A method for genetic transformation of freshwater pearl mussel based on agrobacterium-mediated transformation
By using Agrobacterium-mediated genetic transformation, we have successfully achieved efficient introduction and stable integration of exogenous DNA fragments into the reproductive cells of pearl mussels, solving the problem of low breeding efficiency in pearl mussel breeding and providing a simplified breeding technology route.
Patent Information
- Application Number
- CN202611096449.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-22
- Publication Date
- 2026-08-25
AI Technical Summary
In existing technologies, pearl mussel breeding relies on traditional natural selection and hybridization, which is time-consuming and highly random. It also lacks efficient transgenic and gene editing methods, resulting in low breeding efficiency and the inability to achieve targeted genetic improvement.
Using Agrobacterium-mediated genetic transformation, female pearl mussels in their reproductive period carrying oocytes or fertilized eggs were cultured by infiltrating them with Agrobacterium transformation solution. This constructed a genetic transformation system adapted to the reproductive cell characteristics of freshwater pearl mussels, achieving efficient introduction and stable integration of exogenous DNA fragments.
This method achieves efficient transformation and stable inheritance of exogenous DNA fragments in the reproductive cells of pearl mussels, simplifies the operation process, reduces damage to reproductive cells, is easy to promote and apply, and opens up a molecular breeding technology route for pearl mussel breeding.
Smart Images
Figure CN122629138A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of pearl mussel breeding and aquaculture, and in particular to a method for genetic transformation of freshwater pearl mussels based on Agrobacterium-mediated transformation. Background Technology
[0002] As a major freshwater pearl farming and production country in the world, my country's industry is highly dependent on the main pearl-producing mollusk—the triangular sail mussel ( Hyriopsis cumingii In the natural reproduction process of this species, the male mussel upstream releases sperm externally, which combines with the egg cells inside the female mussel downstream. The fertilized egg then develops for a period on the external gill lamella of the female mussel, eventually becoming a glochidia larva. The female mussel attracts fish such as yellow catfish by mimicking their movements, thereby spraying the mature glochidia larvae into the gills of the yellow catfish. After parasitism, the glochidia larvae absorb nutrients from the fish, metamorphose into juvenile mussels, and detach, subsequently feeding on themselves and growing larger. Although researchers have clarified most of the reproductive process of the *Sailfin oyster*, there is a significant technological gap between upstream breeding techniques and downstream pearl processing techniques. Currently, freshwater pearl mussel breeding still heavily relies on traditional natural selection and hybridization methods, which are time-consuming, highly random, and labor-intensive. Introducing transgenic and gene-editing technologies into the breeding process would greatly improve the efficiency of the pearl mussel breeding industry and address the shortcomings of the entire pearl industry chain.
[0003] In the field of plant genetic improvement, Agrobacterium-mediated genetic transformation technology has developed into a mature, efficient, stable, and low-damage technology system. This technology utilizes the natural biological characteristics of Agrobacterium to integrate target genes into the host genome in the form of T-DNA, achieving targeted and heritable improvement of plant traits. However, applying this technology to pearl mussel breeding faces significant challenges and uncertainties. Currently, no mature and efficient transgenic and gene-editing methods have been established for pearl mussels and most other aquatic shellfish. This technological gap directly results in: pearl mussel breeding still relying primarily on traditional selection methods, which involve a large workload, lengthy cycles, low targeting, and low efficiency; and the inability to effectively implement advanced technologies such as transgenics and gene editing in pearl mussels, thus restricting the targeted genetic improvement of key economic traits such as growth rate, disease resistance, and nacre secretion. Summary of the Invention
[0004] To address the aforementioned technological gaps, this invention provides a method for genetic transformation of freshwater pearl mussels mediated by Agrobacterium. By immersing female pearl mussels carrying egg cells or fertilized eggs in Agrobacterium transformation solution during their reproductive period, the invention successfully achieves efficient introduction and stable integration of exogenous DNA fragments into the genome of pearl mussel reproductive cells, filling a gap in the field of mollusc genetic transformation tools and technologies.
