A modular construction method of a high-titer lanM protein production engineering strain

Abstract

The application belongs to the technical field of genetic engineering and microbial metabolic engineering, and particularly relates to a modular construction method of a high-titer LanM protein engineering strain. The construction method realizes high-level soluble expression of LanM protein in Escherichia coli through four-dimensional modular synergistic regulation of spatial positioning optimization, chaperone-assisted folding, central carbon metabolic flow redistribution and amino acid synthesis strengthening. The system not only improves the yield of the target protein, but also provides a technical reference for the heterologous expression of other metal-binding proteins with similar structural characteristics. Through the synergy of plasmid copy number control, promoter strength matching and induction timing between the modules, the dynamic balance of intracellular metabolic flow and protein synthesis flow is achieved, meeting the requirements of industrial large-scale production.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and microbial metabolic engineering technology, specifically relating to a modular construction method for high-titer LanM protein engineered strains. Background Technology

[0002] Rare earth elements, as core strategic resources of high-tech industries, have irreplaceable application value in fields such as electronics and information, aerospace, medical care, clean energy, and national defense. Their efficient and green separation and recycling are crucial for ensuring the security of my country's rare earth industry chain and the sustainable development of the ecological environment. Lanmodulin (LanM) protein, a specific lanthanide-binding protein derived from rare earth-loving microorganisms, has become a core biomaterial in the field of green rare earth ion recycling due to its high rare earth binding affinity, excellent binding selectivity, and reversible binding characteristics in response to environmental conditions. It provides a new approach to solving the problems of high energy consumption, severe pollution, and poor selectivity in traditional rare earth separation technologies. However, the natural sources of LanM protein are limited, making it difficult to meet the needs of industrial applications. Although the E. coli heterologous expression system provides a feasible path for its large-scale production, the efficient expression of recombinant LanM protein in E. coli still faces several key bottlenecks.

[0003] In actual production, heterologous proteins are prone to misfolding and forming inclusion bodies, resulting in low soluble expression levels. Simultaneously, overexpression of recombinant proteins places a significant metabolic burden on host cells, leading to insufficient supply of precursors such as amino acids and energy sources like ATP, causing cell growth arrest and decreased protein synthesis efficiency. Furthermore, the imbalance in intracellular carbon metabolism flux distribution is also a core factor limiting yield; the conversion efficiency of key intermediates such as pyruvate is low, and the accumulation of metabolic byproducts such as acetic acid and lactic acid further inhibits cell growth and protein synthesis. Due to insufficient expression of key enzymes in the amino acid biosynthesis pathway, the core amino acid raw materials required for LanM protein synthesis are scarce, further limiting protein synthesis efficiency and resulting in extremely low expression efficiency in wild-type strains, severely restricting its industrial application.

[0004] In existing technologies, heterologous expression of recombinant proteins often employs a single-gene random modification strategy. This approach struggles to systematically address multiple bottlenecks in the metabolic network and fails to synergistically improve key aspects such as protein folding, precursor supply, and energy metabolism. Furthermore, there is a lack of targeted modular regulatory schemes for optimizing LanM protein expression. Traditional engineered strain construction suffers from low regulatory precision, poor module compatibility, and limited protein yield increases. Moreover, existing technologies do not fully consider the structural characteristics of LanM protein, such as the absence of cysteine ​​residues and the absence of a periplasmic oxidative folding environment. Some optimization strategies exhibit directional biases and cannot meet the demands of large-scale production for high-titer engineered strains.

[0005] Therefore, developing a method for constructing LanM protein-engineered strains that can synergistically overcome multiple metabolic bottlenecks and precisely redistribute intracellular metabolic flux has become a core technological breakthrough for promoting its industrial application. Summary of the Invention

[0006] This invention addresses the technical shortcomings of existing technologies in heterologous expression of Lanmodulin (LanM) protein, such as low protein folding efficiency, high inclusion body ratio, uneven distribution of intracellular metabolic flux, insufficient supply of precursor amino acids, and the accumulation of metabolic byproduct acetic acid inhibiting bacterial growth. It provides a modular construction method for high-titer LanM protein production engineered strains. Through modular synergistic regulation of four dimensions—spatial localization optimization, molecular chaperone-assisted folding, central carbon metabolic flux redistribution, and enhanced amino acid synthesis—high-level soluble expression of LanM protein in Escherichia coli is achieved.

