Application of TaWOX5 gene in improving plant biomass and enhancing low nitrogen tolerance

Abstract

This invention discloses TaWOX5 The application of genes in increasing plant biomass and enhancing low nitrogen tolerance. TaWOX5 The CDS sequence of the gene is shown in SEQ ID NO.2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.1. This invention demonstrates the overexpression of the gene in oats. TaWOX5 It can significantly increase the number of tillers, photosynthetic efficiency, and aboveground biomass (by ≥21%), and significantly enhance nitrogen absorption and assimilation capacity and photosystem II activity under low nitrogen stress, thus mitigating photosynthetic damage. This gene can be applied to cultivate transgenic plants tolerant to low nitrogen and with high biomass, construct genetic transformation vectors, and perform molecular-assisted breeding, which is of great significance for increasing crop yields in low-nitrogen and infertile soils.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically... TaWOX5 Application of genes in increasing plant biomass and enhancing tolerance to low nitrogen. Background Technology

[0002] In their natural environment, plants, due to their immobility, are frequently affected by adverse environmental conditions such as nutrient deficiency. With the continuous depletion of nitrogen in arable soil and the implementation of requirements to reduce nitrogen fertilizer application in agriculture, low nitrogen stress has become the most severe abiotic nutrient stress limiting oat production. Oats are widely cultivated in the barren and dryland areas of Northwest and North my country. Insufficient soil nitrogen supply disrupts the photosynthetic sucrose translocation in flag leaves and inhibits carbon allocation in tillers, resulting in a reduction in tiller number and a significant decrease in forage yield, greatly hindering the improvement of quality and efficiency in my country's oat industry. Over a long period of plant evolution, a molecular, physiological, and biochemical synergistic regulatory system has been developed to cope with low nitrogen stress. Molecular pathways are the core hubs for regulating downstream physiological and biochemical responses. Isolating and cloning key genes for low nitrogen tolerance and using biotechnology to precisely regulate gene expression (mainly transcription factors) can comprehensively regulate multiple physiological processes such as nitrogen assimilation, source-sink carbon allocation, and tiller development, which is of great significance for improving the low nitrogen tolerance of oats. Existing studies have shown that oats actively inhibit growth under low nitrogen stress. Therefore, identifying key genes that can promote tillering and normal plant growth while significantly improving low nitrogen tolerance can provide core gene resources for molecular breeding to create new nitrogen-efficient oat materials. This is an important theoretical basis for solving practical problems such as significant yield reduction of oats in barren farmland and reducing nitrogen fertilizer dependence. Summary of the Invention

[0003] This application aims to solve the problems existing in the above-mentioned background art, and the present invention provides... TaWOX5 The application of genes in increasing plant biomass and enhancing low nitrogen tolerance, the TaWOX5 Genes positively regulate plant tolerance to low nitrogen and / or positively regulate plant biomass; The TaWOX5 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.1; The TaWOX5 The CDS sequence of the gene is shown in SEQ ID NO.2.

[0004] Furthermore, the present invention also provides a method comprising the aforementioned... TaWOX5 Gene vectors, transgenic recombinant strains, transgenic host cells, and recombinant expression cassettes.

[0005] The inclusion TaWOX5 Gene expression vectors are used to express the genes... TaWOX5 The gene was obtained by inserting it into the expression vector pANIC6B.

[0006] Furthermore, TaWOX5 The application of genes in increasing plant biomass and enhancing low nitrogen tolerance can also be applied to the following aspects: (1) Regulating plant tolerance to low nitrogen; (2) Regulating plant biomass; (3) To cultivate transgenic plants with improved traits of tolerance to low nitrogen and / or high biomass; (4) Prepare recombinant expression cassettes, recombinant vectors, recombinant strains or transgenic host cells for plant genetic transformation; (5) Improve the plant's adaptability and biomass yield in low-nitrogen soils; (6) Used for research on the molecular regulatory mechanisms and signaling pathways of plant responses to low nitrogen stress; (7) As a molecular marker, it can be used in molecular-assisted selection breeding for plant traits of low nitrogen tolerance and / or high biomass.

