METHOD AND SYSTEM FOR REPLENISHING A NUCLEAN ACID

DE502017016959D1Active Publication Date: 2025-07-31HP HEALTH SOLUTIONS GERMANY GMBH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
DE502017016959
Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
Priority Date
2016-12-16
Filing Date
2017-12-06
Publication Date
2025-07-31
Estimated Expiration
2037-12-06

AI Technical Summary

Technical Problem

Existing methods for amplifying nucleic acids are not flexible and require complex functionalization of nanoparticles for each specific application, leading to increased effort and cost.

Method used

A system and method utilizing local heating elements functionalized with compound nucleic acids, along with primer and primer complementary nucleic acids, allow for rapid and flexible nucleic acid amplification by localized heating, reducing the need for specific functionalization of nanoparticles for each application.

Benefits of technology

Enables rapid and efficient nucleic acid amplification with reduced time and cost, allowing for universal use of local heating elements with adaptable primer nucleic acids, and supports multiplexing of different nucleic acids simultaneously.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

[0001] The present invention relates to a method and a system for amplifying a nucleic acid. Furthermore, the invention relates to a primer nucleic acid, a primer complement nucleic acid, and a local heating element for a polymerase chain reaction for amplifying a nucleic acid. State of the art

[0002] DE 10 2012 201 475 A1 appears to disclose a method for amplifying a nucleic acid, in which, according to at least some embodiments, nanoparticle-oligonucleotide conjugates are used. The nanoparticles are linked to primers in such a way that covalent bonds with at least one thiol linker are present between the primers and the nanoparticles in order to reduce the risk of primer detachment, particularly during a denaturation step, and to increase PCR efficiency.

[0003] US 2003 / 0022169 A1 does not appear to disclose a method for amplifying nucleic acid, but rather a method for detecting nucleic acids. For this purpose, the nucleic acid to be detected is apparently bound to a type of nanoparticle to which oligonucleotides are attached, forming nanoparticle-oligonucleotide conjugates. The method appears to be based on the fact that hybridization of the oligonucleotides attached to the nanoparticles with the nucleic acid to be detected causes a measurable change. Furthermore, a system for detecting a specific nucleic acid appears to be disclosed, in which oligonucleotides are attached to the nanoparticles.These oligonucleotides can then in turn hybridize with a binding nucleotide which has at least two sections, wherein a first section is complementary to at least a partial sequence of the oligonucleotides attached to the nanoparticle and a second part is complementary to a partial sequence of the nucleic acid.

[0004] US 2004 / 038229 A1 appears to disclose a method for the enzymatic manipulation of DNA bound to metal particles. In particular, it appears to be disclosed to provide nanoparticles with a single-stranded DNA primer directly bound to them, and to connect a single-stranded DNA to be amplified to the primer by annealing. After amplification, which appears to occur independently of the nanoparticle, the nanoparticle appears to be used to detect the amplified nucleic acid.

[0005] US 2011 / 0274706 A1 appears to disclose a vehicle for delivering nucleic acids to target cells, wherein the vehicle comprises a plurality of nanoparticles and a plurality of nucleic acids. The nanoparticles and the nucleic acids are agglomerated in such a way that they form a nucleic acid granulation particle with a size of at least 20 nm. In this context, it also appears to be disclosed that the nucleic acids can be bound to the nanoparticles via linkers, which can be in the form of oligonucleotides, such as specific primers.

[0006] EP 1 179 185 B1 appears to disclose a method for detecting analytes using semiconductor nanocrystals. In the context of a method known as "fluorescence in situ hybridization (FISH)" for detecting biological samples, it appears to be disclosed that DNA primers can be linked to nanocrystals via nanocrystal-linked nucleotides. Regardless of the detection method, conventional PCR appears to be able to be used to generate nucleic acid fragments for the FISH samples.

[0007] US 2016 / 6265044 A1 appears to disclose conjugates in which a biomolecule is linked to a label, in particular to polymerases, wherein the conjugate exhibits polymerase activity. Furthermore, it appears to be generally disclosed that the biomolecules and / or labels are bound to a surface, wherein the binding can lead to a reversible or irreversible immobilization of nanoparticles, polymerases, oligonucleotides, and primers, etc., on a surface. As further appears to be disclosed, suitable linkers can be used to connect biomolecules, labels, such as nanoparticles, and a surface. Accordingly, the linkers can apparently be attached to the surfaces, the nanoparticles, and / or the primers via covalent bonding, non-covalent bonding, ionic bonding, hydrophobic interactions, or a combination thereof.

[0008] A heating mechanism for DNA applications appears to be known from US 2014 / 0170664 A1. In particular, a preferred embodiment appears to disclose heating a PCR solution by irradiating nanoparticles contained therein. Gold nanospheres appear to be preferably used, which are firmly and irreversibly bound to PCR primers by means of a covalent bond, in particular a thiol bond.

[0009] US 2014 / 0127695 A1 appears to disclose a method for detecting nucleic acids, in which magnetic nanoparticles and detectable nanoparticles are provided. Furthermore, according to one embodiment, a nanoparticle-based system for amplifying a nucleic acid, for example, by PCR, appears to be provided. Primers are attached to the nanoparticles. After the primers attached to the nanoparticles have been elongated, they can hybridize to form a complex. Furthermore, it appears to be disclosed that, for detection purposes, PCR primers are replaced by primers coated on nanoparticles.

[0010] EP 2 110 175 A1 appears to disclose a method for thermally controlling at least one temperature-dependent hybridization or binding reaction or an enzymatic reaction to perform amplification in the presence of magnetic nanoparticles. In particular, it appears to be known to bind single-stranded nucleic acids, such as oligonucleotides or PCR products, to a bead surface via linker molecules.

[0011] From the publication Liu et al., Biotechnol. J. 2007, 2, 508-511: "PCR amplification on magnetic nanoparticles: Application for high-throughput single nucleotide polymorphism genotyping," a method appears to be known in which PCR products are amplified directly on magnetic nanoparticles, with reverse primers appearing to be immobilized on the magnetic nanoparticles by means of a covalent bond.

[0012] US Pat. No. 6,953,659 B2 appears to disclose a method in which modulators, which can be in the form of metal nanoparticles, are used to transfer heat to a nucleic acid, with the nucleic acid being directly bound to one of the modulators. Furthermore, the modulators appear to be used for local heating in a PCR reaction. Furthermore, it appears to be disclosed that primers for an amplification reaction are modified to include a modulator.

[0013] WO2004 / 055160 A2 discloses a synthesis of fluorescent single-stranded DNA using "click chemistry," as well as the use of the fluorescent single-stranded DNA as a primer for the production of DNA sequencing fragments. Using "click chemistry," biomolecules are bound to other components, for example, DNA is bound to a chip by covalent bonding.

[0014] WO2016 / 074701A1 discloses nanoparticles in which integral primer nucleic acids are directly bound to the nanoparticles. The integral primer nucleic acids comprise two partial sequences, one of which is configured as a primer sequence and the other as a spacer sequence, which separates the primer sequence from the nanoparticle. The two partial sequences of the integral primer nucleic acids can optionally be linked to each other via an abasic modification.

[0015] WO 99 / 22030 A1 discloses a method for sequencing by flow cytometry in which primers are bound to microspheres whose fluorescence is used for detection.

[0016] WO 2013 / 113910 A1 discloses a method for amplifying nucleic acids in which primers can be directly bound to a nanoparticle. The problem underlying the invention

[0017] The invention is based on the object of providing a system and / or method for amplifying a nucleic acid that is easier to provide and / or more flexible, and a method that is easier to implement. Furthermore, the invention is based on the object of providing components for a system and method for amplifying a nucleic acid that is easier to provide and / or more flexible. Disclosure of the invention

[0018] This object is achieved by a method according to the invention, a system according to the invention, and a local heating element according to the invention having the features of the corresponding independent claims. Preferred embodiments emerge from the dependent claims, as well as from the description and the figures.

[0019] In a first aspect, the invention relates to a system for amplifying a nucleic acid, comprising at least one local heating element functionalized with at least one compound nucleic acid, and at least one primer nucleic acid designed to bind to the at least one compound nucleic acid and to bind to the nucleic acid. Alternatively or in addition to the primer nucleic acid, the system can comprise at least one primer complement nucleic acid designed to bind to the at least one compound nucleic acid and to elongate the compound nucleic acid by means of an enzymatic reaction by a primer nucleotide sequence. In a further aspect, the invention relates to a method for amplifying a nucleic acid in a reaction solution, comprising providing at least one local heating element in the reaction solution, wherein the local heating element is functionalized with at least one compound nucleic acid.Furthermore, the method comprises providing and / or generating at least one primer nucleic acid in the reaction solution, wherein the primer nucleic acid is configured to bind to the at least one connecting nucleic acid and to bind to the nucleic acid. Furthermore, the method comprises transferring heat through the local heating element to an environment of the local heating element such that a nucleic acid connected to the at least one local heating element via the at least one primer nucleic acid and the at least one connecting nucleic acid is heated to and / or above a denaturation temperature.

[0020] In a further aspect, the invention relates to a primer nucleic acid for a polymerase chain reaction for amplifying a nucleic acid, comprising a connecting portion and a primer portion, wherein the connecting portion is designed to bind to a connecting nucleic acid, and wherein the primer portion is designed to bind at least partially to the nucleic acid and to act as a primer in the polymerase chain reaction.

[0021] In a further aspect, the invention relates to the use of a primer nucleic acid as a primer for a polymerase chain reaction for amplifying a nucleic acid, wherein the primer nucleic acid comprises a connecting portion and a primer portion, wherein the connecting portion is designed to bind to a connecting nucleic acid, and wherein the primer portion is designed to bind at least partially to the nucleic acid and to act as a primer in the polymerase chain reaction.

[0022] In a further aspect, the invention relates to a primer complementary nucleic acid for a polymerase chain reaction for amplifying a nucleic acid, comprising a linking portion and a primer complementary portion, wherein the linking portion is designed to bind to a linking nucleic acid, and wherein the primer complementary portion is designed to elongate the linking nucleic acid by means of an enzymatic reaction around a primer nucleotide sequence and / or a primer nucleic acid.

[0023] In a further aspect, the invention relates to the use of a primer complementary nucleic acid as a primer template for a polymerase chain reaction for amplifying a nucleic acid, comprising a linking portion and a primer complementary portion, wherein the linking portion is adapted to bind to a linking nucleic acid, and wherein the primer complementary portion is adapted to elongate the linking nucleic acid around a primer nucleotide sequence and / or a primer nucleic acid by means of an enzymatic reaction.

[0024] In a further aspect, the invention relates to a local heating element for a polymerase chain reaction for amplifying a nucleic acid, wherein the local heating element is functionalized with at least one linking nucleic acid and the at least one linking nucleic acid is designed to bind to a primer nucleic acid and / or to a primer complementary nucleic acid.

