Chip specifically recognizing captured target nucleic acid and its application in tof-sims analysis detection
Patent Information
- Application Number
- CN202510269556.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-07
- Publication Date
- 2026-09-08
AI Technical Summary
荧光检测不可避免需要对其进行荧光基团标记,会对miRNA的自然生理状态产生影响;而电化学方法通常需要被检测物质具有氧化还原性质,可以进行氧化还原反应,限制了该方法的进一步应用
[0011] The chip of this invention employs affinity probes with good selectivity for target miRNAs, enabling specific identification and capture of trace amounts of target miRNAs in samples. In the chip provided by this invention, the affinity probes bind firmly to the solid-phase support, and by replacing the affinity probes in the chip, it can be adapted for the detection of different miRNAs. Furthermore, combined with ToF-SIMS technology, the chip of this invention can achieve high-throughput and high-sensitivity detection without chemical labeling, providing a new research approach for the quantitative analysis of specific miRNAs in tumor cells.
Smart Images

Figure CN122706809A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biodetection technology, specifically to a chip that specifically identifies and captures target nucleic acids and its application in ToF-SIMS analysis and detection. Background Technology
[0002] miRNAs are a class of non-coding small RNAs widely found in animals, plants, and some viruses. Most miRNAs are involved in various biological processes, especially in tumorigenesis and development. Aberrant miRNA expression affects tumor cell generation, proliferation and apoptosis, metastasis and invasion. miRNAs can act as tumor suppressor genes or oncogenes, exhibiting different expression changes in tumor cells. Their differential expression between tumor cells and normal cells makes miRNAs a promising candidate for cancer biomarkers, applicable to early cancer diagnosis and treatment. Therefore, the analysis and detection of miRNAs has always been a hot topic. However, the low abundance and high sequence homology of miRNAs in tumor cells, coupled with the complex microenvironment of tumor cells, present challenges to miRNA detection and analysis.
[0003] Currently, traditional detection methods include Northern Blot, microarray technology, and real-time quantitative polymerase chain reaction (RT-qPCR). However, these methods suffer from drawbacks such as poor sensitivity and complex operation. Novel detection methods, such as isothermal nucleic acid amplification techniques (e.g., rolling circle amplification, loop-mediated isothermal amplification, exponential amplification reaction), and nanoparticle-based signal amplification techniques, typically utilize fluorescence or electrochemical techniques. Fluorescence detection inevitably requires fluorescent labeling, which can affect the natural physiological state of miRNAs; while electrochemical methods usually require the analyte to possess redox properties and be capable of redox reactions, limiting the further application of this method. Therefore, there is still a need to develop novel, simple, and highly sensitive detection methods for miRNAs. Summary of the Invention
[0004] The purpose of this invention is to overcome the aforementioned problems in the prior art and provide a chip for specifically identifying and capturing target nucleic acids and its application in ToF-SIMS analysis and detection. Using the chip provided by this invention in conjunction with Secondary Time-of-Flight Mass Spectrometry (ToF-SIMS) technology, highly selective and sensitive detection of trace amounts of miRNA in samples can be achieved.
[0005] miRNAs are often differentially expressed in tumor cells and normal cells, and changes in miRNA levels are an effective biomarker in tumor development. The inventors of this invention discovered that by designing affinity probes that specifically recognize target miRNAs, capturing these miRNAs, and combining this with ToF-SIMS detection of changes in characteristic fragment ion peak areas, highly selective and sensitive quantitative analysis and detection of target miRNAs in samples can be achieved.
[0006] To achieve the above objectives, a first aspect of the present invention provides a chip for specifically recognizing and capturing target nucleic acids. The chip includes a solid-phase carrier and an affinity probe immobilized on the solid-phase carrier. The affinity probe includes a circular region and a stem region. The circular region includes a sequence having the function of recognizing and capturing target nucleic acids. The affinity probe is connected to the solid-phase carrier through the stem region.
[0007] A second aspect of the present invention provides a method for preparing a chip that specifically identifies and captures target nucleic acids. The method includes contacting an affinity probe with a solid-phase support to fix the affinity probe on the surface of the solid-phase support. The affinity probe includes a circular region and a stem region. The circular region includes a sequence having the function of identifying and capturing target nucleic acids. The affinity probe is connected to the solid-phase support through the stem region.
[0008] A third aspect of the present invention provides a method for detecting target miRNA in a sample, the method comprising contacting the sample to be tested with the chip described in the first aspect, performing nucleic acid hybridization treatment, and detecting the chip after nucleic acid hybridization treatment by secondary ion time-of-flight mass spectrometry.
[0009] The fourth aspect of the present invention provides the use of the chip described in the first aspect or the method described in the third aspect in the preparation of products for detecting tumor marker miRNA.
[0010] The above-mentioned solution provided by the present invention can achieve at least the following beneficial effects:
[0011] The chip of this invention employs affinity probes with good selectivity for target miRNAs, enabling specific identification and capture of trace amounts of target miRNAs in samples. In the chip provided by this invention, the affinity probes bind firmly to the solid-phase support, and by replacing the affinity probes in the chip, it can be adapted for the detection of different miRNAs. Furthermore, combined with ToF-SIMS technology, the chip of this invention can achieve high-throughput and high-sensitivity detection without chemical labeling, providing a new research approach for the quantitative analysis of specific miRNAs in tumor cells. Attached Figure Description
[0012] It will be understood by those skilled in the art that the accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the following detailed description to explain the invention, but do not constitute a limitation thereof. In the drawings:
[0013] Figure 1 This is a schematic diagram illustrating the chip fabrication process and the process of miRNA capture and detection using the chip in this invention.
