PCR-immunogold labeling kit for identifying plant-derived components in starch products

Abstract

The utility model discloses a PCR-immunogold label kit for identifying plant-derived components in starch products, and relates to the technical field of food-derived component identification. The utility model directly uses an immune colloidal gold test strip to observe the experimental results, avoiding the complex operation of electrophoresis gel running, visualizing the results, and only requires a portable PCR instrument to perform the detection work, which has low requirements for experimental instruments, facilitates the development of rapid detection work on the front line, and has safe, convenient and economical technical effects; through the setting of quantitative tubes and quantitative components, the injection of samples to be tested can be realized according to preset standard values, and compared with the manual counting of the number of drops in the prior art, the feeding amount is more accurate and the detection results are more reliable; cassava g3pdh gene, corn zSSIIb gene, and wheat GAG56D gene are selected as genes to be tested, and specific PCR detection primers are designed and synthesized, which have good specificity and sensitivity in the detection of corn, cassava, and wheat-derived components.

Description

Technical Field

[0001] The utility model relates to the technical field of food-derived component identification, in particular to a PCR-immunogold label kit for identifying plant-derived components in starch products. Background Art

[0002] Starch and starch products are common foods in people's daily diet. At present, the main types of starch include sweet potato starch, potato starch, corn starch, cassava starch, wheat starch, etc. The cost of starch raw materials and different processing technologies result in obvious differences in the prices of starch products. Due to the differences in sensory properties and physical and chemical indicators of different types of starch particles, it is difficult for consumers to distinguish them, and some high-priced starch products are mixed with low-priced starch products.

[0003] At present, the commonly used molecular identification technologies for starch products are mainly ordinary PCR and real-time fluorescence quantitative PCR. Ordinary PCR requires electrophoresis of the amplified product, which is complicated and harmful to human safety; real-time fluorescence quantitative PCR generally uses a more sensitive probe method for detection, and different fluorescent labels are required for multiple detections. The detection material cost is high and the instrument is expensive.

[0004] Therefore, technicians in this field are committed to developing a safe, convenient, accurate and economical technical means to identify plant-derived ingredients in starch products. Summary of the invention

[0005] In view of the above-mentioned defects of the prior art, the technical problem to be solved by the utility model is to provide a safe, convenient, accurate and economical technical means to identify plant-derived components in starch products.

[0006] To achieve the above-mentioned purpose, the utility model provides a PCR-immunogold labeling kit for identifying plant-derived components in starch products, comprising a primer set, a box body and a test paper placed in the box body; wherein,

[0007] The test paper comprises a water-absorbing filter paper, a conjugate pad attached with a rabbit-derived FITC antibody and a colloidal gold particle crosslinked body, a lateral chromatography matrix made of a nitrocellulose membrane, a substrate and a water-absorbing pad, wherein the substrate is located at the bottom layer, the lateral chromatography matrix is ​​pasted on the substrate, the water-absorbing filter paper is pasted on one end of the lateral chromatography matrix and the water-absorbing pad is pasted on the other end, the conjugate pad is pasted on the water-absorbing filter paper near one end of the water-absorbing pad, a T detection band and a C quality control band are arranged in the middle of the lateral chromatography matrix, the T detection band is attached with streptavidin and is arranged near the water-absorbing filter paper, and the C quality control band is attached with mouse anti-rabbit secondary antibody and is arranged near the water-absorbing pad;

[0008] A quantitative tube is provided on the upper cover of the box body in an area corresponding to the absorbent filter paper and extending downward, an observation port is provided on the upper cover of the box body in areas corresponding to the T detection band and the C quality control band, a movably openable and closable sealing plate is closely provided at the lower outlet of the quantitative tube, and a quantitative component is also included for controlling the sealing plate to open or close the lower outlet of the quantitative tube;

[0009] The primer set is used for specific detection of cassava target gene g3pdh, corn target gene zSSIIb, and wheat target gene GAG56D, and the primers include FITC and Biotin markers;

[0010] The cassava target gene G3phd detection primer sequence is:

[0011] F:TGGTTCTTGATCTGCGTGAG,

[0012] R:TGGGAGAACCTTTCCAACAG;

[0013] The maize target gene zSSIIb detection primer sequence is:

[0014] F:CGTCGTTTCCCATCTCTTCCTCT,

[0015] R:CCACTCCGAGACCCTCAGTC;

[0016] The wheat target gene GAG56D detection primer sequence is:

[0017] F: CAACAATTTTCTCAGCCCCAACA,

[0018] R:TTCTTGCATGGGTTCACCTGTT.

