Linc02609-specific antisense oligonucleotide and application thereof

CN122648413APending Publication Date: 2026-08-28LANZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610580391.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-29
Publication Date
2026-08-28

AI Technical Summary

Technical Problem

[0007]本发明的目的在于克服现有技术中对特定长链非编码RNA缺乏有效靶向干预手段的不足的问题

Benefits of technology

1、本发明提供的反义寡核苷酸能够特异性结合LINC02609转录本,从而有效抑制其表达,具有良好的靶向性。在乳腺癌转移模型中,未观察到明显毒性,体内疗效明确且安全性良好。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122648413A_ABST
    Figure CN122648413A_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of biotechnology and gene therapy, and particularly relates to a LINC02609 specific antisense oligonucleotide and application. The antisense oligonucleotide can be specifically combined with the transcription sequence of the LINC02609 gene, so as to inhibit the expression of LINC02609. The antisense oligonucleotide of the present application can effectively inhibit the expression of LINC02609, and further inhibit the proliferation and migration of breast tumor cells. The present application provides a candidate molecule for developing a new type of gene therapy drug for breast tumors, and shows a broad application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical genetic engineering, specifically relating to a LINC02609 specific antisense oligonucleotide and its application in the preparation of drugs, particularly antitumor drugs, for use in the treatment of breast cancer and in drugs that reverse tumor cell drug resistance. Background Technology

[0002] Breast cancer is one of the most common malignant tumors worldwide, and its incidence rate in China has been rising steadily in recent years. For patients with advanced stages or distant metastases, current treatments (including surgery, radiotherapy, chemotherapy, and targeted therapy) still have limited overall efficacy and are prone to tumor recurrence and drug resistance. Furthermore, breast cancer exhibits significant molecular heterogeneity, with considerable differences in treatment responses among patients, further increasing the difficulty of clinical treatment. Therefore, developing new molecular targets and precision treatment strategies is of great importance.

[0003] In recent years, long non-coding RNAs (lncRNAs) have been shown to play a crucial regulatory role in tumorigenesis and development, including regulating tumor cell proliferation, migration, metabolic reprogramming, and drug resistance. Some lncRNAs have been identified as potential diagnostic biomarkers and therapeutic targets. However, targeted interventions against lncRNAs still face challenges such as insufficient target screening, unclear functional mechanisms, and a lack of effective intervention methods, limiting their clinical application.

[0004] LINC02609, a newly reported lncRNA, has not been fully studied in terms of its expression characteristics and functional role in breast cancer, and effective strategies for targeted intervention are lacking. Therefore, developing specific regulatory mechanisms against LINC02609 and elucidating its role in tumorigenesis and development is of great value for expanding the therapeutic targets for breast cancer.

[0005] Antisense oligonucleotides (ASOs), as an important form of nucleic acid drug, can precisely regulate specific genes by specifically binding to target RNA sequences, inducing their degradation or blocking their function. Although ASO technology has shown promising applications in various diseases, research on specific lncRNAs (such as LINC02609) remains relatively limited.

[0006] Therefore, there is an urgent need to develop an antisense oligonucleotide that can specifically target LINC02609 and verify its application potential in inhibiting tumor progression and improving treatment efficacy. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings of existing technologies in the lack of effective targeted intervention methods for specific long non-coding RNAs. It provides an antisense oligonucleotide capable of specifically inhibiting LINC02609 expression and its application in tumor therapy.

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] In a first aspect, the present invention provides an antisense oligonucleotide that can specifically target LINC02609 and exert an antitumor effect.

[0010] The specific plan is as follows: An antisense oligonucleotide that can specifically and complementaryly bind to the LINC02609 transcript sequence, thereby inhibiting the expression of LINC02609; The antisense oligonucleotide is selected from at least one of the following: (1) A nucleotide sequence that is ≥90% complementary to the sequence GGGTCACAACTGGGAGAAAC; (2) Nucleotide sequences that are ≥90% complementary to the sequence ACCAGCAAAAGAGGCAGACG; (3) Nucleotide sequences that are ≥90% complementary to the sequence TCTTCACTCCAAATTGTCCC.