[0007] The present invention also provides a method for regulating plant tolerance to low nitrogen and / or biomass, comprising overexpressing the method described in claim 1 in the plant. TaWOX5 The steps of gene generation.

[0008] The present invention also provides a method for cultivating plants tolerant to low nitrogen and / or high biomass, comprising overexpressing the method described in claim 1 in the plant. TaWOX5 The steps of gene generation.

[0009] The present invention TaWOX5 Application of genes in increasing plant biomass and enhancing low nitrogen tolerance, the plant referred to is forage oats. Avena sativa L. 。

[0010] In summary, this technical solution demonstrates several important and beneficial effects: (a) Significantly increase plant biomass This invention is the first to discover and confirm that TaWOX5 The biological functions of genes in regulating plant biomass. Experiments show that under normal nitrogen supply conditions, TaWOX5 The aboveground biomass of the overexpressing oat lines was significantly increased by 21.84%–24.25% compared to the wild type, with a significant increase in the number of tillers per plant, and significantly larger flag leaf length and width. Simultaneously, the net photosynthetic rate, stomatal conductance, and RuBisCO enzyme activity of the flag leaves of the overexpressing lines were significantly higher than those of the wild type. The starch, sucrose, and glucose contents in the flag leaves were also significantly increased, as were the sucrose and glucose contents in the tillers. These results fully demonstrate that… TaWOX5By enhancing the plant's photosynthetic carbon fixation capacity and source-sink carbon allocation efficiency, this gene promotes tillering development and assimilate accumulation, thereby achieving a significant increase in overall biomass. Field trials further validated these results, indicating that this gene has important application value in agricultural production.

[0011] (ii) Significantly enhances the plant's tolerance to low nitrogen. This invention is the first to demonstrate TaWOX5 The function of genes in improving plant tolerance to low nitrogen stress. Low nitrogen stress treatment experiments showed that under low nitrogen conditions, TaWOX5 The overexpression lines exhibited significantly less leaf yellowing and significantly higher aboveground dry weight than the wild type, while there was no significant difference in belowground dry weight. Physiological parameters showed that under low nitrogen stress, the overexpression lines had significantly higher chlorophyll content, nitrogen balance index, maximum photochemical quantum yield (Fv / Fm) in photosystem II, and effective quantum yield (Y(II)) than the wild type, while the increase in non-photochemical quenching (NPQ) was significantly lower than that in the wild type, indicating... TaWOX5 Overexpression effectively mitigated the damage to the plant photosynthetic system caused by low nitrogen stress. Furthermore, the nitrate nitrogen content, root nitrate uptake rate, and glutamine synthase (GS) activity of the overexpressing lines were significantly higher than those of the wild type under low nitrogen treatment, indicating that... TaWOX5 Overexpression enhanced the plant's ability to absorb and assimilate nitrogen. These results indicate that... TaWOX5 By regulating nitrogen absorption and assimilation processes, the adaptability and growth performance of plants in low-nitrogen soil environments were effectively improved.

[0012] (iii) It has synergistic improvement effects and broad application prospects. The present invention provides TaWOX5 The gene effectively promotes plant growth and biomass accumulation under both normal and low nitrogen conditions, and exhibits stronger resistance under low nitrogen stress, achieving a synergistic improvement in both stress tolerance and growth potential. Derived from wheat, this gene, as an endogenous gene in gramineous crops, demonstrates higher biosafety and interspecific applicability when applied to the genetic improvement of gramineous crops such as oats, wheat, rice, and maize. This invention also provides... TaWOX5 The various applications of genes in plant breeding, construction of genetic transformation vectors, molecular marker-assisted selection, and research on abiotic stress response mechanisms such as drought / low nitrogen provide important gene resources and application tools for molecular breeding of nitrogen-efficient and high-yield crops. Attached Figure Description