[0014] Figure 2 The diagram shows the silicon wafer structure design in Example 1, where (a) is a schematic diagram of the overall silicon wafer structure and (b) is a detailed schematic diagram of the silicon wafer spotting location.
[0015] Figure 3 This is a graph showing the results of characterizing the affinity probe solution after annealing using ultraviolet spectroscopy in Example 1.
[0016] Figures 4-7 This is a graph showing the results of the detection and analysis of characteristic fragment ions on a silicon wafer and a chip with immobilized affinity probes using ToF-SIMS in Example 1. Figure 4 H2PO4 after immobilization of blank silicon wafers and affinity probes - Signal; Figure 5 HP2O6 after fixing blank silicon wafers and affinity probes - Signal; Figure 6 The signal intensity of the four bases after the affinity probe is immobilized; Figure 7 The signal intensity of the five bases after miRNA hybridization.
[0017] Figure 8 This is a graph showing the affinity probe saturation and fixation concentration determined by ToF-SIMS detection after hybridization of the chip and the target miRNA in Example 2.
[0018] Figure 9 The working curve is plotted based on the characteristic fragment ions after hybridization of the chip and the target miRNA in Example 2 and detection by ToF-SIMS. Detailed Implementation
[0019] The endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0020] In this invention, unless otherwise specified, the nucleotide sequences involved are listed from left to right in the order of 5'→3'; in the expressions such as "first chemical modification group", "second chemical modification group", "first characteristic fragment ion", and "second characteristic fragment ion", the numbers "first" and "second" are only used for the purpose of easy distinction in description, and have no limiting effect on the specific substances involved or their optional range.
[0021] The first aspect of the present invention provides a chip for specifically recognizing and capturing target nucleic acids. The chip includes a solid-phase carrier and an affinity probe immobilized on the solid-phase carrier. The affinity probe includes a circular region and a stem region. The circular region includes a sequence having the function of recognizing and capturing target nucleic acids. The affinity probe is connected to the solid-phase carrier through the stem region.
[0022] According to a preferred embodiment of the present invention, the target nucleic acid is miRNA, preferably human miRNA.
[0023] In this invention, the target miRNA can be selected according to actual requirements. miRNAs exhibit high sequence homology and exist as miRNA families, such as the let-7 family, miR-34 family, and miR-15 family. Any known miRNA can be detected using the chip of this invention. However, the inventors have discovered that the let-7 family has important physiological functions, and that let-7a-5p within the let-7 family is closely related to the generation, development, proliferation, metastasis, and apoptosis of tumor cells. Therefore, in some preferred embodiments of this invention, let-7 family miRNAs can be used as target miRNAs.
[0024] Preferably, the target nucleic acid is at least one miRNA from the let-7 family. For example, it can be let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i, etc.
[0025] According to a preferred embodiment of the present invention, the target nucleic acid is let-7a.
[0026] Preferably, the target nucleic acid is let-7a-5p, and its nucleotide sequence is shown in SEQ ID NO:3.
[0027] UGAGGUAGUAGGUUGUAUAGUU (SEQ ID NO: 3, let-7a-5p)
[0028] According to a preferred embodiment of the present invention, the circular region of the affinity probe comprises a nucleotide sequence complementary to the target nucleic acid or a fragment thereof.
[0029] Preferably, the number of nucleotides in the circular region is not less than 10, and more preferably 15-45. For example, the number of nucleotides in the circular region can be 15, 20, 25, 30, 35, 40, or 45, or it can be any range of any two of the above values, or any intermediate value within that range.
[0030] According to a preferred embodiment of the present invention, the circular region of the affinity probe comprises the nucleotide sequence shown in SEQ ID NO:1.
[0031] AACTATACAACCTACTACCTCA(SEQ ID NO:1)
[0032] According to a preferred embodiment of the present invention, the stem region of the affinity probe includes a first chemical modification group, which causes the stem region to be covalently connected to the solid support.
[0033] Preferably, the first chemically modified group is selected from at least one of thiol, amino, carboxyl and azide groups.
[0034] Preferably, the first chemical modification group is modified at the 5' end of the stem region.
[0035] According to a preferred embodiment of the present invention, the first chemically modified group is a carboxyl group.
[0036] The number of nucleotides in the stem region can be adjusted according to actual needs (e.g., requirements for stem region stability). Preferably, the number of nucleotides in the stem region is not less than 5 pairs, and more preferably 5-10 pairs. For example, it can be 5, 6, 7, 8, 9, or 10 pairs, or it can be a range consisting of any two of the above values.
[0037] The affinity probe used in this invention can be obtained in any way in the art, for example, through artificial synthesis. Typically, the synthesized probe is a straight-chain nucleotide sequence, which needs to be annealed to form a stem-loop structure. Therefore, in the synthesized affinity probe sequence, the stem region sequence can be located at the 5' and 3' ends, respectively. After annealing, they complementarily pair to form a double-stranded nucleotide sequence in the stem region, while the unpaired loop region sequence forms a loop structure. Therefore, in the affinity probe sequence, the total number of nucleotides in the stem region can be 10 or more, preferably 10-20.
