A method for changing the thickness of fiber cell walls and the lignin content of poplar wood tissue and applications

Abstract

The present application relates to a method and application for changing the fiber cell wall thickness and lignin content of poplar wood tissue, and belongs to the technical field of plant molecular breeding; the steps are as follows: S1: cloning of the genomic sequence and coding sequence of PtoMYB10; S2: screening of PtoMYB10 target site knockout and vector construction; S3: creation of PtoMYB10 knockout mutants. The method and application for changing the fiber cell wall thickness and lignin content of poplar wood tissue of the present application, by knocking out the PtoMYB10 gene of poplar, the mutant plants show higher growth vigor, compared with the wild type, the plant height and ground diameter are not inhibited by growth; the mutant plants show significantly reduced xylem fiber cell wall thickness; the mutant plants do not show significant changes in vessel cell wall thickness, the vessels maintain normal morphology without collapse; histological staining shows that the lignin content in the xylem of the mutant plants is reduced; the present application provides a genetic resource for molecular genetic improvement of forest trees oriented towards wood biomass development and utilization.

Description

Technical Field

[0001] This invention relates to a method and application for altering the cell wall thickness and lignin content of poplar wood tissue fibers, belonging to the field of plant molecular breeding technology. Background Technology

[0002] Trees, through photosynthesis, assimilate vast amounts of inorganic carbon into organic matter, which is then fixed in the secondary cell walls of wood, forming the largest renewable carbohydrate resource pool on Earth. The secondary cell walls of wood are rich in polysaccharides such as cellulose, which can be converted into clean fuels like ethanol through biorefining processes, becoming an organic biomass resource to replace fossil fuels. In addition to polysaccharides like cellulose, the secondary cell walls of wood also contain a large amount of lignin. As an aromatic polymer, lignin can prevent the breakdown of cell wall polysaccharides into monosaccharide molecules, thus limiting the efficient conversion of wood biomass.

[0003] To improve the processing performance of wood, numerous studies have focused on reducing the lignin content. However, reducing lignin content often leads to thinning and collapse of vessel walls, thereby impairing the vessel's ability to transport water and nutrients, ultimately limiting plant growth and reducing biomass yield. How to reduce the lignin content in wood without affecting plant biomass yield is a key challenge in cultivating new forest tree germplasm that meets the needs of industrial development.

[0004] Therefore, a method for altering the cell wall thickness and lignin content of poplar wood tissue fibers is provided (a method for reducing the cell wall thickness and lignin content of poplar wood fibers). By knocking out the poplar PtoMYB10 gene, the mutant plants exhibited higher growth vigor, and compared with the wild type, plant height and ground diameter were not inhibited. The mutant plants showed a significantly reduced xylem cell wall thickness. No significant changes were detected in the vessel cell wall thickness of the mutant plants, and the vessels maintained normal morphology without collapse. Histochemical staining showed that the lignin content in the xylem of the mutant plants was reduced, thus achieving the alteration of wood tissue cell wall thickness and lignin content, providing gene resources for forestry molecular genetic improvement guided by the development and utilization of wood biomass. Summary of the Invention

[0005] The purpose of this invention is to provide a method for altering the thickness of xylem fiber cell walls and lignin content in poplar wood tissue. By knocking out the PtoMYB10 gene, the mutant plants exhibit higher growth vigor, with no growth inhibition on plant height and diameter at ground level. The mutant plants show a significantly reduced thickness of xylem fiber cell walls. No significant changes were detected in the thickness of vessel cell walls in the mutant plants, and the vessels maintained their normal morphology without collapse. Histochemical staining showed a reduced lignin content in the xylem of the mutant plants, thus achieving changes in the thickness of xylem fiber cell walls and lignin content in wood tissue, providing gene resources for the molecular genetic improvement of forest trees guided by the development and utilization of wood biomass.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] A method for altering the cell wall thickness and lignin content of poplar wood tissue includes the following steps:

[0008] S1: Cloning of the PtoMYB10 genome and coding sequences

[0009] Using stem tissue of Populus alba L. × (P. davidiana Dode + P. simonii Carr.) × P. tomentosa Carr. as material, genomic DNA and total RNA were extracted, and the total RNA was reverse transcribed into cDNA. Using genomic DNA and cDNA as templates, respectively, the genomic sequence and coding sequence of PtoMYB10 were amplified using specific primers.

[0010] S2: Screening and vector construction for knocking out PtoMYB10 target sites

[0011] The obtained PtoMYB10 genome sequence was input into the online tool CRISPRdirect (http: / / crispr.dbcls.jp / ) to identify potential Cas9 target sites for PtoMYB10 knockout; for the two candidate target sites, gene knockout vectors were constructed through steps such as target site adapter preparation and gRNA expression cassette preparation.

[0012] S3: Creation of the PtoMYB10 knockout mutant

[0013] The gene editing vector constructed in S2 was transformed into Agrobacterium EHA105, and then transformed into Populus 741 using Agrobacterium-mediated leaf disc transformation to obtain PtoMYB10 knockout mutant candidate plants.