[0013] Figure 1 For overexpression TaWOX5Identification results of transgenic positive feed oat plants; where A is the electrophoresis image of gene level identification of 'Yanwang' variety transgenic plants (M is Marker, PANIC-6B-TaWOX5 is positive control, wild type is negative control, water is blank control, 1-8 are independent transgenic lines); B is the transcriptional expression analysis of 'Yanwang' variety transgenic plants (different lowercase letters indicate significant differences). P <0.05); OE1 (#1), OE2 (#5), and OE3 (#6) are three independent transgenic positive lines with significantly increased transcriptional expression levels; C is the electrophoresis diagram of gene level identification of transgenic plants of the 'Qinghai Sweet' variety (M is the marker, PANIC-6B-TaWOX5 is the positive control, wild type is the negative control, and 1-9 are independent transgenic lines); D is the transcriptional expression analysis of transgenic plants of the 'Qinghai Sweet' variety (different lowercase letters indicate significant differences). P <0.05); OE1 (#5), OE2 (#8), and OE3 (#9) are three independent transgenic positive lines with significantly increased transcriptional expression levels.

[0014] Figure 2 for TaWOX5 Overexpression oats ( TaWOX5 Comparison of growth phenotypes and physiological indicators between the 'Yanwang' (OE, 'Yanwang') and wild-type Yanwang (WT). A shows a photograph of plant growth phenotype (scale bar 10 cm); B shows a photograph of flag leaf morphology (scale bar 10 cm); C shows aboveground biomass; D shows tiller number; E shows plant height; F shows flag leaf length; G shows flag leaf width; H shows heading time; I shows net photosynthetic rate; J shows stomatal conductance; K shows intercellular CO2 concentration; L shows RuBisCO enzyme activity; M shows flag leaf starch content; N shows flag leaf sucrose content; O shows flag leaf glucose content; P shows tiller bud sucrose content; Q shows tiller bud glucose content. Different lowercase letters indicate significant differences (…). P <0.05), ns indicates no significant difference.

[0015] Figure 3 for TaWOX5 Overexpression oats ( TaWOX5-OE, AE represent the 'Yanwang' variety, and FJ represents the 'Qinghaitian' variety) and their corresponding wild-type (WT) field growth phenotypes. Among them, A is a field growth phenotype photograph of the 'Yanwang' variety oat plant, scale bar 10 cm; B is a photograph of the whole plant in the field, scale bar 10 cm; C is a aboveground biomass chart; D is a tiller number chart; E is a plant height chart; F is a field growth phenotype photograph of the 'Qinghaitian' variety oat plant, scale bar 10 cm; G is a photograph of the whole plant in the field, scale bar 10 cm; H is an aboveground biomass chart; I is a tiller number chart; J is a plant height chart. Different lowercase letters indicate significant differences (…). P <0.05), ns indicates no significant difference.

[0016] Figure 4 for TaWOX5 Overexpression oats ( TaWOX5 Physiological phenotypes of *Yanwang* (OE, 'Yanwang') and wild-type *Yanwang* (WT) under low nitrogen stress were compared. A shows photographs of plant growth phenotypes under low nitrogen stress (HN: normal nitrogen treatment, LN: low nitrogen treatment), scale bar 10 cm; B shows aboveground dry weight; C shows underground dry weight; D shows chlorophyll content; E shows nitrogen balance index; F shows maximum photochemical quantum yield (Fv / Fm) of photosystem II; G shows effective quantum yield (Y(II)) of photosystem II; H shows non-photochemical quenching (NPQ); I shows nitrate nitrogen content; J shows root nitrate uptake rate; K shows glutamine synthase (GS) activity. Different lowercase letters indicate significant differences (…). P <0.05); ns indicates no significant difference. Detailed Implementation

[0017] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments will be clearly and completely described below with reference to the accompanying drawings. The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the present invention.

[0018] Example 1: TaWOX5 Gene acquisition and transgenic vector construction The protein provided by this invention is named as follows: TaWOX5, derived from wheat. Its amino acid sequence: MEALSGRVGVKCGRWNPTAEQVKVLTELFRAGLRTPSTEQIQRISTHLSAFGKVESKNVFYWFQNHKARERHHHKKRRRVASCSPDSSSNDEETGRAAAAEPADLVLQPPESKREARGYNHHPRIMTCYVREVAEQEEATTWERPTREVETLELFPLKAACYDLELEADRFSRYVRSGEQQCREISFFDVATGRDPPLELRLCSFDRYLV (SEQ ID NO.1).

