2 airway inflammation, or neuroendocrine cell-related immune diseases; (e) Drug screening and efficacy evaluation for chronic sinusitis, type 2 airway inflammation or neuroendocrine cell-related immune diseases.

[0017] The principle of this invention: This invention constructs Ascl1 Cre Rosa26-LSL-DTR By using double-heterozygous mice and combining them with local DT instillation technology in the nasal cavity, NEC local specific ablation of the nasal mucosa of adult mice was achieved, thereby establishing an animal model system suitable for the study of chronic sinusitis and airway type 2 inflammation.

[0018] 1. Ascl1 Cre Rosa26-LSL-DTR Construction of double heterozygous mice This invention will... Ascl1 Cre mice and Rosa26-LSL-DTR Mice were crossbred to obtain Ascl1 Cre Rosa26-LSL-DTRDouble heterozygous mice. In Ascl1-positive cells, Cre recombinase mediates the excision of the LSL blocking sequence, resulting in the expression of the diphtheria toxin receptor DTR on the surface of Ascl1-positive cells, thereby conferring these cells to diphtheria toxin.

[0019] 2. Local DT instillation in the nasal cavity achieves localized specific ablation of NEC. This invention employs a method of local nasal instillation of DT (diuretic peptide), allowing DT to primarily act on the nasal mucosa, thereby achieving Ascl1-positive NEC-induced ablation of the nasal mucosa. Compared to existing technologies, the advantages of this invention are: firstly, it avoids systemic ablation during the embryonic period. Ascl1 Knockout leads to perinatal lethality, making it impossible to study adults; on the other hand, it overcomes the limitation that conditional knockout during lung development can only be initiated at the embryonic stage and cannot achieve regulation at the adult stage, while also solving... Ascl1 CreERT2 Rosa26-LSL-DTA The model faces the problem of irreversible ablation. Therefore, this invention is more suitable for local NEC ablation of the nasal mucosa in adult mice and for studies related to type 2 upper airway inflammation such as chronic sinusitis.

[0020] 3. NEC ablation verification This invention demonstrated, through immunofluorescence staining of Ascl1 in mouse head tissue sections, that DT treatment significantly reduced the number of Ascl1-positive cells in the nasal mucosa; further, RT-PCR detection of nasal mucosa tissue revealed… Ascl1 and Calca The gene expression level decreased significantly, confirming that the NEC in the nasal mucosa was effectively ablated.

[0021] 4. Validation of the Papain-induced chronic sinusitis model This invention establishes an eosinophilic chronic sinusitis model by intranasal instillation of Papain, based on NEC ablation. Results showed that, compared to the control group, the NEC ablation group exhibited significantly reduced eosinophil infiltration in the nasal mucosa, decreased goblet cell metaplasia, and decreased expression of type 2 inflammatory factors Il5 and Il13, suggesting that NEC participates in the regulation of type 2 inflammation in chronic sinusitis.

[0022] 5. Application Potential and Technological Significance In summary, this invention constructs a localized specific ablation system for NEC in the nasal mucosa of adult mice, enabling localized induced specific ablation of NEC in the nasal mucosa during adulthood. This model possesses advantages such as high tissue specificity, minimal systemic side effects, ease of operation, and high controllability. It can be widely applied to mechanistic studies of chronic sinusitis, type 2 airway inflammation, and related immune diseases, while also providing a new experimental platform and theoretical basis for the development of related targeted intervention strategies.