[0014] Preferably, S1 is as follows:

[0015] Genomic DNA and total RNA were extracted from stem tissue of Populus 741, and the total RNA was reverse transcribed into cDNA. Using genomic DNA and cDNA as templates, the genomic and coding sequences of PtoMYB10 were amplified using specific primers 5'-TTCTTGCCTCGCATCTCC-3' (MYB10-CL1) and 5'-GGGGCAGTTTTCACCATC-3' (MYB10-CL2), respectively. The PCR amplification products were separated by agarose gel electrophoresis, and the target fragments were recovered using a DNA rapid recovery / purification kit (Beijing Dingguo Changsheng Biotechnology Co., Ltd.). The purified DNA fragments were ligated into the pEASY-Blunt vector (TransGold, Beijing), and the ligation product was transformed into Escherichia coli DH10b. Single clones were selected for sequencing analysis after antibiotic resistance to obtain the genomic and coding sequences of PtoMYB10.

[0016] Preferably, the vector construction process in S2 is as follows:

[0017] 1) Target site adapter preparation: Based on the sequence of target site 1 (TCAACTTCTCCAACCATAAC), adapter primers were designed: MYB10-U6-29-F: 5'-ATTGTTATGGTTGGAGAAGTTGA-3'; MYB10-U6-29-R: 5'-AAACTCAACTTCTCCAACCATAA-3'; the adapter primers were dissolved in TE solution to prepare a stock solution, which was then added to 0.5×TE solution and mixed. The mixture was then incubated at high temperature. 1) Annealing at room temperature to form target site adapter 1; Based on the sequence of target site 2 (GATTCGGCAAGCTTGAACAT), adapter primers were designed: MYB10-AtU3d-F: 5'-GTCATGTTCAAGCTTGCCGAATC-3' and MYB10-AtU3d-R: 5'-AAACGATTCGGCAAGCTTGAACA-3'. The preparation method of target site adapter 2 is the same as that of target site adapter 1; 2) gRNA expression cassette preparation: pYLsgRNA-AtU6-29 and pYLsgRNA-AtU3d / LacZ vectors were digested with Bsa I; gRNA expression cassettes were amplified by nested PCR; 3) Ligation of gRNA expression cassettes with pYLCRISPR / Cas9 vector: pYLCRISPR / Cas9 vector was digested with Bsa I, and the gRNA expression cassettes (⑤ and ⑥) obtained in step 2) were cloned into pYLCRISPR / Cas9 vector using homologous recombination to obtain gene editing vector.

[0018] Preferably, in step 2), the enzyme digestion system is as follows: plasmid, 1 μg; 10×CutSmart Buffer, 5 μl; Bsa I, 10 units; Nuclease-free Water added to 50 μl; enzyme digestion reaction conditions are: 37℃, 30 min; 70℃, 5 min; using T4 DNA ligase, target site adapter 1 and target site adapter 2 are ligated to the enzyme-digested vectors pYLsgRNA-AtU6-29 and pYLsgRNA-AtU3d / LacZ, respectively. The ligation system is as follows: plasmid, 0.5 μl; adapter, 1 μl; enzyme, 0.5 μl; 10×T4 DNA ligase buffer, 1 μl; ddH2O added to 10 μl; ligation reaction conditions: room temperature, 30 min.

[0019] Preferably, in step 2), the specific steps for amplifying the gRNA expression cassette using nested PCR are as follows:

[0020] a. Using the ligation product of the pYLsgRNA-AtU3d / LacZ vector as a template, the first round of PCR amplification was performed using primer combinations UF / MYB10-AtU3d-R and MYB10-AtU3d-F / gRNA-R, respectively, to obtain PCR products, which were labeled as ① and ②, respectively. Using the ligation product of the pYLsgRNA-AtU6-29 vector as a template, the first round of PCR amplification was performed using primer combinations UF / MYB10-U6-29-R and MYB10-U6-29-F / gRNA-R, respectively, to obtain PCR products, which were labeled as ③ and ④, respectively. The primer sequences were: UF: 5'-CTCCGTTTTACCTGTGGAATCG-3'; gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'.

[0021] b. Dilute PCR products ① and ② from a 10-fold ratio, take 1 μl of each and mix them as templates. Use the primer combination CAS9-F / CAS9-3d-R to perform PCR amplification and obtain PCR products, labeled as ⑤. Dilute PCR products ③ and ④ from a 10-fold ratio, take 1 μl of each and mix them as templates. Use the primer combination CAS9-U6-29-F / CAS9-R to perform PCR amplification and obtain PCR products, labeled as ⑥. ⑤ and ⑥ are the prepared gRNA expression cassettes.

[0022] Preferably, the specific genetic transformation steps described in S3 are as follows:

[0023] The first step is to infect the leaf disc with Agrobacterium carrying recombinant plasmids for 10-15 minutes. The second step is to transfer the leaf disc to CM1 medium and incubate it in the dark for two days. The third step is to transfer the leaf disc to CM2 medium to induce callus formation, changing the medium every 10-14 days. The fourth step is to transfer the leaf disc to CM3 medium when visible yellow or white callus granules are formed on the edge of the leaf disc to induce adventitious bud differentiation. The fifth step is to cut off the adventitious buds when they grow to about 2 cm in height and plant them on CM4 medium for rooting culture.