[0019] To construct TaWOX5 the expression vector, TaWOX5 the CDS sequence obtained by gene synthesis: ATGGAGGCGCTGAGCGGGCGGGTGGGAGTGAAGTGCGGGCGGTGGAACCCGACGGCGGAGCAGGTGAAGGTGCTGACGGAGCTGTTCCGGGCGGGGCTGCGGACGCCGAGCACCGAGCAGATCCAGCGGATCTCCACCCACCTCAGCGCCTTCGGCAAGGTGGAGAGCAAGAACGTCTTCTACTGGTTCCAGAACCACAAGGCCCGCGAGCGCCACCACCACAAGAAGCGCCGCCGCGTCGCATCCTGCTCCCCCGACAGCAGCAGCAACGATGAAGAGACCGGCCGTGCCGCCGCCGCCGAGCCCGCCGACCTCGTGCTCCAGCCTCCCGAGAGCAAGCGGGAGGCCAGAGGCTACAACCACCACCCCCGGATCATGACATGCTATGTGAGGGAGGTGGCGGAGCAGGAAGAGGCGACGACGTGGGAGCGGCCGACGAGGGAAGTGGAGACGCTGGAGCTGTTCCCGCTCAAAGCAGCCTGCTACGACCTGGAGCTGGAGGCGGACAGGTTCAGCCGGTATGTGAGGAGCGGCGAGCAACAGTGCAGGGAGATCTCCTTCTTCGACGTGGCCACCGGACGGGATCCGCCGCTGGAGCTCAGGCTCTGCAGCTTCGATCGGTATCTGGTCTAG (SEQ ID NO.2).

[0020] For the product obtained by gene synthesis TaWOX5 Overexpression primers (OE-TaWOX5-F and OE-TaWOX5-R, Table 1) were designed based on the CDS sequence of the gene and successfully ligated into the overexpression vector PANIC-6B using the Gateway method.

[0021] Table 1 Primer names and sequences II. Cultivating Overexpression TaWOX5 Genetically modified feed oat plants The TaWOX5-PANIC-6B plasmid was transformed into Agrobacterium EHA105 strain, and then Agrobacterium-mediated genetic transformation was used to transform callus from two varieties of forage oats, 'Yanwang' and 'Qinghaitian'. After co-culture, redifferentiation, resistance selection, and rooting, overexpression was obtained. TaWOX5 Transgenic positive feed oat plants overexpressing TaWOX5 The results of gene and transcriptional identification of transgenic positive feed oat plants are as follows: Figure 1 As shown, the transgenic positive lines of 'Yanwang' with significantly elevated transcriptional expression levels, numbered 1, 5, and 6, were named OE1, OE2, and OE3, respectively, for subsequent functional verification of growth and stress phenotypes. The transgenic positive lines of 'Qinghaitian' with significantly elevated transcriptional expression levels, numbered 5, 8, and 9, were named OE1, OE2, and OE3, respectively, for subsequent field growth phenotype verification.

[0022] three, TaWOX5 Overexpression increases oat biomass 3 TaWOX5 Three plump, healthy seeds from each of the overexpression lines (OE1, OE2, and OE3) and wild-type (WT) oats were sown in 30cm diameter pots. After germination, one seedling of uniform growth was retained from each pot. When the oats reached the tillering stage, the sucrose and glucose content in the tillering buds was measured. At the heading stage, the heading time, flag leaf length and width, photosynthetic rate, and starch, glucose, and sucrose content were measured. At the milk stage, the oat plant height, number of tillers, and aboveground biomass were measured.