[0007] This invention provides a modular construction method for an engineered strain that produces high-titer LanM protein, comprising the following steps: Step S1: Construct the basic expression system of the LanM gene. The LanM gene is cloned into the expression vector pET28a containing the T7 promoter (pT7) to construct the recombinant expression plasmid pET28a-pT7-LanM. The recombinant expression plasmid is then transformed into competent Escherichia coli cells to obtain the basic expression strain. Step S2: By screening the spatial localization path through the fusion signal peptide sequence at the N-terminus of the LanM gene, the basic path of cytoplasmic expression as the basis for subsequent modular modification is determined; Step S3: Construct a molecular chaperone-assisted folding module, wherein the molecular chaperone system is selected from the DnaK-DnaJ-GrpE system (KJE strain) and the GroEL-GroES system (groES / EL strain). Step S4: Construct a central carbon metabolism regulatory module, which includes an overexpression element and an sRNA repression element; Step S5: Construct an amino acid biosynthesis pathway regulation module and introduce an amino acid synthesis rate-limiting enzyme gene; Step S6: Combine and integrate the genetic elements screened in steps S3, S4 and S5 to obtain the optimal engineered strain.

[0008] Furthermore, in the modular construction method of the above-mentioned high-titer LanM protein production engineered strain, the signal peptide sequences screened in step S2 include OmpA signal peptide, PhoA signal peptide, and PelB signal peptide.

[0009] Furthermore, in the modular construction method of the above-mentioned high-titer LanM protein production engineered strain, the molecular chaperone system in step S3 is the DnaK-DnaJ-GrpE system (KJE strain) and the GroEL-GroES system (groES / EL strain), and the molecular chaperone-assisted folding module is integrated into a regulatory plasmid containing the pBAD promoter.

[0010] Furthermore, in the modular construction method of the above-mentioned high-titer LanM protein production engineered strain, the overexpression element in step S4 includes the mqo gene and the eda gene, wherein the mqo gene encodes malate quinone oxidoreductase and the eda gene encodes 2-keto-3-deoxy-6-phosphoglucuronide aldolase.

[0011] Furthermore, in the modular construction method of the high-titer LanM protein production engineered strain described above, the sRNA repressive element in step S4 is an sRNA repressive element targeting the pta gene. The sRNA repressive element includes a scaffold sequence driven by the pR promoter and a binding sequence complementary to the pta mRNA.

[0012] Furthermore, in the modular construction method of the above-mentioned high-titer LanM protein production engineered strain, the rate-limiting enzyme gene in step S5 includes the aspC gene, which encodes aspartate aminotransferase.

[0013] Furthermore, in the modular construction method of the above-mentioned high-titer LanM protein production engineered strain, the optimal engineered strain integrated in step S6 is the REC2 strain. The REC2 strain contains the recombinant expression plasmid pET28a-pT7-LanM and the multi-module regulatory plasmid pSTV28-pBAD-DnaKJE-Mqo-Eda. The multi-module regulatory plasmid integrates the DnaK-DnaJ-GrpE molecular chaperone module, the mqo gene overexpression element, and the eda gene overexpression element.

[0014] Furthermore, the modular construction method for the high-titer LanM protein production engineered strain described above also includes a large-scale fermentation process based on the REC2 strain, wherein the fermentation process controls the fermentation temperature at a cell density OD range. 600 When the temperature reached 40, the temperature was reduced from 37°C to 20°C, and IPTG with a final concentration of 0.4 mM and L-arabinose with a mass-volume ratio of 0.2% were added sequentially for induction. A fed-batch process consisting of 500 g / L glucose and 100 g / L yeast extract was then started.

[0015] Advantages and beneficial effects of the present invention: First, this invention uses a modular metabolic engineering strategy to distribute the heterologous expression pressure of LanM protein to four independent but interconnected functional modules: protein folding, energy metabolism, precursor supply, and byproduct inhibition. By utilizing the synergistic regulation of multiple modules, the systemic metabolic bottleneck that is difficult to overcome by single gene modification is solved, enabling a breakthrough in the expression level of LanM protein in heterologous hosts.

[0016] Secondly, this invention addresses the structural characteristic of LanM protein, which lacks cysteine. Through experiments, it eliminates the traditional periplasmic secretion strategy and establishes a customized folding scheme that combines cytoplasmic expression with the DnaK-DnaJ-GrpE molecular chaperone. This effectively solves the problem of foreign proteins easily forming inclusion bodies in cells and significantly improves the solubility ratio of the target protein.