[0024] Preferably, the components of the CM1-CM4 culture media in S3 are as follows: CM1: WPM 2.41g / L + sucrose 30g / L + AS 100μmol / L + NAA 1mg / L + ZT 2mg / L + agar powder 6g / L; CM2: WPM 2.41g / L + sucrose 30g / L + NAA 1mg / L + ZT 2mg / L + Cef 400mg / L + Hyg 10mg / L + agar powder 6g / L; CM3: WPM 2.41g / L + sucrose 30g / L + NAA 0.1mg / L + ZT 2mg / L + Cef 400mg / L + Hyg 10mg / L + agar powder 6g / L; CM4: WPM 2.41g / L + sucrose 30g / L + NAA 0.1mg / L + Cef 400mg / L + Hyg 10mg / L + Agar powder 6g / L.

[0025] Preferably, the method further includes the following steps:

[0026] S4: Using the genomic DNA of the transgenic plant as a template, the genomic sequence at the target site was amplified using primers myb10-JC1 and myb10-JC2 (see Table 6 below). The mutation at the target site was identified by high-throughput sequencing of the PCR products. Two biallelic mutants, ptomyb10 (L243) and ptomyb10 (L248), were identified.

[0027] Preferably, the nucleotide sequence of the primer myb10-JC1 is shown in SEQ ID NO.18.

[0028] Preferably, the nucleotide sequence of the primer myb10-JC2 is shown in SEQ ID NO.19.

[0029] The application of the PtoMYB10 gene as a target gene in poplar breeding, the nucleotide sequence of the PtoMYB10 gene is shown in SEQ ID NO.3; the cDNA sequence of the PtoMYB10 gene is shown in SEQ ID NO.4.

[0030] Preferably, the target gene has two target sites, wherein the nucleotide sequence of target site 1 is shown in SEQ ID NO.6; and the nucleotide sequence of target site 2 is shown in SEQ ID NO.7.

[0031] Preferably, the nucleotide sequence of the adapter primer for target site 1, MYB10-U6-29-F, is shown in SEQ ID NO. 8; the nucleotide sequence of MYB10-U6-29-R is shown in SEQ ID NO. 9; the nucleotide sequence of the adapter primer for target site 2, MYB10-AtU3d-F, is shown in SEQ ID NO. 10; the nucleotide sequence of MYB10-AtU3d-R is shown in SEQ ID NO. 11.

[0032] Another objective of this invention is to provide the application of the above-described method for altering the cell wall thickness and lignin content of poplar wood tissue in poplar breeding.

[0033] To achieve the above objectives, the present invention provides the following technical solution:

[0034] Application of methods to alter the cell wall thickness and lignin content of poplar wood tissue in poplar breeding.

[0035] Preferably, the specific steps are as follows: a poplar PtoMYB10 gene knockout mutant is obtained through gene editing technology, the growth of the mutant plant is measured, including plant height and ground diameter, and the lignin content in the wood tissue of the mutant plant is measured. Mutants with large growth and low lignin content are screened as superior strains for new variety breeding.

[0036] The beneficial effects of this invention are as follows:

[0037] The present invention describes a method for altering the thickness of fiber cell walls and lignin content in poplar wood tissue. By knocking out the transcription factor PtoMYB10, which is related to the development of secondary cell walls, through gene editing technology, the thickness of fiber cell walls and lignin content in wood tissue can be significantly reduced. The thickness of vessel cell walls remains unchanged and maintains normal morphology. The mutant plants maintain high growth vigor, and the growth of plant height and diameter at ground level is not inhibited, providing excellent germplasm for the cultivation of superior forest tree varieties.

[0038] The present invention will be further described below with reference to specific embodiments and accompanying drawings, but this does not imply any limitation on the scope of protection of the present invention. Attached Figure Description

[0039] Figure 1 Identification of the poplar PtoMYB10 knockout mutant in Example 1 of this invention;

[0040] Figure 2The morphological characteristics of the poplar PtoMYB10 knockout mutant in Example 1 of this invention;

[0041] Figure 3 Anatomical analysis of the wood of the poplar PtoMYB10 knockout mutant in Example 1 of this invention;

[0042] Figure 4 Chemical staining of wood tissue of poplar PtoMYB10 knockout mutant in Example 1 of this invention. Detailed Implementation

[0043] The present invention will be further described below with reference to specific embodiments. Operations not described in detail in the following embodiments can be performed by referring to the instructions for use of molecular cloning related reagent kits.

[0044] Unless otherwise specified, the reagents involved in the following examples are all commercially available conventional reagents, and the methods used are all methods commonly used in this technical field.

[0045] The routine experimental procedures used in the examples are as follows:

[0046] 1. DNA extraction

[0047] Poplar genomic DNA was extracted using the DNAsecure Plant Kit (Tiangen, Beijing). The specific operating steps were performed according to the instruction manual.

[0048] 2. Extraction of total RNA

[0049] Total RNA extraction from poplar trees was performed using the RNAprep Pure Plant Kit (Tiangen, Beijing), with specific operating procedures following the instructions.