[0023] The results show that TaWOX5 Overexpression significantly increased oat biomass. Figure 2 A and C), were 21.84%, 21.55%, and 24.25% respectively, with a significant increase in tiller number ( Figure 2 A and D), plant height was significantly reduced ( Figure 2 A and E), flag leaf length ( Figure 2 B and F) and width ( Figure 2 Both B and G increased significantly, and the heading time also increased significantly. Figure 2 H), in addition, TaWOX5-OE The net photosynthetic rate of the flag leaf was significantly higher than that of the WT ( Figure 2 I), porosity ( Figure 2 J) was significantly higher than WT, but intracellular ( Figure 2 There was no significant difference in K, while RuBisCO enzyme activity was significantly increased ( Figure 2 L), photosynthetic products such as starch content ( Figure 2 M), sucrose content ( Figure 2 N) and glucose content ( Figure 2 O) was also significantly higher than WT, indicating TaWOX5 Overexpression enhanced the photosynthetic carbon fixation capacity of oats; in addition... TaWOX5- OE Sucrose in tillers ( Figure 2 P) and glucose ( Figure 2 The contents of Q) were significantly higher than those of the wild type. These results indicate that... TaWOX5 Overexpression may significantly increase oat yield by enhancing photosynthetic nitrogen fixation, leading to increased tiller number due to increased sugar production. In addition, under field growing conditions (… Figure 3 The growth phenotypes of two varieties, 'Yanwang' and 'Qinghaitian', were evaluated. Among them, the 'Yanwang' variety... TaWOX5 -OE biomass increased by 19.8%-32.5% compared to wild type (WT). Figure 3 C), and also more tillers ( Figure 3 D); similarly, the 'Qinghai Sweet' variety TaWOX5 -OE biomass is 22.4%-23.9% higher than wild type ( Figure 3 H), the number of tillers also increased ( Figure 3 I); There was no significant difference in plant height between the two transgenic varieties and the wild type. Figure 3 E and Figure 3 J). In summary, these results indicate that, TaWOX5 Overexpression of this substance can promote tillering growth in oats and increase oat biomass under different genetic backgrounds and environmental conditions.

[0024] Four, TaWOX5 Overexpression improves oat tolerance to low nitrogen In order to investigate TaWOX5 To investigate the biological functions of oats under low nitrogen stress, we subjected WT and three overexpression lines (OE1, OE2, OE3) to low nitrogen stress (LN, 0–0.2 mM NO3). - The other group was treated with normal nitrogen (NN, 4 mM NO3), while the other group received normal nitrogen (NN, 4 mM NO3). - (This serves as a control.) Phenotypic differences appeared approximately 4 weeks after the low nitrogen stress treatment. TaWOX5 The overexpression lines exhibited stronger tolerance to low nitrogen compared to WT.

[0025] Under low nitrogen stress, wild-type leaves turn yellow first and more leaves turn yellow over time. Figure 4 A); In addition, compared with normal nitrogen treatment, the aboveground dry weight of oat plants ( Figure 4 B) Significantly decreased after exposure to low nitrogen stress; under low nitrogen stress, TaWOX5 The aboveground dry weight of the overexpression lines ( Figure 4 B) is higher than the wild type, while the underground dry weight ( Figure 4 C) No significant differences. There were no significant differences in the above indicators between wild-type and overexpression lines under normal nitrogen treatment. Furthermore, under low nitrogen stress, the photosynthetic system of oats was affected, including chlorophyll content ( Figure 4 D) Nitrogen balance index ( Figure 4 E), Maximum photochemical quantum yield of photosystem II (Fv / Fm, Figure 4 F) and the effective quantum yield of optical system II (Y(II), Figure 4 G) all decreased significantly, but WT was lower than TaWOX5- OE The reduction is even greater, with non-photochemical quenching (NPQ) Figure 4 H) both increased significantly, but WT was higher than TaWOX5-OE The increase was even greater. All the above results indicate that the photosynthetic system of WT under low nitrogen stress is... TaWOX5-OE They suffer more severe damage. Meanwhile, physiological indicators related to nitrogen metabolism indicate that under normal nitrogen treatment, TaWOX5 There was no significant difference between the overexpression lines and the wild type, but under low nitrogen treatment, the nitrate nitrogen content of the overexpression lines was significantly higher. Figure 4 I) Root nitrate absorption rate ( Figure 4 J) and glutamine synthase (GS) activity Figure 4 K) was significantly higher than that of the wild type, but lower than that of the control group under normal nitrogen treatment. These results indicate that... TaWOX5 Overexpression significantly improved oat tolerance to low nitrogen, and this improvement was partly dependent on nitrogen uptake and assimilation processes.