[0017] Third, this invention utilizes the combined overexpression of the mqo and eda genes to optimize the flux allocation of the central carbon metabolism pathway. While improving the efficiency of the TCA cycle, it also increases the supply of reducing power NADPH and energy ATP, providing sufficient power support for protein synthesis. By targeting and inhibiting the pta gene through sRNA technology, the acetic acid synthesis pathway is precisely regulated at the transcriptional level, eliminating the cell growth inhibition caused by the accumulation of organic acids during high-density fermentation.

[0018] Fourth, by strengthening the aspartic acid family amino acid synthesis pathway mediated by aspC, this invention specifically supplements the key amino acid precursors in the LanM protein synthesis process, alleviates the amino acid starvation response caused by the overexpression of foreign proteins, and ensures the continuous and efficient progress of protein translation.

[0019] Fifth, the optimal engineered strain REC2 constructed in this invention has excellent genetic stability and industrial scale-up potential. It exhibits extremely high production intensity in a 5L fermenter, with a LanM protein titer reaching 131.3 mg / L. It provides low-cost and high-efficiency material production technology support for the biological recovery of rare earth elements, and has significant economic value and environmental benefits.

[0020] In summary, this invention successfully constructed a modular technology system suitable for high-yield production of LanM protein through the systematic reconstruction of the E. coli metabolic network. This system not only improves the yield of the target protein but also provides a technical reference for the heterologous expression of other metal-binding proteins with similar structural features. Through plasmid copy number control, promoter strength matching, and synergistic induction timing, a dynamic balance between intracellular metabolic flux and protein synthesis flux is achieved among the modules, meeting the requirements of large-scale industrial production. Attached Figure Description

[0021] Figure 1This is a comparison chart of LanM protein yields in the multi-module synergistic optimization integrated strains REC1-REC10 of this invention; Figure 2 This is a schematic diagram of the recombinant expression plasmid and regulatory plasmid of the optimal engineered strain REC2 of this invention. Detailed Implementation Example

[0023] This embodiment aims to elaborate in detail on a modular construction method for an engineered strain producing high-titer LanM protein, achieving efficient heterologous expression of LanM protein through step-by-step implementation. Specifically, it includes the following steps: I. Construction of Wild-Type Basic Expression Strains (WT): A basic expression system for the LanM gene was constructed to obtain the initial expression strain. This specifically includes: Vector and host selection: Using Escherichia coli BL21(DE3) as the host strain, the LanM gene (derived from the rare earth-loving microorganism Hansschlegelia quercus and optimized for codon preference) was cloned into the expression vector pET28a containing the T7 promoter (pT7) to construct the recombinant expression plasmid pET28a-pT7-LanM. The sequence of the LanM gene is LanM (sequence ATGGCAAGTGGCGCGGATGCTTTGAAGGCGCTTAACAAAGACAATGACGATTCGCTGGAAATTGCAGAGGTAATCCACGCAGGCGCAACTACGTTCACGGCAATCAACCCGGACGGAGACACAACTTTGGAGAGCGGAGAGACGAAAGGACGCTTGACA GAAAAGGATTGGGCTAGAGCTAATAAAGACGGGGACCAGACGTTGGAAATGGACGAATGGCTGAAGATCCTGCGTACTAGATTTAAAAGAGCCGATGCTAATAAGGATGGCAAATTAACGGCTGCGGAGTTGGATTCCAAAGCGGGGCAAGGGGTATTGGTCATGATCATGAAATGA).

[0024] Preparation and transformation of competent cells: BL21(DE3) competent cells were prepared using an E. coli competent cell preparation kit. 10 μL of pET28a-pT7-LanM plasmid and 100 μL of competent cells were incubated on ice for 30 min, followed by heat shock at 42℃ for 90 sec and then immediately incubated on ice for 2 min. 900 μL of antibiotic-free LB medium was added, and the cells were incubated at 37℃ and 220 rpm for 1 h. 100 μL of the revived bacterial culture was then plated on an LB agar plate containing 50 μg / mL kanamycin and incubated overnight at 37℃.

[0025] Positive clone verification: Colony PCR: Single colonies were picked and amplified by PCR using 2×Rapid Taq Master Mix DNA polymerase (reaction system shown in Table 1, procedure shown in Table 2). The amplification products were detected by 1% agarose gel electrophoresis. The presence of the expected size band (full length of LanM gene 336bp) indicated a positive result.