[0050] 3. PCR amplification of DNA fragments

[0051] PCR amplification was performed using ExTaq enzyme or GoldMix. The amplification system and procedure are as follows:

[0052] ExTaq amplification system: 10×ExTaq Reaction Buffer: 2.0 μl;

[0053] dNTP (2.5mM): 2.0μl;

[0054] Forward Primer (2.0mM): 2.0μl;

[0055] Reverse Primer (2.0mM): 2.0μl;

[0056] Template (genomic DNA or cDNA): 1 μl;

[0057] ExTaq polymerase (5U / μl): 0.1μl;

[0058] Add ddH2O to 20 μl;

[0059] Amplification program: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 sec, 55-58℃ annealing for 30 sec, 72℃ extension for 1.5 min, 35 cycles; 72℃ extension for 10 min; 15℃, 30 sec.

[0060] Gold Mix amplification system: Gold Mix (green): 22 μl;

[0061] Forward Primer (2.0mM): 1.0μl;

[0062] Reverse Primer (2.0mM): 1.0μl;

[0063] Template (genomic DNA or cDNA): 1.0 μl;

[0064] Amplification program: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 sec, 55-58℃ annealing for 10 sec, 72℃ extension for 0.5-1.5 min, 35 cycles; 72℃ extension for 5 min; 15℃, 30 sec;

[0065] 4. DNA fragment recovery, ligation, and cloning

[0066] The target DNA fragment was recovered from the PCR amplification product using a DNA rapid recovery / purification kit (Beijing Dingguo Changsheng Biotechnology Co., Ltd.). Detailed steps are described in the instruction manual. The DNA fragment was cloned using the pEASY-Blunt vector (TransGold, Beijing). The reaction system and conditions were as follows: PCR product, 4 μl; pEASY-Blunt vector, 1 μl; reaction at room temperature for 5 min. The ligation product was transformed into E. coli DH10b. After antibiotic selection, single clones were selected and sent to Qingke Biotechnology Co., Ltd. for sequencing.

[0067] Example 1

[0068] S1: Cloning of the genomic and coding sequences of PtoMYB10

[0069] Genomic DNA was extracted from stem tissue of Populus alba L. × (P. davidiana Dode + P. simonii Carr.) × P. tomentosa Carr. Using the genomic DNA as a template, the genomic sequence of PtoMYB10 was amplified using specific primers 5'-TTCTTGCCTCGCATCTCC-3' (MYB10-CL1) and 5'-GGGGCAGTTTTCACCATC-3' (MYB10-CL2). Total DNA was extracted from the stem tissue of Populus alba L. × (P. davidiana Dode + P. simonii Carr.) × P. tomentosa Carr. RNA was reverse transcribed into cDNA. Using cDNA as a template, the coding sequence of PtoMYB10 was amplified using specific primers 5'-TTCTTGCCTCGCATCTCC-3' (MYB10-CL1) and 5'-GGGGCAGTTTTCACCATC-3' (MYB10-CL2). The PCR amplification products were separated by agarose gel electrophoresis. The target fragment was recovered using a DNA rapid recovery / purification kit (Beijing Dingguo Changsheng Biotechnology Co., Ltd.). The purified DNA fragment was ligated into the pEASY-Blunt vector (TransGold, Beijing). The ligation product was transformed into E. coli DH10b. Single clones were selected for sequencing analysis after antibiotic resistance screening to obtain the genomic sequence and coding sequence of PtoMYB10 (Tables 2-4).

[0070] Table 1

[0071] sequence name sequence MYB10-CL1 (SEQ ID NO.1) 5'-TTCTTGCCTCGCATCTCC-3' MYB10-CL2 (SEQ ID NO.2) 5'-GGGGCAGTTTTCACCATC-3'

[0072] Table 2

[0073]

[0074]

[0075] Table 3

[0076]

[0077] Table 4

[0078]

[0079] S2: Screening and vector construction for knocking out PtoMYB10 target sites

[0080] The obtained PtoMYB10 genome sequence was input into the online tool CRISPRdirect (http: / / crispr.dbcls.jp / ) to identify potential Cas9 target sites for knocking out PtoMYB10. Two candidate targets were screened, and their sequences are shown in Table 5.

[0081] Table 5

[0082] sequence name sequence Target site 1 (SEQ ID NO.6) TCAACTTCTCCAACCATAAC Target site 2 (SEQ ID NO.7) GATTCGGCAAGCTTGAACAT

[0083] Gene knockout vectors were constructed for the two selected candidate targets. The vector construction process is as follows:

[0084] 1) Preparation of target site adapter: Based on the sequence of target site 1 (SEQ ID NO.6), adapter primers were designed: MYB10-U6-29-F (SEQ ID NO.8); MYB10-U6-29-R (SEQ ID NO.9); The adapter primers were dissolved in TE solution to prepare a 100 μM stock solution, and 1 μl of each was added to 98 μl of 0.5×TE solution. 25 μl of the mixture was then incubated at 90 °C for 30 s, and then transferred to room temperature for annealing to form target site adapter 1;

[0085] Based on the sequence of target site 2 (SEQ ID NO.7), adapter primers were designed: MYB10-AtU3d-F (SEQ ID NO.10) and MYB10-AtU3d-R (SEQ ID NO.11); the preparation method of target site adapter 2 is the same as that of target site adapter 1;

[0086] Table 5

[0087] sequence name sequence MYB10-U6-29-F (SEQ ID NO.8) 5'-ATTGTTATGGTTGGAGAAGTTGA-3' MYB10-U6-29-R (SEQ ID NO.9) 5'-AAACTCAACTTCTCCAACCATAA-3' MYB10-AtU3d-F (SEQ ID NO.10) 5'-GTCATGTTCAAGCTTGCCGAATC-3' MYB10-AtU3d-R (SEQ ID NO.11) 5'-AAACGATTCGGCAAGCTTGAACA-3'