[0005] The specific technical solution is as follows: In a first aspect, this invention provides a method for genetic transformation of freshwater pearl mussels based on Agrobacterium-mediated transformation, comprising: Female pearl mussels of reproductive age carrying oocytes or fertilized eggs were cultured by infiltration with Agrobacterium-transformation broth, and transgenic freshwater pearl mussel offspring were obtained through screening and culture.
[0006] While Agrobacterium-mediated genetic transformation systems are well-established in plant genetic breeding, their successful application in animals, especially aquatic mollusks, is rare. Due to fundamental differences in immune recognition mechanisms, germ cell membrane components, and intracellular environments between mollusks and plant cells, the ability of Agrobacterium to attach, infect, and transfer T-DNA into the pearl mussel genome remains unpredictable. This invention innovatively applies Agrobacterium transformation to freshwater pearl mussels, and for the first time verifies that Agrobacterium can mediate the efficient transformation and stable inheritance of exogenous DNA fragments in pearl mussel germ cells. Furthermore, this invention systematically explores and optimizes key conditions such as the infection components of the Agrobacterium transformation solution, tailored to the unique physiological and ecological characteristics of pearl mussels, constructing a genetic transformation system adapted to the characteristics of freshwater pearl mussel germ cells, thereby achieving stable integration and expression of exogenous DNA fragments in pearl mussel offspring.
[0007] Furthermore, the Agrobacterium transformation solution comprises: Agrobacterium containing a transformation plasmid of the target gene and a transformation buffer for Agrobacterium infection.
[0008] Furthermore, the gene is a DNA fragment.
[0009] Furthermore, the transformation plasmid containing the target gene includes transgenic plasmids and gene editing plasmids.
[0010] Furthermore, the transgenic plasmid is a Ti transformation plasmid, which consists of a backbone vector and a transgenic fragment inserted into the backbone vector; the backbone vector is pK7WGF2.
[0011] Furthermore, the transgenic fragment is a screening marker gene or a reporter gene; The screening marker gene is preferably a hygromycin resistance gene; the reporter gene is preferably the green fluorescent protein (GFP) gene.
[0012] Furthermore, the Agrobacterium is Agrobacterium GV3101.
[0013] Furthermore, the conversion buffer includes: an acid-base environment regulating component, an energy supply component, and an infection capacity inducing component.
[0014] Furthermore, the conversion buffer, based on relevant effective components, includes morpholine ethanesulfonic acid (MES) 5-15 mM as the acid-base conditioning component, sucrose 1 wt%-3 wt% as the energy supply component, and acetylsuccinone 0.1-0.2 mM as the infection induction component; the pH is adjusted to 5.8-6.2.
[0015] Furthermore, the conversion buffer, based on relevant effective components, comprises: morpholine ethanesulfonic acid (MES) 10 mM as the pH-regulating component; sucrose 2 wt% as the energy supply component; and acetylsyringone 0.2 mM as the infection-inducing component; with the pH adjusted to 5.8-6.2.
[0016] Furthermore, the Agrobacterium transformation solution consists of Agrobacterium cells containing the target gene plasmid suspended in a specific transformation buffer.
[0017] Furthermore, the Agrobacterium transformation culture is prepared by the following method: Agrobacterium containing the target gene plasmid is cultured to the late logarithmic growth stage, the bacterial cells are collected by centrifugation, and resuspended in transformation buffer. The OD of the culture is then measured. 600 The value was adjusted to 0.2-0.3.
[0018] Preferably, the freshwater pearl mussel species is the triangular sail mussel (Triangular sail mussel). Hyriopsis cumingii ).
[0019] Preferably, the conditions for immersion culture are: continuous culture at a water temperature of 26-30℃ for 2-3 days.
[0020] Furthermore, the transgenic plasmid contains at least one selection marker gene expression cassette, preferably a hygromycin resistance gene expression cassette, for effectively screening successfully transformed pearl mussel reproductive cells during subsequent culture.