[0023] The beneficial effects of this invention are: (1) This invention establishes a local specific ablation model of NEC in the nasal mucosa of adult mice, providing a new technical tool for the study of NEC function in the nasal mucosa; (2) The present invention uses local DT instillation in the nasal cavity to achieve intranasal regulation and reduce the potential risk of non-target tissues. (3) This invention can perform induced ablation in adulthood, avoiding the systemic effects of NEC deficiency during development; (4) The construction method of the present invention is simple to operate, has good reproducibility and strong tissue specificity, and can be stably used for research on chronic sinusitis and type 2 inflammation, and NEC function. (5) This invention reveals that NEC participates in the inflammatory regulation of type 2 chronic sinusitis, providing a new theoretical basis and experimental foundation for the study of related disease mechanisms and the development of potential treatment strategies; (6) The technical solution provided by the present invention can be widely applied to basic scientific research, disease model construction and related drug screening and evaluation. Attached Figure Description

[0024] Figure 1 Ascl1 fluorescent reporter mice ( Ascl1-Cre-tdTomato A schematic diagram confirming the presence of NEC in the nasal mucosa of mice; The left image shows a schematic diagram of the presence of NEC in the nasal mucosa of mice confirmed by Ascl1 fluorescent reporter mice; the right image shows a magnified schematic diagram of a localized tdTomato-positive NEC in the respiratory nasal mucosa. In the diagram, E-cadherin: E-cadherin; Ascl1: Basic helical-loop-helical transcription factor 1 of the non-setot scaly ... Ascl1-tdTomato: Ascl1 promoter-driven expression of tdTomato red fluorescent protein; Yellow arrow: Ascl1-positive neuroendocrine cells; White dashed line: Basement membrane under the nasal epithelium; DAPI: 4,6-Biamidine-2-phenylindole.

[0025] Figure 2 A schematic diagram illustrating the process of constructing a model of NEC-induced ablation of the nasal mucosa in adult mice and eosinophilic chronic sinusitis. In the picture, Ascl1 Cre : Basic helical-loop-helical transcription factor 1 of the non-bristled scaly carapaceae family; DTR: Diphtheria toxin receptor.

[0026] Figure 3 for Ascl1 Cre Rosa26-LSL-DTRSchematic diagram of DNA electrophoresis genotype identification results in double heterozygous mice; Where A is Ascl1 Schematic diagram of the 599bp band of wild-type mouse DNA electrophoresis band; B is Ascl1 Cre Schematic diagram of mouse DNA electrophoresis band (559bp); C is Rosa26-LSL-DTR Schematic diagram of wild-type allele (650 bp) and positive allele (340 bp) bands in mouse DNA electrophoresis.

[0027] In the figure, M represents the DNA molecular weight standard (100-1500 bp Marker), bp represents the DNA molecular base pairs, and 1-16 represent the sample numbers of different offspring mice.

[0028] Figure 4 For NEC ablation or non-ablation Ascl1 Cre Rosa26-LSL-DTR Schematic diagram and statistical graph of Ascl1 immunofluorescence staining after Papain treatment in double heterozygous mice; A indicates whether NEC ablation or non-ablation occurred. Ascl1 Cre Rosa26-LSL-DTR Schematic diagram of Ascl1 immunofluorescence staining after Papain treatment in double heterozygous mice; B represents the statistical count of Ascl1-positive cells per centimeter of nasal epithelium; In the figure, PBS is the control group, Papain is the Papain-only treatment group, and DT+Papain is the DT pre-ablation and Papain treatment group; Ascl1 (red) is used to label NEC, and DAPI (blue) is used to label cell nuclei. Yellow arrows: Ascl1-positive neuroendocrine cells; White dashed lines: Basement membrane beneath the nasal epithelium; This means P < 0.001.

[0029] Figure 5 For NEC ablation or non-ablation Ascl1 Cre Rosa26-LSL-DTR Papain treatment in double heterozygous mice Ascl1 and Calca Schematic diagram of gene expression detection; Figure A is... Ascl1 A schematic diagram illustrating the detection of mRNA expression; Figure B is... Calca A schematic diagram of mRNA expression detection; In the figure, PBS is the control group, Papain is the Papain-only treatment group, and DT+Papain is the DT pre-ablation combined with Papain treatment group. Ascl1: Basic helical-loop-helical transcription factor 1 of the non-trickled scaly carapace family; Calca: Calcitonin gene-related peptide; This indicates that P < 0.05; This indicates that P < 0.01; This means P < 0.001.