[0019] Furthermore, the quantitative component includes a slide groove opened on the box body, and a connecting rod that can slide along the slide groove, one end of the connecting rod is fixedly connected to the sealing plate, and the other end passes through the slide groove to the outside of the box body and is fixedly connected to a shift block.

[0020] Furthermore, the sealing plate is made of rubber.

[0021] Compared with the prior art, the utility model has the following beneficial effects:

[0022] (1) The utility model directly uses immunocolloidal gold test strips to observe the experimental results, avoiding the complicated operation of electrophoresis gel running, and the results are visualized. Only a portable PCR instrument is needed to perform the detection work, which has low requirements for experimental instruments, facilitates the rapid detection work on the front line, and has the technical effects of safety, convenience, and economy;

[0023] (2) By setting up the quantitative tube and the quantitative component, the sample to be tested can be injected according to the preset standard value. Compared with the manual counting of the number of drops in the prior art, the feeding amount is more accurate and the test result is more reliable;

[0024] (3) Cassava g3pdh gene, corn zSSIIb gene, and wheat GAG56D gene were selected as test genes, and specific PCR detection primers were designed and synthesized, which had good specificity and sensitivity in the detection of corn, cassava, and wheat derived components. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is a structural diagram of the test paper of the utility model;

[0026] Figure 2 It is a structural diagram of the utility model test kit;

[0027] Figure 3 It is a partial longitudinal section view of the test kit of the utility model;

[0028] Figure 4 It is a quantitative component structure diagram of the utility model;

[0029] Figure 5 (a) is the result of the specific detection experiment of corn in Example 1;

[0030] Figure 5 (b) is the result of the specific detection experiment of cassava in Example 1;

[0031] Figure 5 (c) is the result of the specific detection experiment of wheat in Example 1;

[0032] Figure 6 (a) is the result of the sensitivity detection experiment of corn in Example 2;

[0033] Figure 6 (b) is the result of the sensitivity detection experiment of cassava in Example 2;

[0034] Figure 6 (c) in FIG. 2 is the result of the sensitivity detection experiment of wheat in Example 2.

[0035] Figure numerals: 1. absorbent filter paper; 2. conjugate pad; 3. lateral chromatography matrix; 4. T detection tape; 5. C quality control tape; 6. substrate; 7. absorbent pad; 8. box body; 9. quantitative tube; 10. slide groove; 11. connecting rod; 12. shift block; 13. sealing plate; 14. observation port. DETAILED DESCRIPTION

[0036] The following describes several preferred embodiments of the utility model with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The utility model can be embodied in many different forms of embodiments, and the protection scope of the utility model is not limited to the embodiments mentioned in the text.

[0037] In the drawings, components with the same structure are indicated by the same numerical labels, and components with similar structures or functions are indicated by similar numerical labels. The size and thickness of each component shown in the drawings are arbitrarily shown, and the utility model does not limit the size and thickness of each component. In order to make the illustration clearer, the thickness of the components is appropriately exaggerated in some places in the drawings.

[0038] like Figures 1 to 4 As shown, the PCR-immunogold labeling kit for identifying plant-derived components in starch products of the present invention comprises a primer set, a box body 8 and a test paper placed in the box body 8; wherein,

[0039] The test paper comprises a water-absorbing filter paper 1, a conjugate pad 2 with a crosslinked body of rabbit-derived FITC antibody and colloidal gold particles, a lateral chromatography matrix 3 made of a nitrocellulose membrane, a substrate 6 and a water-absorbing pad 7, wherein the substrate 6 is located at the bottom layer, the lateral chromatography matrix 3 is pasted on the substrate 6, the water-absorbing filter paper 1 is pasted on one end of the lateral chromatography matrix 3, and the water-absorbing pad 7 is pasted on the other end, the conjugate pad 2 is pasted on the end of the water-absorbing filter paper 1 close to the water-absorbing pad 7, a T detection band 4 and a C quality control band 5 are arranged in the middle of the lateral chromatography matrix 3, the T detection band 4 is attached with streptavidin and is arranged close to the water-absorbing filter paper 1, and the C quality control band 5 is attached with mouse anti-rabbit secondary antibody and is arranged close to the water-absorbing pad 7;

