A gene editing method and application for enhancing low temperature tolerance of fish by targeting trpv1 gene

Abstract

The application belongs to the technical field of genetic engineering, and relates to a gene editing method for enhancing low-temperature tolerance of fish by targeting a trpv1 gene and application. The application precisely edits a fish trpv1 gene by using CRISPR-Cas9 technology, blocks negative signal transduction induced by low temperature, and releases the inhibition on related metabolic pathways. The application provides a brand-new molecular target for improvement of low-temperature tolerance of fish and cold-resistant breeding of aquatic products, and has important application value.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to a gene editing method and application that targets the trpv1 gene to enhance the low-temperature tolerance of fish. Background Technology

[0002] Improving the cold tolerance of fish is one of the core research directions in aquaculture breeding. Currently, the industry mainly improves the cold resistance of fish by modifying fish feed formulations and combining traditional population selection with molecular marker-assisted selection. However, the above-mentioned traditional improvement techniques have significant limitations: (1) Insufficient explanation of physiological mechanisms: Although it is known that low temperature stress involves the synergistic regulation of multiple signaling networks such as the inhibition of INS / IGF-1 and AKT signaling pathways and the upregulation of FoxO pathway, the key molecular switches and interaction mechanisms behind them are still unclear; (2) Lagging discovery of key genes: Current research focuses on genetic locus localization and transcriptome differential expression analysis, and has not yet identified key functional genes that can decisively affect the cold resistance of fish, resulting in a lack of precise targets for breeding work; (3) Limited technical means: Traditional breeding cycles are long and inefficient, and it is difficult to overcome the reproductive isolation of species to introduce superior traits. Existing transgenic strategies mostly rely on random insertion and lack precise modification of specific sites in the genome. Therefore, using cutting-edge technologies such as gene editing to accurately identify and modify key cold-resistant genes is of great scientific significance and application value for breaking through existing breeding bottlenecks and cultivating groundbreaking cold-resistant aquatic varieties. Summary of the Invention

[0003] In view of this, the present invention provides a gene editing method and application for targeting the trpv1 gene to enhance the low temperature tolerance of fish. The purpose is to solve or at least partially solve the problems in the prior art, and to provide a new molecular target for improving the low temperature tolerance of fish and for cold-resistant aquaculture breeding. It has important application value.

[0004] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0005] In a first aspect, the present invention provides a gRNA that targets the trpv1 gene.

[0006] Preferably, the gRNA targets an exon near the 5' end of the trpv1 gene.

[0007] Preferably, the nucleotide sequence of the gRNA is shown in SEQ ID NO.1.

[0008] In a second aspect, the present invention also provides a composition comprising the gRNA and Cas9 mRNA targeting the trpv1 gene.

[0009] Preferably, the composition is used to knock out the trpv1 gene.

[0010] Thirdly, the present invention also provides a gene editing method targeting the zebrafish trpv1 gene, comprising the following steps:

[0011] SA-1, Design the trpv1 gene target, and the gRNA sequence targeting the trpv1 gene is shown in SEQ ID NO.1;

[0012] SA-2. Based on the target of the trpv1 gene, specific primers for gRNA were designed, and PCR amplification was performed to obtain gRNA in the CRISPR / Cas9 system.

[0013] SA-3. Linearize the Cas9 plasmid, and use the linearized Cas9 plasmid as a template to prepare Cas9 mRNA by in vitro transcription with T7 polymerase.

[0014] SA-4: A combination of gRNA and Cas9 mRNA was microinjected into wild-type zebrafish zygotes in vitro, and homozygous offspring with trpv1 gene knockout were screened by genotyping.

[0015] Preferably, in step SA-2, the template for PCR amplification is plasmid pMD19-T-gRNA scaffold, and the specific primer sequences of the gRNA are shown in SEQ ID NO.2-3, respectively.

[0016] Preferably, in step SA-4, the volume ratio of gRNA to Cas9 mRNA in the composition is 1:1.