[0030] Figure 6 For NEC ablation or non-ablation Ascl1 Cre Rosa26-LSL-DTR Schematic diagram of HE staining of head sections from double heterozygous mice after Papain treatment; In this image, A shows the original HE-stained mouse head section (top) and a magnified view (bottom). B is the corresponding high-power field bar chart of eosinophil count; In the figure, PBS is the control group, and Papain is the Papain-only treatment group. DT+Papain is the DT pre-ablation and Papain treatment group; Red arrow: Eosinophils; This means P < 0.001.

[0031] Figure 7 For NEC ablation or non-ablation Ascl1 Cre Rosa26-LSL-DTR Schematic diagram of PAS staining on head sections of double heterozygous mice after Papain treatment; In this image, A shows the original PAS-stained image of a mouse head section (top) and a magnified view (bottom). B is a bar chart showing the number of goblet cells in a high-power field; In the figure, PBS is the control group, Papain is the Papain-only treatment group, and DT+Papain is the DT pre-ablation combined with Papain treatment group. Red arrow: PAS-positive goblet cells; This means P < 0.001.

[0032] Figure 8 For NEC ablation or non-ablation Ascl1 CreRosa26-LSL-DTR A schematic diagram of RT-PCR detection of type 2 inflammatory factor expression levels in nasal mucosa tissue of double heterozygous mice after Papain treatment; Where A is Il5 A schematic diagram of gene expression levels; B is Il13 A schematic diagram of gene expression levels.

[0033] In the figure, PBS is the control group, and Papain is the Papain-only treatment group. DT+Papain is the DT pre-ablation and Papain treatment group; This indicates that P < 0.05; This indicates that P < 0.01.

[0034] Figure 9 A schematic diagram of the plasmid map of the Ascl1-Cre-tdTomato homologous recombination donor vector; In the figure, 5'arm is the 5' homologous arm (approximately 2.6 kb), 3'arm is the 3' homologous arm (approximately 3.2 kb), 2A-Cre-2A-tdTomato-Wpre-pA is the exogenous knock-in expression cassette (containing the Cre recombinase coding sequence, the tdTomato fluorescent reporter gene, the Wpre enhancement element, and the polyA termination signal), Amp is the ampicillin resistance selection gene, Rep is the plasmid replication initiation site, and EcoRI is the restriction enzyme site. Detailed Implementation

[0035] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0036] Unless otherwise stated, all reagents used in the following examples are commercially available analytical grade reagents; the mice used were purchased from the company: 1. Ascl1-Cre-tdTomato Mice (hereinafter referred to as mice) Ascl1 Cre Full strain name: C57BL / 6J-Ascl1 em1（2A -Cre-2A-tdTomato-Wpre-pA）Smoc The mice were purchased from Shanghai Southern Model Biotechnology Co., Ltd., a company with legal breeding qualifications; the purpose was to obtain mice capable of fluorescent reporter tracing in Ascl1-positive cells and for subsequent use with... Rosa26-LSL-DTR Mice were bred to achieve specific knockout of Ascl1 lineage cells. Ascl1-Cre-tdTomato The mice were constructed using CRISPR / Cas9 gene knock-in technology, and the specific construction method is as follows: a. Using C57BL / 6J mice as the genetic background, a knock-in strategy was designed targeting the Ascl1 gene (Ensembl ID: ENSMUSG00000020052) and the Ascl1-201 transcript (Ensembl ID: ENSMUST00000020243.9). A CRISPR / Cas9-mediated homologous recombination method was used to knock in the exogenous expression cassette 2A-Cre-2A-tdTomato-Wpre-pA at the stop codon site in the Ascl1 gene coding region (located within exon 1). The genomic sequence of the target region is as follows: TACTCCAACGACTTGAACTCTATGGCGGGTTCTCCGGTCTCGTCCTACTCCTCCGACGAGGGATCCTACGACCCTCTTAGCCCAGAGGAACAAGAGCTGCTGGACTTTACCAACTGGTTCTGA GGACCTGCCAGGCTCTCCTGGGAATGGACTTTGGAAGCAGGTACGCTTCATGTGGGGATGGGCAGAGCCTTTCTTGACTAGGTCCTTTTTCTTTTTCGGTGTGGAGGGGGGAGTTCACG (SEQ ID NO:16).