[0040] A quantitative tube 9 is provided on the upper cover of the box body 8 and extends downward through the area corresponding to the absorbent filter paper 1. An observation port 14 is provided on the upper cover of the box body 8 and in the area corresponding to the T detection band 4 and the C quality control band 5. A movable sealing plate 13 is closely provided at the lower outlet of the quantitative tube 9, and a quantitative component is also provided for controlling the sealing plate 13 to open or close the lower outlet of the quantitative tube 9.

[0041] The primer set is used for specifically detecting the cassava target gene g3pdh, the corn target gene zSSIIb and the wheat target gene GAG56D, and the primers include FITC and Biotin markers.

[0042] Furthermore, the quantitative component includes a slide groove 10 opened on the box body 8, and a connecting rod 11 that can slide along the slide groove 10, one end of the connecting rod 11 is fixedly connected to the sealing plate 13, and the other end passes through the slide groove 10 to the outside of the box body 8 and is fixedly connected to a shift block 12.

[0043] Furthermore, the sealing plate 13 is made of rubber.

[0044] When the test kit is in use, first slide the dial block 12 to position the sealing plate 13 below the quantitative tube 9, close the lower outlet of the quantitative tube 9, and drip the sample to be tested into the quantitative tube 9, that is, the volume of the injected sample to be tested is substantially the same as the volume of the quantitative tube 9, thereby achieving quantitative injection of the sample to be tested; then slide the dial block 12 and open the lower outlet of the quantitative tube 9 to start the test paper detection process.

[0045] The quantitative tube 9 and the quantitative assembly can realize the injection of the sample to be tested according to the preset standard value. Compared with the manual counting of the number of drops in the prior art, the feeding amount is more accurate and the detection result is more reliable.

[0046] Example 1

[0047] A specific detection experiment was conducted, and cassava g3pdh gene, corn zSSIIb gene, and wheat GAG56D gene were selected as the genes to be tested. Specific PCR detection primers were designed and synthesized, and FITC and Biotin were respectively labeled at the 5' ends of the upstream and downstream primers. The sequences of the above detection primers are:

[0048] Cassava (target gene G3phd):

[0049] F:TGGTTCTTGATCTGCGTGAG

[0050] R:TGGGAGAACCTTTCCAACAG

[0051] Maize (target gene zSSIIb):

[0052] F:CGTCGTTTCCCATCTCTTCTCCT

[0053] R:CCACTCCGAGACCCTCAGTC

[0054] Wheat (target gene GAG56D):

[0055] F:CAACAATTTTCTCAGCCCCAACA

[0056] R:TTCTTGCATGGGTTCACCTGTT

[0057] DNA was extracted from the starch sample to be tested, and the obtained DNA was PCR amplified using cassava, corn and wheat PCR primers to obtain PCR amplification products, which contained FITC and Biotin markers.

[0058] Corn was used as the test object, and other starch-containing plants (cassava, wheat, rice, potato, soybean and mung bean) were used as negative controls. Sterile distilled water was used as a template for blank control. The designed primers were used for PCR amplification and test strip verification. Two parallel experiments were set up. The specific verification of cassava and wheat was similar.

[0059] like Figure 5 In the specificity experiment of corn shown in (a), the corresponding relationship of the test strip numbers in the figure is: 1 corn, 2 cassava, 3 wheat, 4 rice, 5 potato, 6 soybean, 7 mung bean, 8 blank control. The experimental results are as follows: only corn has bands in both the quality control band and the test band of the test strip, while the blank control and cassava, wheat, rice, potato, soybean, and mung bean have only the quality control band but no test band. The repeatability between the two parallels is good, indicating that the specificity of corn is good;

[0060] like Figure 5 In the specificity experiment of cassava shown in (b), the corresponding relationship of the test strip numbers in the figure is: 1 cassava, 2 corn, 3 wheat, 4 rice, 5 potato, 6 soybean, 7 mung bean, 8 blank control. The experimental results are as follows: only cassava has bands in both the quality control band and the test band of the test strip, while the blank control and corn, wheat, rice, potato, soybean, and mung bean have only the quality control band but no test band. The repeatability between the two parallels is good, indicating that cassava has good specificity;