[0017] Preferably, in step SA-4, the screening of homozygous offspring for trpv1 gene knockout through genotyping includes the following steps:

[0018] SB-1: F0 generation zebrafish individuals were mated with wild-type zebrafish individuals to obtain F1 generation. Genotypic analysis of the F1 generation was performed on individuals with the trpv1 genotype. + / - Genotyped zebrafish were used to obtain F1 generation heterozygous zebrafish;

[0019] SB-2. Mating the male and female F1 generation heterozygous zebrafish selected in step SB-1 to obtain the F2 generation. The F2 generation has the genotype trpv1. - / - The zebrafish genotype is a homozygous offspring of the trpv1 gene knockout.

[0020] Fourthly, the present invention also provides the application of gene knockout zebrafish constructed by the above method in studying the biological function of the trpv1 gene.

[0021] Fifthly, the present invention also provides a method for enhancing the low-temperature tolerance of fish and / or constructing low-temperature resistant fish, characterized by comprising the following steps:

[0022] SC-1: Knock out the trpv1 gene in wild-type fish using the aforementioned gene editing method;

[0023] SC-2. Individual fish with trpv1 gene knockout were screened for cold-resistant fish through genotyping.

[0024] Preferably, in step SC-2, the trpv1 gene knockout fish include those with genotype detection as trpv1. + / - The individual fish with the genotype and genotype test result were trpv1. - / - Individual fish of a specific genotype.

[0025] More preferably, the fish is a zebrafish.

[0026] Preferably, the fish is a zebrafish.

[0027] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0028] (1) Short breeding cycle and high efficiency: In response to the problems of long breeding cycle and difficulty in trait aggregation in traditional populations, this invention directly blocks the downward inhibitory transmission of low temperature signal by precisely knocking out or modifying the trpv1 gene, and obtains stable heritable cold-resistant fish in one generation, which greatly shortens the breeding cycle.

[0029] (2) Clear target and controllable mechanism: It overcomes the shortcomings of existing studies that only focus on site association analysis and lack key functional gene verification. This invention is based on the core regulatory role of trpv1 gene in low temperature signal transduction and makes targeted improvements, avoiding the genomic instability and biosafety risks caused by random transgenesis.

[0030] (3) Low cost and wide application: No need to introduce foreign species genes, only need to fine-tune the endogenous genes. The structure is simple and easy to pass food safety assessment. At the same time, this strategy does not rely on expensive feed additives, significantly reducing breeding costs and facilitating the large-scale promotion of cold-resistant new varieties. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0032] Figure 1Sequencing peak diagram of the target site sequence in F1 generation trpv1 gene mutant heterozygote zebrafish;

[0033] Figure 2 Figure showing the sequence alignment of target sites between wild-type zebrafish and F2 homozygous zebrafish.

[0034] Figure 3 Figure A shows the results of the low-temperature tolerance experiment; Figure B shows the statistical analysis of zebrafish survival rate and the survival rate of zebrafish at 6℃. Detailed Implementation

[0035] The technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0036] It should be noted that the order of description of the following embodiments is not intended to limit the preferred order of embodiments. Furthermore, in the description of this invention, the term "comprising" means "including but not limited to". Various embodiments of the invention may exist in the form of a range; it should be understood that the description in the form of a range is merely for convenience and brevity and should not be construed as a rigid limitation on the scope of the invention; therefore, it should be considered that the range description has specifically disclosed all possible sub-ranges and single numerical values ​​within that range. For example, it should be considered that the range description from 1 to 6 has specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and single digits within the range, such as 1, 2, 3, 4, 5, and 6, regardless of the range. Additionally, whenever a numerical range is indicated herein, it means including any referenced number (fraction or integer) within the indicated range.

[0037] The following specific embodiments further illustrate a gene editing method and application of the present invention that targets the trpv1 gene to enhance the low-temperature tolerance of fish. This section further illustrates the content of the present invention with reference to specific embodiments, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, such as the conditions described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory or the conditions recommended by the manufacturer. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the art.