[0026] Based on the above experimental results, this invention is the first to confirm that... TaWOX5 The gene plays a positive regulatory role in plant tolerance to low nitrogen and increased biomass. Since the function of this gene has been clearly identified, those skilled in the art are fully capable of applying the teachings of this invention to… TaWOX5 Genes are applied to multiple levels of plant genetic improvement. Specifically, based on the gene sequences and functions disclosed in this invention, conventional molecular biology techniques known in the art (such as Gateway recombination, Agrobacterium-mediated transformation, etc.) can be used to construct [genes containing...]. TaWOX5This invention involves the introduction of recombinant expression cassettes, recombinant expression vectors, recombinant strains, or transgenic host cells into target plants to achieve gene overexpression, thereby obtaining transgenic plants with low nitrogen tolerance and / or increased biomass. The aforementioned vector construction and genetic transformation methods are all mature technologies fully disclosed in the art and can be implemented without creative effort. Therefore, this invention can not only be used to regulate plant low nitrogen tolerance and biomass, but can also be further applied to the following aspects: cultivating transgenic plants with improved traits of low nitrogen tolerance and / or high biomass; preparing recombinant expression cassettes, recombinant vectors, recombinant strains, or transgenic host cells for plant genetic transformation; improving plant adaptability and biomass yield in low-nitrogen soils; studying the molecular regulatory mechanisms and signaling pathways of plant low nitrogen stress responses; and using them as molecular markers for molecular-assisted selection breeding of low nitrogen tolerance and / or high biomass traits in plants. The above applications are particularly suitable for forage oats (… Avena sativa (L.), and can also be extended to other gramineous crops. Therefore, this invention provides important genetic resources and technical support for molecular breeding of crops tolerating low nitrogen and achieving high yields.

[0027] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-described technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. TaWOX5 The application of genes in increasing plant biomass and enhancing low nitrogen tolerance, the TaWOX5 Genes positively regulate plant tolerance to low nitrogen and / or positively regulate plant biomass; The TaWOX5 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.1; The TaWOX5 The CDS sequence of the gene is shown in SEQ ID NO.

2.

2. An expression vector for positively regulating plant tolerance to low nitrogen and / or biomass, characterized in that, The vector contains the gene as described in claim 1.

3. The expression vector according to claim 2, characterized in that, The inclusion TaWOX5 Gene expression vectors are used to express the gene. TaWOX5 The gene was obtained by inserting it into the expression vector pANIC6B.

4. A transgenic recombinant strain that positively regulates plant tolerance to low nitrogen and / or biomass, characterized in that, This strain is a transgenic recombinant strain containing the gene described in claim 1.

5. A transgenic host cell that positively regulates plant tolerance to low nitrogen and / or biomass, characterized in that, The cell is a transgenic host cell containing the gene described in claim 1.

6. A recombinant expression cassette for positively regulating plant tolerance to low nitrogen and / or biomass, characterized in that, The expression cassette is a recombinant expression cassette containing the gene described in claim 1.

7. TaWOX5 The application of genes in increasing plant biomass and enhancing low nitrogen tolerance can also be applied to the following aspects: (1) Regulating plant tolerance to low nitrogen; (2) Regulating plant biomass; (3) To cultivate transgenic plants with improved traits of tolerance to low nitrogen and / or high biomass; (4) Prepare recombinant expression cassettes, recombinant vectors, recombinant strains or transgenic host cells for plant genetic transformation; (5) Improve the plant's adaptability and biomass yield in low-nitrogen soils; (6) Used for research on molecular regulatory mechanisms and signaling pathways of plant responses to low nitrogen stress; (7) As a molecular marker, it can be used in molecular-assisted selection breeding for plant traits of low nitrogen tolerance and / or high biomass.

8. A method for regulating plant tolerance to low nitrogen and / or biomass, characterized in that, Includes overexpression of the expression described in claim 1 in plants TaWOX5 The steps of gene generation.

9. A method for cultivating plants tolerant to low nitrogen and / or with high biomass, characterized in that, Includes overexpression of the expression described in claim 1 in plants TaWOX5 The steps of gene generation.

10. The plant described in claims 1, 2, 4, 5, 6, 7, 8, and 9 is forage oats. Avena sativa L.

Images