[0021] The screening and culture process includes: using antibiotic resistance genes (such as hygromycin resistance genes) carried in transgenic plasmids to screen freshwater pearl mussels or their offspring after Agrobacterium tumefaciens infiltration, thereby identifying and obtaining transgenic positive germ cells or individuals.
[0022] The present invention provides, in a second aspect, the application of the method described in the first aspect in the preparation of transgenic and / or gene-edited aquatic organisms.
[0023] Furthermore, the aquatic organism is a freshwater pearl mussel.
[0024] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention is the first to successfully apply Agrobacterium-mediated transformation to pearl mussel breeding, opening up a new molecular breeding technology route for the genetic improvement of pearl mussels.
[0025] (2) Compared with the microinjection method used for transgenic animal oocytes in many other methods, the "Agrobacterium infiltration culture" method used in this invention is a non-invasive operation, which greatly reduces the damage to germ cells and the technical requirements for professionals. It simplifies the operation process and is easy to promote and apply. Attached Figure Description
[0026] Figure 1 The image shows the structure of the pBHHG461 plasmid in Example 1.
[0027] Figure 2 This shows the GFP expression in germ cells after genetic transformation in Example 2; scale bar: 50 μm.
[0028] Figure 3 This study used PCR detection of T-DNA insert fragments. Band 1 was derived from the genomic DNA extracted from the germ cell mass expelled by female mussels after genetic transformation with Agrobacterium containing pBHHG461 plasmid, using this as a template. Band 2 was derived from the genomic DNA extracted from the germ cell mass expelled by female mussels after transformation with empty Agrobacterium, using this as a template. Band 3 was derived from the genomic DNA extracted from the germ cell mass expelled by female mussels that did not undergo genetic transformation.
[0029] Figure 4 The expression of GFP protein was detected by Western blot. Bands 1 and 2 are proteins extracted from the germ cell masses expelled by different female mussels after genetic transformation with Agrobacterium containing pBHHG461 plasmid; band 3 is proteins extracted from the germ cell masses expelled by female mussels that did not undergo genetic transformation. Detailed Implementation
[0030] The present invention will be further described below with reference to specific embodiments. The following are only specific embodiments of the present invention, but the scope of protection of the present invention is not limited thereto.
[0031] The primer sequences involved in this invention are as follows: 321F1 (SEQ ID NO.1): TCGACCTGCAGGCGGCCGCACTAGTATGCACCATCATCATCATCATCACCACCACCACCA; 321R1 (SEQ ID NO.2): TGGTGGTGGTGGTGATGATGATGATGATGGTGCATACTAGTGCGGCCGCCTGCAGGTCGA; 321F2 (SEQ ID NO.3): CATCATCATCATCATCACCACCACCACCACCACACTAGTATGGTGAGCAAGGGCGAGGAG; 321R2 (SEQ ID NO.4): CTCCTCGCCCTTGCTCACCATACTAGTGTGGTGGTGGTGGTGGTGATGATGATGATGATG; CmRF1R (SEQ ID NO.5): CTTTACGATGCCATTGGGAT; HygRF2 (SEQ ID NO.6): GGCATGCGACGTCGGGCCCTCTAGAAGAACCGCAACGTTGAAGGAGCCAC; HygRR2 (SEQ ID NO.7): CGAGGGTACCCGGGGATCCTCTAGAGATCTAGTAACATAGATGACACCGC; ccdBF5 (SEQ ID NO.8): TACACAGCCAGTCTGCAGGT; HygRR1 (SEQ ID NO.9): GATGTTGGCGACCTCGTATT; P35SF3 (SEQ ID NO.10): CGCACAATCCCACTATCCTT; GFPR1 (SEQ ID NO.11): TGAAGTCGATGCCCTTCAG.
[0032] In the following examples, "TB" refers to Transforming Buffer; "MES" refers to Morpholine Ethylene Sulfate (MES); and "AS" refers to Acetylsyringone.
[0033] In the following examples, the Agrobacterium-mediated transformation techniques include electroporation transformation, chemical transformation, etc., and chemical transformation is used in specific examples.