[0011] Current breast cancer treatments suffer from limited efficacy, high recurrence rates, and drug resistance. Although the role of long non-coding RNAs in tumor development is gradually being recognized, targeted interventions against specific lncRNAs (such as LINC02609) are still relatively lacking, limiting their application in precision oncology.

[0012] Furthermore, the antisense oligonucleotide is selected from at least one of the following: (1) A nucleotide sequence that is ≥95% complementary to the sequence GGGTCACAACTGGGAGAAAC; (2) Nucleotide sequences that are ≥95% complementary to the sequence ACCAGCAAAAGAGGCAGACG; (3) Nucleotide sequences that are ≥95% complementary to the sequence TCTTCACTCCAAATTGTCCC.

[0013] Furthermore, the antisense oligonucleotide is selected from at least one of the following: (1) Nucleotide sequences complementary to the sequence GGGTCACAACTGGGAGAAAC; (2) Nucleotide sequences complementary to the sequence ACCAGCAAAAGAGGCAGACG; (3) Nucleotide sequences complementary to the sequence TCTTCACTCCAAATTGTCCC.

[0014] Furthermore, the antisense oligonucleotide has a length of 15–25 nucleotides.

[0015] Based on the nucleotide sequence database in GeneBank, the reference sequence LINC02609 (transcription number: ENST00000443802) published by NCBI was selected. Using computer-aided design based on RNA secondary structure, and according to the expression abundance of different exons in RNA-seq high-throughput sequencing, three LINC02609-specific antisense oligonucleotides (LINC02609 ASO#1-3) were designed. The control sequence used was Ribobio product lnc6N0000001-1-5 (ASO Ctrl). Sequence alignment with Ensembl blasts showed that the selected target sequences all exhibited good specificity and would not interfere with the expression of other normal human genes.

[0016] Furthermore, the specific sequence of the antisense oligonucleotide is shown below: LINC02609 ASO#1: 5'-GTTTCTCCCAGTTGTGACCC-3'; LINC02609 ASO#2: 5'-CGTCTGCCTCTTTTGCTGGT-3'; LINC02609 ASO#3: 5'-GGGACAATTTGGAGTGAAGA-3'.

[0017] The antisense oligonucleotide sequence of this invention has strong targeting capabilities, specifically binding to the LINC02609 transcript and effectively inhibiting its expression. By regulating the activation level of the AKT key signaling pathway through antisense oligonucleotides and inhibiting glycolytic metabolism, the proliferation, migration, and metastasis of breast cancer cells can be effectively suppressed, thus exerting a significant anti-tumor effect.

[0018] Furthermore, the antisense oligonucleotide contains one or more chemical modifications. Antisense oligonucleotides can be chemically modified to improve their stability and biological activity.

[0019] Furthermore, the chemical modification is selected from at least one of the following: locked nucleic acid (LNA) modification, thiophosphate modification, or 2'-position modification.

[0020] Modification can be achieved through LNA, phosphate thioester, or 2'-position modification. This can either enhance nuclease resistance, improve in vivo stability, making it difficult for nucleases to recognize and cleave them, and significantly prolonging the plasma half-life; or improve affinity and binding specificity to target RNA. Chemical modification can significantly enhance the medicinal potential of antisense oligonucleotides.

[0021] In a second aspect, the present invention provides pharmaceutical uses of the above-mentioned antisense oligonucleotides.

[0022] The application of antisense oligonucleotides as described above in the preparation of antitumor drugs.

[0023] Preferably, the tumor is breast cancer.

[0024] Furthermore, the antisense oligonucleotide can be used to prepare drugs that inhibit the proliferation, migration and metastasis of tumor cells, or to prepare drugs that reverse the drug resistance of tumor cells.

[0025] Specifically, this includes, but is not limited to, the following application effects or application scenarios.

[0026] Furthermore, the antisense oligonucleotide is used to inhibit tumor cell proliferation.

[0027] Furthermore, the antisense oligonucleotide is used to inhibit tumor cell migration or metastasis.