[0038] Preferably, to improve the stability of the affinity probe, the affinity probe may further include loop enlargement regions located at the 5' and 3' ends of the circular region sequence, respectively. These regions enhance the stability of the circular region. The nucleotide sequences in the loop enlargement regions do not pair complementaryly with each other, thus preventing the formation of a double-stranded structure in the stem region. Furthermore, the nucleotide sequences in the loop enlargement regions do not pair complementaryly with the target nucleic acid.
[0039] According to a preferred embodiment of the present invention, the nucleotide sequence of the affinity probe is as shown in SEQ ID NO:2.
[0040] AACCGCGAAAAACTATACAACCTACTACCTCAGCACGCGGTT(SEQ ID NO:2)
[0041] According to a preferred embodiment of the present invention, the solid support is a conductive material, preferably a silicon wafer and / or conductive glass, preferably a silicon wafer.
[0042] Preferably, the surface of the solid support has a second chemical modification group, and more preferably, the second chemical modification group includes at least one of Au, carboxyl, amino and alkynyl groups.
[0043] In this invention, the second chemical modification group interacts with the first chemical modification group, thereby linking the solid-phase support to the affinity probe. Those skilled in the art can select the second chemical modification group and the corresponding first chemical modification group accordingly. For example, when a thiol group is used as the first chemical modification group, the second chemical modification group can be Au (e.g., the solid-phase support is treated with gold coating); or, for example, when an azide group is used as the first chemical modification group, an alkynyl group can be selected as the second chemical modification group. The correspondence between chemical modification groups is well known to those skilled in the art and will not be elaborated further here.
[0044] A second aspect of the present invention provides a method for preparing a chip that specifically identifies and captures target nucleic acids. The method includes contacting an affinity probe with a solid-phase support to fix the affinity probe on the surface of the solid-phase support. The affinity probe includes a circular region and a stem region. The circular region includes a sequence having the function of identifying and capturing target nucleic acids. The affinity probe is connected to the solid-phase support through the stem region.
[0045] The characteristics of the affinity probe and solid support used in the method provided by this invention are as described above and will not be repeated here.
[0046] According to a preferred embodiment of the present invention, the contact conditions include: temperature 1-30°C and time 1-3 hours.
[0047] According to a preferred embodiment of the present invention, the method further includes a step of activating the affinity probe with an activator before contact, preferably the activator being selected from 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide.
[0048] Preferably, the activator is provided in the form of an aqueous solution, and the concentration of the aqueous solution is preferably 0.1-100 mM. The concentration of the aqueous solution refers to the total concentration of the activator (i.e., 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide).
[0049] For example, the concentration of the aqueous solution can be 0.1mM, 0.5mM, 1mM, 2mM, 3mM, 4mM, 5mM, 6mM, 7mM, 8mM, 9mM, 10mM, 15mM, 20mM, 25mM, 30mM, 35mM, 40mM, 45mM, 50mM, 60mM, 70mM, 80mM, 90mM, or 100mM, or it can be a range consisting of any two of the above values, or any intermediate value within that range.
[0050] More preferably, the concentration ratio of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride to N-hydroxysuccinimide in the activator (aqueous solution) is 1:0.8-1.2. For example, it can be 1:0.8, 1:0.9, 1:1, 1:1.2, 1:1.2, or any range of any two of the above ratios, or any intermediate ratio within that range.
[0051] According to some preferred embodiments of the present invention, the concentration of the aqueous solution is 1-20 mM.
[0052] According to a preferred embodiment of the present invention, the method further includes a pretreatment step for the solid support.
[0053] Preferably, the pretreatment includes cleaning and surface treatment of the solid support.
[0054] More preferably, the cleaning includes treating the solid carrier with a plasma cleaner or a piranha solution.
[0055] According to some preferred embodiments of the present invention, the cleaning is performed using a plasma cleaner on the solid support. During the cleaning process, the surface of the solid support can also be hydroxylated.
[0056] According to some preferred embodiments of the present invention, the surface treatment includes a sealing treatment of non-specific adsorption sites on the surface of the solid support.
[0057] Any method applicable to the blocking of non-specific adsorption sites in the art can be used in this invention. For example, a blocking liquid can be used to treat the solid support.
[0058] Preferably, the sealing solution may be selected from at least one of bovine serum albumin, skim milk, polyvinylpyrrolidone, and serum.
[0059] According to a preferred embodiment of the present invention, the blocking solution is selected as bovine serum albumin solution.
[0060] Preferably, the concentration of bovine serum albumin in the blocking solution is 0.5-5% (mass-volume ratio, i.e., 0.5-5g bovine serum albumin per 100mL of blocking solution). For example, it can be 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, or any range consisting of any two of the above values, or any intermediate value within that range.
[0061] Preferably, the method further includes a step of cleaning the solid support after the sealing treatment (to remove residual sealing liquid from the surface). Any reagent capable of removing residual sealing liquid from the surface of the solid support can be used in this step, preferably water (such as deionized water).
[0062] Experiments have verified that the chip obtained by using the method of the present invention can still exhibit excellent target nucleic acid detection performance (such as high specificity and high sensitivity) without the need for sealing treatment. Therefore, in order to save time and reagent costs, the step of sealing non-specific adsorption sites on the solid support surface can be omitted in the method of the present invention.