[0038] Transient receptor potential vanillic acid isoform 1 (TRPV1) belongs to the TRP channel family and was initially known as a key molecule for capsaicin receptor and thermosensing. In mammals, TRPV1 primarily mediates thermal pain sensation and thermoregulation. Related studies have shown that the trpv1 gene sequence in fish exhibits specific variations, enabling it not only to sense heat but also to participate in the regulation of intracellular calcium ion signaling pathways, thereby affecting downstream metabolic networks. Therefore, this invention utilizes CRISPR-Cas9 technology to precisely edit the fish trpv1 gene, providing a novel molecular target for improving fish cold tolerance and for cold-resistant aquaculture breeding.

[0039] In the following embodiments, the wild-type zebrafish parents were raised in the standardized zebrafish breeding system of the Institute of Hydrobiology, Chinese Academy of Sciences; the embryos used for zebrafish microinjection were obtained by artificial breeding and spawning of sexually mature parents.

[0040] Example 1: Building a CRISPR / Cas9 System

[0041] 1. Design trpv1 gene targets

[0042] To more effectively disrupt the function of the trpv1 protein, a target site for the CRISPR / Cas9 system was designed in the exon near the 5' end of the zebrafish trpv1 gene. The target site is shown below:

[0043] trpv1 gene gRNA: GACGACTTCCACTACTGAGAAACCAGGAAATGTGAAAAGGGTTTATTGCTCTCAATGATTGTGACTCATCACTGTTGATACTTAAGCTTACCTTTTGTCCACAGGTGAGCTGCCCTTGTCACTGGCTGCTTGCACTAATCAGCAAGACATTGTGGACTTTCTTATGGAAAACCCTCACCA GGCGGTGGATGTCAGGGAGAGGGACTGTCATGGAAACACCGTGCTTCACGCTTTAGTATCCGTAGCTGATAATAGCCCTGAAAACACAGAGTTCGTCATCGCCATGTATGACCACATCCTAATCAAAGCTGACCAACTTCACCCCAAGACCAAGTTGGAGGAAATTGAAAATAATGAGGGACTGACCCCAATCACACTCGCTGCCAA AAAGGGAAAACTAGGGGTAACTATTTTTTCTGATGTTTTCTGAATTTTAAATGTTTTAGAATATGAAAGCTATGGTTTGCAAATCAGTTTTTGAAGAAGTGACTCATTTGAAGTAGTCTGCATGCTTTACGTTCTGTATTTTGTTTTTGGATGTTCCCTTTTTTGTAGAGATGAGTAGTCC(SEQ ID NO.1);

[0044] The underlined parts are the target sites of CRISPR / Cas9.

[0045] 2. Preparation of trpv1 gene gRNA

[0046] The plasmid pMD19-T-gRNA scaffold (National Zebrafish Resource Center, CZRC ID: CZP3) was adjusted to a concentration of 15 ng / μL as a template. PCR amplification was performed using the upstream primer trpv1-gRNA-F (as shown in SEQ ID NO.2) and the downstream primer trpv1-gRNA-R (as shown in SEQ ID NO.3). The PCR reaction system consisted of: 5 μL of 2X Taq Master Mix (Nanjing Novizan Biotechnology Co., Ltd., catalog number: P111-03), 0.5 μL each of the upstream and downstream primers, 1 μL of template DNA, and 3 μL of ddH2O. The PCR reaction conditions were: 95 ℃ for 5 min, 95 ℃ for 30 s, 60 ℃ for 30 s, 72 ℃ for 30 s (30 cycles), and 72 ℃ for 8 min. min; After PCR amplification products were subjected to 1.5% agarose gel electrophoresis, the bands with the correct fragment size were excised and purified using a gel extraction kit (Guangzhou Feiyang Biotechnology Co., Ltd., catalog number: D2500) to obtain trpv1 gene gRNA.

[0047] The sequences of the upstream primer trpv1-gRNA-F and the downstream primer trpv1-gRNA-R are shown below:

[0048] trpv1-gRNA-F:5'-GACGACTTCCACTACTGAGA-3' (SEQ ID NO.2);

[0049] trpv1-gRNA-R: 5'-GGACTACTCATCTCTACAAA-3' (SEQ ID NO. 3).