[0028] Furthermore, the antisense oligonucleotides are used to regulate the metabolic processes of tumor cells.

[0029] Furthermore, the antisense oligonucleotide is used to reduce the activation level of the AKT signaling pathway.

[0030] Furthermore, the antisense oligonucleotide is used to prepare drugs that reverse drug resistance in tumor cells.

[0031] This invention utilizes antisense oligonucleotides to precisely intervene in LINC02609, a key molecule driving malignant tumor progression, in a sequence-specific manner, effectively regulating oncogene expression. By directly binding to the LINC02609 gene target that drives tumor proliferation, survival, migration, and angiogenesis, it blocks RNA function, interrupting the flow of pro-cancer signals at the post-transcriptional level, ultimately leading to tumor cell cycle arrest, increased apoptosis, and decreased invasiveness.

[0032] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. The antisense oligonucleotides provided by this invention can specifically bind to the LINC02609 transcript, thereby effectively inhibiting its expression and exhibiting good targeting properties. No significant toxicity was observed in a breast cancer metastasis model, demonstrating clear in vivo efficacy and good safety.

[0033] 2. The antisense oligonucleotide provided by this invention has a prominent tumor-suppressive effect. In vitro and in vivo experiments show that the antisense oligonucleotide can silence LINC02609, thereby significantly inhibiting the proliferation, migration and metastasis of breast cancer cells, significantly reducing tumor burden and reducing the number of metastatic nodules.

[0034] 3. The antisense oligonucleotides provided by this invention can regulate key signals and metabolic processes. By targeting LINC02609, the activation level of the AKT signaling pathway can be reduced and the glycolytic metabolism process can be inhibited. Attached Figure Description

[0035] Figure 1A and Figure 1B This section presents the expression and clinical relevance analysis results of LINC02609 in breast cancer. Among them, Figure 1A The results of Kaplan-Meier survival analysis based on publicly available datasets show that high expression of LINC02609 is significantly associated with reduced overall patient survival. Figure 1B The box plot shows that the expression level of LINC02609 in M1 stage breast cancer tissue is significantly higher than that in M0 stage.

[0036] Figures 2A to 2E The figure shows the experimental results of silencing LINC02609 with specific ASOs on the proliferation and DNA damage of breast cancer cells. Figure 2A The changes in LINC02609 expression levels in different breast cancer cell lines were detected by RT-qPCR. The results showed that ASOs could effectively silence LINC02609. Figure 2B The results of the CCK-8 assay showed that silencing LINC02609 significantly inhibited cell viability. Figure 2C Clonalization experiments showed that silencing LINC02609 reduced cell proliferation. Figure 2D EdU staining results show that DNA replication activity decreased after silencing LINC02609. Figure 2E The results from the comet experiment show that silencing LINC02609 increases the level of DNA damage.

[0037] Figure 3A and Figure 3B The figure shows the experimental results regarding the effects of LINC02609-specific ASOs on the migration and invasion abilities of breast cancer cells. Among them, Figure 3A The results of the wound healing assay show that ASOs treatment significantly slowed cell migration; Figure 3B The results of the Transwell migration assay show that ASOs significantly reduced cell migration ability after silencing LINC02609.

[0038] Figure 4 The figure shows the experimental results of the effect of LINC02609-specific ASOs on the AKT signaling pathway. The expression levels of AKT and phosphorylated AKT (p-AKT) were detected by immunofluorescence staining. The results showed that the p-AKT level was significantly reduced after ASOs treatment, indicating that the AKT signaling pathway was inhibited.

[0039] Figure 5A and Figure 5B The figure shows the experimental results of the effect of LINC02609-specific ASOs on glycolytic metabolism in breast cancer cells. Among them, Figure 5A Western blot was used to detect changes in the protein expression level of PFKFB3, a key enzyme in glycolysis. Figure 5B The results of Seahorse's energy metabolism analysis showed that ASOs treatment significantly reduced the extracellular acidification rate (ECAR), indicating a decrease in glycolytic activity.