[0063] According to some preferred embodiments of the present invention, the surface treatment does not include the sealing treatment of non-specific adsorption sites on the surface of the solid support.
[0064] The present invention further provides a chip prepared using the method of the second aspect.
[0065] A third aspect of the present invention provides a method for detecting target miRNA in a sample, the method comprising contacting the sample to be tested with the chip described in the first aspect, performing nucleic acid hybridization treatment, and detecting the chip after nucleic acid hybridization treatment by secondary ion time-of-flight mass spectrometry.
[0066] According to a preferred embodiment of the present invention, the method includes the following steps:
[0067] (1) Secondary ion time-of-flight mass spectrometry detection was performed on the hybridized sites. The primary ion source was selected from Bi source, wherein the Bi source was selected from Bi + and Bi3 + any one of them;
[0068] (2) Determine the fixation of affinity probes and nucleic acid hybridization on the chip surface based on the detection results.
[0069] Preferably, in step (1), the primary ion source is Bi3. + .
[0070] Preferably, in step (2), the first characteristic fragment ion is used as a signal marker of successful fixation of the affinity probe, and the second characteristic fragment ion is used as a signal marker of successful nucleic acid hybridization;
[0071] The first characteristic fragment ion is selected from H2PO4. - HP2O6 - PO4 3- At least one of guanine, adenine, cytosine, and thymine, preferably H2PO4. - HP2O6 - At least one of thymine and uracil; the second characteristic fragment ion is uracil.
[0072] Preferably, step (2) includes at least one of the following steps:
[0073] (2-1) Determine the saturated fixation concentration of affinity probes: The same concentration of test sample is contacted with chips prepared using affinity probes with different concentration gradients to perform nucleic acid hybridization. Then, the chip after nucleic acid hybridization is detected by secondary ion time-of-flight mass spectrometry. The saturated fixation concentration of affinity probes is determined based on the detection results.
[0074] (2-2) Determine the working curve of miRNA: The miRNA standard solutions with different concentration gradients are contacted with the chip prepared with the same concentration of affinity probe to perform nucleic acid hybridization treatment. Then, the chip after nucleic acid hybridization treatment is detected by secondary ion time-of-flight mass spectrometry, and the working curve of miRNA is determined according to the detection results.
[0075] In step (2-1), the sample to be tested can be a standard solution prepared using the target miRNA. There are no particular limitations on the concentration of the sample to be tested in this invention; those skilled in the art can select it according to actual needs. Preferably, the sample to be tested can be a target miRNA standard solution with a concentration of 1-100 μM. For example, the concentration of the sample to be tested can be 1 μM, 2 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, 15 μM, 20 μM, 30 μM, 40 μM, 50 μM, 60 μM, 70 μM, 80 μM, 90 μM, or 100 μM, or a range consisting of any two of the above values, or any intermediate value within that range. Preferably, the sample to be tested is a target miRNA standard solution with a concentration of 1-10 μM.
[0076] In step (2-1), the chip can be prepared using an affinity probe solution with an arbitrary concentration gradient from 0 to 200 μM. In this invention, there are no particular restrictions on the concentration gradient distribution of the affinity probe solution, which can be adjusted according to actual needs. For example, the chip can be prepared using affinity probe solutions with concentration gradients of 0, 5 μM, 10 μM, 15 μM, 20 μM, 30 μM, 40 μM, 50 μM, 60 μM, 70 μM, 80 μM, 90 μM, 100 μM, 120 μM, 140 μM, 160 μM, 180 μM, and 200 μM, or any of these concentrations, or an intermediate concentration, can be selected.
[0077] According to a preferred embodiment of the present invention, the concentration gradient distribution of the affinity probe solution can be 0, 5 μM, 10 μM, 40 μM, 60 μM, or 80 μM.
[0078] More preferably, step (2-1) includes using the peak area ratio of thymine and uracil (i.e., the ratio of the peak area of the [TH] signal to the peak area of the [UH] signal). [T-H] / Area [U-H] Using the affinity probe concentration as the independent variable and the affinity probe concentration as the dependent variable, an affinity probe saturation concentration curve was plotted.
[0079] In step (2-2), there are no restrictions on the concentration gradient distribution of the miRNA standard solution; it can be selected and adjusted according to actual needs. For example, miRNA standard solutions with any concentration gradient from 0 to 50 μM can be used. Specifically, miRNA standard solutions with concentration gradients of 0, 0.05 μM, 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1 μM, 2 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, 15 μM, 20 μM, 30 μM, 40 μM, and 50 μM can be used, or any of these concentrations, or an intermediate concentration, can be selected.
[0080] According to a preferred embodiment of the present invention, the concentration gradient distribution of the miRNA standard solution can be 0.1 μM, 0.5 μM, 1 μM, 2 μM, 6 μM, 8 μM, 10 μM, and 15 μM.
[0081] In step (2-2), there are no particular restrictions on the concentration of the affinity probe used to fabricate the chip; it can be selected and adjusted according to actual needs. For example, the concentration of the affinity probe can be 5-100 μM, such as 5 μM, 10 μM, 15 μM, 20 μM, 25 μM, 30 μM, 35 μM, 40 μM, 45 μM, 50 μM, 55 μM, 60 μM, 65 μM, 70 μM, 75 μM, 80 μM, 85 μM, 90 μM, 95 μM, 100 μM, or any range consisting of any two of the above values, or any intermediate value within that range. Preferably, the concentration of the affinity probe can be 30-80 μM.