[0025] In a further aspect, the invention relates to the use of a local heating element in a polymerase chain reaction for amplifying a nucleic acid, wherein the local heating element is functionalized with at least one linking nucleic acid and the at least one linking nucleic acid is designed to bind to a primer nucleic acid and / or to a primer complementary nucleic acid.

[0026] Replicating a nucleic acid is, in particular, amplifying a nucleic acid, preferably by means of an enzymatic reaction. In other words, replicating a nucleic acid preferably essentially corresponds to duplicating one or more nucleic acids, in particular specific nucleic acids, i.e., nucleic acids whose nucleotide sequence is at least partially known and which are preferably specifically selected and / or amplified based on the known nucleotide sequence. In other words, replicating a nucleic acid preferably relates to copying the nucleic acids, i.e., creating essentially identical amplicons or copies of the nucleic acid to be amplified.

[0027] The nucleic acid is preferably amplified using a polymerase chain reaction, also referred to below as PCR (polymerase chain reaction). A PCR, within the meaning of the present invention, is a method for amplifying nucleic acids in which a replication cycle consisting of the steps of denaturation, hybridization, and elongation is repeatedly performed, preferably in this order. In each run, the number of nucleic acid molecules can be increased (typically doubled at best), resulting in an exponential increase in the number of nucleic acid molecules. In the following, a nucleic acid to be amplified is referred to as the "original." The original is a single strand and, together with its complementary strand, referred to as the "complement," can form a double strand. The original and the complement can be part of a larger nucleic acid.In particular, in PCR, a copy of the original produced in one run of the amplification cycle can serve as a template for forming a complement in a subsequent run, and a resulting copy of the complement can serve as a template for forming an original in a subsequent run. A common term for the amplification product is "amplicon."

[0028] The denaturation step serves to denature a nucleic acid double strand, i.e., to separate it into its two individual strands. For example, the denaturation step can separate the original from the complement. The preferred type of denaturation according to the invention is thermal denaturation (also referred to as "melting"). For this purpose, at least part of the nucleic acid double strand or the entire double strand is exposed to a temperature, referred to as the "denaturation temperature," which causes or at least promotes the separation of the nucleic acid double strands. On the one hand, the preferred denaturation temperature is chosen to be high enough that nucleic acid double strands can be separated. On the other hand, the preferred denaturation temperature can be chosen to be low enough that a DNA polymerase, which may also be present in the sample and may also be in the heated area orin the vicinity of a local heating element is not significantly damaged. However, since the probability of a polymerase being in the vicinity of a local heating element is very low, consideration of the polymerase may be unnecessary when choosing the denaturation temperature. A typical value for the denaturation temperature is 95°C.

[0029] To facilitate the following explanation of the invention, "denaturation step" in the nomenclature of the present invention refers to the step of the method in which the heating device generates heat in order to warm or heat at least a portion of the reaction volume and thereby cause denaturation of double-stranded nucleic acid molecules in the heated portion of the reaction volume. The duration of the denaturation step is therefore the sum of the time in which the heating device generates heat in the run of the PCR cycle relating to the denaturation step. In the case of a heating resistor as the heating device, the duration of the denaturation step is therefore preferably the entire duration of a current being passed through the heating device in order to heat the reaction volume and thereby cause denaturation of double-stranded nucleic acid molecules. In the case of optothermally excited nanoparticles as the local heating element orAs a heating device, the duration of the denaturation step is the duration for which the optical excitation source impinges on the nanoparticle in order to at least partially heat the reaction volume and thereby cause denaturation of double-stranded nucleic acid molecules. If the heating device generates heat in one run of the amplification cycle rather than in several separate time intervals, the duration of the denaturation step is the sum of the durations of these intervals. In particular, the denaturation step defined in this way does not include the release of heat due to the inherent heat capacity of the heating device, nor does it include the decay of the temperature in the part of the reaction volume adjacent to the heating device, even if the temperatures there are still within the range required for denaturation.This means, in particular, that in the process according to the invention, denaturation can still occur even after the denaturation step defined in this way. It also means that the heat released in the denaturation step is generally lower than the heat generated in the denaturation step.

[0030] PCR preferably also uses at least two oligonucleotides, referred to as "primers," a forward primer and a reverse primer. The forward primer is complementary to the 3' end of the original, and the reverse primer is complementary to the 3' end of the complement. In the hybridization step (also referred to as the "annealing step"), the forward primer and / or the reverse primer hybridizes to a complementary sequence in the original, complement, or amplicon. The hybridization step usually takes place at a temperature that induces or at least promotes hybridization of the forward and reverse primers to their complementary sequences in the original, complement, or amplicon. It is preferably chosen to enable the most specific hybridization of the primers possible. The hybridization temperature is typically between 50°C and 72°C.

[0031] In the elongation step, the hybridized primers are complementarily extended or elongated by a polymerase enzyme. Thus, a complement can be synthesized starting from the forward primer, and an original can be synthesized starting from the reverse primer. For the purpose of elongation, the polymerase is exposed to a temperature that enables or at least promotes elongation. When using a polymerase from the bacterium Thermus aquaticus (Taq), an elongation temperature of 72°C is typically used. In some embodiments of PCR, the hybridization and elongation temperatures are identical, meaning both steps take place at the same temperature (i.e., there are only two temperature stages during PCR: a combined hybridization and elongation temperature, and a denaturation temperature).

[0032] The terms "nucleic acid" and "oligonucleotide" in the context of the present invention include not only (deoxy)ribonucleic acids or (deoxy)oligoribonucleotides, even if the aforementioned are preferred, but also nucleic acids and oligonucleotides which contain one or more nucleotide analogues with modifications to their backbone (for example methylphosphonates, phosphothioates or peptide nucleic acids (PNA), in particular to a sugar of the backbone (for example 2'-O-alkyl derivatives, 3'- and / or 5'-aminoriboses, locked nucleic acids [LNA], hexitol nucleic acids, morpholinos, glycol nucleic acid (GNA), threose nucleic acid (TNA) or tricyclo-DNA, compare the article by D. Renneberg and CJ Leumann, "Watson-Crick base-pairing properties of Tricyclo-DNA", J. Am. Chem. Soc., 2002, vol.124, pages 5993-6002, the relevant content of which is incorporated by reference into the present disclosure) or which contain base analogues, for example 7-deazapurines or universal bases such as nitroindole or modified natural bases such as N4-ethylcytosine. In one embodiment of the invention, the nucleic acids or oligonucleotides are conjugates or chimeras with non-nucleoside analogues, for example PNA. In one embodiment of the invention, the nucleic acids or oligonucleotides contain non-nucleoside units such as spacers, for example hexaethylene glycol or Cn spacers with n between 3 and 6, at one or more positions. If the nucleic acids or oligonucleotides contain modifications, these are selected such that hybridization with natural DNA / RNA analytes is possible even with the modification.Preferred modifications influence the melting behavior, preferably the melting temperature, in particular to distinguish between hybrids with different degrees of base complementarity (mismatch discrimination). Preferred modifications include LNA, 8-aza-7-deaza-purines, 5-propynyl-uracil and -cytosine, and / or abasic interruptions or modifications in the nucleic acid or oligonucleotide. Further modifications within the meaning of the invention include, for example, modifications with biotin, thiol, and fluorescence donor and fluorescence acceptor molecules.

[0033] Abasic modifications are preferably selected from a group comprising: 1',2'-dideoxyribose (dSpacer), triethylene glycol (Spacer9) and hexaethylene glycol (Spacer18).

[0034] The method according to the invention takes place in a reaction volume or in a reaction solution. In the context of the present invention, this means that the amplification of the nucleic acids takes place in at least part of a contiguous reaction volume. The reaction volume is a liquid solution or at least part of a reaction solution or suspension, which, in addition to the solvent or suspending agent, preferably water, usually also contains the nucleic acid(s) to be amplified (hereinafter also referred to as "target" or "target nucleic acid(s)"). It also generally contains originals and complements and / or other components, for example, polymerase(s), dNTPs, and salts, which may be suspended or dissolved.

[0035] A linking nucleic acid is in particular a nucleic acid that is functionalized with a local heating element and has a nucleotide sequence that enables binding or hybridization of another nucleic acid, in particular a primer nucleic acid and / or a primer complement nucleic acid, to the linking nucleic acid. The linking nucleic acid is preferably present as a single-stranded nucleic acid, in particular as a single-stranded oligonucleotide. Preferably, the linking nucleic acid does not function as a primer for the PCR, i.e., the linking nucleic acid preferably does not have a nucleotide sequence that functions as a primer in a PCR. Preferably, the linking nucleic acid has a nucleotide sequence that is as universal as possible, which enables the user to easily adapt or suitably design other nucleic acids that are intended to bind to the linking nucleic acid.This means that the nucleic acid intended to bind to the connecting nucleic acid can be at least partially provided with a nucleotide sequence which, for example in an overhang, is at least partially complementary to the most universal nucleotide sequence of the connecting nucleic acid.

[0036] A primer nucleic acid is a nucleic acid that serves or can serve as a primer for amplifying the nucleic acid. The primer nucleic acid is preferably present as an oligonucleotide. Particularly preferably, at least part of the nucleotide sequence of the primer nucleic acid is at least partially complementary to the nucleic acid to be amplified. The primer nucleic acid can, for example, be designed as a forward primer and / or as a reverse primer. The primer nucleic acid can, in particular, have multiple parts, wherein, for example, one part is designed to act as a primer for the PCR, while another part or several other parts are designed with other functions. For example, another part of the primer nucleic acid can be designed to bind to the connecting nucleic acid.

[0037] A primer complementary nucleic acid is a nucleic acid that serves to generate primers. The primer complementary nucleic acid is preferably present as an oligonucleotide. Preferably, at least part of the nucleotide sequence of the primer complementary nucleic acid is at least partially complementary to a primer for amplifying the nucleic acid. In other words, the primer complementary nucleic acid is preferably at least partially designed such that, for example, by an enzymatic reaction, at least part of the primer complementary nucleic acid can be completed into a double strand such that the resulting section can be used in a further step as a primer for amplifying the nucleic acid. In other words, at least part of the primer complementary nucleic acid preferably serves as a template for generating primers.Furthermore, the primer complementary nucleic acid can preferably comprise multiple parts, wherein, for example, one part is designed to act as a template for the generation of primers, while another part or several other parts of the primer complementary nucleic acid can be provided with other functions. For example, another part of the primer complementary nucleic acid can be designed to bind to the connecting nucleic acid, so that, preferably upon completion of the primer complementary nucleic acid, the connecting nucleic acid bound to another part of the primer complementary nucleic acid can be elongated.