[0088] 2) gRNA expression cassette preparation: pYLsgRNA-AtU6-29 and pYLsgRNA-AtU3d / LacZ vectors were digested with BsaI. The digestion system was: plasmid, 1 μg; 10×CutSmart Buffer, 5 μl; BsaI, 10 units; Nuclease-free Water added to 50 μl. The digestion conditions were: 37℃, 30 min; 70℃, 5 min. Target site adapter 1 and target site adapter 2 were ligated to the digested vectors pYLsgRNA-AtU6-29 and pYLsgRNA-AtU3d / LacZ using T4 DNA ligase. The ligation system was: plasmid, 0.5 μl; adapter, 1 μl; enzyme, 0.5 μl; 10×T4 DNA ligase buffer, 1 μl; ddH2O added to 10 μl. The ligation conditions were: room temperature, 30 min.

[0089] The gRNA expression cassette was amplified by nested PCR, and the steps are as follows:

[0090] a. Using the ligation product of the pYLsgRNA-AtU3d / LacZ vector as a template, the first round of PCR amplification was performed using primer combinations UF / MYB10-AtU3d-R and MYB10-AtU3d-F / gRNA-R, respectively, to obtain PCR products, which were labeled as ① and ②, respectively. Using the ligation product of the pYLsgRNA-AtU6-29 vector as a template, the first round of PCR amplification was performed using primer combinations UF / MYB10-U6-29-R and MYB10-U6-29-F / gRNA-R, respectively, to obtain PCR products, which were labeled as ③ and ④, respectively. The primer sequences are UF (SEQ ID NO.12) and gRNA-R (SEQ ID NO.13).

[0091] b. Dilute PCR products ① and ② from a 10-fold ratio, take 1 μl of each and mix them as templates. Use the primer combination CAS9-F / CAS9-3d-R for PCR amplification to obtain PCR products, labeled as ⑤. Dilute PCR products ③ and ④ from a 10-fold ratio, take 1 μl of each and mix them as templates. Use the primer combination CAS9-U6-29-F / CAS9-R for PCR amplification to obtain PCR products, labeled as ⑥. ⑤ and ⑥ are the prepared gRNA expression cassettes. Primer sequences are shown in Table 6 below.

[0092] Table 6

[0093]

[0094] 3) Ligation of the gRNA expression cassette with the pYLCRISPR / Cas9 vector:

[0095] The pYLCRISPR / Cas9 vector was digested with Bsa I enzyme, and the gRNA expression cassettes (⑤ and ⑥) obtained in step 2) were cloned into the pYLCRISPR / Cas9 vector using homologous recombination to obtain the gene editing vector.

[0096] S3: Creation of the PtoMYB10 knockout mutant

[0097] The gene editing vector constructed in S2 was transformed into Agrobacterium EHA105, and then transformed into Populus 741 by Agrobacterium-mediated leaf disc transformation to obtain PtoMYB10 knockout mutant candidate plants.

[0098] The specific genetic transformation steps are as follows: First, the leaf discs are infected with Agrobacterium carrying recombinant plasmids for 10-15 minutes; second, the leaf discs are transferred to CM1 medium and cultured in the dark for two days; third, the leaf discs are transferred to CM2 medium to induce callus formation, with the medium being replaced every 10-14 days; fourth, when visible yellow or white callus granules appear on the edge of the leaf disc, the leaf disc is transferred to CM3 medium to induce adventitious bud differentiation; fifth, when the adventitious buds grow to about 2 cm in height, they are cut off and planted on CM4 medium for rooting culture; the composition of CM1-CM4 medium is as follows: CM1: WPM 2.41 g / L + sucrose 30 g / L + AS 100 μmol / L + NAA 1 mg / L + ZT 2 mg / L + agar powder 6 g / L; CM2: WPM 2.41 g / L + sucrose 30 g / L + NAA 1 mg / L + ZT 2 mg / L + Cef CM3: WPM 2.41g / L + sucrose 30g / L + NAA 0.1mg / L + ZT 2mg / L + Cef 400mg / L + Hyg 10mg / L + agar powder 6g / L; CM4: WPM 2.41g / L + sucrose 30g / L + NAA 0.1mg / L + Cef 400mg / L + Hyg 10mg / L + agar powder 6g / L; where AS, NAA, ZT, Cef, and Hyg are abbreviations for acetosyringone, 1-naphthaleneacetic acid, zeatin, cefotaxime, and hygromycin, respectively.