[0026] Table 1 2×Rapid Taq Master Mix reaction system <![CDATA[ddH2O]]> To 50 μL 2×Rapid Taq Master Mix 25 μL Upstream primer (10 μM) 2 μL Downstream primer (10 μM) 2 μL Template DNA 1 μL Table 2 2×Rapid Taq Master Mix Reaction Program

[0027] Sequencing verification: Positive colonies were inoculated into LB liquid medium containing kanamycin and cultured overnight at 37°C with shaking. The plasmid was extracted and sent to Sanger sequencing (Qingke Biotechnology) to confirm the insertion direction and sequence correctness of the LanM gene.

[0028] The basic expression strain WT (containing pET28a-pT7-LanM plasmid) was obtained as the starting point for subsequent modular modification.

[0029] II. To determine the optimal expression space for the LanM protein, this invention designed a comparative experiment of cytoplasmic expression and periplasmic expression. The linearized plasmid backbone of pET28a-pT7-LanM was obtained by PCR amplification using high-fidelity DNA polymerase 2×PhantaMax Master Mix (reaction system and procedure are shown in Tables 3 and 4).

[0030] Table 3 2×Phanta Max Master Mix Reaction System <![CDATA[ddH2O]]> To 50 μL 2×Phanta Max Master Mix 25 μL Upstream primer (10 μM) 2 μL Downstream primer (10 μM) 2 μL Template DNA 1 μL Table 4 2×Phanta Max Master Mix Reaction Procedure

[0031] Simultaneously, three signal peptide sequences were artificially synthesized: OmpA, PhoA, and PelB. The sequences of the signal peptides used were obtained from NCBI, specifically OmpA (sequence ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCC), PhoA (sequence ATGAAACAAAGCACTATTGCACTGGCACTCTTACCGTTACTGTTTACCCCTGTGACAAAAGCC), and PelB (sequence ATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCC). The signal peptide fragments were synthesized by Genewiz, and homologous sequences were added to both ends of the fragments corresponding to the ends of the vector. These signal peptides transport the nascent peptide chains into the periplasmic space through a Sec-dependent secretion pathway. The signal peptide sequence was fused into the N-terminus of the LanM gene using 2×Seamless Cloning Mix. The vector and signal peptide sequence were mixed at a molar ratio of 1:3. The signal peptide sequence was then inserted into the pET28a-pT7-LanM linearized vector via seamless cloning (2×Seamless Cloning Mix, reaction at 50℃ for 30 min). This vector was then transformed into BL21(DE3) to obtain the periplasmic expression strain OmpA. sp PhoA sp PelB sp .

[0032] The LanM protein yield of the cytoplasmic expression strain (WT) was significantly higher than that of the three secretory strains (OmpAsp, PhoAsp, and PelBsp). Sequence analysis revealed that the LanM protein molecule does not contain cysteine ​​residues, and its correct spatial folding does not depend on the oxidative environment of the periplasmic space or the assistance of disulfide isomerases. Furthermore, the secretion process may increase the transport burden on the cell membrane. Therefore, cytoplasmic expression was determined to be the optimal strategy, and subsequent modifications were all based on the cytoplasmic expression architecture.

[0033] 3. Construct a molecular chaperone-assisted folding module to enhance the soluble expression of LanM protein and reduce inclusion body formation.

[0034] step: This embodiment constructed a molecular chaperone regulatory plasmid based on the pSTV28 vector, which contains a chloramphenicol resistance gene and a pBAD promoter. Specifically, two systems were constructed: DnaK-DnaJ-GrpE (KJE strain) and GroEL-GroES (groES / EL). During induction, the pBAD promoter was activated by adding 0.2% L-arabinose, allowing the molecular chaperone to be pre-synthesized before LanM expression. The strain introducing the DnaK-DnaJ-GrpE molecular chaperone system showed a 4.14-fold increase in LanM production compared to the WT strain. The operating principle is that DnaK, as an Hsp70 class molecular chaperone, recognizes and binds to the hydrophobic region of the nascent LanM polypeptide chain in synergy with DnaJ, preventing non-specific aggregation, while GrpE assists in ADP / ATP exchange, promoting the release of LanM in a soluble conformation.