[0037] b. Using crispor.tefor.net, two complementary strand guide RNAs (sgRNAs) targeting specific sites were designed. The target sequence (20 nt) of the sgRNA is complementary to the genomic DNA, and its 3' end is adjacent to the PAM motif (NGG) required for Cas9 protein recognition. Target sequence 1 and target sequence 2 (5'→3') are ACTGGTTCTGAGGACCTGCC (SEQ ID NO:17, PAM: AGG) and GGCAGGTCCTCAGAACCAGT (SEQ ID NO:18, PAM: TGG), respectively.

[0038] c. A homologous recombination vector was constructed using the in-fusion cloning method. This vector (donor vector) sequentially contains a 5' homologous arm (approximately 2.6 kb), a 2A-Cre-2A-tdTomato-Wpre-pA, and a 3' homologous arm (approximately 3.2 kb) (e.g., ...). Figure 9 (As shown).

[0039] d. Cas9 mRNA, sgRNA and donor vector were microinjected into C57BL / 6J mouse zygotes and transplanted into pseudopregnant female mice to obtain F0 generation mice.

[0040] e. Genotyping of F0 generation mice was performed using long-fragment PCR. Positive F0 generation chimeric mice were mated with wild-type C57BL / 6J mice to obtain F1 generation heterozygous mice. The correct knock-in of the exogenous sequence at the Ascl1 gene locus was verified by PCR and sequencing. Further breeding yielded stably inherited mice. Ascl1-Cre-tdTomato Knock-in to a mouse model, that is... Ascl1-Cre-tdTomato Mice.

[0041] 2. Rosa26-LSL-DTR Mice (full strain name: C57BL / 6-Gt(ROSA)26Sor) tm1(HBEGF)Awai / J) refers to commercially available laboratory mice (The Jackson Laboratory, https: / / www.jax.org / ). In this embodiment... Ascl1-Cre-tdTomato Mice are also used as tracer report mice.

[0042] Animal experiments were reviewed and approved by the laboratory animal welfare and ethics committee of the institution, and were conducted and handled in an SPF-grade animal facility in accordance with regulations.

[0043] Example 1: Immunofluorescence staining of Ascl1 fluorescent reporter mice To determine whether NEC is present in the nasal mucosa of mice, this example uses fluorescent reporter mice. Ascl1-Cre- tdTomato Perform immunofluorescence staining.

[0044] Ascl1-Cre-tdTomato Mice (6-8 weeks old) were euthanized under deep anesthesia. Their heads were separated, and the skin and soft tissues of the head were removed. A coronal incision was made 1 mm behind both eyes to separate the nasal cavity and sinuses. The nasal cavity and sinuses were decalcified, fixed, and embedded in paraffin. Serial sections with a thickness of 4 μm were prepared in the coronal plane. Immunofluorescence staining was then used to identify the expression of tdTomato (Ascl1), with E-cadherin used to label the nasal mucosal epithelial structure and DAPI used for nuclear staining.

[0045] The results showed that scattered tdTomato-positive cells were observed in the nasal mucosal epithelium of the mouse respiratory region, and these cells were located above the nasal epithelial basement membrane. Further magnification revealed that the tdTomato-positive cells exhibited typical intraepithelial distribution characteristics, suggesting the presence of Ascl1-positive NECs in the mouse nasal mucosa. Figure 1 ).