[0099] Using the genomic DNA of transgenic plants as a template, the genomic sequence at the target site was amplified using primers myb10-JC1 and myb10-JC2 (see Table 7 below). The mutation at the target site was identified by high-throughput sequencing of the PCR products. This invention identified two biallelic mutants, ptomyb10(L243) and ptomyb10(L248). Figure 1 In both mutants, an insertion or deletion of 1-2 bases occurs at target site 1, which leads to premature termination of protein coding; sequence alignment shows the mutant forms of PtoMYB10, with "+" or "-" numbers indicating the number of inserted or deleted bases;

[0100] Table 7

[0101] sequence name sequence myb10-JC1 (SEQ ID NO.18) 5'-ACTATTGGAACTCTTGGATTAAAAAGAAGATA-3' myb10-JC2 (SEQ ID NO.19) 5'-GTGCTGGTTTGAGTTCCATGTTTC-3'

[0102] S4: Phenotypic and wood anatomy analysis of PtoMYB10 knockout mutants

[0103] PtoMYB10 knockout mutants (ptomyb10(L243) and ptomyb10(L248)) and wild-type plants were cultured in an artificial climate chamber with a photoperiod of 14 / 10-h light / dark, a light intensity of 4500 lux, and a temperature of 25℃. After 8 weeks of culture, the plant height, ground diameter, and number of internodes of wild-type and mutant plants were measured. Compared with wild-type plants, ptomyb10(L248) showed significantly increased plant height and ground diameter. Figure 2 In the middle (a), plant height and ground diameter increased by 18.5% and 39.6%, respectively. Figure 2 Compared with the wild type, ptomyb10(L243) showed no significant difference in plant height and ground diameter; the number of internodes in ptomyb10(L243) and ptomyb10(L248) was significantly increased compared with the wild type. Figure 2 b) ; such as Figure 2 As shown, the morphological characteristics of the poplar PtoMYB10 knockout mutant in Example 1 of the present invention are shown, where (a) is the phenotype of the PtoMYB10 knockout mutant; (b) is the plant height, stem diameter and number of internodes of wild-type and mutant plants. t-test: *, P<0.05; **, P<0.01;

[0104] This invention further includes anatomical analysis of the wood tissues of wild-type and mutant plants:

[0105] Internode tissues from the same location in wild-type and mutant plants (ptomyb10(L243) and ptomyb10(L248)) were selected and ultrathin resin sections were prepared. The section preparation process is as follows:

[0106] 1) Using a pre-cooled double-edged blade, the internodes are transversely cut into stem segments 0.5cm thick. The segments are then quickly placed in a pre-cooled fixative solution containing 3% glutaraldehyde and 0.1M PB (pH 7.2). In the fixative solution, the stem segments are transversely divided into thin slices 2-3mm thick. The segments are then placed in a vacuum pump for vacuum treatment, during which the fixative solution is replaced 2-3 times.

[0107] 2) Rinse the sample 3-4 times with 0.1M PB solution, about 30 minutes each time, and then fix with 1% osmium tetroxide for 2 hours;

[0108] 3) Rinse the sample thoroughly with 0.1M PB solution, and then dehydrate the sample using a gradient of ethanol (30%, 50%, 70%, 80%, 95%, 100%, 100%).

[0109] 4) Replace the ethanol in the sample sequentially with an ethanol / acetone (1:1, v / v) solution and a pure acetone solution, each step lasting at least 30 minutes;

[0110] 5) Soak the sample in acetone / resin solutions of 3:1, 1:1 and 1:3 (v / v) for 4 hours in sequence, and then soak it in pure resin for 8 hours.

[0111] 6) The samples were embedded in pure resin and polymerized at 60℃ for more than 24 hours. The embedded blocks were then sliced ​​using a Leica microtome to a thickness of 70 nm. The prepared ultrathin sections were observed under an HT7700 transmission electron microscope to examine the morphology of the wood cell walls. Compared with wild-type plants, the thickness of the wood fiber cell walls in the ptomyb10(L243) and ptomyb10(L248) mutant plants decreased by 22% and 35%, respectively. The thickness of the vessel cell walls did not differ significantly from that of the wild type, and the vessel cells maintained normal morphology. Figure 3 The image shows the anatomical analysis of the poplar PtoMYB10 knockout mutant wood in Example 1 of this invention; where (a) is a transmission electron microscope image of the xylem fiber cell wall and vessel cell wall of wild-type and mutant plants; (b) is a statistical analysis of the thickness of the xylem fiber cell wall and vessel cell wall of wild-type and mutant plants; Mann-Whitney test: **, P<0.01;

[0112] S5: PtoMYB10 knockout mutant wood histochemical staining

[0113] This invention further analyzed the changes in lignin content in wood tissues of PtoMYB10 knockout mutants using histochemical staining:

[0114] The 7th internode of wild-type and mutant plants (ptomyb10(L243) and ptomyb10(L248)) was selected. Using a Leica VT1200S microtome, the stem segments were transversely cut into 35 μm thick sections. These sections were immersed in 2% (w / v) phloroglucinol for 1 min, followed by immersion in 30% (v / v) hydrochloric acid for 45 s. Microscopic observation and image capture were performed using a Zeiss Axio Imager A1microscopy microscope. Compared with the wild type, the xylem (developing xylem and mature xylem) staining intensity of ptomyb10(L243) and ptomyb10(L248) was weakened, indicating that the lignin content in the wood of the mutant plants was lower than that of the wild type. Figure 4 The image shows histochemical staining of the wood tissue of the poplar PtoMYB10 knockout mutant in Example 1 of this invention; wherein, the α, α' and α” regions are developing xylem, and the β, β' and β” regions are mature xylem.