[0040] Figures 6A to 6F This figure shows the experimental results of the antitumor effect of LINC02609-specific ASOs in an in vivo breast cancer metastasis model. Among them, Figure 6A The results of in vivo fluorescence imaging in small animals show that the tumor burden decreased after ASO treatment; Figure 6B The results are from the quantitative analysis of fluorescence signals; Figure 6C This is a statistical result of the number of metastatic nodules in lung tissue; Figure 6D This is a curve showing the change in mouse body weight during the experiment; Figure 6E HE staining results for lung and liver tissues; Figure 6F The Ki-67 immunohistochemical staining results show that ASO treatment significantly inhibits tumor cell proliferation. Detailed Implementation

[0041] The present invention will now be described in further detail with reference to specific embodiments. However, this should not be construed as limiting the scope of the present invention to the following embodiments; all technologies implemented based on the content of the present invention fall within the scope of the present invention.

[0042] Unless otherwise specified, the terms "upper," "lower," "left," "right," "center," "inner," and "outer," etc., used in the description of specific embodiments of the present invention to indicate orientation or positional relationships, are based on the orientation or positional relationships shown in the accompanying drawings, or the orientation or positional relationship in which the product / equipment / device is usually placed during use. These terms are merely for the purpose of facilitating the description of the present invention or simplifying the description in specific embodiments, and for enabling those skilled in the art to quickly understand the solution, and do not indicate or imply that a particular device / component / element must have a specific orientation, or be constructed and operated in a specific positional relationship. Therefore, they should not be construed as limitations on the present invention.

[0043] Furthermore, the use of terms such as "horizontal," "vertical," "suspended," "parallel," and "coaxial" does not imply that the corresponding device / component / element must be absolutely horizontal, vertical, suspended, parallel, or coaxial. Slight tilt or deviation is permissible, as long as it does not affect the normal function of the relevant component. For example, "horizontal" simply means that its direction is more horizontal relative to "vertical," not that the structure must be perfectly horizontal; a slight tilt is acceptable. "Coaxial" means that two components are arranged as coaxially as possible, allowing them to move coaxially or approximately coaxially when their relative positions change. Alternatively, it can be simplified to mean that the corresponding device / component / element, when arranged in "horizontal," "vertical," "suspended," "parallel," or "coaxial" directions, can have an error / deviation of ±10% relative to the corresponding direction, more preferably within ±8%, more preferably within ±6%, more preferably within ±5%, and more preferably within ±4%. For example, the deviation in the "coaxial" direction is controlled within 0.2-1mm, preferably within 0.2-0.5mm. As long as the corresponding device / component / element is within the error / deviation range, it can still achieve its function in the solution of the present invention.

[0044] Furthermore, the use of terms such as "first," "second," and "third" in terminology is merely for distinguishing descriptions of identical or similar components and should not be interpreted as emphasizing or implying the relative importance of a particular component.

[0045] Furthermore, in the description of the embodiments of the present invention, "several", "more than", and "a number of" represent at least two. The number can be any number, such as two, three, four, five, six, seven, eight, or nine, and can even exceed nine.

[0046] Furthermore, in the description of the technical solution of this invention, unless otherwise explicitly specified / limited / restricted, the terms "set up," "install," "connect," "link," "provided with," "laid out," and "arranged" should be interpreted broadly. For example, they can refer to fixed connections, detachable connections, or integral connections; they can refer to connection methods commonly used in the art, such as welding, riveting, bolting, and threaded connections. Such connections can be mechanical, electrical, or communication connections; they can be direct connections or indirect connections through an intermediate medium; and they can refer to the internal communication between two components.

[0047] Example 1 Expression and clinical relevance analysis of LINC02609 in breast cancer The expression level and clinical significance of LINC02609 were analyzed based on publicly available breast cancer datasets (such as GSE9893). Clinical analysis showed that LINC02609 was associated with poor prognosis, and its expression level was significantly higher in stage M1 tumors than in stage M0. Further Kaplan-Meier survival analysis demonstrated that patients with high LINC02609 expression had significantly lower overall survival. Specifically... Figure 1A As shown, LINC02609 is associated with poor prognosis, and its expression level is significantly higher in tumor stage M1 than in stage M0. Figure 1B As shown in the box plot, compared with the M0 stage breast cancer cohort, LINC02609 expression was significantly higher in patients with distant metastases (M1 stage) than in patients without metastases (M0 stage). These results indicate that LINC02609 is highly expressed in breast cancer and is associated with poor prognosis, suggesting it as a potential target for tumor therapy.