[0038] For completing the primer complementary nucleic acid or for elongating the connecting nucleic acid, an enzyme or the same enzyme, such as a polymerase, can be used, for example, which also serves to elongate primers during the replication or amplification of the nucleic acid in the reaction solution, in particular during PCR. Alternatively or additionally, at least one further enzyme or at least one further polymerase or type of polymerase can be provided in the reaction solution, which serves to complete the primer complementary nucleic acid, but is different from the polymerase for elongating the primers. In this case, at least two types of polymerase would preferably be present in the reaction solution.According to a preferred embodiment, for example, an enzyme which is only used for elongating the compound nucleic acid can be at least partially removed from the reaction solution, such as washed out, after the compound nucleic acid has been elongated and before the nucleic acid is replicated or amplified.

[0039] A local heating element within the meaning of this invention is a heating element which is particularly designed to heat only a spatially limited partial volume of the reaction volume or the reaction solution around the local heating element using thermal energy provided in or by the local heating element. Preferably, a volume of the local heating element or of the plurality of local heating elements occupies only a small fraction of the total volume of the reaction volume or the reaction solution, so that the heated volume only constitutes a small fraction of the total reaction volume. This enables particularly rapid temperature changes, since, in particular, the thermal inertia of the system or the local heating element is kept as low as possible.Secondly, the use of one or more local heating elements allows for very rapid cooling of the heated volume if a sufficiently large, cold temperature reservoir is present in the reaction volume, with the cold temperature reservoir having a colder temperature than the temperature of the surroundings of a heated local heating element, in order to cool the one or more local heating elements and their surroundings again after heating. Preferably, the temperature of the cold temperature reservoir essentially corresponds to the combined annealing temperature and / or elongation temperature. This can be achieved by heating the local heating elements sufficiently intensely (to achieve the desired temperature range) and for a sufficiently short time (so that the heat remains localized).In this way, very rapid temperature changes, each occurring in a very limited spatial sub-volume of the reaction volume around a local heating element, can achieve temperature cycles for the amplification reaction of very short duration and at very short time intervals. Localizing the warming or heating of the reaction solution in an environment(s) of one or more local heating elements results in the denaturation of nucleic acids in the environment(s) around the local heating element(s). For this reason, it can be particularly advantageous to bind at least one primer to the at least one local heating element, in particular via a connecting nucleic acid, in order to enable denaturation of the primer and the resulting double-stranded amplicon into single-stranded nucleic acids.

[0040] In a further aspect of the invention, the local heating element is designed and operated such that the heat generated in the local heating element / heat quantity supplied to the reaction volume in the denaturation step is less than CR * 5° C (degrees Celsius). Here, CR is the heat capacity of the reaction volume during heating by the local heating element. In other words, if other heat inflows and outflows are not taken into account, the local heating element heats the reaction volume (averaged over the volume) by less than 5° C; i.e., once the heat has spread in the reaction volume (i.e., the sample volume is thermalized), the global temperature increase in the entire sample volume introduced by the local heating element in the denaturation step is less than 5° C. In other words, the local heating direction orthe local heating element adds less heat to the reaction volume during the denaturation step than would be required to heat the entire reaction volume by 5°C. This low global energy input into the reaction volume enables very rapid temperature cycles, as only a small amount of heat / energy needs to be removed from the reaction volume after the denaturation step to return to the annealing and elongation temperature, or preferably the amounts of energy / heat introduced by the local heating element during the denaturation step are so small that no global temperature increase significant for the PCR occurs and the heat does not need to be removed from the reaction volume.

[0041] The invention offers the advantage that, particularly in comparison to conventional methods for amplifying nucleic acid by global heating of the reaction solution, very rapid amplification of the nucleic acid can be achieved, since the time required for one cycle of the amplification reaction, as well as the time between two consecutive cycles, is much shorter than with conventional methods which require global heating of the reaction solution.

[0042] In particular, the invention also offers the advantage over the LASER-PCR method known from document DE 10 2012 201 475 A1 that, in contrast, the local heating elements do not have to be separately or specifically functionalized for each specific application, i.e., for amplifying each specific nucleic acid. In other words, according to the invention, it is not necessary to produce nanoparticles specifically functionalized in a suitable manner for the amplification of each specific nucleic acid. Rather, the invention enables the effort and / or costs and / or production time to be reduced by providing local heating elements functionalized with a universally usable compound nucleic acid and by providing primer nucleic acids and / or primer complementary nucleic acids specifically adapted for the nucleic acid to be amplified.

[0043] Furthermore, the inventors have recognized the advantage that an optionally occurring disruption of the bond between primer nucleic acids and the connecting nucleic acids or to the local heating elements during a denaturation step does not necessarily have to be disadvantageous for the replication of the nucleic acid, but that this can be advantageously used for some embodiments of the invention. Consequently, the inventors have recognized that a bond between the primer nucleic acid and the local heating element is not necessarily required, and is necessarily maintained even during or beyond a denaturation step.

[0044] Preferably, one or more compound nucleic acids can be functionalized to the local heating element or to each of the local heating elements in such a way that the functionalization is essentially irreversible. According to the invention, in particular, a specific adaptation of the system or method for amplifying the specific, desired nucleic acid can be achieved by providing, separately from the one or more local heating elements functionalized with universal compound nucleic acids, specific primer nucleic acids and / or primer complementary nucleic acids adapted to the nucleic acid to be amplified, without the primer nucleic acid and / or the primer complementary nucleic acid having to be functionalized, in particular irreversibly, to the local heating elements.Thus, for example, local heating elements functionalized with universal linking nucleic acids can be used in combination with a variety of different primer nucleic acids and / or primer complementary nucleic acids, provided that the linking nucleic acids and the primer nucleic acids and / or the primer complementary nucleic acids can bind to each other.

[0045] This also offers the advantage that for new applications, ie for amplifying another nucleic acid, it is possible to use existing local heating elements, which are functionalized, for example, with a universal compound nucleic acid, and only the primer nucleic acid and / or the primer complementary nucleic acid has to be adapted to the new application or to the nucleic acid to be amplified.

[0046] According to a preferred embodiment, the at least one local heating element is designed as a nanoparticle and is in particular designed to transfer heat to its surroundings by excitation.

[0047] Nanoparticles are preferably particles that, due to their size, have special optical properties, in particular characteristic absorption and / or scattering spectra, which are not or not as clearly evident in the bulk material. The nanoparticles preferably have a diameter between 2 and 500 nm, more preferably between 3 and 300 nm, and most preferably between 5 and 200 nm. Preferred nanoparticles have a diameter between 7 and 150 nm. The nanoparticles can be spherical, but non-globular shapes are also particularly suitable, e.g. elongated nanoparticles (nanorods). In a preferred embodiment, the nanoparticle comprises at least one semiconductor or a metal, preferably a noble metal, e.g. gold or silver. In one embodiment, the nanoparticle consists entirely of the metal; in another, the metal forms only part of the nanoparticle, e.g., its shell.A preferred nanoparticle can be a shell-core nanoparticle. A preferred nanoparticle can have pores on its surface that can be occupied by atoms or molecules with a size and charge determined by the properties of the pores. Particularly preferably, these atoms or molecules only attach to the nanoparticle when it is in a solution. According to the invention, the nanoparticle also comprises the atoms and molecules attached to its surface. Preferred nanoparticles are suitable for absorbing optical energy due to their material absorption or plasmon resonance.

[0048] When heat is transferred to its surroundings through excitation of a nanoparticle, this means that energy is transferred to the nanoparticle and from the nanoparticle to at least part of the reaction solution in the surroundings of the nanoparticle, whereby the nanoparticle heats its surroundings through the transfer of energy. In this case, the excitation of the nanoparticles preferably heats the immediate surroundings of the nanoparticles more than the wider surroundings of the nanoparticles. Usually, the nanoparticles are first heated through excitation and then transfer heat to their surroundings. However, it is also conceivable that heat is transferred to their surroundings through excitation of the nanoparticles without the nanoparticles themselves being heated first.

[0049] Preferably, the environment of the nanoparticles is a spherical volume having 100 times the diameter of the nanoparticle located at its center, more preferably 10 times the diameter, most preferably 4 times the diameter, and preferably less than 2 times the diameter.

[0050] In particular, local heating of the reaction volume takes place in an environment, i.e. a restricted volume region, around the local heating element or around the nanoparticle. According to the invention, a single local heating element or a single nanoparticle or several local heating elements or several nanoparticles can be provided. The excitation of the nanoparticle can take place in particular by means of optical excitation, i.e. by means of a supply of optical radiation which is at least partially absorbed by the nanoparticle. Particularly preferably, the optical excitation can take place by means of laser radiation, wherein the radiation spectrum of the laser radiation is preferably selected such that it at least partially overlaps with an absorption spectrum of the nanoparticle.The use of laser radiation for optical excitation of the nanoparticle can be particularly advantageous because, particularly using pulsed laser radiation, excitation of the nanoparticle can be achieved for a very short period of time and at a high repetition rate, which can be very advantageous for local heating to amplify the nucleic acid. A detailed description of the local heating of at least a portion of the reaction volume using nanoparticles and optical excitation by laser radiation can be found in the above-cited document DE 10 2012 201 475 A1.

[0051] For example, to amplify the nucleic acid, it may be sufficient to locally heat the reaction volume using local heating elements, although a combination with global heating of the reaction volume, for example, using conventional heating elements such as heating blocks, is possible. Particularly preferably, one or more compound nucleic acids can be bound to a surface of the nanoparticle. Preferably, different compound nucleic acids can also be bound to the surface of the nanoparticle, for example, each via a thiol linker.

[0052] The use of nanoparticles as local heating elements thus offers the advantage of providing local heating elements with particularly small volumes and thus with particularly low thermal inertia. The nanoparticles are preferably in direct contact with the reaction solution. This allows for particularly rapid temperature changes, thus minimizing the duration of thermal cycles and / or the time intervals between two consecutive thermal cycles.

[0053] Furthermore, the use of nanoparticles has the advantage that their absorption spectrum can be easily adapted to the excitation light source to be used, thus optimizing energy transfer. Furthermore, nanoparticles, especially nanoparticles made of gold and / or other precious metals, often offer the advantage that nucleic acids can be easily attached to their surface, for example, using thiol linkers.

[0054] Preferably, the at least one local heating element is designed as a microheating element and particularly preferably configured to transfer heat to its surroundings by resistive heating. The microheating element is preferably in direct contact with the reaction solution or the reaction volume. For example, a microheating element can be in the form of an electrically conductive wire. Wires with a particularly thin diameter, such as in the range of a few micrometers, are particularly preferably used in order to keep the volume and thermal inertia of the microheating element as small as possible. The heating of the surroundings of the microheating elements can preferably be achieved by resistive heating of the microheating elements, which can be achieved, for example, by continuous and / or pulsed current supply to the microheating elements.Particularly preferably, the microheating elements are formed from and / or coated with a noble metal, such as gold and / or silver, in order to enable easy conjugation or functionalization of a surface of the microheating element with one or more compound nucleic acids.