[0046] Example 2 Ascl1 Cre Rosa26-LSL-DTR Construction and Genotyping of Double Heterozygous Mice To establish a mouse model of NEC-induced ablation of the nasal mucosa, the following methods were used: Ascl1-Cre-tdTomato mice andRosa26-LSL-DTR Mice were crossbred to obtain Ascl1 Cre Rosa26-LSL-DTR Double heterozygous mice.

[0047] Mouse DNA was extracted from 2-week-old mice after ear clipping using the Novizan DNA Extraction Kit (PD101). DNA amplification was performed using PCR, and the PCR products were subjected to DNA electrophoresis. The PCR program for DNA amplification was as follows: pre-denaturation at 94℃ for 5 minutes, followed by 35 cycles (94℃ for 30 seconds, 60℃ for 30 seconds, 72℃ for 1 minute), a final extension at 72℃ for 7 minutes, and isothermal treatment at 12℃. The primer sequences used are as follows: (1) Ascl1 Wild-type primer pairs (detection) Ascl1 Wild-type allele): mouse wt Ascl1 -F: 5'-AGAAGATGAGCAAGGTGGAGACG-3' (SEQ ID NO. 1); mouse wt Ascl1 -R: 5'-GGCTTGGAGAATCTGTCAGGTAAA-3' (SEQ ID NO. 2).

[0048] (2) Ascl1 Cre Mutant primer pairs (detection) Ascl1 Cre Alleles): mouse mut Ascl1 -F: 5'-GGTTCTCCGGTCTCGTCCTACT-3' (SEQ ID NO.3); mouse mut Ascl1 -R: 5'-CCACATTCTCCTTTCTGATTCTCC-3' (SEQ ID NO. 4).

[0049] (3) Rosa26-LSL-DTR Mixed primer set (simultaneous detection of wild-type and targeted alleles): Downstream primer Common DTR -R as DTR The downstream primers used at the site are shared. Mut DTR -F: 5'-GGAGCGGGAGAAATGGATATG-3' (SEQ ID NO.5); Common DTR-R: 5'-AAAGTCGCTCTGAGTTGTTAT-3' (SEQ ID NO.6); Wt DTR -F: 5'-GCGAAGAGTTTGTCCTCAACC-3' (SEQ ID NO. 7).

[0050] The results are as follows Figure 3 As shown, Ascl1 Wild-type mice, Ascl1 Cre positive mice and Rosa In all positive mice, a specific band was detected, indicating successful acquisition. ​ Cre ​ Double heterozygous mice.

[0051] Example 3: Establishment of a local NEC-induced ablation model of nasal mucosa and an eosinophilic chronic sinusitis model in adult mice. Reference ​ The experimental procedure shown was used to select infants aged 8-10 weeks. ​ Cre ​ The heterozygous mice were divided into three groups (n=5-6 per group): PBS control group: An equal volume of sterile phosphate-buffered saline was administered via nasal instillation throughout the entire process, without the application of DT or Papain stimulation; Papain treatment group: 20 μL of 2 mg / mL Papain solution was infused at a specified time, and PBS was administered simultaneously as an alternative to DT. DT+Papain group: DT solution was administered into the nasal cavity on days 0, 3, 8, and 11 to specifically ablate NEC in the nasal mucosa, and Papain nasal drops were added at specified times to construct an eosinophilic chronic sinusitis model.

[0052] Diphtheria toxin (DT) preparation and administration: Diphtheria toxin (List Labs, catalog number #150, or equivalent) was dissolved in sterile PBS to a working concentration of 2.5 ng / μL. 20 μL of DT solution (50 ng DT per mouse per administration) was instilled into each nostril of mice in the DT+Papain group using a micropipette on days 0, 3, 8, and 11, for a total of four administrations. The PBS control group and the Papain-only treatment group received the same volume of PBS instilled into their nostrils during the same period.