[0048] Based on the nucleic acid sequence database in GeneBank, the reference sequence of LINC02609 published by NCBI (transcription number: ENST00000443802) was selected. Computer-aided design based on RNA secondary structure was used to design three LINC02609-specific antisense oligonucleotides (LINC02609 ASO#1-3) according to the expression abundance of different exons in RNA-seq high-throughput sequencing. The control sequence used was the Ribo product lnc6N0000001-1-5 (ASO Ctrl).

[0049] The specific sequence of the antisense oligonucleotide is shown below: LINC02609 ASO#1: 5'-GTTTCTCCCAGTTGTGACCC-3'; LINC02609 ASO#2: 5'-CGTCTGCCTCTTTTGCTGGT-3'; LINC02609 ASO#3: 5'-GGGACAATTTGGAGTGAAGA-3'.

[0050] Sequence alignment with Ensembl blast revealed that the selected target sequences exhibited high specificity and did not interfere with the expression of other normal human genes. Therefore, antisense oligonucleotides based on this lncRNA gene targeting intervention show promising application prospects in tumor therapy.

[0051] Example 2 LINC02609, a specific ASO, affects breast cancer cell proliferation and tumor growth. (1) Experimental methods RT-qPCR: RNA was extracted using the Trizol method and cDNA was obtained by reverse transcription using a reverse transcription kit.

[0052] The qPCR reaction was performed using 2×M5 HiPer SYBR Premix EsTaq, and the specific method is as follows: Take 1 µl of cDNA template (approximately 50 ng), add 0.75 µl each of forward and reverse primers, 7.5 µl of 2 × M5 HiPerSYBR Premix EsTaq, and 5 µl of RNase-Free H2O, for a total of 15 µl.

[0053] The reaction conditions are: Stage 1: Pre-denaturation cycle number: 1, 95℃ for 30 seconds; Stage 2: PCR reaction cycle number: 45, 95℃ for 5 seconds, 60℃ for 30 seconds.

[0054] Device used: LightCycler480 (Roche).

[0055] β-Actin was used as the internal reference, and the relative expression difference between the treatment group and the control group was analyzed using the 2-ΔΔCt method.

[0056] Cell proliferation assay (CCK-8 assay): Cells were seeded in 96-well plates, with technical replicates for each group. After 48 hours of culture, 10 µl of CCK-8 reagent (APExBIO) was added to each well, and the cells were incubated at 37°C for 1–4 hours. Cell proliferation capacity was evaluated by measuring absorbance at 450 nm using a microplate reader (TECANINFINITE E PLEX).

[0057] DNA replication activity assay (EdU method): EdU (Raybot, catalog number C10310-1) was diluted with complete culture medium and co-incubated with cells for 2 hours. Cells were fixed with 4% (w / w) paraformaldehyde at room temperature for 30 minutes, quenched with glycine, permeabilized with 0.5% Triton X-100, and then incubated with the reaction mixture in the dark for 30 minutes. Cell nuclei were counterstained with Hoechst 33342. Images of 3-5 fields of view were randomly acquired using an inverted fluorescence microscope, and the number of EdU-positive cells was quantitatively analyzed based on the fluorescence images to assess DNA replication activity.

[0058] Colony formation assay: Cells transfected with the ASOs (ASO Ctrl and ASO#1-2) described in this application were cultured at a final concentration of 1000 cells / well (6-well plate) in a 37°C, 5% CO2 incubator for 7-14 days. Cell growth was observed. When visible colonies appeared in the culture dish, the culture was terminated, the culture medium was discarded, and the cells were carefully washed twice with PBS. The cells were fixed with methanol for 15 minutes, the methanol was discarded, and the cells were air-dried. The cells were stained with 0.05% crystal violet for 10 minutes, the stain was slowly washed away with PBS, and the cells were dried. Cell counts were performed using ImageJ to compare differences in cell proliferation.