[0055] The use of a microheating element as a local heating element, in particular the use of a resistively heated wire, offers the advantage that local heating of the surroundings of the respective microheating element can be achieved using particularly simple technical means, since in order to heat the microheating element, essentially only a controlled energization of the microheating element has to be carried out. The energization is preferably carried out by means of an external voltage source and / or current source. According to some preferred embodiments, one or more batteries can be sufficient as an external voltage source to heat or energize the at least one microheating element. In particular, the energization can be carried out in such a way that the denaturation temperature is reached and / or exceeded locally in the surroundings of the microheating element, while at a greater distance from the microheating element the reaction volume orthe reaction solution has a lower temperature, which is preferably maintained at the elongation and / or annealing temperature required for the amplification of the nucleic acid. For example, it is possible to provide a plurality of local heating elements, each of which is configured as a nanoparticle or as a resistive microheating element or as a microwire. In particular, a plurality of nanoparticles can be provided as local heating elements and / or a plurality of microheating elements can be provided as local heating elements. For example, the nanoparticles can be heated by optical excitation and the microheating elements can be heated by current.

[0056] Preferably, a local heating element, in particular a microheating element, can additionally be designed to globally heat at least a portion of the reaction solution upon appropriate excitation and / or energization, i.e. to heat not only the surrounding area around the local heating element. This can be achieved, for example, by more intense and / or longer resistive heating or energization of the microheating element, so that, for example, the surrounding area around the microheating element that is thereby heated increases until, if necessary, the surrounding areas of several adjacent microheating elements overlap. Furthermore, for global heating, the energization or resistive heating of the at least one microheating element can be carried out in such a way that a change in the average temperature of the reaction solution occurs, in particular also outside the surrounding area of ​​the at least one microheating element.

[0057] Particularly preferably, the at least one local heating element is in direct contact with the reaction solution or the reaction volume. In particular, several local heating elements can be provided as colloidal nanoparticles in the reaction solution or in the reaction volume, and / or one or more local heating elements can be provided as microheating elements, in particular as microwires, extending at least partially through the reaction solution or through the reaction volume. This offers the advantage that thermal inertia is kept as low as possible, since at least a portion of the reaction solution containing the nucleic acid to be amplified is located in the immediate vicinity of the local heating elements, which are heated by local heating.

[0058] The primer nucleic acid has at least one primer segment designed to bind to the nucleic acid, and at least one linking segment designed to bind to the at least one linking nucleic acid. In other words, the primer nucleic acid has at least two segments, comprising a primer segment and a linking segment. The primer nucleic acid can be formed as an oligonucleotide, wherein preferably the primary segment and / or the linking segment each form part of the oligonucleotide. The linking segment is preferably designed to enable binding of the primer nucleic acid to a linking nucleic acid. In particular, the linking segment can be designed to at least partially hybridize with the linking nucleic acid. The primer segment is preferably designed to function as a primer for amplifying the nucleic acid.

[0059] In particular, the primer section can be designed to act as a forward primer and / or as a reverse primer.

[0060] Independent of the primer nucleic acid, which is designed to bind to the linking nucleic acid, according to a preferred embodiment, at least one further primer can be present in the reaction solution, which is not designed to bind to the linking nucleic acid. For example, a forward primer can be designed as a primer nucleic acid and be designed to bind to the linking nucleic acid, while a reverse primer is not designed to bind to the linking nucleic acid, or vice versa.

[0061] Preferably, a nucleotide sequence in the connecting portion of the primer nucleic acid is at least partially complementary to a nucleotide sequence of the connecting nucleic acid and / or a nucleotide sequence in the primer portion is at least partially complementary to a nucleotide sequence of the nucleic acid. This offers the advantage that the primer nucleic acid can hybridize with the connecting portion to the connecting nucleic acid and / or that the primer nucleic acid can hybridize with the primer portion to the nucleic acid to be amplified.

[0062] Preferably, the primer complementary nucleic acid has at least one connecting segment configured to bind to the at least one connecting nucleic acid. Further preferably, the primer complementary nucleic acid has at least one primer complementary segment configured to elongate the connecting nucleic acid by a primer nucleotide sequence by means of an enzymatic reaction. In other words, the primer complementary segment can preferably serve as a template for generating a primer nucleotide sequence, wherein the connecting nucleic acid is elongated by a primer nucleotide sequence by means of an enzymatic reaction.In other words, the primer complementary nucleic acid preferably has a connecting section by means of which the primer complementary nucleic acid can bind to the connecting nucleic acid, and furthermore a primer complementary section which can serve as a template for generating a primer nucleotide sequence. The primer nucleotide sequence can serve as a primer for an amplification reaction, in particular for a PCR, for amplifying the nucleic acid and is particularly preferably at least partially complementary to the nucleic acid. The primer complementary nucleic acid is particularly preferably designed such that when the primer complementary nucleic acid is bound to the connecting nucleic acid by means of the connecting section, the connecting nucleic acid is extended or amplified by a primer section or by a primer nucleotide sequence by means of an enzymatic reaction, such as by means of a polymerase.can be elongated so that the elongated linking nucleic acid can serve at least partially as a primer for amplifying the nucleic acid. In other words, the primer complementary nucleic acid can preferably be used to individualize the local heating elements functionalized with linking nucleic acids by means of an enzymatic reaction such that they can serve as primers or primer nucleic acids for amplifying the desired nucleic acid. This has the advantage that local heating elements functionalized with a universal linking nucleic acid can be used which can only be individualized in the reaction solution or in the reaction volume and / or prior to, in particular immediately before, the actual amplification reaction by providing one or more suitable primer complementary nucleic acids, i.e. can be adapted to the specific nucleic acid to be amplified.Furthermore, this makes it possible to individualize local heating elements, which are functionalized with, in particular, universal, compound nucleic acids, by means of different primer complementary nucleic acids, so that they are adapted, for example, for the amplification of different nucleic acids, in particular simultaneously.

[0063] Preferably, a nucleotide sequence in the connecting portion of the primer complementary nucleic acid is at least partially complementary to a nucleotide sequence of the connecting nucleic acid and / or a nucleotide sequence in the primer complementary portion is at least partially complementary to the primer nucleotide sequence. This enables hybridization of the primer complementary nucleic acid to the connecting nucleic acid and / or hybridization of the primer nucleotide sequence formed by enzymatic elongation of the connecting nucleic acid to the nucleic acid to be amplified.

[0064] According to a preferred embodiment, a plurality of local heating elements are provided, each functionalized with a plurality of compound nucleic acids. Each local heating element can be functionalized with a plurality of identical or different compound nucleic acids, wherein the compound nucleic acids differ, for example, in their nucleotide sequence. Furthermore, first local heating elements can be provided which are functionalized with compound nucleic acids of a first type, and second local heating elements which are functionalized with compound nucleic acids of a second type. This can, for example, enable the amplification of a plurality of different nucleic acids essentially simultaneously in a reaction solution or in a reaction volume. In other words, this can serve to achieve multiplexing during the amplification of nucleic acids.

[0065] Preferably, the primer nucleic acid has at least one abasic modification between the at least one connecting segment and the at least one primer segment. This offers the advantage of creating a separation or a caesura between the connecting segment and the primer segment. In particular, the at least one abasic modification can ensure that an enzymatic reaction, such as the elongation of the primer segment along the nucleic acid to be amplified by means of a polymerase, preferably does not extend to the connecting segment. In other words, the provision of at least one abasic modification, preferably several abasic modifications, can interrupt and / or terminate the course of an enzymatic reaction in order to exclude specific regions, in particular the connecting segments, from the enzymatic reaction.

[0066] Particularly in an embodiment in which the linking nucleic acids functionalized on local heating elements were elongated by a primer segment or a primer nucleotide sequence corresponding to the primer complementary nucleic acids, and the primer complementary nucleic acids bound to the linking nucleic acids were detached or removed again after heating the respective local heating elements, it may be helpful for the linking nucleic acids to have one or more abasic modifications. This can provide one or more abasic modifications between a portion of the original linking nucleic acid and the added primer segment, thereby preferably excluding a portion of the original linking nucleic acid from the enzymatic reaction.Preferably, the linking nucleic acids have the at least one abasic modification two nucleotide bases from the 3' end, more preferably three nucleotide bases from the 3' end, particularly preferably four nucleotide bases from the 3' end, and most preferably at least five nucleotide bases from the 3' end. This can be advantageous in order to provide the polymerase with a short portion of double-stranded nucleic acid as a starting and / or binding site for the elongation at the 3' end of the linking nucleic acids.

[0067] According to a further preferred embodiment, the linking nucleic acid can have at least one abasic modification, which is preferably located at least a few nucleotide bases away from the 3' end of the linking nucleic acid, for example less than 20 nucleotide bases, preferably less than ten nucleotide bases. This has the advantage that the preferably few nucleotide bases between the 3' end of the linking nucleic acid and the abasic modification form a double strand with a primer complementary nucleic acid bound to the linking nucleic acid over at least a few nucleotide sequences and thus provide, for example, a start and / or binding site for a polymerase. This offers the advantage that the primer complementary section can be completed, for example, by a polymerase, while the action of the polymerase on the abasic modification is interrupted.

[0068] According to a further preferred embodiment, a plurality of, in particular different, primer nucleic acids can be provided, the primer sections of which are designed as forward primers and / or as reverse primers. In particular, the local heating elements and / or the connecting nucleic acids and / or the primer nucleic acids and / or the primer complementary nucleic acids can be designed such that only forward primers are formed on some local heating elements and / or only reverse primers are formed on other local heating elements. This can, for example, ensure that a nucleic acid to be amplified is bound at one end to a local heating element with a forward primer and at the other end to a local heating element with a reverse primer.As a result, the nucleic acid can be heated particularly efficiently, in particular to and / or above the denaturation temperature, preferably by means of the two local heating elements, since heat can act on the nucleic acid from two sides.

[0069] Alternatively or additionally, both forward and reverse primers can be formed on some local heating elements. This offers the advantage that a nucleic acid to be amplified can be bound to the same local heating element at both ends. This enables particularly effective heating of the nucleic acid, especially above the denaturation temperature, since the average distance of the nucleic acid from the local heating element can be reduced or limited.