[0082] More preferably, step (2-2) includes using the peak area ratio of uracil and thymine (i.e., the ratio of the peak area of the [UH] signal to the peak area of the [TH] signal). [U-H] / Area [T-H] Using miRNA concentration as the independent variable and α as the dependent variable, miRNA working curves were plotted.
[0083] According to some preferred embodiments of the present invention, the sample is tumor cells. The tumor cells can be tumor cells from any source, such as tumor cells isolated from tumor tissue derived from a patient, or tumor cell lines cultured in vitro.
[0084] The methods provided by this invention can be diagnostic or non-diagnostic. For example, a diagnostic method may be to use the methods of this invention to test patient-derived tissues to determine whether the patient has a disease associated with the detected miRNA or to assess the risk of disease; a non-diagnostic method may include using the methods of this invention to quantitatively detect miRNAs in samples in research or non-diagnostic testing.
[0085] The fourth aspect of the present invention provides the use of the chip described in the first aspect or the method described in the third aspect in the preparation of products for detecting tumor marker miRNA.
[0086] According to a preferred embodiment of the present invention, the product may be a kit for detecting tumor marker miRNA.
[0087] According to some preferred embodiments of the present invention, the tumor marker miRNA is at least one of the let-7 family miRNAs. For example, it can be let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i, etc.
[0088] According to a preferred embodiment of the present invention, the target nucleic acid is let-7a.
[0089] Preferably, the target nucleic acid is let-7a-5p, and its nucleotide sequence is shown in SEQ ID NO:3.
[0090] The present invention further provides a method for detecting target miRNAs in tumor cells. The method is characterized by comprising the following steps:
[0091] (1) Tumor cell culture;
[0092] (2) Extraction of total miRNA from tumor cells;
[0093] (3) Provide the chip described in the first aspect;
[0094] (4) Hybridize the total miRNA extracted in step (2) with the chip obtained in step (3) and detect it using the third method.
[0095] In this invention, the selected tumor cells can be any type of cell, such as human non-small cell lung cancer cells, breast cancer cells, cervical cancer cells, testicular cancer cells, melanoma cells, prostate cancer cells, liver cancer cells, bladder cancer cells, pancreatic cancer cells, glioblastoma cells, colorectal cancer cells, lung squamous cell carcinoma cells, esophageal cancer cells, etc., with human non-small cell lung cancer cells being preferred.
[0096] In this invention, the method for extracting target miRNA from tumor cells can be either the total RNA extraction method using the traditional chemical reagent TRNzol, or the total miRNA extraction method using a centrifugal column enrichment method, preferably the total miRNA extraction method using a centrifugal column enrichment method.
[0097] Example
[0098] The present invention will be described in detail below through embodiments. It should be understood that the following embodiments are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.
[0099] In the following examples, the affinity probe (5'-COOH-AACCGCG) AAA AACTATACAACCTACTACCTCA GCA Both CGCGGTT-3' (SEQ ID NO:2) and let-7a-5p (5'-UGAGG UAGUAGGUUGUAUAGUU-3' (SEQ ID NO:3) were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0100] Acetone and anhydrous ethanol were purchased from Tianjin Concord Technology Co., Ltd.; deionized water was prepared using a Millipore pure water system; high-purity nitrogen was purchased from Beijing Zhongke Tailong Electronic Technology Co., Ltd.; 3-aminopropyltriethoxysilane was purchased from Shandong Keyuan Biochemical Co., Ltd.; 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride was purchased from Beijing Innocare Technology Co., Ltd.; N-hydroxysuccinimide was purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd.; 2-morpholine ethanesulfonic acid (0.1M, pH=6.0) was purchased from Beijing Coollab Technology Co., Ltd.; single-sided polished monocrystalline silicon wafers (2-inch wafers) were purchased from Beijing Zhongjing Scientific Instruments Technology Co., Ltd.; tris(hydroxymethyl)aminomethane (powder) was purchased from Shanghai Maclean Biochemical Technology Co., Ltd.; ethylenediaminetetraacetic acid reagent was purchased from Beijing Innocare Technology Co., Ltd.; sodium chloride reagent was purchased from Xilong Scientific Co., Ltd. All reagents were of analytical grade. The 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride / N-hydroxysuccinimide solution is an aqueous solution prepared with both 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide solution having a concentration of 5 mM.
[0101] Unless otherwise specified, the operating temperature in the following embodiments is room temperature (25±5℃).
[0102] Example 1
[0103] This embodiment is used to illustrate the chip fabrication process of the present invention.
[0104] refer to Figure 1 The schematic diagram shows the process of fabricating a chip using a silicon wafer as a solid-phase carrier and attaching affinity probes that can specifically recognize and bind to let-7a-5p.
[0105] (I) Design and pretreatment of solid support
[0106] (1) Silicon wafer structure design
[0107] refer to Figure 2 The silicon wafer layout was designed using L-Edit software. The silicon wafer is 1cm×1cm in size and has 10×10 array combinations of 500μm×500μm. Each combination contains a 4×4 array of circular rings with an inner diameter of 100μm and a ring spacing of 600μm.