[0034] Example 1: A method for genetic transformation of pearl mussels based on Agrobacterium-mediated transformation The transformation plasmid used was prepared by the following steps: (1) The circular plasmid pK7WGF2 was reacted with SpeI-HF enzyme to cut the circular plasmid into linear DNA fragment A, and then the fragment was purified to obtain product AP.
[0035] (2) Synthesize primer fragments 321F1 (SEQ ID NO.1), 321R1 (SEQ ID NO.2), 321F2 (SEQ ID NO.3) and 321R2 (SEQ ID NO.4).
[0036] (3) Dilute 321F1 and 321R1 to 10µM concentration respectively, add 25µL of each and mix. Then heat in a 95℃ metal bath for 10 minutes, turn off the metal bath and cool naturally to room temperature to obtain 321(F1+R1) refolding mixture. Prepare 321F2 and 321R2 dilutions in the same way, and take 25µL of each and mix, heat to denature and then refold to obtain 321(F2+R2) refolding mixture.
[0037] (4) Mix DNA fragment AP, fragment 321 (F1+R1) and fragment 321 (F2+R2) in equal volumes and concentrations, add recombinase Exnase® MultiS and buffer to prepare a reaction system, react at 37°C for 30 minutes, and then transfer into competent Escherichia coli DB3.1.
[0038] (5) Select an appropriate number of single clones and perform PCR clone detection using the positive primer 321F1 and the reverse primer CmRF1R (SEQ ID NO.5). Then select positive clones for expansion culture, extract the corresponding plasmids for sequencing, and obtain intermediate plasmid B.
[0039] (6) Add an appropriate amount of plasmid B to XbaI restriction enzyme and digest it at 37°C for 2 hours. Then purify the digestion product to obtain linear DNA fragment C. Purify the fragment using a kit to obtain product CP.
[0040] (7) Using pKI1.1R plasmid as template, PCR reaction was performed with primers HygRF2 (SEQ ID NO.6) and HygRR2 (SEQ ID NO.7) to amplify PCR fragment D containing hygromycin resistance gene and recombination sites at both ends. PCR fragment D was purified with a kit to obtain product DP.
[0041] (8) Mix equal amounts of CP and DP, add recombinase Exnase® MultiS and buffer to prepare a reaction system, place it on a PCR instrument at 37°C for 30 minutes, and then transfer it into competent Escherichia coli DB3.1. (9) Select an appropriate number of clones, perform PCR clone detection using primers ccdBF5 (SEQ ID NO.8) and HygRR1 (SEQ ID NO.9), select positive single clones for amplification culture, extract plasmids and sequence them to obtain the pBHHG461 recombinant plasmid, as shown below. Figure 1 As shown.
[0042] (10) Plasmid pBHHG461 was introduced into competent Agrobacterium GV3101 by chemical transformation, and the transformed bacterial solution was spread on LB culture plates containing three antibiotics: zizomycin (100 μg / mL), gentamicin (50 μg / mL), and rifampin (50 μg / mL). The plates were then placed in a constant temperature incubator at 28℃ for 3 days.
[0043] (11) Select 2-3 clones and use primers ccdBF5 (SEQ ID NO.10) and HygRR1 (SEQ ID NO.11) to perform PCR clone detection to confirm that the grown clone is the expected Agrobacterium clone containing plasmid pBHHG461.
[0044] (12) The detected single colony was inoculated into 5 mL of LB liquid medium containing three antibiotics: zizomycin (100 μg / mL), gentamicin (50 μg / mL), and rifampin (50 μg / mL), and cultured overnight at 28°C with shaking at 200 rpm.
[0045] (13) The next morning, take 2-3 mL of the shaken Agrobacterium tumefaciens solution and re-inoculate it into 400 mL of fresh LB liquid medium containing three antibiotics: zizomycin (100 μg / mL), gentamicin (50 μg / mL), and rifampin (50 μg / mL). Continue to culture at 28°C and 200 rpm for about 6-8 hours until OD. 600 It reaches 0.8-1.0.