[0070] According to the invention, the local heating element is intended to heat its surroundings and, in particular, to heat a limited subvolume of the reaction volume in its surroundings, preferably to a temperature greater than or equal to the denaturation temperature. If the denaturation temperature is reached or exceeded, a nucleic acid elongated in an enzymatic reaction, which is connected to the local heating element via the connecting nucleic acid and optionally via the primer nucleic acid, is preferably dissolved, so that it is no longer connected to the local heating element via the connecting nucleic acid and optionally via the primer nucleic acid. Furthermore, double-stranded nucleic acids are at least partially separated into single strands.If the primer nucleic acid is bound to the linking nucleic acid by means of hybridization, it cannot be ruled out that the primer nucleic acid will also detach from the linking nucleic acid when the denaturation temperature is reached or exceeded. This does not generally prevent the system and / or method according to the invention from functioning, since after the primer nucleic acid has detaches from the linking nucleic acid, either the same primer nucleic acid can rebind to the linking nucleic acid at temperatures lower than the denaturation temperature, or another primer nucleic acid can bind to the released linking nucleic acid. If it is desired that the same primer nucleic acid rebinds to the linking nucleic acid to which it was previously bound, it can be advantageous to set a time period for stimulating or deactivating the primer nucleic acid.Heating of the local heating element should be kept as short as possible so that denaturation can occur, but the temperature in the vicinity of the local heating element falls back below the denaturation temperature as quickly as possible in order to minimize the time available for the primer nucleic acid to diffuse away or to separate from the compound nucleic acid. Since a time period of a few microseconds is often sufficient for denaturation, it can be advantageous to heat or excite the local heating element for a time period of only a few microseconds. Preferably, heating or excitation takes placeExciting the at least one local heating element for a denaturation step for less than 1 ms, more preferably for less than 500 µs, more preferably for less than 250 µs, even more preferably for less than 100 µs, much more preferably for less than 50 µs, very much more preferably for less than 25 µs, most preferably for less than 10 µs.

[0071] However, for other preferred embodiments, it may be desirable to avoid or prevent detachment of the primer nucleic acid from the connecting nucleic acid as much as possible. For this purpose, according to preferred embodiments, the connecting nucleic acid and / or the primer nucleic acid, preferably each, may comprise at least one immobilization element designed to immobilize the primer nucleic acid, when bound to the connecting nucleic acid, to the connecting nucleic acid in such a way that the primer nucleic acid remains bound to the connecting nucleic acid even during and / or after a denaturation step.The at least one immobilization element can, for example, be formed as at least one modification in the nucleotide sequence of the connecting nucleic acid and / or in the nucleotide sequence of the primer nucleic acid, in particular in the connecting section of the primer nucleic acid, wherein the at least one modification has, for example, at least one amino group. The at least one modification can then preferably result in the connecting nucleic acid and the primer nucleic acid being bonded to one another sufficiently firmly by means of a chemical reaction, for example by means of a d-linker, that they do not separate from one another even at a temperature greater than and / or equal to the denaturation temperature.If such immobilization of the primer nucleic acid to the compound nucleic acid is desired, it may be advantageous to perform the immobilization before carrying out the method for amplifying the nucleic acid, in particular before the environment of the local heating element is first heated to the denaturation temperature by means of the at least one local heating element. Furthermore, it may be advantageous to remove any excess primer nucleic acid that is not bound to a compound nucleic acid from the reaction solution after immobilization and preferably before carrying out the amplification method. For example, the unbound primer nucleic acids can be removed by centrifugation and / or filtration.

[0072] According to a further embodiment, at least one further reaction is carried out prior to performing an amplification reaction, such as a PCR. The at least one further reaction can, for example, comprise reverse transcription (RT), in which, for example, one type of nucleic acid, such as RNA, is transcribed into another type of nucleic acid, such as DNA, by an enzymatic reaction.

[0073] Primer complementary nucleic acids and / or primer nucleic acids can preferably each be present in a concentration of more than 1 nM, particularly preferably more than 5 nM and most preferably more than 25 nM, and / or preferably in a concentration of less than 1000 nM, particularly preferably less than 300 nM and most preferably less than 100 nM.

[0074] It is understood that the features mentioned above and those to be explained below can be used not only in the combination specified in each case, but also in other combinations or on their own, without departing from the scope of the present invention.

[0075] The invention is illustrated schematically in the drawings using exemplary embodiments and is described below with reference to the drawings. Character description

[0076] The Figures 1A to 1E show schematic representations of a first preferred embodiment of the invention.

[0077] Figure 2 shows a schematic representation of an exemplary process sequence according to the first preferred embodiment.

[0078] The Figures 3A to 3C show schematic representations explaining partial aspects of the first preferred embodiment.

[0079] The Figures 4A to 4Dshow schematic representations of a second preferred embodiment of the invention.

[0080] Figure 5 shows a schematic representation of an exemplary process sequence according to the second preferred embodiment.

[0081] Figure 6 shows experimental data for the first example.

[0082] Figure 7 shows experimental data for the second example.

[0083] Figure 8 shows experimental data for the third example.

[0084] Figure 9 shows experimental data for the fourth example. Detailed description of the drawings

[0085] The Figures 1A to 1Eshow, in a schematic representation, a first preferred embodiment of a system 10 for amplifying a nucleic acid, wherein the system has at least one local heating element 12 functionalized with a plurality of compound nucleic acids 14. Particularly preferably, the compound nucleic acids 14 are attached to the local heating element 12 sufficiently firmly so that they remain attached to the local heating element 12 even when a temperature of the local heating element 12 and / or a temperature of the environment of the local heating element 12 reaches and / or exceeds a denaturation temperature. The compound nucleic acids 14 can be of the same type and / or different types. Furthermore, the system 10 has a plurality of primer nucleic acids 16, which are provided separately from the local heating element 12 and the compound nucleic acids 14.The primer nucleic acids 16 each have a connecting section 16a and a primer section 16b. In particular, the system 10 is designed to be used in a reaction volume, in particular in a reaction solution 20 (see . Figure 1E ). Particularly preferably, a plurality of systems 10 are provided in the reaction solution.

[0086] The Figures 1A and 1Bshow a system 10 in which the local heating element 12 is formed as a nanoparticle 12a. In particular, a plurality of systems 10 can be provided in the reaction solution 20, wherein the nanoparticles 12a are preferably present as colloidal nanoparticles 12a in the reaction solution. The connecting nucleic acids 14 are attached to the surface of the nanoparticle 12a, for example by means of a thiol linker. If the functionalized nanoparticles 12a and the primer nucleic acids 16 are provided separately in the reaction solution, they are at least partially separated from one another in the reaction solution, as for example in Figure 1Ashown. If the temperature of the reaction solution, in particular in the area around the at least one local heating element 12 or around the at least one nanoparticle 12a, is lower than the denaturation temperature, preferably significantly lower than the denaturation temperature, and particularly preferably approximately corresponds to the annealing temperature, primer nucleic acids 16 of the majority of primer nucleic acids 16 can bind with the connecting nucleic acids 14, so that at least some of the primer nucleic acids 16 are connected to the nanoparticle 12a via the connecting nucleic acids 14. The time required until a certain part ora certain number of primer nucleic acids 16 binds to the functionalized nanoparticles 12a, can depend on various parameters, such as a temperature of the reaction solution, as well as a concentration of the primer nucleic acids 16 and / or the functionalized nanoparticles 12a in the reaction solution, and / or a loading density with which the connecting nucleic acids 14 are attached to the nanoparticles 12a and / or a concentration of salts.

[0087] The Figures 1C and 1D show a modification of the first preferred embodiment of the system 10, which in the essential parts of the Figures 1A and 1B shown embodiment, wherein the local heating element 12 is designed as a resistive microheating element 12b. In particular, the microheating element 12b can be designed as a microwire. Although the Figures 1C and 1DWhile the diagrams schematically depict only a short section of a microheating element 12b, the length of the microheating element 12b can be significantly longer than shown. For example, the microheating element 12b can be heated by energizing the microheating element 12b such that a current flows through the microheating element 12b substantially along a wire longitudinal axis, heating it. According to the previous preferred embodiment, a plurality of connecting nucleic acids 14 are attached to the surface of the microheating element 12b, for example, by means of a thiol linker core.

[0088] Figure 1Eshows a schematic representation of a reaction vessel 18 containing a reaction solution 20. A plurality of local heating elements 12, each in the form of nanoparticles 12a, are provided in the reaction solution 20 and are each functionalized with a plurality of connecting nucleic acids 14. Furthermore, a plurality of primer nucleic acids 16 are provided in the reaction solution 20, some of which are free in the reaction solution 20 and some of which are bound to the nanoparticles 12a via connecting nucleic acids 14. As further shown, the primer nucleic acids 16 can hybridize and bind to one of the single-stranded nucleic acids 22 to be amplified via the respective primer sections 16b.This applies essentially equally to primer nucleic acids 16 that are bound to connecting nucleic acids 14 and to primer nucleic acids 16 that are not bound to connecting nucleic acids 14 but are free in the reaction solution 20. In addition, further primers 24 and / or primer nucleic acids may also be present in the reaction solution 20. For example, these further primers 24 may be designed as reverse primers while the primer nucleic acids 16 or their primer sections 16b are designed as forward primers, or vice versa. It is also possible that further primers 24 are provided in the reaction solution 20 that do not have a connecting section 16a and therefore cannot bind to the connecting nucleic acid 14. For example, these further primers 24 may compete with the primer nucleic acids 16 that can bind to the nanoparticles 12a.

[0089] In order for the nucleic acid 22 to be amplified to be present in the reaction solution 20 as a single-stranded nucleic acid 22, it may be advantageous to carry out global warming or heating of the reaction solution 20 to and / or above the denaturation temperature at the beginning of or before any amplification of the nucleic acid 22 is to be carried out in order to initially separate the nucleic acids 22, possibly present in double-stranded form, into single strands. Furthermore, heating of the reaction solution at the beginning of and / or before any amplification of the nucleic acid 22, for example by global warming or heating of the reaction solution 20, may be advantageous or even necessary, in particular if, for example, so-called hot-start enzymes are used, which must first be activated by exposure to heat and / or if components, such as enzymes, should or must be deactivated before the actual amplification of the nucleic acid 22.

[0090] The denaturation required for PCR or for amplification of the nucleic acids 22 is carried out by optical excitation of the nanoparticles 12a, whereby the nanoparticles 12a and / or a local environment of the nanoparticles 12a are heated to and / or above the denaturation temperature, while essentially the remainder of the reaction solution 22 is not heated by the optical excitation 26 of the nanoparticles 12a, but remains at a lower temperature. Particularly preferably, this lower temperature of the reaction solution is selected such that it essentially corresponds to an annealing temperature, which enables elongation by means of the polymerase and / or hybridization of single-stranded nucleic acids and / or binding of primer nucleic acids 16 to connecting nucleic acids 14.The optical excitation 26 can, for example, be effected by irradiating the reaction solution 20 with optical radiation, for which purpose the reaction vessel 18 is advantageously at least partially transparent to the optical radiation, wherein the optical radiation spectrally overlaps at least partially with an absorption spectrum of the nanoparticles 12a and is selected such that it is essentially not absorbed by the reaction solution, apart from the nanoparticles 12a in the reaction solution. It is understood that the in . Figure 1E The embodiment shown can also be used with micro heating elements 12b as local heating elements 12 in combination with or instead of nanoparticles 12a, although this is not shown in a separate figure.