[0108] (2) Silicon wafer pretreatment
[0109] First, the silicon wafer is soaked in acetone, anhydrous ethanol and deionized water in sequence, and ultrasonic treatment is performed during the soaking process for 10 minutes each time. Then, the surface of the silicon wafer is rinsed with deionized water and then dried with high-purity nitrogen.
[0110] The silicon wafer surface was cleaned for 10 minutes using a plasma cleaner, which also hydroxylated the surface. The cleaned wafer was then stored in anhydrous ethanol. For the next reaction, the wafer was removed with tweezers and dried with high-purity nitrogen. The wafer was then immersed in 4% (v / v) 3-aminopropyltriethoxysilane and reacted at room temperature for 30 minutes for amination, keeping the wafer as sealed as possible during the amination process. After the reaction, the wafer was removed with tweezers and thoroughly rinsed with anhydrous ethanol to remove any unreacted 3-aminopropyltriethoxysilane solution. It was then dried with high-purity nitrogen and dried at 110°C for 1 hour.
[0111] (II) Design, construction and characterization of affinity probes.
[0112] (1) Affinity probe sequence design
[0113] The stem-loop affinity probe sequence was designed using Integrated DNA Technologies (IDT) software. The designed stem-loop affinity probe sequence is 5'-COOH-AACCGCG. AAA AACTATACAACCTACTACCTCA GCA CGCGGTT-3'. This sequence is divided into three parts. The first part, marked in bold italics, is the circular region, which undergoes specific base pairing hybridization with let-7a-5p. The second part consists of seven bases each at the 5' and 3' ends, which can pair with each other to form a stem structure. The third part is the underlined sequence, which is the loop expansion region, which can increase the stability of the circular structure.
[0114] (2) Construction and characterization of affinity probes
[0115] Centrifuge the affinity probe powder at 4000 rpm for 1 min at room temperature. Then, slightly open the tube and add 49.2 μL of annealing buffer (10 mM tris(hydroxymethyl)aminomethane, 50 mM sodium chloride, 1 mM ethylenediaminetetraacetic acid, 24°C, pH 7.4). Mix well to prepare a 100 μM probe stock solution. Transfer the probe stock solution to a PCR tube, dilute to 10 μM with annealing buffer, and place in a PCR instrument. Set the annealing program as follows: heat from room temperature to 95°C, hold for 5 min, then slowly cool at a rate of 1°C / cycle until reaching 25°C. Store at 4°C.
[0116] Take 10 μM annealed affinity probe solution and 10 μM unannealed affinity probe solution, perform UV detection, and observe the change in absorbance at 260 nm.
[0117] UV spectra of affinity probe solutions before and after annealing are as follows: Figure 3As shown, after annealing, the affinity probe forms a stem-loop structure. Base pairing exists in the stem region. Compared with the oligonucleotide chain before annealing, the exposed conjugated structure is reduced, which leads to a decrease in UV absorption. However, due to the short sequence in the stem region, only a slight decrease in absorbance can be observed, which proves the formation of the stem-loop structure.
[0118] (III) Immobilization and characterization of affinity probes.
[0119] The 100 μM affinity probe stock solution was diluted to 5 μM with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride / N-hydroxysuccinimide solution and activated at room temperature for 30 min. Spotting was performed using a Nano-Plotter system. The affinity probe was spotted at fixed positions, and a total of 8 spottings were performed, each with a volume of 100 pL, for a total volume of 800 pL. After spotting, the reaction was carried out at room temperature for 2 h, followed by thorough elution with deionized water to remove unfixed affinity probes. The sample was then dried with high-purity nitrogen to obtain a chip immobilized with the affinity probe.
[0120] The resulting chip was then tested using ToF-SIMS with parameters of 30 keV Bi3 under negative ion operation conditions. + The source has a current of approximately 0.58 pA and an analysis area of 400 μm × 400 μm.
[0121] The results showed that the characteristic ion peaks of oligonucleotides are phosphorus-containing ion peaks, with the typical characteristic peak being H2PO4. - (m / z: 96.9732) and HP2O6 - (m / z: 158.9317). For example... Figure 4 and Figure 5 As shown, when only the pre-treated silicon wafer is detected, no characteristic ion signals are detected. However, after the affinity probe is immobilized on the silicon wafer, four base signals from DNA can be detected: [TH] (m / z: 124.0393), [AH] (m / z: 133.0488), [GH] (m / z: 149.0472), and [CH] (m / z: 109.0392), proving that the affinity probe has been immobilized on the silicon wafer surface. Figure 6 .
[0122] Example 2
[0123] This embodiment is used to illustrate the effect of using the chip of the present invention for target miRNA detection.
[0124] (a) Determining the saturation fixation concentration of the affinity probe
[0125] The 100 μM affinity probe stock solution was diluted with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride / N-hydroxysuccinimide solution to obtain affinity probe concentration gradient solutions of 0 μM (i.e., 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride / N-hydroxysuccinimide solution without the addition of stock solution), 5 μM, 10 μM, 40 μM, 60 μM and 80 μM.
[0126] Using the method described in Example 1, the Nano-Plotter system was used to spot the above-mentioned affinity probe concentration gradient solutions to obtain chips with different affinity probe loadings.
[0127] Take let-7a-5p dry powder, centrifuge at 4000 rpm for 1 min, slightly open the tube, add 42.5 μL of hybridization buffer (10 mM tris(hydroxymethyl)aminomethane, 50 mM sodium chloride, 1 mM ethylenediaminetetraacetic acid, 24℃, pH 7.4), mix well to prepare a 100 μM let-7a-5p stock solution. Dilute to 5 μM with hybridization buffer to obtain the sample solution.