[0059] Comet assay: Spread 80 µl of 0.5% high-melting-point agarose preheated to 56°C evenly on a preheated slide as a base layer. Immediately cover with a coverslip to prevent air bubble formation and cure at 4°C for 10 minutes. After removing the coverslip, gently mix the cell suspension (1×10³ cells / 10 µl PBS) with 75 µl of 0.5% low-melting-point agarose preheated to 37°C, spread evenly on the base layer, cover with a new coverslip, and cure at 4°C for 10 minutes. Add 85 µl of 0.5% low-melting-point agarose (37°C) to form a third layer, cure at room temperature, and remove the coverslip. Immerse the slide completely in fresh, pre-cooled lysis buffer and incubate at 4°C for 1 hour. After gently rinsing twice with PBS, place horizontally in an electrophoresis tank containing fresh alkaline electrophoresis buffer and unwind at room temperature in the dark for 20 minutes, followed by electrophoresis at 25 V, 300 mA for 20 minutes in an ice bath. Finally, neutralize with Tris-HCl buffer (pH 7.5) for 15 minutes, stain with propidium iodide (20 µl / slide) for 10 minutes in the dark, rinse three times with ultrapure water, and analyze by fluorescence microscopy.

[0060] (2) Experimental results Experimental results are as follows Figures 2A to 2E As shown.

[0061] Among them, such as Figure 2A As shown, the LINC02609-specific ASOs in Example 1 can silence LINC02609 in a variety of breast cancer cell lines.

[0062] like Figure 2B , Figure 2C , Figure 2D As shown, LINC02609 silencing significantly inhibited cell proliferation, as detected by multiple methods including CCK8, EdU, and colony formation assays. Scale bar: 50 μm.

[0063] like Figure 2E As shown, the comet experiment further revealed that silencing LINC02609 resulted in significant DNA tailing, manifested as a smaller comet head and an elongated tail, while the control group cells showed very little tailing, indicating that their DNA integrity was maintained.

[0064] The above results indicate that LINC02609 plays an important role in maintaining tumor cell proliferation and genome stability.

[0065] Example 3 Effects of LINC02609-specific ASOs on cell migration ability (1) Experimental methods Scratch healing assay: Cells were seeded on both sides of an IBIDI culture-insert and cultured until confluence. The insert was then removed to create a standardized intercellular space. Cells were washed with PBS and cultured in serum-free medium. The closure of the intercellular space was recorded by photographing at 0 h and other predetermined time points. Cell migration ability was evaluated by analyzing changes in intercellular space width.

[0066] Cell migration assay: Cell migration was performed using Transwell chambers. An appropriate amount of cells were resuspended in serum-free medium and seeded in the upper chamber of the Transwell chamber. Serum-containing complete medium was added to the lower chamber as a chemokine. After a certain period of culture, unmigrated cells from the upper chamber were wiped off. Cells that migrated to the subcellular surface were fixed, stained, photographed under a microscope, and counted to assess cell migration ability.

[0067] (2) Experimental results To investigate whether LINC02609 regulates epithelial-mesenchymal transition (EMT), the IBIDI scratch healing assay and Transwell migration assay were used to assess cell migration ability. The experimental results are as follows: Figure 3A and Figure 3B As shown, ASOs treatment significantly reduced cell migration speed and number, meaning that ASOs significantly weakened cell migration ability. Figure 3A This indicates that the absence of LINC02609 inhibits wound closure. Figure 3B This indicates that LINC02609 deficiency inhibits cell migration. Experimental results were analyzed using a two-tailed t-validation.p Value < 0.001, ** p Value < 0.01, * p The value <0.05 indicates that the experimental results are statistically significant.

[0068] The above results indicate that silencing LINC02609 can significantly inhibit the migration ability of breast cancer cells.

[0069] Example 4 The effect of LINC02609 antisense oligonucleotide on the AKT signaling pathway.