[0035] IV. Construction of the Central Carbon Metabolism Regulation Module This module regulates metabolic flux bidirectionally through "overexpression enhancement" and "sRNA inhibition." First, in the overexpression submodule, genes such as mqo, eda, zwf, and pgk were amplified from the *E. coli* BL21 genome. The mqo gene encodes malate quinone oxidoreductase, which bypasses the traditional malate dehydrogenase pathway, directly oxidizing malate to oxaloacetate and transferring electrons to the respiratory chain, thereby enhancing intracellular ATP regeneration efficiency. The eda gene encodes 2-keto-3-deoxy-6-phosphate glucuronide aldolase, which enhances the ED pathway and alleviates carbon flux pressure on the EMP pathway. Overexpression of the mqo single gene increased yield by 3.81-fold, while combined mqo-eda overexpression increased yield by 4.10-fold.

[0036] Based on this, this embodiment designs a synthetic sRNA repressive element targeting competitive metabolic pathways. The sRNA expression cassette (containing a PR promoter, a target mRNA binding sequence (synthesized by Genewiz), a MicC scaffold, and a terminator) is used to target and repress genes such as pta and ldhA.

[0037] Artificially synthesized sRNA sequences specifically include targeting pta (sequence GATCAGCATAATAATACGGGACAC), ppsA (sequence TGACGAGCCATTGTTGGACAT), ldhA (sequence TGTGCTATAAACGGCGAGTTTCAT), pflB (sequence TAACTTTTCATTAAGCTCGGACAT), poxB (sequence ATAAGCTGCAACCGTTTGTTTCAT), and ackA (sequence AACCAGTACTAACTTACTCGACAT). The sequence of the sRNA expression cassette is: TAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCGATCAGCATAATAATACGGGACACTTTCTGTTGGGCCATTGCATTGCCACTGATTTTCCAACATATAAAAAGACAAGCCCGAACAGT CGTCCGGGCTTTTTTTCTCGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA Taking the pta gene as an example, the molecular structure of the sRNA repressor element (sRNA expression cassette) in this invention follows the logic of "transcription-target binding-stability enhancement-transcription termination," specifically comprising four major functional modules: pR promoter: Located on the far left of the sRNA box, it is a strong promoter that drives sRNA transcription and can initiate transcription in response to the host's physiological state; Target mRNA binding sequence: Located immediately downstream of the pR promoter, it is a synthetically produced short RNA sequence (20-30 bases in length) that is completely complementary to the translation initiation region of the ptamRNA. The binding free energy is calculated to be -30 to -40 kcal / mol using UNAFold software (or by using the website http: / / mfold.rna.albany.edu / ?q=DINAMelt / Two-state-melting). It binds precisely to the target mRNA through base pairing. Hfq binding scaffold structure sequence: Located between the target mRNA binding sequence and the terminator, it can bind to the host Hfq protein (RNA chaperone) and enhance the stability of the interaction between sRNA and target mRNA. T1 / TE terminator sequence: Located on the far right of the sRNA box, it is used to terminate the transcription process of sRNA and avoid redundant expression of irrelevant sequences.

[0038] This sRNA box blocks the conversion pathway of acetyl-CoA to acetic acid through a strategy of "precisely inhibiting the pta gene at the transcriptional level," reducing the toxicity of acetic acid accumulation to the cells during high-density fermentation and preserving more carbon flux and precursors for LanM protein synthesis.

[0039] Targeted inhibition of the pta gene (spta) increased yield by 1.82-fold because it blocked the conversion pathway of acetyl-CoA to acetate, reducing the toxic effects of intracellular acetate accumulation on bacterial growth. By coupling MQO overexpression with spta inhibition, efficient allocation of metabolic flux to LanM synthesis precursors was achieved.

[0040] Overexpression of the aspC gene, which encodes aspartate aminotransferase, catalyzes precursors of key amino acids in LanM proteins such as Asn and Lys. The introduction of aspC resulted in a 4.41-fold increase in LanM protein yield.