[0053] Papain model construction: The method described in the reference (Wang WQ et al., Single-cell profiling identifies mechanisms of inflammatory heterogeneity in chronic rhinosinusitis, Nat Immunol, 2022, 23(10): 1484-1494) was slightly modified. Day 0 was the day of the first administration of DT. For the Papain-only group and the DT+Papain group, 20 μL of a 2 mg / mL Papain solution (Sigma-Aldrich, catalog number P5306 or equivalent, dissolved in PBS) was instilled into each nostril of mice on days 3, 4, and 5 for three consecutive days, and on days 10, 11, 12, 13, and 14 for five consecutive days. The PBS control group received an equal volume of PBS concurrently. Mice were sacrificed on day 15 for tissue analysis.

[0054] Example 4: Downregulation of type 2 inflammation after NEC ablation of mouse nasal mucosa Materials Collection: In Example 3, mice in each group were sacrificed on day 15 after deep anesthesia. The heads were separated, and the scalp skin and soft tissue were removed. For some mouse head samples, a coronal incision was made approximately 1 mm posterior to the eyes to separate the nasal cavity and sinuses. The samples were fixed with 4% paraformaldehyde, decalcified with 10% EDTA, embedded in paraffin, and sectioned into continuous 4 μm thick coronal sections for immunofluorescence, HE, and PAS staining. For other mice, nasal and sinus mucosal tissue was separated under a dissecting microscope, flash-frozen in RNA protection solution or liquid nitrogen, and then stored at -80°C for RT-PCR analysis.

[0055] (1) Ascl1 immunofluorescence staining: After dewaxing, antigen retrieval and blocking, the sections were incubated overnight at 4°C with the primary antibody Ascl1 (such as R&Dsystems, catalog number AF-2567 or equivalent antibody), and incubated at room temperature for 1 hour with the corresponding fluorescent secondary antibody. The cell nuclei were counterstained with DAPI, and the number of Ascl1 positive cells per centimeter of nasal epithelium was observed and counted under a fluorescence microscope.

[0056] The results are as follows ​ As shown, compared with the PBS control group, the number of Ascl1-positive cells in the nasal mucosa was significantly increased in the Papain-only treatment group; while the number of Ascl1-positive cells in the DT+Papain group was significantly lower than that in the Papain-only treatment group (P<0.001), indicating that local DT nasal drops can effectively ablate NEC in the nasal mucosa.

[0057] (2) ​ and ​Gene mRNA expression detection: Total RNA was extracted from nasal and sinus mucosal tissue using the TRIzol method, and cDNA was synthesized by reverse transcription. Real-time quantitative PCR (RT-PCR) was then performed. The primers used are as follows: house mouse ​ -F: 5'-GCAACCGGGTCAAGTTGGT-3' (SEQ ID NO: 8); house mouse ​ -R: 5'-CAAGTCGTTGGAGTAGTTGGG-3' (SEQ ID NO: 9); house mouse ​ -F: 5'-CAGTGCCTTTGAGGTCAATCT-3' (SEQ ID NO: 10); house mouse ​ -R: 5'-CCAGCAGGCGAACTTCTTCTT-3' (SEQ ID NO: 11).

[0058] The relative expression level was calculated using the 2^(-ΔΔCt) method with β-actin as an internal reference.

[0059] The results are as follows ​ As shown: Compared with the PBS control group, the Papain-only treatment group ​ and ​ The mRNA expression levels were significantly increased (P<0.05 and P<0.01, respectively); the expression of the above two genes in the DT+Papain group was significantly decreased compared with that in the Papain-only group (P<0.01 and P<0.001, respectively), which was consistent with the immunofluorescence staining results, further confirming that the NEC in the nasal mucosa was effectively ablated.

[0060] (3) HE staining and eosinophil count: After dewaxing and routine staining with hematoxylin and eosin, the inflammatory cell infiltration of the nasal mucosa was observed under an optical microscope, and the number of eosinophils was counted in units of 400x high power field. Three fields of view were randomly selected from each slide and the average value was taken.