[0070] (1) Experimental methods Immunofluorescence staining: Cells were seeded on culture dishes or slides and cultured to an appropriate density. After washing with PBS, they were fixed with 4% paraformaldehyde for 10–20 minutes, followed by permeabilization with 0.1%–0.5% Triton X-100 for 10 minutes. After washing with PBS, they were blocked with blocking buffer containing 5% bovine serum albumin (BSA) at room temperature for 30–60 minutes. Primary antibody (such as anti-AKT or anti-p-AKT antibody) was added and incubated overnight at 4°C. The next day, after washing, the corresponding fluorescently labeled secondary antibody was added and incubated at room temperature in the dark for 1 hour. After washing with PBS, the nuclei were stained with DAPI. Finally, images were acquired and analyzed using a fluorescence microscope.

[0071] (2) Experimental results The expression levels of AKT and its phosphorylated form (p-AKT) were detected by immunofluorescence staining. The results are as follows: Figure 4 As shown, compared with the control group, intracellular p-AKT fluorescence signal was significantly weakened after treatment with LINC02609-specific ASOs, while the total AKT level did not change significantly. Scale bar is 20 μm.

[0072] The above results indicate that silencing LINC02609 can inhibit the activation state of the AKT signaling pathway, thereby participating in the regulation of tumor cell-related biological behaviors.

[0073] Example 5 Effects of LINC02609-specific ASOs on glycolytic metabolism We further investigated whether LINC02609 regulates glycolysis in breast cancer. Western blot analysis revealed that silencing LINC02609 significantly inhibited the expression of glycolytic kinase PFKFB3 and weakened glycolytic activity.

[0074] (1) Experimental methods Extracellular acidification rate (ECAR): Cellular metabolic activity was assessed using a Seahorse XF extracellular flux analyzer (Agilent Technologies). Cells were seeded at optimized density in Seahorse XF cell culture microplates and allowed to adhere overnight. Before analysis, cells were washed and incubated with Seahorse XF assay medium (supplemented with glucose, glutamine, and / or sodium pyruvate as designed) and equilibrated at 37°C in a CO2-free incubator for 1 hour. Extracellular acidification rates were measured under basal conditions and after continuous injection of mitochondrial stress test compounds, according to the manufacturer's instructions. Data were normalized to cell number or protein content and analyzed using Wave software.

[0075] (2) Experimental results The protein expression level of PFKFB3, a key enzyme in glycolysis, was detected by Western blot, and the extracellular acidification rate was measured using the Seahorse energy metabolism analysis system to assess glycolytic activity.

[0076] The results are as follows Figure 5A As shown, silencing LINC02609 downregulates PFKFB3 protein expression. Compared with the control group, PFKFB3 protein expression was significantly downregulated after treatment with LINC02609-specific ASOs (see figure).

[0077] at the same time, Figure 5B As shown, Seahorse metabolic analysis revealed that LINC02609 deficiency inhibited ECAR activity. The significantly reduced ECAR levels suggest that cellular glycolysis flux was suppressed.

[0078] The above results indicate that silencing LINC02609 can inhibit glycolytic metabolism in breast cancer cells, suggesting that LINC02609 plays an important regulatory role in tumor metabolic reprogramming.

[0079] Example 6 Efficacy evaluation of LINC02609 specific ASOs in vivo for the treatment of breast cancer metastases To evaluate the in vivo therapeutic effect of LINC02609-specific ASOs, we established a mouse model of breast cancer lung metastasis.

[0080] (1) Experimental scheme Mouse experimental protocol: Female NOD / SCID mice aged 4–6 weeks were randomly assigned to groups. A lung metastasis model was established by tail vein injection of breast cancer cells (e.g., MDA-MB-231-luc). Following modeling, mice were treated with LINC02609-specific ASOs dissolved in physiological saline via intraperitoneal injection at a dose of 20 mg / kg, administered twice weekly.