[0041] The specific primer sequences include the following: ilvE gene primers: ilvE-F (sequence GGAATTCGAGCTCGGTACCCATGACCACGAAGAAAGCTGATT) ilvE-R (sequence CGGCCAGTGCCAAGCTTGcgcagaaaggcccacccgaaggtgagccTTATTGATTAACTTGATCTAACCAGCC) pheA gene primers: pheA-F (sequence GGAATTCGAGCTCGGTACCCATGACATCGGAAAACCCGTT) pheA-R (sequence CGGCCAGTGCCAAGCTTGcgcagaaaggcccaccccgaaggtgagccTCAGGTTGGATCAACAGGCA) serB gene primers: serB-F (sequence GGAATTCGAGCTCGGTACCCATGCCTAACATTACCTGGTGC) serB-R (sequence CGGCCAGTGCCAAGCTTGcgcagaaaggcccaccccgaaggtgagccTTACTTCTGATTCAGGCTGCC) ghdA gene primers: ghdA-F (sequence GGAATTCGAGCTCGGTACCCATGGATCAGACATATTCTCTGGA) ghdA-R (sequence CGGCCAGTGCCAAGCTTGcgcagaaaggcccacccgaaggtgagccTTAAATCACACCCTGCGCCA) alaA gene primers: alaA-F (sequence GGAATTCGAGCTCGGTACCCATGTCCCCATTGAAAAATCCA) alaA-R (sequence CGGCCAGTGCCAAGCTTGcgcagaaaggcccaccccgaaggtgagccTTACAGCTGATGATAACCAGAAA) The high-efficiency components selected above were combined to construct the REC1 to REC10 series of strains. (See attached document.) Figure 1 The production performance of each integrated strain was quantitatively analyzed using ELISA. The experiment showed that strain REC2 exhibited the best production titer. Strain REC2 simultaneously integrated a DnaK-DnaJ-GrpE helper folding module, an mqo overexpression element, and an eda overexpression element. The connection methods of each module are shown in the appendix. Figure 2The REC2 strain contains two types of plasmids: one is the pET28a-pT7-LanM plasmid (containing KanR resistance) responsible for LanM gene expression, and the other is the pSTV28-pBAD-DnaKJE-Mqo-Eda plasmid (containing CmR resistance) responsible for multi-module regulation. The REC2 strain achieved a LanM yield of 2.55 mg / L in shake flasks, which is 8.92 times that of the wild-type strain.

[0042] The linearization primer sequences for the above plasmid are as follows: pET28a-pT7-LanM plasmid linearization primers: F1 (sequence GGGGCAAGGGGTATTGGTCATG) R1 (sequence TCTTAAAGTTAAACAAAATTATTTCTAGAGGGGAA) pSTV28 plasmid linearization primers: F2 (sequence ggctcaccttcgggtgggcctttctgcgCAAGCTTGGCACTGGCCG) R2 (sequence GGGTACCGAGCTCGAATTCC) VII. In order to verify the industrial application potential of the engineered strain, this invention further implemented fed-batch fermentation on a 5L fermenter scale.

[0043] Primary REC2 seed culture: Select a single colony and inoculate it into 5 mL of LB liquid medium containing the corresponding resistance (kanamycin 50 mg / L, chloramphenicol 34 mg / L), and culture at 37℃ and 220 rpm for 9 h with shaking until the OD600 reaches 1.0~1.5.

[0044] Secondary REC2 seed: Transfer the primary seed culture to 500 mL of fermentation medium containing the corresponding resistance at a volume ratio of 1:100, and culture at 37℃ and 220 rpm for 6-8 h with shaking until the OD600 reaches 3.0-4.0.

[0045] Fermentation tank preparation: Add 2 L of fermentation medium to a 5 L fermenter and sterilize at 115℃ for 15 min; after cooling, aseptically add the corresponding antibiotics (kanamycin 50 mg / L, chloramphenicol 34 mg / L), 0.2% (v / v) antifoaming agent and other aseptic additives (FeSO4·7H2O, MgSO4·7H2O, etc.).

[0046] Fermentation medium: 20 g / L glucose, 15 g / L peptone, 10 g / L NaCl, 10 g / L yeast extract, 2.5 g / L KH2PO4, 2 g / L K2HPO4, ddH2O to a final volume, sterilized at 115℃ for 15 minutes; after the medium temperature drops to room temperature, add 0.1 g / L FeSO4·7H2O, 1 g / L MgSO4·7H2O, 0.1 mg / L VB1, 53 mg / L CaCl2, 4 mL / L Na2MoO4·2H2O stock solution, 0.2% (v / v) antifoaming agent, and 4 mL / L 1000× trace inorganic salt solution stock solution.