[0091] In the following, the first preferred embodiment will be described with reference to Figure 2explained in detail, in particular a method for amplifying the nucleic acid according to the first preferred embodiment.

[0092] According to the first preferred embodiment, at least one local heating element 12 and at least one primer nucleic acid 16 are provided separately from one another in the reaction solution 20 at the beginning of step a). Preferably, the reaction solution 20 contains a plurality of local heating elements 12 and a plurality of primer nucleic acids 16, some of which are preferably designed as forward primers and others as reverse primers for the PCR, but preferably both the forward primer nucleic acids and the reverse primer nucleic acids are designed with a connecting section 16a that can bind to the connecting nucleic acids 14.

[0093] According to a preferred embodiment, the local heating elements 12 are each formed as a nanoparticle 12a and functionalized with connecting nucleic acids 14. One type of local heating element 12 is considered to be local heating elements 12 which are similar, in particular with regard to the nanoparticles 12a and the connecting nucleic acids 14 functionalized thereon. The connecting nucleic acids 14 are attached to the particle surface (e.g., via a 3'-thiol bond) in such a way that the 5' end of the respective connecting nucleic acids 14 faces away from the nanoparticle 12a. The connecting nucleic acids 14 themselves preferably do not serve as primers for amplifying the nucleic acids or for PCR. Rather, the nanoparticles 12a can be used multifunctionally such that, if necessary, different types of primer nucleic acids 16 can bind to the connecting nucleic acids 14.

[0094] Since the optothermal heating of the nanoparticles 12a, ie the heating of the nanoparticles 12a by means of optical excitation, to reach or exceed the denaturation temperature for the amplicon during the amplification process only takes place locally and not the entire reaction solution 20 has to be heated to the denaturation temperature, it is necessary that the amplicon is bound to the surface of the nanoparticles via at least one primer nucleic acid 16 and one linking nucleic acid 14 for denaturation.

[0095] In order to bind the nucleic acid 22 to be detected or the amplicon to the nanoparticles 12a functionalized with connecting nucleic acids 14, at least one of the two primer sequences required for the PCR (preferably both primer sequences) has, in addition to the primer section 16b, a connecting section 16a, such as an overhang at the 5' end, which is complementary to at least some of the connecting nucleic acids 14 on the nanoparticles 12a. The 3' end of the primer sequences or the primer nucleic acids 16 or their primer sections 16b is preferably kept free so that the primer nucleic acids 16 can be elongated by the polymerase starting from this side.

[0096] Preferably, one or more abasic modifications 28 are located between the primer section 16b and the connecting section 16a of a respective primer nucleic acid 16 in order to prevent the polymerase from overwriting the connecting sections 16a or from forming the complement to the connecting sections 16a. This is particularly relevant when the primer nucleic acids 16 are not bound to a connecting nucleic acid 14, but are located in the solution separately from a connecting nucleic acid 14 and a local heating element 12. The at least one abasic modification thus offers the advantage that in the following cycles of the PCR, the connecting nucleic acids 14 and the connecting sections 16a of the primer nucleic acids 16 are present in single-stranded form, i.e., as a single-stranded overhang sequence, and thus the amplicon orthe nucleic acid 22 to be amplified can bind to the connecting nucleic acids 14 on the nanoparticles 12a and can be denatured in the zone around the nanoparticles 12a or around the nanoparticle surface that can be locally heated by optothermal heating.

[0097] In step b), at least a portion of the primer nucleic acids 16 are annealed with the single-stranded nucleic acid 22, i.e., the primer nucleic acids 16 hybridize with their primer segment 16b to the nucleic acid 22 to be amplified. To ensure that the nucleic acid 22 is single-stranded, an initial, possibly global, heating step, in which, for example, the entire reaction solution 20 is heated to or above the denaturation temperature, may be advantageous. This initial heating step can, for example, take place before step a) and / or between steps a) and b).

[0098] In step c), the nucleic acids 22 present in the reaction solution 20, which are bound to primer nucleic acids 16, are elongated. In particular, an enzymatic reaction takes place in which, by means of a polymerase, the primer section 16b of the primer nucleic acid 16 bound to the nucleic acid 22 is elongated into an amplicon 22a, thus completing the nucleic acid 22 into a double strand. Preferably, the connecting section 16a of the primer nucleic acid 16 is not captured by the polymerase or completed into a double strand, which can be achieved in particular by providing the at least one abasic modification 28 between the connecting section 16a and the primer section 16b.

[0099] In step d), the nucleic acid 22 hybridized with the elongated primer nucleic acid 16 is bound to one of the connecting nucleic acids 14 on the local heating element 12. As a result, the now double-stranded nucleic acid 22 or the amplicon 22a is brought at least partially, but preferably completely, into the environment 29 of the local heating element 12, which can be heated to and / or above the denaturation temperature by means of local heating.

[0100] In step e), the at least one local heating element 12 is heated, which, for example, in the case that the local heating element 12 is designed as a nanoparticle 12a, can be done by means of optical excitation 26, for example by laser radiation. The local heating element 12 and an environment 29 of the local heating element 12 are heated to and / or above the denaturation temperature, so that the double-stranded nucleic acids located in the environment 29 of the local heating element 12, i.e. the nucleic acid 22 or the amplicons 22a and / or the primer nucleic acids 16 and / or the connecting nucleic acids 14, at least partially, but preferably completely, separate from one another and are at least partially, but preferably completely, present again as single-stranded nucleic acids.

[0101] With steps a) to e), an amplicon 22a was generated, whereby a complement, ie a nucleic acid with a nucleotide sequence that is at least partially complementary to nucleic acid 22, was generated to nucleic acid 22. By at least one repetition, nucleic acid 22 can thus be copied or amplified. In Figure 3C By way of example, a double-stranded nucleic acid 22 to be amplified and two amplicons 22a hybridized to form a double strand are shown. The double strand of amplicons 22a has a connecting segment 16a at each of its two ends, originating from the primer nucleic acids 16, by means of which the amplicon double strand can bind to one or two local heating elements 12 or their connecting nucleic acids 14.

[0102] Steps a) to e) can be carried out in a large number of cycles, for example between 20 and 1000 cycles, in particular more than 300 cycles, in order to achieve an exponential amplification of the nucleic acid 22 present at the beginning. The order of steps b), c) and d) is not bound to the exemplary order shown, but can also be chosen differently and / or varied. The cycle can in particular be carried out as often as necessary until the desired extent of amplification is achieved. The number of runs of the polymerase chain reaction cycle is preferably greater than 45, more preferably greater than 60, more preferably greater than 80, more preferably greater than 100, more preferably greater than 150, more preferably greater than 200. With a large number of runs, a particularly high degree of amplification can advantageously be achieved.

[0103] The number of cycles of the polymerase chain reaction is preferably less than 1000, more preferably less than 750, and most preferably less than 500. A not too high number of cycles can advantageously reduce the duration of the amplification. Furthermore, negative influences from contamination or the consumption or damage of reaction partners, such as a polymerase used in the process, can advantageously be minimized.

[0104] During denaturation or during optothermal, local heating of the nanoparticles 12a, not only the amplicon double strand of the nucleic acid 22 to be amplified is denatured, i.e. the hybridization between the elongated primer nucleic acid 16 and the nucleic acid 22 is broken, but possibly also double strands consisting of a connecting nucleic acid 14 and a connecting section 16a of a primer nucleic acid 16 bound thereto. In this case, both elongated primer nucleic acids 16, i.e. amplicons 22a, and not yet elongated primer nucleic acids 16 can be separated again from the connecting nucleic acids 14 on the nanoparticles 12a. As a result, in subsequent PCR cycles, new primer nucleic acids 16 can repeatedly bind to the connecting nucleic acids 14 on the nanoparticles 12a and, preferably, a constant exchange of primer nucleic acids 16 with the connecting nucleic acids 14 on the nanoparticles 12a can occur.This allows for the addition of primer nucleic acids 16 in excess to the reaction solution 20, meaning that more primer nucleic acids 16, each with a connecting segment 16a, can be present in the reaction solution 20 than can simultaneously bind to the connecting nucleic acids 14 on the nanoparticles 12a. This can be advantageous, for example, to accelerate the dynamics of the amplification reaction.

[0105] It can also preferably be achieved in this way that the actual elongation of the primer nucleic acids 16 by the polymerase does not necessarily have to take place in the vicinity of the nanoparticles 12a, in particular via the connecting nucleic acids 14 bound to the nanoparticles 12a, where, under certain circumstances, completely different ion and charge distributions can prevail than in other partial volumes of the reaction solution at a greater distance from the nanoparticles 12a. This is because the process in which a primer nucleic acid 16 finds an amplicon 22a or a nucleic acid 22 to be amplified and is elongated by the polymerase can, if necessary, also take place far away from the local heating elements 12 or nanoparticles 12a or the nanoparticle surface, and this amplicon thus created can then bind to the connecting nucleic acids 14 on the nanoparticles 12a with at least one protruding connecting section 16a.

[0106] According to a further preferred embodiment, the reaction solution 20 contains at least two different types or varieties of primer nucleic acids 16, some of which are designed as forward primers and others as reverse primers, which, however, are identical with regard to their connecting section 16a and which are thus in principle suitable for binding to the same connecting nucleic acids 14.

[0107] In a further preferred embodiment, the reaction solution 20 contains first primer nucleic acids 16, which are designed as forward primers and have a first nucleotide sequence in their connecting section 16a, and second primer nucleic acids 16, which are designed as reverse primers and have a second nucleotide sequence different from the first nucleotide sequence in their connecting section 16a.Furthermore, according to this preferred embodiment, there is preferably either one type of nanoparticle which has two different types of connecting nucleic acids 14, wherein a first connecting nucleic acid 14 is complementary to the first nucleotide sequence and a second connecting nucleic acid 14 is complementary to the second nucleotide sequence, or preferably two different types of nanoparticles 12a, each of which has only one type of connecting nucleic acid 14 which is at least partially complementary to either the first nucleotide sequence or the second nucleotide sequence.

[0108] In a further preferred embodiment, the reaction solution 20 contains at least two different combinations of forward primer and reverse primer nucleic acids 16, which differ in their primer segments 16b but have essentially the same connecting segments 16a. A combination of forward primer and reverse primer nucleic acids 16, ie, a primer pair, is defined by the fact that it can jointly generate and / or amplify a double-stranded amplicon 22a.