[0050] 3. Preparation of Cas9 mRNA

[0051] The Cas9 plasmid (National Zebrafish Resource Center, CZRC ID: CZP11) was linearized and digested with the restriction endonuclease XbaI (New England Biolabs, Inc., catalog number: R0145) for 2 h. The digestion system consisted of 1 μL of XbaI enzyme, 10× CutSmart Buffer (New England Biolabs, Inc., catalog number: B7204), 1 μg of Cas9 plasmid, and ddH2O to a final volume of 50 μL. The digestion product was recovered and purified according to the method described in Section 2 of this embodiment to obtain the linearized Cas9 plasmid. Using the linearized Cas9 plasmid as a template, in vitro transcription was performed using the TranscriptAid T7 high-yield transcription kit (ThermoFisher Scientific Inc., catalog number: K0441) and incubated at 37 °C for 6–8 h. The RNA was purified by LiCl / ethanol precipitation, dissolved in RNase-free water, aliquoted, and stored at -80 °C for later use to obtain Cas9 mRNA. The specific steps of the LiCl / ethanol precipitation method are as follows: 2.5 μL of 4 mol / L LiCl solution is mixed with 100 μL of anhydrous ethanol to obtain LiCl precipitate; 30 μL of RNase-free water and 30 μL of LiCl precipitate are added to the RNA sample to be precipitated and mixed well, then pre-cooled at -20 ℃ for 2 h; centrifuged at 4 ℃ and 15000 g for 15 min, the lower precipitate is taken, and washed twice with 100 μL of 70% ethanol solution (prepared with RNase-free water), and centrifuged at 4 ℃ and 13000 g for 5 min; 30 μL of RNase-free water is added, mixed well, and the concentration is measured.

[0052] Example 2: Construction of trpv1 gene knockout zebrafish

[0053] 1. Microinjection

[0054] The Cas9 mRNA and trpv1 gene gRNA prepared in Example 1 were mixed at a volume ratio of 1:1 to obtain an injection mixture. At the same time, eggs and sperm from sexually mature zebrafish parents were collected and microinjected immediately after in vitro artificial insemination using a PV820 injection system (Shanghai World Precision Instrument Trading Co., Ltd.). Each fertilized egg was injected with 1 nL of the injection mixture. The injected embryos were incubated and cultured at 28 °C. After 12 h of culture, dead eggs were removed and the water was changed to ensure a clean culture environment.

[0055] 2. Screening for heterozygous mutant individuals in the F1 generation of zebrafish with trpv1 gene knockout.

[0056] After the surviving F0 generation adult fish from Section 1 of this embodiment reached sexual maturity, they were hybridized with wild-type zebrafish to obtain F1 generation zebrafish individuals. Genomic DNA was extracted from the surviving F1 generation zebrafish individuals using a gDNA extraction kit (Thermo Fisher Scientific Inc., catalog number: K182002), amplified by PCR (the PCR reaction was performed according to the method described in Section 2 of Example 1), and then sent for sequencing identification. Figure 1 As shown, individuals exhibiting a distinct double peak at the target site in the sequencing peak diagram were identified as F1 generation trpv1 gene mutant heterozygous zebrafish (trpv1). + / - ), for use in subsequent experiments.

[0057] 3. Screening for homozygous mutant individuals in the F2 generation of zebrafish trpv1 gene knockout.

[0058] After the F1 generation heterozygous zebrafish identified in Section 2 of this embodiment reach sexual maturity, the F1 individuals are self-crossed to obtain the F2 generation. Genomic DNA is extracted from surviving zebrafish individuals in the F2 generation (using the same method described in Section 2 of this embodiment), amplified by PCR (using the same method described in Section 2 of Example 1), and then sent for sequencing identification. Individuals whose sequencing peaks show a single and clear mutation sequence at the target site are identified as F2 generation homozygous zebrafish with trpv1 gene mutation (trpv1). - / - ).

[0059] Figure 2 The image shows the sequence alignment of target sites in wild-type zebrafish and F2 homozygous zebrafish; "CZ268" in the image represents the target site gene sequence in F2 homozygous zebrafish. The results show that, compared to wild-type zebrafish, the F2 generation trpv1... - / - The presence of a 4 bp deletion mutation in the target gene sequence of zebrafish CZ268 indicates that the trpv1 gene knockout zebrafish was successfully constructed.