[0128] Using a Nano-Plotter system, the affinity probes were fixed at their positions on the chip obtained in Example 1, and the sample solution was spotted. Each sample position was spotted 8 times, with each spotting volume being 100 pL. After spotting, the sample was incubated at 37°C for 2 hours, then unreacted let-7a-5p was washed away with deionized water, and the sample was dried with high-purity nitrogen.
[0129] The dried chip was directly used for ToF-SIMS detection, with four sampling locations as a group for scanning. The test parameters were 30 keV Bi3 under negative ion operation conditions. + The source has a current of approximately 0.58 pA and an analysis area of 400 μm × 400 μm.
[0130] In negative ion mode, the [CH], [TH], [GH], [AH], and [UH] signals were detected, respectively. Since the affinity probe is a DNA oligonucleotide chain containing T bases not found in RNA, and let-7a-5p contains U bases not found in DNA, the ratio of T to U base signals can be used as an indicator of affinity probe immobilization saturation. The peak area of characteristic bases was selected as the signal, and the ratio of the [TH] signal peak area to the [UH] signal peak area was used as the Area. [T-H] / Area [U-H] Plot the affinity probe concentrations against the vertical axis (denoted as "proportion") and the horizontal axis (different affinity probe concentrations).
[0131] like Figure 7As shown, after hybridization with miRNA, the chip produced a characteristic [UH] peak (m / z: 111.0223). Figure 8 As shown, the proportion gradually increases with the increase of the affinity probe immobilization concentration. When the affinity probe immobilization concentration reaches 40 μM, the proportion remains almost unchanged. Therefore, the saturated immobilization concentration of the affinity probe can be set to 40 μM.
[0132] (II) Drawing the working curve
[0133] The 100 μM affinity probe stock solution was diluted to 40 μM with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride / N-hydroxysuccinimide solution, and spotted using a Nano-Plotter system. The affinity probe was spotted at fixed locations, and a total of 8 spottings were performed, each with a volume of 100 pL, for a total volume of 800 pL. The reaction was carried out at room temperature for 2 h, followed by thorough elution with deionized water to remove unfixed affinity probe, and drying under high-purity nitrogen.
[0134] The let-7a-5p stock solution was diluted to 100 nM, 500 nM, 1 μM, 2 μM, 6 μM, 8 μM, 10 μM, and 15 μM with hybridization buffer to prepare gradient sample solutions. The gradient sample solutions were then spotted using the method described in Experiment (I).
[0135] After spotting, the chip was directly used for ToF-SIMS detection, with four spotting locations as a group for scanning. The test parameters were: negative ion operation, 30 keV Bi32O4. + The source has a current of approximately 0.58 pA and an analysis area of 400 μm × 400 μm.
[0136] In negative ion mode, the signals of [CH], [TH], [GH], [AH] and [UH] were detected respectively. The peak area ratio of [UH] and [TH] was used as the ordinate, and different let-7a-5p concentrations were used as the abscissa for data analysis to obtain the working curve.
[0137] Using the method in Experiment (I), the ratio of the peak area of the [TH] signal to the peak area of the [UH] signal is used to determine the Area. [T-H] / Area [U-H] A working curve was plotted with the let-7a-5p concentration as the x-axis and the let-7a-5p concentration as the ordinate. The results are as follows: Figure 9 As shown, the working curve is fitted with a linear relationship, and the linear equation is y = 0.16698x + 0.33176, R0. 2 It is 0.98083.
[0138] (III) Determining the detection limit
[0139] The lowest detection limit was calculated using a minimum concentration of 100 nM and a sample volume of 800 pL. The limit of detection was calculated according to the following formula I:
[0140] n = cv Formula I
[0141] In Equation I, n is the amount of miRNA, c is the concentration of miRNA in the sample, and v is the total sample volume. Calculations show that n = 80 amol, indicating that the chip and detection method of this invention achieve miRNA detection and analysis at the amol level.
Claims
1. A chip for specifically recognizing and capturing target nucleic acids, characterized in that, The chip includes a solid-phase carrier and an affinity probe immobilized on the solid-phase carrier. The affinity probe includes a circular region and a stem region. The circular region includes a sequence that has the function of recognizing and capturing target nucleic acids. The affinity probe is connected to the solid-phase carrier through the stem region.
2. The chip according to claim 1, wherein, The target nucleic acid is a miRNA, preferably a human miRNA; Preferably, the target nucleic acid is at least one of the miRNAs of the let-7 family, preferably let-7a; More preferably, the target nucleic acid is let-7a-5p; And / or, the circular region of the affinity probe includes a nucleotide sequence complementary to the target nucleic acid or a fragment thereof; Preferably, the number of nucleotides in the circular region is not less than 10, and more preferably 15-45; And / or, the stem region of the affinity probe includes a first chemical modification group, which causes the stem region to be covalently connected to the solid support; Preferably, the first chemical modifying group is selected from at least one of thiol, amino, carboxyl, and azide groups; Preferably, the number of nucleotide pairs in the stem region is not less than 5 pairs, and more preferably 5-10 pairs; And / or, the solid support is a conductive material, preferably a silicon wafer and / or conductive glass; Preferably, the surface of the solid support has a second chemical modification group, and more preferably, the second chemical modification group includes at least one of Au, carboxyl, amino and alkynyl groups.