[0061] The results are as follows ​ As shown: Compared with the PBS control group, the Papain-only treatment group showed obvious eosinophil infiltration in the nasal mucosa (P<0.001); while the DT+Papain group showed a significant reduction in eosinophil infiltration (P<0.001), suggesting that NEC ablation can reduce Papain-induced eosinophilic inflammation of the nasal mucosa.

[0062] (4) PAS staining and goblet cell counting: After routine PAS staining, the number of PAS-positive goblet cells in each high-power field was observed and counted under an optical microscope. Three fields of view were randomly selected from each slide and the average value was taken.

[0063] The results are as follows ​ As shown: Compared with the PBS control group, obvious goblet cell metaplasia was observed in the nasal mucosal epithelium of the Papain-treated group (P<0.001); the degree of goblet cell metaplasia was significantly reduced in the DT+Papain group (P<0.001), suggesting that NEC ablation can significantly inhibit Papain-induced goblet cell metaplasia.

[0064] (5) Type 2 inflammatory factors Il5 and Il13 mRNA expression detection: The same RT-PCR method as (2) was used, and the primers used were as follows: house mouse Il-5 -F: 5'-TCAGGGGCTAGACATACTGAAG-3' (SEQ ID NO: 12); house mouse Il-5 -R: 5'-CCAAGGAACTCTTGCAGGTAAT-3' (SEQ ID NO: 13); house mouse Il-13 -F: 5'-TGAGCAACATCACACAAGACC-3' (SEQ ID NO: 14); house mouse Il-13 -R: 5'-GGCCTTGCGGTTACAGAGG-3' (SEQ ID NO: 15).

[0065] The results are as follows ​ As shown: Compared with the PBS control group, the nasal mucosa in the Papain-only treatment group... Il5 and Il13 mRNA expression levels were significantly increased (P<0.01 and P<0.05, respectively); the expression of the above-mentioned type 2 inflammatory factors in the DT+Papain group was significantly decreased compared with that in the Papain-only group (both P<0.01), suggesting that NEC ablation can effectively reduce Papain-induced type 2 inflammatory response in the nasal mucosa.

[0066] Statistical analysis: All data are expressed as mean ± standard error (mean ± SEM). One-way ANOVA was used for comparisons between groups, and Tukey's test was used for subsequent multiple comparisons. P < 0.05 was considered statistically significant.

[0067] Based on the results of the above embodiments, the local specific ablation model of NEC in the nasal mucosa constructed in this invention can effectively induce specific ablation of Ascl1-positive NEC in the nasal mucosa region, and significantly reduce type 2 inflammatory response in the context of Papain-induced eosinophilic chronic sinusitis, suggesting that NEC participates in the regulation of upper airway type 2 inflammation. The model constructed in this invention can serve as an experimental platform for studying the mechanism of action of NEC in chronic sinusitis, type 2 airway inflammation, and related immune diseases, and provide new tools for the development of targeted intervention strategies and drug screening.

[0068] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for constructing a localized specific ablation model of nasal mucosal neuroendocrine cells, characterized in that, Includes the following steps: (1) Fluorescent reporter mice Ascl1-Cre-tdTomato and Rosa26-LSL-DTR Mice were crossbred to obtain Ascl1 Cre Rosa26-LSL-DTR Double heterozygous progeny mice; wherein, the Ascl1 Cre Rosa26-LSL-DTR Cre recombinase in double heterozygous progeny mice mediates in Ascl1-positive cells Rosa26-LSL-DTR Removal of the LSL blocking sequence at the site leads to the expression of diphtheria toxin receptor DTR on the surface of Ascl1-positive cells; (2) For adults Ascl1 Cre Rosa26-LSL-DTR Diphtheria toxin was administered to double heterozygous mice via nasal drops to induce specific ablation of Ascl1-positive neuroendocrine cells in the nasal mucosa, thus establishing a local specific ablation model of nasal mucosal neuroendocrine cells.