[0109] In another embodiment, the reaction solution 20 contains at least two different combinations of forward primer and reverse primer nucleic acids 16, which have at least partially different connecting segments 16a, and a correspondingly large number of different types of local heating elements 12, each carrying the connecting nucleic acids 14 complementary to the different connecting segments 16a. In a further preferred embodiment, the reaction solution contains several primer pairs, which differ from one another with regard to their connecting segments and / or their primer segments.

[0110] In a further preferred embodiment, the reaction solution 20 contains a primer pair in which only one of the forward primer and the reverse primer is provided with a connecting section 16a, while the other primer does not have a connecting section 16a. According to a further preferred embodiment, primer pairs in which neither the forward primer nor the reverse primer has a connecting section 16a can additionally be provided in the reaction solution.

[0111] According to some preferred embodiments, the amplicon 22a or the nucleic acid 22 to be amplified can be bound with two primer nucleic acids 16 to a local heating element 12 or to a nanoparticle 12a, e.g. if both forward primer primer nucleic acid 16 and reverse primer primer nucleic acid 16 are equipped with the same connecting section 16a, or both connecting sections 16a (those of forward primer primer nucleic acid 16 and reverse primer primer nucleic acid 16 with different connecting sections 16) can bind to one type of local heating element 12 or nanoparticle 12a, which are functionalized with both corresponding connecting nucleic acids 14, as exemplified in Figure 3A. In this case, an amplicon 22a is connected as a double strand consisting of an elongated primer pair, in particular of an elongated forward primer nucleic acid 16 and an elongated reverse primer nucleic acid 16, to the same local heating element 12 via two connecting nucleic acids 14. This preferably results in the amplicons being located at least partially, preferably completely, within the environment 29 of the local heating element 12, which can be heated by the local heating element 12 to and / or above the denaturation temperature.

[0112] This can also result in the amplicon 22a or the nucleic acid 22 to be amplified being able to be dehybridized, for example, better and / or more homogeneously and / or at a lower excitation power density, for example at a lower laser excitation density if the local heating elements 12 are optically excited by means of laser radiation, since the amplicon 22a is on average brought closer to the local heating element 12 or the nanoparticle surface over its length than in a case where it is bound to a local heating element 12 or a nanoparticle 12a only with a primer nucleic acid 16 or only at one end, since the heating of the environment 29 decreases with increasing distance from the particle surface.

[0113] According to some preferred embodiments, it may also happen that the amplicon is bound with two primer nucleic acids 16 between two local heating elements 12 or between two nanoparticles 12a, e.g. if both forward primer primer nucleic acid 16 and reverse primer primer nucleic acid 16 are provided with corresponding connecting sections, as in Figure 3B shown by way of example. This may also result in the amplicon 22a being able to be dehybridized better and / or more homogeneously and / or at a lower excitation power density, since the amplicon 22a or the amplicons 22a are heated from both sides, as opposed to heating from only one side, which occurs when the amplicons 22a with a primer nucleic acid 16 are bound at only one end to a local heating element 12 or to only one nanoparticle 12a.

[0114] Preferably, the primer nucleic acids 16 and the local heating elements 12 functionalized with connecting nucleic acids 14 are added simultaneously or sequentially to the reaction solution 20 for the amplification reaction.

[0115] In a further embodiment, the primer nucleic acids 16 are first hybridized to the connecting nucleic acids 14 on the local heating elements 12 and then immobilized to the connecting nucleic acids 14 in such a way that the primer nucleic acids 16 can no longer detach from the respective connecting nucleic acid 14 or from the local heating element 12 even during the denaturation step. This immobilization can be achieved, for example, by primer sections 16b of the primer nucleic acids 16 and / or the connecting nucleic acids 14 having modifications (such as at least one amino group), which are then sufficiently firmly bonded by means of a chemical reaction, for example with d-linker (BS3- (bis(sulfosuccinimidyl) suberate)), so that their bond is maintained even at temperatures equal to or higher than the denaturation temperature.Alternatively or additionally, immobilization can be carried out using click chemistry, for example, using at least one azide modification and one alkyne modification. Optionally, an excess binding reagent for the chemical immobilization reaction and / or excess unbound primer nucleic acids 16 can be removed from the reaction solution 20 prior to the amplification reaction, e.g., by washing and / or purification and / or filtering and / or centrifugation.

[0116] Although some of the preferred embodiments just presented have been explained exclusively or mainly as embodiments in which the local heating elements 12 are formed as nanoparticles 12a, it is self-evident that these are also considered preferred embodiments of the invention if they are additionally or alternatively realized with microheating elements 12b as local heating elements 12.

[0117] In the following, a second preferred embodiment is explained, which is shown in the Figures 4A to 4D This differs from the first preferred embodiment in particular in that, alternatively or in addition to the primer nucleic acids 16, primer complementary nucleic acids 30 are provided in the reaction solution 20. As shown in Figure 4A As shown, the primer complementary nucleic acids 30 have a connecting section 30a and a primer complementary section 30b. The connecting section 30a, corresponding to the connecting section 16a of the primer nucleic acids 16, serves to enable the primer complementary nucleic acids 30 to bind to the connecting nucleic acids 14 and the local heating elements 12, respectively.

[0118] As in Figure 4BAs shown, when a primer complementary nucleic acid 30 is bound to a linking nucleic acid 14, the linking nucleic acid 14 can be elongated by an enzymatic reaction, for example by a polymerase, by a primer nucleotide sequence or a primer segment that is at least partially, preferably completely, complementary to the primer complementary segment 30b. Thus, for example, a universal linking nucleic acid 14 that has no primer properties can be provided with a primer functionality using a primer complementary nucleic acid 30 and / or functionalized or elongated to form a primer nucleic acid or a primer.By globally heating the reaction solution 20 and / or by locally heating the local heating elements 12, the primer complement nucleic acids 30 can then be separated from the elongated connecting nucleic acids 14, so that the elongated connecting nucleic acids 14 are single-stranded and / or can be used as primers for an amplification reaction. In the embodiment shown in FIGS. Figures 4A and 4B In the embodiment shown, the local heating elements 12 are designed as nanoparticles 12a.

[0119] The Figures 4C and 4D show a modification of the second embodiment from the Figures 4A and 4B , in which the local heating elements 12 are designed as micro heating elements 12b, in particular as micro heating wires.

[0120] In Figure 5The individualization or functionalization of local heating elements 12 functionalized with compound nucleic acids 14 is shown by way of example. Although the illustrated and explained steps are presented with reference to an embodiment in which the local heating elements 12 are formed as nanoparticles 12a, it goes without saying that this also applies to other embodiments in which additionally or alternatively local heating elements 12 are formed as microheating elements 12b.

[0121] In step a), local heating elements 12 functionalized with connecting nucleic acids 14 and, separately, primer complementary nucleic acids 30 are provided in the reaction solution 20. Preferably, a connecting section 30a extends in a first part of the primer complementary nucleic acid 30, starting at the 3' end, followed by a primer complementary section 30b, which preferably extends to the 5' end of the primer complementary nucleic acid 30. Furthermore, the connecting nucleic acids 14 are preferably attached by their 5' end to the local heating element 12 or to the nanoparticle 12a or to the nanoparticle surface, such that the connecting nucleic acids 14 and the connecting sections 30a are oriented in a suitable manner to enable hybridization.

[0122] In step b), an annealing or hybridization takes place, in which the connecting nucleic acid 30 binds to one of the connecting nucleic acids 14 and is then connected to the local heating element 12 or nanoparticle 12a.

[0123] In step c), the connecting nucleic acid 14, which is bound to the primer complementary nucleic acid 30, is elongated. The elongation preferably occurs through a chemical reaction, preferably by means of an enzyme, such as a polymerase. The connecting nucleic acid 14 is elongated such that the elongated part is complementary to the primer complementary segment 30b of the primer complementary nucleic acid 30 and thus at least partially, but particularly preferably completely, has a nucleotide sequence that can be used as a primer to amplify the nucleic acid 22. The original connecting nucleic acid 14 can then continue to serve as the connecting segment 14a of the elongated connecting nucleic acid 14.

[0124] In step d), denaturation occurs such that the primer complementary nucleic acid 30 separates from the elongated connecting nucleic acid 14, and then the primer complementary nucleic acid 30 and the elongated connecting nucleic acid 14 bound to the local heating elements 12 are each present in single-stranded form in the reaction solution 20. The denaturation can be carried out, for example, by globally heating the reaction solution 20 to or above the denaturation temperature, or by locally heating the local heating element 12 and the surrounding area 29 of the local heating elements to or above the denaturation temperature, for example by optically exciting the local heating elements 12 formed as nanoparticles 12a, while a temperature of the reaction solution outside the locally heated surrounding area 29 remains essentially or almost unchanged.Preferably, the reaction solution outside the locally heated environments 29 of the local heating elements 12 and preferably also within the environments 29 outside the denaturation times in which the local heating elements 12 are heated has a temperature which essentially corresponds to an elongation temperature and / or an annealing temperature.

[0125] The local heating elements 12 individualized or functionalized with a primer functionality in steps a) to d) can subsequently be used as primers, in particular in the context of a laser PCR, as is known, for example, from DE 10 2012 201 475 A.

[0126] According to the second preferred embodiment, for the amplification of the nucleic acid, primers are first generated by enzymatic elongation of connecting nucleic acids 14 that are functionalized on local heating elements 12. For this purpose, the reaction solution 20 contains at least one type or kind of local heating element 12, such as nanoparticles 12a that are functionalized with connecting nucleic acids 14. The connecting nucleic acids 14 are attached to the nanoparticle surface or to the local heating element 12 (e.g. via a 5'-thiol bond) in such a way that the 3' end faces away from the nanoparticle 12a or the local heating element 12. Without further elongation, the connecting nucleic acids 14 preferably do not serve as a primer sequence. This type or kind of nanoparticles 12a or local heating elements 12, i.e. the local heating elements 12 orNanoparticles 12a, which are functionalized with universal connecting nucleic acids 14, are thus multifunctional and not restricted to the replication of a particular, specific nucleic acid 22.

[0127] Rather, the local heating elements 12 are only transformed into specifically functionalized local heating elements 12 through an enzymatic reaction. For this purpose, the universally applicable local heating elements 12, which are functionalized with universal connecting nucleic acids 14, are mixed in the reaction solution 20 with primer complementary nucleic acids 30, which, in other words, serve as primer templates. The primer complementary nucleic acids 30 consist of two partial sequences. Reading from 5' to 3', first comes the primer complementary section 30b, which is at least partially, but preferably completely, complementary to the primer sequence to be generated at the 3' end of the connecting nucleic acids 14. Next comes the connecting section 30a, which is at least partially complementary to the connecting nucleic acids 14 on the local heating elements 12.