[0115] The present invention relates to a method for altering the cell wall thickness and lignin content of poplar wood tissue fibers (a method for reducing the cell wall thickness and lignin content of poplar wood fibers). By knocking out the poplar PtoMYB10 gene, the mutant plants exhibit higher growth vigor, and compared with the wild type, plant height and ground diameter are not inhibited. The mutant plants show a significantly reduced xylem fiber cell wall thickness. No significant changes were detected in the vessel cell wall thickness of the mutant plants, and the vessels maintained normal morphology without collapse. Histochemical staining showed that the lignin content in the xylem of the mutant plants was reduced.

[0116] The present invention describes a method for altering the cell wall thickness and lignin content of poplar wood tissue fibers. By knocking out the PtoMYB10 gene, the method achieves changes in the cell wall thickness and lignin content of wood tissue fibers, providing genetic resources for the molecular genetic improvement of forest trees guided by the development and utilization of wood biomass.

[0117] Although the foregoing has described the inventive concept and embodiments in detail, those skilled in the art will recognize that various improvements and modifications can be made to the invention without departing from the scope of the claims, and such improvements and modifications should still fall within the protection scope of the invention.

Claims

1. A method for altering the cell wall thickness and lignin content of poplar wood tissue fibers, comprising the following steps: S1: Cloning of the genomic and coding sequences of PtoMYB10 Using stem tissue from Populus 741 as material, genomic DNA and total RNA were extracted, and the total RNA was reverse transcribed into cDNA. Using genomic DNA as a template, the genomic sequence and coding sequence of PtoMYB10 were amplified using specific primers. S2: Screening and vector construction for knocking out PtoMYB10 target sites The obtained PtoMYB10 coding sequence was input into the online tool CRISPRdirect to identify potential Cas9 target sites for PtoMYB10 knockout. Two candidate targets were screened out, namely TCAACTTCTCCAACCATAAC and GATTGGCAAGCTTGAACAT. For the two candidate targets, gene knockout vectors were constructed by preparing target site adapters and gRNA expression cassettes to obtain gene editing vectors. S3: Creation of the PtoMYB10 knockout mutant The gene editing vector constructed in S2 was transformed into Agrobacterium EHA105, and then transformed into Populus 741 using Agrobacterium-mediated leaf disc transformation to obtain PtoMYB10 knockout mutant candidate plants.

2. The method for altering the cell wall thickness and lignin content of poplar wood tissue as described in claim 1, characterized in that: The specific steps of S1 are as follows: Using 741 poplar stem tissue as material, genomic DNA and total RNA were extracted. The total RNA was reverse transcribed into cDNA. Using genomic DNA and cDNA as templates, specific primers 5'-TTCTTGCCTCGCATCTCC-3' and 5'-GGGGCAGTTTTCACCATC-3' were used to amplify the genomic sequence and coding sequence of PtoMYB10. The PCR amplification products were separated by agarose gel electrophoresis. The target fragment was recovered using a DNA rapid recovery / purification kit. The purified DNA fragment was ligated into the pEASY-Blunt vector. The ligation product was transformed into E. coli DH10b. After antibiotic selection, single clones were selected for sequencing analysis to obtain the genomic sequence and coding sequence of PtoMYB10. The PCR products were cloned, recovered, and sequenced using conventional methods. The specific steps of S2 are as follows: 1) Preparation of target site adapters: Based on the sequence of target site 1: TCAACTTCTCCAACCATAAC, adapter primers were designed as follows: MYB10-U6-29-F: 5'-ATTGTTATGGTTGGAGAAGTTGA-3'; MYB10-U6-29-R: 5'-AAACTCAACTTCTCCAACCATAA-3'; The adapter primers were dissolved in TE buffer to prepare a 100 μM stock solution. 1 μl of each solution was added to 98 μl of 0.5×TE buffer. 25 μl of the mixture was then incubated at 90 °C for 30 s, followed by annealing at room temperature to form target site adapter 1. Based on the sequence of target site 2: GATTCGGCAAGCTTGAACAT, adapter primers were designed as follows: MYB10-AtU3d-F: 5'-GTCATGTTCAAGCTTGCCGAATC-3' and MYB10-AtU3d-R: 5'-AAACGATTCGGCAAGCTTGAACA-3', the preparation method of target site adapter 2 is the same as that of target site adapter 1; 2) gRNA expression cassette preparation: pYLsgRNA-AtU6-29 and pYLsgRNA-AtU3d / LacZ vectors were digested with Bsa I; the gRNA expression cassette was amplified by nested PCR. 3) Ligation of the gRNA expression cassette with the pYLCRISPR / Cas9 vector: The pYLCRISPR / Cas9 vector was digested with Bsa I enzyme, and the gRNA expression cassettes (⑤ and ⑥) obtained in step 2) were cloned into the pYLCRISPR / Cas9 vector using homologous recombination to obtain the gene editing vector. In step 2), the enzyme digestion system was as follows: plasmid, 1 μg; 10X CutSmart Buffer, 5 μl; Bsa I, 10 units; Nuclease-free Water added to 50 μl; the enzyme digestion reaction conditions were: 37℃, 30 min; 70℃, 5 min. Using T4 DNA ligase, target site adapter 1 and target site adapter 2 were ligated to the digested vectors pYLsgRNA-AtU6-29 and pYLsgRNA-AtU3d / LacZ, respectively. The ligation system was as follows: plasmid, 0.5 μl; adapter, 1 μl; enzyme, 0.5 μl; 10x T4 DNA ligase buffer, 1 μl; ddH2O added to 10 μl; ligation reaction conditions: room temperature, 30 min. In step 2), the specific steps for amplifying the gRNA expression cassette using nested PCR are as follows: a. Using the ligation product of the pYLsgRNA-AtU3d / LacZ vector as a template, the first round of PCR amplification was performed using primer combinations UF / MYB10-AtU3d-R and MYB10-AtU3d-F / gRNA-R, respectively, to obtain PCR products, which were labeled as ① and ②, respectively. Using the ligation product of the pYLsgRNA-AtU6-29 vector as a template, the first round of PCR amplification was performed using primer combinations UF / MYB10-U6-29-R and MYB10-U6-29-F / gRNA-R, respectively, to obtain PCR products, which were labeled as ③ and ④, respectively. The primer sequences were: UF: 5'-CTCCGTTTTACCTGTGGAATCG-3'; gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'. b. Dilute PCR products ① and ② from a 10-fold ratio, take 1 μl of each and mix them as templates. Use the primer combination CAS9-F / CAS9-3d-R for PCR amplification to obtain PCR product ⑤. Dilute PCR products ③ and ④ from a 10-fold ratio, take 1 μl of each and mix them as templates. Use the primer combination CAS9-U6-29-F / CAS9-R for PCR amplification to obtain PCR product ⑥. ⑤ and ⑥ are the prepared gRNA expression cassette. The specific genetic transformation steps described in S3 are as follows: The first step involves infecting the leaf discs with Agrobacterium carrying recombinant plasmids for 10-15 minutes. The second step involves transferring the leaf discs to CM1 medium and incubating them in the dark for two days. The third step involves transferring the leaf discs to CM2 medium to induce callus formation, changing the medium every 10-14 days. The fourth step involves transferring the leaf discs to CM3 medium when visible yellow or white callus granules appear on the edges, inducing adventitious bud differentiation. The fifth step involves cutting off the adventitious buds when they reach approximately 2 cm in height and planting them on CM4 medium for rooting culture. The components of CM1-CM4 culture media described in S3 are as follows: CM1: WPM 2.41g / L + sucrose 30g / L + AS 100μmol / L + NAA 1mg / L + ZT 2mg / L + agar powder 6g / L; CM2: WPM 2.41g / L + sucrose 30g / L + NAA 1mg / L + ZT 2mg / L + Cef 400mg / L + Hyg 10mg / L + agar powder 6g / L; CM3: WPM 2.41g / L + sucrose 30g / L + NAA 0.1mg / L + ZT 2mg / L + Cef 400mg / L + Hyg 10mg / L + agar powder 6g / L; CM4: WPM 2.41g / L + sucrose 30g / L + NAA 0.1mg / L + Cef 400mg / L + Hyg 10 mg / L + 6 g / L agar powder.