[0081] Mice body weight was monitored regularly during the experiment, and tumor burden changes were detected using a small animal in vivo imaging system (IVIS). Mice were euthanized via cervical dislocation when predetermined termination points were reached (including rapid weight loss >20%, abnormal weight gain due to ascites >20%, or signs of respiratory distress). Lung tissue was harvested for metastatic nodule counting and histological analysis (including HE staining and Ki-67 immunohistochemistry) to evaluate the in vivo antitumor and antimetastatic effects of ASOs.

[0082] (2) Experimental results Evaluation of the in vivo antitumor effects of LINC02609-specific ASOs in a mouse model of lung metastasis of breast cancer.

[0083] The results are as follows Figures 6A to 6F As shown.

[0084] See Figure 6A and Figure 6B Compared with the control group, the in vivo fluorescence signal of mice treated with ASOs was significantly reduced, indicating a significant reduction in tumor burden.

[0085] Further analysis of lung tissue revealed representative photographs of lung tissue obtained from the control and ASO groups of mice. See details below. Figure 6C The black arrows indicate metastatic nodules, showing that the number of lung metastatic nodules in the ASOs-treated group of mice was significantly reduced.

[0086] See Figure 6D This data represents longitudinal monitoring of mouse body weight during treatment. Throughout the experiment, the body weight of mice in each group remained stable, indicating that the treatment did not cause significant systemic toxicity.

[0087] See Figure 6E Representative images of H&E staining and Ki-67 immunohistochemical staining of mouse lung and liver tissues after different treatments (control group n=5, LINC02609 ASO group n=6). Figure 6F This is a quantitative analysis of Ki-67 positive cells in mouse lung and liver tissues. Statistical significance was determined using a two-tailed Student's t-test: *** p Value < 0.001, ** p Value < 0.01, * p Value <0.05. Histological analysis showed that the proliferation of tumor cells in the lung and liver tissues of the ASOs treatment group was significantly inhibited, and the proportion of Ki-67 positive cells was significantly reduced, indicating that ASOs effectively inhibited tumor cell proliferation.

[0088] The above results indicate that antisense oligonucleotides targeting LINC02609 can effectively inhibit the metastasis and progression of breast cancer in vivo and have good safety.

[0089] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An antisense oligonucleotide, characterized in that, The antisense oligonucleotide can bind specifically to the transcribed sequence of the LINC02609 gene; The antisense oligonucleotide is selected from at least one of the following: (1) A nucleotide sequence that is ≥90% complementary to the sequence GGGTCACAACTGGGAGAAAC; (2) Nucleotide sequences that are ≥90% complementary to the sequence ACCAGCAAAAGAGGCAGACG; (3) Nucleotide sequences that are ≥90% complementary to the sequence TCTTCACTCCAAATTGTCCC.

2. The antisense oligonucleotide as described in claim 1, characterized in that, The antisense oligonucleotide is 15-25 nucleotides in length.

3. The antisense oligonucleotide as described in claim 1 or 2, characterized in that, The antisense oligonucleotide comprises at least one of the following sequences: LINC02609 ASO#1: 5'-GTTTCTCCCAGTTGTGACCC-3'; LINC02609 ASO#2: 5'-CGTCTGCCTCTTTTGCTGGT-3'; LINC02609 ASO#3: 5'-GGGACAATTTGGAGTGAAGA-3'.

4. The antisense oligonucleotide as described in claim 1 or 2, characterized in that, The antisense oligonucleotide contains one or more chemical modifications.

5. The antisense oligonucleotide as described in claim 4, characterized in that, The chemical modification is selected from at least one of the following: locked nucleic acid modification, thiophosphate modification, or 2'-position modification.

6. The use of the antisense oligonucleotide as described in any one of claims 1-5 in the preparation of antitumor drugs.

7. The application as described in claim 6, characterized in that, The tumor is breast cancer.

8. The application as described in claim 6 or 7, characterized in that, The drug is a drug that inhibits the proliferation of tumor cells.

9. The application as described in claim 6 or 7, characterized in that, The drug is used to inhibit the migration or metastasis of tumor cells.

10. The application as described in claim 6 or 7, characterized in that, The drug is used to reverse drug-resistant subtypes of tumor cells.