3. The chip according to claim 1 or 2, wherein, The circular region of the affinity probe includes the nucleotide sequence shown in SEQ ID NO:1; Preferably, the nucleotide sequence of the affinity probe is shown in SEQ ID NO:
2.
4. A method for preparing a chip that specifically identifies and captures target nucleic acids, characterized in that, The method includes contacting an affinity probe with a solid-phase carrier to immobilize the affinity probe on the surface of the solid-phase carrier, wherein the affinity probe includes a circular region and a stem region, the circular region including a sequence having the function of recognizing and capturing target nucleic acids, and the affinity probe is connected to the solid-phase carrier through the stem region.
5. The method according to claim 4, wherein, The target nucleic acid of the affinity probe is miRNA, preferably human miRNA; Preferably, the target nucleic acid is at least one of the miRNAs of the let-7 family, preferably let-7a; More preferably, the target nucleic acid is let-7a-5p; And / or, the circular region of the affinity probe includes a nucleotide sequence complementary to the target nucleic acid or a fragment thereof; Preferably, the number of nucleotides in the circular region is not less than 10, and more preferably 15-45; More preferably, the circular region of the affinity probe comprises the nucleotide sequence shown in SEQ ID NO:1; And / or, the stem region of the affinity probe includes a first chemical modification group, which causes the stem region to be covalently connected to the solid support; Preferably, the first chemical modifying group is selected from at least one of thiol, amino, carboxyl, and azide groups; Preferably, the number of nucleotide pairs in the stem region is not less than 5 pairs, and more preferably 5-10 pairs; More preferably, the nucleotide sequence of the affinity probe is shown in SEQ ID NO:2; And / or, the solid support is a conductive material, preferably a silicon wafer and / or conductive glass; Preferably, the surface of the solid support has a second chemical modification group, and more preferably, the second chemical modification group includes at least one of Au, carboxyl, amino and alkynyl groups.
6. The method according to claim 4, wherein, The contact conditions include: temperature 1-30℃, time 1-3h; Preferably, the method further includes a step of activating the affinity probe with an activator before contact, wherein the activator is preferably selected from 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide; More preferably, the activator is provided in the form of an aqueous solution, preferably with a concentration of 0.1-100 mM, and preferably with a concentration ratio of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride to N-hydroxysuccinimide of 1:0.8-1.
2.
7. The method according to claim 4 or 5, wherein, The method further includes a pretreatment step for the solid support; Preferably, the pretreatment includes cleaning and surface treatment of the solid support; More preferably, the cleaning includes treating the solid carrier with a plasma cleaner or a piranha solution; More preferably, the surface treatment includes a sealing treatment of non-specific adsorption sites on the surface of the solid support, or the surface treatment does not include a sealing treatment of non-specific adsorption sites on the surface of the solid support, preferably the surface treatment does not include a sealing treatment of non-specific adsorption sites on the surface of the solid support.
8. A method for detecting target miRNA in a sample, characterized in that, The method includes contacting the sample to be tested with the chip according to any one of claims 1-3, performing nucleic acid hybridization treatment, and detecting the chip after nucleic acid hybridization treatment using secondary ion time-of-flight mass spectrometry.
9. The method according to claim 8, wherein, The method includes the following steps: (1) Secondary ion time-of-flight mass spectrometry detection was performed on the hybridized sites. The primary ion source was selected from Bi source, wherein the Bi source was selected from Bi + and Bi3 + any one of them; Preferably, the selected primary ion source is Bi3. + ; (2) Determine the fixation of affinity probes and nucleic acid hybridization on the chip surface based on the detection results; Preferably, the first characteristic fragment ion is used as a signal marker for successful fixation of the affinity probe, and the second characteristic fragment ion is used as a signal marker for successful nucleic acid hybridization; The first characteristic fragment ion is selected from H2PO4. - HP2O6 - PO4 3- At least one of guanine, adenine, cytosine, and thymine, preferably H2PO4. - HP2O6 - At least one of thymine and thymine; the second characteristic fragment ion is uracil; Preferably, step (2) includes at least one of the following steps: (2-1) Determine the saturated fixation concentration of affinity probes: The same concentration of test sample is contacted with chips prepared using affinity probes with different concentration gradients to perform nucleic acid hybridization. Then, the chip after nucleic acid hybridization is detected by secondary ion time-of-flight mass spectrometry. The saturated fixation concentration of affinity probes is determined based on the detection results. (2-2) Determine the working curve of miRNA: The miRNA standard solutions with different concentration gradients are contacted with the chip prepared with the same concentration of affinity probe to perform nucleic acid hybridization treatment. Then, the chip after nucleic acid hybridization treatment is detected by secondary ion time-of-flight mass spectrometry, and the working curve of miRNA is determined according to the detection results. More preferably, step (2-1) includes plotting an affinity probe saturation concentration curve using the peak area ratio of thymine and uracil as the dependent variable and the affinity probe concentration as the independent variable. More preferably, step (2-2) includes plotting a miRNA working curve using the peak area ratio of uracil and thymine as the dependent variable and the miRNA concentration as the independent variable.
10. Use of the chip according to any one of claims 1-3 or the method according to claim 8 or 9 in the preparation of a product for detecting tumor marker miRNA.