3. The method for altering the cell wall thickness and lignin content of poplar wood tissue as described in claim 1, characterized in that: It also includes the following steps: S4: Using the genomic DNA of transgenic plants as a template, the genomic sequence at the target site was amplified using primers myb10-JC1 and myb10-JC2. The mutation at the target site was identified by high-throughput sequencing of the PCR products. Two biallelic mutants, ptomyb10 (L243) and ptomyb10 (L248), were identified.

4. The method for altering the cell wall thickness and lignin content of poplar wood tissue as described in claim 3, characterized in that: The nucleotide sequence of the primer myb10-JC1 is shown in SEQ ID NO.

18.

5. The method for altering the cell wall thickness and lignin content of poplar wood tissue as described in claim 3, characterized in that: The nucleotide sequence of the primer myb10-JC2 is shown in SEQ ID NO.

19.

6. The application of the method for altering the cell wall thickness and lignin content of poplar wood tissue as described in any one of claims 1-5 in poplar breeding.

7. The application of the method for altering the cell wall thickness and lignin content of poplar wood tissue as described in claim 6 in poplar breeding is as follows: a poplar PtoMYB10 gene knockout mutant is obtained through gene editing technology, the growth of the mutant plant is measured, including plant height and ground diameter, and the lignin content in the wood tissue of the mutant plant is measured at the same time. Mutants with large growth and low lignin content are screened as superior lines for new variety breeding.

8. Application of the PtoMYB10 gene as a target gene in poplar breeding, wherein the nucleotide sequence of the PtoMYB10 gene is shown in SEQ ID NO.3; and the cDNA sequence of the PtoMYB10 gene is shown in SEQ ID NO.

4.

9. The target gene of claim 8 has two target sites, wherein, The nucleotide sequence of target site 1 is shown in SEQ ID NO.6; the nucleotide sequence of target site 2 is shown in SEQ ID NO.

7.

10. The adapter primers for target site 1 of claim 9: MYB10-U6-29-F has the nucleotide sequence shown in SEQ ID NO. 8; MYB10-U6-29-R has the nucleotide sequence shown in SEQ ID NO. 9; the adapter primers for target site 2: MYB10-AtU3d-F has the nucleotide sequence shown in SEQ ID NO. 10; MYB10-AtU3d-R has the nucleotide sequence shown in SEQ ID NO. 11.

Images