[0046] (14) Transfer about 400 mL of bacterial culture to a centrifuge tube or centrifuge cup, centrifuge at 4000 xg (gravitational acceleration) for about 15 minutes at room temperature (below 30°C), and discard the supernatant.
[0047] (15) Using a 5mL pipette, pipette 5-10 mL of transformation buffer TB into a centrifuge cup (tube) containing the bacterial pellet, and gently pipette the mixture to ensure that all the bacterial pellet is resuspended evenly. Then, add transformation buffer TB to dilute the resuspended solution to the bacterial culture OD. 600 Reaching 0.2-0.3; The conversion buffer TB has the following formulation: 10 mM morpholine ethanesulfonic acid (MES), pH 6.0, 2% sucrose, 0.15 mM acetylsuccinone (AS, used to activate the Vir gene of Agrobacterium).
[0048] (16) Freshwater pearl mussels (triangular sail mussels) in their reproductive period carrying egg cells or fertilized eggs Hyriopsis cuminggii After cleaning and removing the outer shell, parasitic algae and other biological groups, the bacteria are transferred into an appropriate amount of prepared transformation buffer containing Agrobacterium and cultured at 26-30 ℃ for 2 days.
[0049] Example 2: Verification of Expression Effect 2.1 Detection of fluorescent proteins After two days of co-culture, the transformation buffer containing Agrobacterium was removed, and the freshwater pearl mussels were rinsed three times with deionized water. They were then placed in clean deionized water and cultured at 25°C. After 1-2 days, the female mussels secreted a cluster of reproductive cells (containing oocytes or fertilized eggs) resembling thick mucus in several separate secretions. This mucus was collected using a 1 mL pipette and placed in a clean 10 mL shaker tube. 5 mL of transformation buffer containing 30 μg / mL hygromycin was added, and the tube was fixed on a shaker and cultured at 15 rpm / min at 25°C for 3-4 hours.
[0050] Use a pipette to take an appropriate amount of cell buffer from the shaker tube and place it under a fluorescence confocal microscope. Set the excitation wavelength to 488 nm and the emission collection wavelength to 500-530 nm to observe whether there is a green fluorescent protein (GFP) signal. Figure 2 As shown, compared with the control group, green fluorescent signals appeared in the field of view of the experimental group, proving that GFP was successfully expressed, indicating that the cells (clusters) were successfully genetically transformed.
[0051] 2.2 PCR detection A suitable amount of cell buffer was aspirated from the shaker tube using a pipette, and the supernatant was removed by centrifugation. Whole-genome DNA was extracted using the CTAB method or a commercial kit. Primers for specific fragments on pBHHG461 were designed for PCR amplification. The detection primers were P35SF3 (SEQ ID NO.10) and GFPR1 (SEQ ID NO.11), and the expected PCR fragment size was 601 bp.
[0052] Test results as follows Figure 3As shown in the diagram, band 1 represents the genomic DNA extracted from the germ cell mass expelled by a female mussel after genetic transformation with Agrobacterium containing the pBHHG461 plasmid, using this DNA as a template; band 2 represents the genomic DNA extracted from the germ cell mass expelled by a female mussel after transformation with empty Agrobacterium, using this DNA as a template; and band 3 represents the genomic DNA extracted from the germ cell mass expelled by a female mussel that did not undergo genetic transformation, using this DNA as a template. The results of the three bands show that only the germ cell mass transformed by Agrobacterium containing the pBHHG461 plasmid contains the exogenous inserted DNA fragment.
[0053] 2.3 Western blot detection of exogenous gene protein expression Use a pipette to extract an appropriate amount of cell buffer from the shaker tube, and centrifuge to remove the supernatant. Add an appropriate amount of total protein extraction buffer (containing protease inhibitors), grind (or sonicate) the cells, and heat in a metal bath at 95 ℃ for 15-20 minutes. Then, transfer 10-30 μL of sample to the PAGE lane of the electrophoresis tank, and separate the various proteins at 150 V for 50 min. After electrophoresis, transfer the separated proteins to a PVDF membrane, block the membrane with 2.5% skim milk, and then add fresh 2.5% skim milk containing primary antibody GFP. Incubate at room temperature for 2 hours (or overnight at 4 ℃). Next, wash the membrane three times with TBST solution (5-10 min each time), and incubate for 1 hour with 2.5% skim milk containing secondary antibody. Finally, wash the membrane three times with TBST solution (5-10 min each time) and perform Western blot protein detection.