[0047] 1000× Trace Inorganic Salt Solution Stock Solution: 27 g / L FeCl3·6H2O, 2 g / L ZnCl2, 1.9 g / L CuSO4·5H2O, 0.5 g / L H3BO3, ddH2O to volume, then filtered through a sterile 0.22 µm water membrane for sterilization.

[0048] 1000×FeSO4·7H2O stock solution (1M): After adjusting the volume to the appropriate concentration with ddH2O, filter with a sterile 0.22 µm filter membrane using water for sterilization.

[0049] 1000×MgSO4·7H2O stock solution (1M): After adjusting the volume to the appropriate concentration with ddH2O, filter with a sterile 0.22 µm filter membrane to remove bacteria.

[0050] 1000×VB1 stock solution (0.1 g / L): After adjusting the volume to the corresponding concentration with ddH2O, filter with a sterile 0.22 µm water-based filter membrane for sterilization.

[0051] 1000×CaCl2 stock solution (0.1 M): After adjusting the volume to the appropriate concentration with ddH2O, filter with a sterile 0.22 µm water-based filter membrane for sterilization.

[0052] 1000×Na2MoO4·2H2O stock solution (2 g / L): After adjusting the volume to the corresponding concentration with ddH2O, filter with a sterile 0.22 µm water filter membrane for sterilization.

[0053] The fermentation process is divided into three stages: The first stage is the cell growth stage: REC2 seed culture is inoculated into the fermenter at an inoculum volume of 6% (v / v). The initial fermentation parameters are set as follows: temperature 37℃, aeration ratio 1 vvm, and initial rotation speed 300 r·min. -1 Dissolved oxygen (DO) is controlled at 30%±2% (by adjusting the speed and ventilation rate), and pH is stabilized at 7.0±0.2 (automatically adjusted with 10% H2SO4 and 50% ammonia).

[0054] The second stage is the fed-batch stage: After 6 hours of fermentation, when the initial glucose is depleted and dissolved oxygen begins to rise, exponential or constant-rate feeding is initiated. The feeding solution consists of 500 g / L glucose, 100 g / L yeast extract, and 20 g / L magnesium sulfate, sterilized at 115°C for 15 minutes. The feeding rate is controlled at 21 mL / h to maintain the OD of the cell density. 600 It quickly accumulated to around 40.

[0055] The third stage is the induction expression stage: the fermenter temperature is lowered to 20℃ to reduce the protein translation rate and promote its correct folding. After stabilization for 1 h, IPTG at a final concentration of 0.4 mmol / L and L-arabinose at 0.2% are added sequentially. Samples are taken every 3 h after induction to detect cell OD. 600 The yield of LanM protein and the concentrations of metabolites such as glucose and acetic acid in the fermentation broth were measured until the protein yield reached its peak. After continuous induction, a LanM protein titer of 131.3 mg / L was finally achieved in a 5L fermenter. This result demonstrates the significant technical advantages of the modular construction strategy of this invention in improving the yield of rare earth-binding proteins.

[0056] In its specific operation, the REC2 strain significantly enhanced the flux of the tricarboxylic acid cycle (TCA) through overexpression of the mqo gene, providing sufficient ATP for protein synthesis. Simultaneously, the introduction of the eda gene diverted some glucose molecules through the ED pathway, reducing metabolic byproducts caused by EMP pathway overload. At the translational level, the KJE molecular chaperone system driven by the pBAD promoter was expressed first under the influence of arabinose, providing an immediate folding-supporting environment for the subsequent IPTG-induced LanM peptide chain. This precisely time- and space-matched regulatory scheme effectively solved the metabolic burden and folding dilemma in heterologous protein expression, achieving high-titer accumulation of LanM protein.

[0057] The detection method used in this embodiment is histidine-tagged ELISA. The specific operation is as follows: Fermented cells were collected and resuspended in disruption buffer (50 mM Tris-HCl, 150 mM NaCl, 10% glycerol, 1 mM PMSF, 100× protease inhibitor). Cell disruption was performed by sonication under ice bath conditions, with a power setting of 200 W, a 2-second on / 3-second off cycle, for a total duration of 5 minutes. The disrupted suspension was centrifuged at 4°C and 10,000 rpm for 30 minutes, and the supernatant was collected. The concentration of LanM protein was detected using a histidine-tagged ELISA kit based on the competitive method principle. A standard curve group (gradient concentrations of histidine-tagged standard protein) and a sample group were set up. Following the kit instructions, the OD values ​​were read at 450 nm using a microplate reader, and the concentration of LanM protein in the samples was calculated based on the standard curve. This quantitative method ensures the accuracy and reproducibility of the experimental data.