2. The construction method according to claim 1, characterized in that: In step (1), Ascl1 Cre Rosa26-LSL- DTR The genotypes of double heterozygous mice were identified by PCR amplification and agarose gel electrophoresis.

3. The construction method according to claim 2, characterized in that: The primer pairs used in the PCR amplification include those for detection. Ascl1 Primer pairs for wild-type alleles, used for detection Ascl1 Cre Primer pairs for alleles and those used for detection Rosa26-LSL-DTR Primer combinations for alleles; among which, (1) Ascl1 Wild-type primer pairs: mouse wt Ascl1 -F: 5'-AGAAGATGAGCAAGGTGGAGACG-3', as shown in SEQ ID NO.1; mouse wt Ascl1 -R: 5'-GGCTTGGAGAATCTGTCAGGTAAA-3', as shown in SEQ ID NO.2; (2) Ascl1 Cre Mutant primer pairs: mouse mut Ascl1 -F: 5'-GGTTCTCCGGTCTCGTCCTACT-3', as shown in SEQ ID NO.3; mouse mut Ascl1 -R: 5'-CCACATTCTCCTTTCTGATTCTCC-3', as shown in SEQ ID NO.4; (3) Rosa26-LSL-DTR Mixed primer set: Mut DTR -F: 5'-GGAGCGGGAGAAATGGATATG-3', as shown in SEQ ID NO.5; Common DTR -R: 5'-AAAGTCGCTCTGAGTTGTTAT-3', as shown in SEQ ID NO.6; Wt DTR -F: 5'-GCGAAGAGTTTGTCCTCAACC-3', as shown in SEQ ID NO.

7.

4. The construction method according to claim 1, characterized in that: In step (2), the dosage of diphtheria toxin is 30-100 ng per mouse per administration, dissolved in sterile phosphate buffer, and administered in equal amounts through each nostril. The administration frequency is 1-3 times per week, and the duration of administration is 1-3 weeks.

5. The construction method according to claim 1, characterized in that: The adult mice were 6-12 weeks old.

6. The construction method according to claim 1, characterized in that: The ablation effect of the localized ablation model of nasal mucosal neuroendocrine cells was verified using one or more of the following methods: (a) Detection of the number of Ascl1-positive cells in nasal mucosal epithelium by Ascl1 immunofluorescence staining; (b) RT-PCR detection of nasal mucosal tissue Ascl1 Gene mRNA expression level; (c) RT-PCR detection of nasal mucosa tissue Calca Gene mRNA expression level.

7. A method for constructing an eosinophilic chronic sinusitis model, characterized in that: Based on the local specific ablation model of nasal mucosal neuroendocrine cells constructed by the method described in any one of claims 1 to 6, an eosinophilic chronic sinusitis model is established by intranasal instillation of papain.

8. The construction method according to claim 7, characterized in that: The papain administration regimen was as follows: Day 0 was the day of the first administration of diphtheria toxin, and 20 μL of a 2 mg / mL papain solution was instilled into each nostril of the mice on days 3, 4, 5 and days 10, 11, 12, 13 and 14.

9. The construction method according to claim 7 or 8, characterized in that: The inflammation level of the eosinophilic chronic sinusitis model was assessed using one or more of the following methods: (a) HE staining to detect the degree of eosinophil infiltration in the nasal mucosa; (b) PAS staining to detect the degree of goblet cell metaplasia in the nasal mucosa; (c) RT-PCR detection of type 2 inflammatory factors in nasal mucosa tissue Il5 and / or Il13 mRNA expression levels.

10. The application of the local specific ablation model of nasal mucosal neuroendocrine cells constructed by the method of any one of claims 1 to 6, or the eosinophilic chronic sinusitis model constructed by the method of any one of claims 7 to 9, in drug screening and efficacy evaluation for eosinophilic chronic sinusitis.

Images