[0060] Example 3: Tolerance of trpv1 gene knockout zebrafish to low temperature environment

[0061] Wild-type zebrafish (WT, N=3) were mixed with trpv1 - / - Three zebrafish (N=3) were placed in conical flasks with identical conditions. A thermometer was placed in each group to monitor the water temperature in real time. The room temperature was gradually lowered in a low-temperature incubator. The growth of zebrafish in different groups was observed, and the survival rate of each group was counted.

[0062] Figure 3 The results of the low-temperature tolerance experiment are shown in the figure; Figure A is a statistical analysis of the zebrafish survival rate; Figure B is the survival rate of zebrafish at 6 ℃. The results show that zebrafish in the WT group began to die at 15 ℃, while those in the trpv1 group... - / - The zebrafish can remain completely alive at 5°C. Figure 3 (Figure A in the diagram); at 6 ℃, trpv1 - / - The zebrafish in the group A were significantly more active than those in the WT group. Figure 3 (See Figure B in the diagram). The results showed that knockout of the trpv1 gene significantly enhanced the tolerance of zebrafish to low-temperature environments.

[0063] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A gRNA targeting the trpv1 gene, characterized in that, It targets an exon near the 5' end of the trpv1 gene, and the nucleotide sequence of the gRNA is shown in SEQ ID NO.

1.

2. A composition, characterized in that, The composition includes gRNA and Cas9 mRNA targeting the trpv1 gene as described in claim 1; the composition is used to knock out the trpv1 gene.

3. A gene editing method targeting the zebrafish trpv1 gene, characterized in that, Includes the following steps: SA-1, Design the trpv1 gene target, and the gRNA sequence targeting the trpv1 gene is shown in SEQ ID NO.1; SA-2. Based on the target of the trpv1 gene, specific primers for gRNA were designed, and PCR amplification was performed to obtain gRNA in the CRISPR / Cas9 system. SA-3. Linearize the Cas9 plasmid, and use the linearized Cas9 plasmid as a template to prepare Cas9 mRNA by in vitro transcription with T7 polymerase. SA-4: A combination of gRNA and Cas9 mRNA was microinjected into wild-type zebrafish zygotes in vitro, and homozygous offspring with trpv1 gene knockout were screened by genotyping.

4. The method as described in claim 3, characterized in that, In step SA-2, the template for PCR amplification is plasmid pMD19-T-gRNA scaffold, and the specific primer sequences for the gRNA are shown in SEQ ID NO.2-3.

5. The method as described in claim 3, characterized in that, In step SA-4, the volume ratio of gRNA to Cas9 mRNA in the composition is 1:

1.

6. The method as described in claim 3, characterized in that, In step SA-4, the screening of homozygous offspring for trpv1 gene knockout through genotyping includes the following steps: SB-1: F0 generation zebrafish individuals were mated with wild-type zebrafish individuals to obtain F1 generation. Genotypic analysis of the F1 generation was performed on individuals with the trpv1 genotype. + / - Genotyped zebrafish were used to obtain F1 generation heterozygous zebrafish; SB-2. Mating the male and female F1 generation heterozygous zebrafish selected in step SB-1 to obtain the F2 generation. The F2 generation has the genotype trpv1. - / - The zebrafish genotype is a homozygous offspring of the trpv1 gene knockout.

7. The application of the gene knockout zebrafish constructed by any one of claims 3-6 in the study of the biological function of the trpv1 gene.

8. A method for enhancing the low-temperature tolerance of fish and / or constructing low-temperature resistant fish, characterized in that, Includes the following steps: SC-1, Knocking out the trpv1 gene in wild-type fish using the method described in any one of claims 3-6; SC-2. Individual fish with trpv1 gene knockout were screened for cold-resistant fish through genotyping.

9. The method as described in claim 8, characterized in that, In step SC-2, the trpv1 gene knockout fish include those with genotype detection as trpv1. + / - The individual fish with the genotype and genotype test result were trpv1. - / - Individual fish of a specific genotype.

10. The method as claimed in claim 8 or claim 9, characterized in that, The fish in question is a zebrafish.

Images