[0058] Through the implementation of the above steps, this invention not only successfully constructed a REC2 engineered strain that produces high levels of LanM protein, but also established a universal modular modification process for the heterologous expression of rare earth binding proteins. This process achieves optimal allocation of intracellular resources through decoupling regulation of secretion, folding, carbon metabolism, and amino acid synthesis. The implementation of this technical solution lays a solid material foundation for the large-scale application of LanM protein in the field of rare earth green recycling, and also provides a referable technical path for the production of other high-value-added recombinant proteins. The genetic elements and regulatory strategies involved in this invention have good compatibility and can be flexibly combined and replaced according to the structural characteristics of different target proteins.

Claims

1. A modular construction method for an engineered strain producing high-titer LanM protein, characterized in that, Includes the following steps: Step S1: Construct the basic expression system of the LanM gene. The LanM gene is cloned into the expression vector pET28a containing the T7 promoter to construct the recombinant expression plasmid pET28a-pT7-LanM. The recombinant expression plasmid is then transformed into competent Escherichia coli cells to obtain the basic expression strain. Step S2: By screening the spatial localization path through the fusion signal peptide sequence at the N-terminus of the LanM gene, the basic path of cytoplasmic expression as the basis for subsequent modular modification is determined; Step S3: Construct a molecular chaperone-assisted folding module, wherein the molecular chaperone system is selected from the DnaK-DnaJ-GrpE system and the GroEL-GroES system; Step S4: Construct a central carbon metabolism regulatory module, which includes an overexpression element and an sRNA repression element; Step S5: Construct an amino acid biosynthesis pathway regulation module and introduce an amino acid synthesis rate-limiting enzyme gene; Step S6: Combine and integrate the genetic elements screened in steps S3, S4 and S5 to obtain the optimal engineered strain.

2. The modular construction method of the engineered strain for producing high-titer LanM protein as described in claim 1, characterized in that, The signal peptide sequences screened in step S2 include OmpA signal peptide, PhoA signal peptide, and PelB signal peptide.

3. The modular construction method of the engineered strain for producing high-titer LanM protein as described in claim 1, characterized in that, The molecular chaperone system in step S3 is the DnaK-DnaJ-GrpE system and the GroEL-GroES system, and the molecular chaperone-assisted folding module is integrated into a regulatory plasmid containing the pBAD promoter.

4. The modular construction method of the engineered strain for producing high-titer LanM protein as described in claim 1, characterized in that, The overexpression elements in step S4 include the mqo gene and the eda gene, wherein the mqo gene encodes malate quinone oxidoreductase and the eda gene encodes 2-keto-3-deoxy-6-phosphoglucuronide aldolase.

5. The modular construction method of the engineered strain for producing high-titer LanM protein as described in claim 4, characterized in that, The sRNA repressor element in step S4 is an sRNA repressor element targeting the pta gene. The sRNA repressor element includes a scaffold sequence driven by the pR promoter and a binding sequence complementary to the pta mRNA.

6. The modular construction method of the engineered strain for producing high-titer LanM protein as described in claim 1, characterized in that, The rate-limiting enzyme gene in step S5 includes the aspC gene, which encodes aspartate aminotransferase.

7. The modular construction method of the engineered strain for producing high-titer LanM protein as described in claim 1, characterized in that, The optimal engineered strain integrated in step S6 is strain REC2, which contains the recombinant expression plasmid pET28a-pT7-LanM and the multi-module regulatory plasmid pSTV28-pBAD-DnaKJE-Mqo-Eda. The multi-module regulatory plasmid integrates the DnaK-DnaJ-GrpE molecular chaperone module, the mqo gene overexpression element, and the eda gene overexpression element.

8. The modular construction method of the engineered strain for producing high-titer LanM protein as described in claim 7, characterized in that, It also includes a large-scale fermentation process based on the REC2 strain, wherein the fermentation temperature is controlled at the cell density OD. 600 When the temperature reached 40, the temperature was reduced from 37°C to 20°C, and IPTG with a final concentration of 0.4 mM and L-arabinose with a mass-volume ratio of 0.2% were added sequentially for induction. A fed-batch process consisting of 500 g / L glucose and 100 g / L yeast extract was then started.

Images