[0061] like Figure 5 In the specificity experiment of wheat shown in (c), the corresponding relationship of the test strip numbers in the figure is: 1 wheat, 2 corn, 3 cassava, 4 rice, 5 potato, 6 soybean, 7 mung bean, 8 blank control. The experimental results are as follows: only wheat has bands in both the quality control band and the test band of the test strip; while the blank control and cassava, corn, rice, potato, soybean, and mung bean have only the quality control band but no test band, and the repeatability between the two parallels is good, indicating that the specificity of wheat is good.

[0062] Example 2

[0063] A sensitivity detection experiment was conducted, and the genomic DNA of corn, cassava, and wheat was quantified to 50 ng / μL, and diluted with deionized water to seven concentration gradients of 50, 20, 10, 1, 0.1, 0.01, and 0.001 ng / μL on test strips. Two parallel experiments were set up, and the PCR-immunogold-labeled test strip reaction system and conditions in the utility model were used for amplification to verify the sensitivity of the kit of the utility model.

[0064] like Figure 6The parameters corresponding to the test strip numbers in the figure are: 1, 2, 3, 4, 5, 6, 7, and the corresponding genomic DNA concentrations are 50, 20, 10, 1, 0.1, 0.01, and 0.001 ng / μL, respectively. The experimental results show that all three genomes can be stably detected at a concentration of 0.01 ng / μL and the repeatability between two parallels is good, indicating that the sensitivity of the method can reach 0.01 ng / μL.

[0065] The preferred specific embodiments of the utility model are described in detail above. It should be understood that ordinary technology in the field can make many modifications and changes according to the concept of the utility model without creative work. Therefore, any technical solution that can be obtained by a technician in the technical field based on the concept of the utility model through logical analysis, reasoning or limited experiments on the basis of the existing technology should be within the scope of protection determined by the claims.

Claims

1. A PCR-immunogold labeling kit for identifying plant-derived components in starch products, characterized in that: It comprises a primer set, a box body (8) and a test paper placed in the box body (8); wherein: The test paper comprises a water-absorbing filter paper (1), a conjugate pad (2) with a rabbit-derived FITC antibody and a colloidal gold particle crosslinked body, a lateral chromatography matrix (3) made of a nitrocellulose membrane, a substrate (6) and a water-absorbing pad (7), wherein the substrate (6) is located at the bottom layer, the lateral chromatography matrix (3) is pasted on the substrate (6), the water-absorbing filter paper (1) is pasted on one end of the lateral chromatography matrix (3) and the water-absorbing pad (7) is pasted on the other end, the conjugate pad (2) is pasted on the end of the water-absorbing filter paper (1) close to the water-absorbing pad (7), a T detection band (4) and a C quality control band (5) are arranged in the middle of the lateral chromatography matrix (3), the T detection band (4) is pasted with streptavidin and is arranged close to the water-absorbing filter paper (1), and the C quality control band (5) is pasted with mouse anti-rabbit secondary antibody and is arranged close to the water-absorbing pad (7); A quantitative tube (9) is provided on the upper cover of the box body (8) in an area corresponding to the absorbent filter paper (1) and extending downward therefrom, and an observation port (14) is provided on the upper cover of the box body (8) in areas corresponding to the T detection band (4) and the C quality control band (5). A movably openable and closable sealing plate (13) is closely provided at the lower outlet of the quantitative tube (9), and a quantitative component is also provided for controlling the sealing plate (13) to open or close the lower outlet of the quantitative tube (9).

2. The PCR-immunogold labeling kit for identifying plant-derived components in starch products according to claim 1, characterized in that: The quantitative assembly comprises a slide groove (10) provided on the box body (8), and a connecting rod (11) which can slide along the slide groove (10); one end of the connecting rod (11) is fixedly connected to the sealing plate (13), and the other end passes through the slide groove (10) to the outside of the box body (8) and is fixedly connected to a shifting block (12).

3. The PCR-immunogold labeling kit for identifying plant-derived components in starch products according to claim 1, characterized in that: The sealing plate (13) is made of rubber material.

Images