[0054] like Figure 4 As shown, specific GFP protein band signals (at a position of 30.44 kDa on the membrane and a size of 12xHis-GFP) can be observed in some cells of the germ cell cluster genetically transformed by Agrobacterium containing pBHHG461 plasmid, while no GFP band signal can be observed in the untransformed control group.
[0055] Optimization of Genetic Transformation Buffer Components in Comparative Example 1 This invention conducted single-factor tests on the key components of the conversion buffer. The tested components included the acid-base regulator morpholine ethanesulfonic acid (MES), the infection inducing agent acetylsuccinone (AS), and the energy supply and osmotic pressure regulator sucrose. Different concentration gradients were set up in the experiment (see Table 1 for details). Five individuals were treated in each group using the freshwater pearl mussel as the test subject. After immersion in the corresponding conversion buffer for 3 days, the number of surviving individuals in each group was counted to evaluate the effects of each component and concentration combination on the short-term tolerance of freshwater pearl mussels.
[0056] Table 1. Optimization test data of each component of the genetic transformation buffer.
[0057] The optimization test results of each component of the genetic transformation buffer are shown in Table 1. The results show that the components of the transformation buffer screened and optimized in this invention can efficiently introduce exogenous genes and are safe and non-toxic to the short-term survival of the Triangular Sail mussel.
[0058] This invention is not limited to the above-described embodiments. Any modifications, improvements, or substitutions that can be conceived by those skilled in the art without departing from the essential content of this invention fall within the scope of this invention.
Claims
1. A method for genetic transformation of freshwater pearl mussels based on Agrobacterium-mediated transformation, characterized in that, include: Female pearl mussels of reproductive age carrying oocytes or fertilized eggs were cultured by infiltration with Agrobacterium-transformation broth, and transgenic freshwater pearl mussel offspring were obtained through screening and culture.
2. The method according to claim 1, characterized in that, The Agrobacterium transformation solution includes: Agrobacterium containing a transformation plasmid of the target gene and a transformation buffer for Agrobacterium infection.
3. The method according to claim 2, characterized in that, The transformation plasmids containing the target gene include transgenic plasmids and gene editing plasmids; The transgenic plasmid is a Ti transformation plasmid, which consists of a backbone vector and a transgenic fragment inserted into the backbone vector; And / or, the transgenic fragment is a selection marker gene or a reporter gene; the selection marker gene is a hygromycin resistance gene; the reporter gene is a green fluorescent protein (GFP) gene.
4. The method according to claim 2, characterized in that, The Agrobacterium is Agrobacterium GV3101.
5. The method according to claim 2, characterized in that, The conversion buffer includes: an acid-base environment regulating component, an energy supply component, and an infection capacity inducing component.
6. The method according to claim 5, characterized in that, Based on the relevant effective components, the acid-base environment regulating component is morpholine ethanesulfonic acid (MES) 5~15mM, the energy supply component is sucrose 1wt%~3wt%, and the infection capacity inducing component is acetylsuccinone 0.1~0.2 mM; Adjust the pH to 5.8~6.
2.
7. The method according to claim 1, characterized in that, The OD of the Agrobacterium-transformed bacterial broth 600 The value is between 0.2 and 0.
3.
8. The method according to claim 1, characterized in that, The conditions for immersion culture are: continuous culture in water at 26-30℃ for 2-3 days.
9. The method according to claim 1, characterized in that, The freshwater pearl mussel in question is the Triangle Sail Mussel.
10. The method according to claim 1, characterized in that, The screening and culture process involves screening transformed freshwater pearl mussels using antibiotic resistance genes carried in transgenic plasmids.