[0128] When a primer complement nucleic acid 30 hybridizes with a connecting nucleic acid 14 on the local heating element, an enzyme present in the reaction solution 20, such as a DNA polymerase, can extend the connecting nucleic acid 14 at the 3' end with the aid of the dNTPs (deoxyribonucleoside triphosphates) also present. This creates an oligonucleotide bound to the local heating element 12 that comprises, from 5' to 3', a connecting segment 14a that essentially corresponds to the original connecting nucleic acid 14 and a desired primer segment 14b that has the desired primer functionality. The connecting segment 14a can preferably function as a spacer, which preferably causes the primer segment 14b to be located at a greater distance from the surface of the local heating element 12 or the nanoparticle 12a.

[0129] The target or the nucleic acid 22 to be amplified can then hybridize to the primer section 14b, so that amplification can be carried out by means of the known laser PCR, as is known from DE 10 2012 201 475 A for nanoparticles already provided in a specifically functionalized manner.

[0130] In a further preferred embodiment, the linking nucleic acid 14 can have at least one abasic modification 28 that prevents complete or partial overwriting of the linking nucleic acid 14 by the polymerase in subsequent PCR cycles. This abasic modification can, for example, be spaced a few nucleotide bases from the 3' end of the linking nucleic acid 14.

[0131] In a further preferred embodiment, the reaction solution 20 contains first primer complementary nucleic acids 30, which serve as forward primer templates, and second primer complementary nucleic acids 30, which serve as reverse primer templates, wherein the first and second primer complementary nucleic acids 30 are preferably each provided with the same connecting section 30a.

[0132] In a further preferred embodiment, the reaction solution 20 contains first primer complementary nucleic acids 30, which are designed as forward primer templates and have a connecting section 30a with a first nucleotide sequence, and second primer complementary nucleic acids 30, which are designed as reverse primer templates and have a connecting section 30a with a second nucleotide sequence. Furthermore, in this embodiment, there are either one type or variety of local heating elements 12 containing two types of connecting nucleic acids 14 (a first complementary to the first and a second complementary to the second primer complementary nucleic acids 30) or at least two types or varieties of local heating elements 12, each of which has only one connecting nucleic acid 14 complementary to either the first or only one to the second primer complementary nucleic acids 30.Furthermore, a combination of these embodiments may also be advantageous.

[0133] In a further preferred embodiment, the reaction solution 20 contains at least two primer template pairs which at least partially have the same nucleotide sequences in the connecting sections 30a, but whose primer complementary sections 30b are specific for amplification of different nucleic acids 22.

[0134] In a further preferred embodiment, the reaction liquid 20 contains at least two different types of primer template pairs which differ in terms of their connecting sections 30a and correspondingly many types of differently functionalized local heating elements 12 whose connecting nucleic acids 14 are at least partially complementary to one type of primer template pair.

[0135] When using a polymerase that generates A overhangs at the 3' end (e.g., Taq polymerase), the primer sequence should preferably be selected so that the first nucleotide following the primer sequence is an adenine; otherwise, elongation may be impaired. In other words, when using a polymerase that generates A overhangs at the 3' end, it may be advantageous to select the primer sequence such that an adenine base would follow upon elongation of the primer anyway, thus compensating for the A overhang in advance.

[0136] In order to achieve the most complete hybridization possible of the primer complementary nucleic acids 30 to the compound nucleic acids 14 at the beginning of or before the start of the amplification reaction or PCR, it may be advantageous to pre-incubate the local heating elements 12 with the compound nucleic acids 14 attached thereto and the primer complementary nucleic acids 30 under conditions different from the conditions that prevail or are advantageous during the amplification reaction. For example, a different salt concentration in the reaction solution 20, for example a higher salt concentration (e.g. 15-20 mM MgCl 2 ), and / or a different temperature of the reaction solution 20, for example a lower temperature (e.g. between 20 and 50°C), may be advantageous for the incubation. In this embodiment, it may be advantageous that further reagents for the PCR or laser PCR and / or the target orthe nucleic acid 22 to be amplified is added and then the actual amplification reaction is started.

[0137] In a further preferred embodiment, the elongation or individualization or functionalization of the connecting nucleic acids 14 functionalized to the local heating elements 12, i.e., a synthesis of the local heating element-bound primers, by an enzyme based on the primer complementary nucleic acids 30 takes place in a first reaction, and the amplification reaction, in which the target and / or the amplicon 22a or the nucleic acid 22 to be amplified are amplified, takes place in a subsequent second reaction. The first and second reactions can take place, for example, under different chemical and / or thermal conditions and / or using different polymerases and / or nucleosides, but they can also take place either simultaneously and / or in parallel and / or sequentially under the same conditions.In the first reaction, the synthesis of the primers bound to the local heating elements 12 can take place by an enzyme in one step or in several cyclically repeated steps, e.g. by repeated (global or local) heating or heating, whereby the double strands formed on the local heating element 12 by elongation of the connecting nucleic acids 14 complementary to the primer complementary section 30b of the primer complementary nucleic acids 30 are repeatedly denatured and are available again in the following cycle as free primer templates for generating new primers on other connecting nucleic acids 14. This offers the advantage that smaller amounts of primer complementary nucleic acids 30 may be sufficient. This can be advantageous, for example, since smaller amounts of primer complementary nucleic acids 30, i.e. primer templates, enable a subsequent amplification reaction in which a target and / or an amplicon 22a orthe nucleic acid 22 to be amplified, optionally have a lesser (negative) influence on the amplification reaction.

[0138] In a further preferred embodiment, excess, unbound primer templates or primer complementary nucleic acids 30 and / or dehybridized primer templates or primer complementary nucleic acids 30 and / or further reaction partners such as enzymes (e.g. polymerase) and / or nucleosides can be removed from the reaction solution 20 before the start of the second reaction, ie before the amplification of the nucleic acid 22, for example by washing and / or purification and / or filtering and / or centrifugation.

[0139] In a further preferred embodiment, the primer templates or primer complementary nucleic acids 30 can be digested and / or destroyed and / or cut and / or comminuted in a second reaction, for example by an enzyme, after the first reaction in which the primers were synthesized, so that they can have a lesser (negative) influence in a third reaction in which a target and / or an amplicon 22a or the nucleic acid 22 are amplified. For example, primer templates containing the nucleotide uracil can be comminuted by the enzyme uracil-DNA glycosylase (UDG), since uracil is specifically hydrolyzed by this enzyme. Alternatively or additionally, primer templates containing RNA nucleotides can be comminuted, for example by the enzyme RNase H2, since these can be destroyed by the enzyme RNase H2. In a further embodiment, enzymes and / or primer templates can be comminuted before the start of the third reaction, for examplebe removed from the reaction solution 20 by washing and / or purification and / or filtering and / or centrifugation.

[0140] It may be advantageous to provide the primer complementary nucleic acid at least partially with uracil bases instead of thymine bases, in order to be able to cleave the primer complementary nucleic acid, or at least its primer complementary segments, using UDG after elongation of the connecting nucleic acids. It may be particularly advantageous if no uracil nucleosides are provided for subsequent amplification of the nucleic acid or PCR, in order to avoid cutting, decomposition, or fragmentation of nucleic acids other than the primer complementary nucleic acids by the UDG.

[0141] If the primer templates or the primer complementary nucleic acids 30 are not removed or not completely removed before the amplification reaction in which a target and / or an amplicon 22a or the nucleic acid 22 are amplified, they may, for example, compete with the amplicon 22a in the sense that they compete with the target and / or the amplicon 22a in the PCR for binding to the elongated connecting nucleic acid 14. Therefore, in such a case, the concentration of primer templates or primer complementary nucleic acids 30 in the reaction solution 20 may not be chosen too high, as amplification could otherwise be at least partially inhibited. For some preferred embodiments, concentrations of the primer complementary nucleic acids 30 of 5-10 nM may be suitable, for example.

[0142] Over time, however, the primer template or the primer complement nucleic acid 30 can be gradually degraded upon binding to the newly formed, particle-bound amplicon strand 22a by the 5'-3' exonuclease activity of DNA polymerase, for example, if the latter elongates the reverse primer after it binds to the particle-bound amplicon strand. In this case, the reverse primer and the forward primer complement nucleic acid 30 could potentially both bind to the same strand of amplicon 22a. If the reverse primer is then elongated at its 3' end after presentation of the amplicon 22a, the enzyme may eventually reach the forward primer complementary nucleic acid 30 and may then, depending on the enzyme, degrade the forward primer complementary nucleic acid 30 and / or remove it from the amplicon due to the so-called 5'-3' exonuclease activity.

[0143] The statements presented below apply equally to both the first and the second preferred embodiment: Preferably, the connecting nucleic acids 14 and / or the primer nucleic acids 16 and / or the primer complementary nucleic acids 30 consist at least partially, but preferably completely, essentially of DNA, in particular of oligonucleotides. Essentially completely means that these nucleic acids are considered to consist of DNA, regardless of whether they optionally have abasic modifications and / or linker elements, such as thiol linkers. However, both connecting sections 16a and 30a as well as connecting nucleic acids 14 and the primer sections 16b and / or the primer complementary sections 30b can also consist of or comprise, for example, RNA, PNA, LNA or comparable. They can also contain modifications.

[0144] Preferably, the nucleotide sequences of the connecting nucleic acid 14 and / or the primer nucleic acid 16 and / or the primer complementary nucleic acid 30, in particular their connecting sections 14a, 16a and 30a, respectively, comprise repetitive sequences, i.e. they comprise multiple repetitions of short partial sequences such as tenfold repetition of the partial sequence TTTG or CAAA. However, the connecting nucleic acid 14 and the primer complementary nucleic acid 30 can each also comprise only one type of nucleotide, such as 30 adenine bases or 30 thymine bases. Nucleotide sequences with a very high proportion of adenine or thymine bases may be less suitable since they could be disrupted and / or blocked under certain circumstances, for example by poly-A carrier RNA (which is often used in nucleic acid preparation to improve yield and frequently consists of multi-adenine sequences).The nucleotide sequence in the linking nucleic acids 14 and / or the primer nucleic acids 16 and / or the primer complementary nucleic acids 30 preferably has a suitable length so that their hybridization is sufficiently dynamic and efficient under the given hybridization conditions. In particular, the respective lengths of the linking nucleic acids 14 and / or the primer nucleic acids 16 and / or the primer complementary nucleic acid 30 are suitably selected to exhibit a desired melting behavior.

[0145] For example, the primer nucleic acids 16 and / or the linking nucleic acids 14 and / or the primer complementary nucleic acids 30 can be configured such that a binding of a linking segment 30a and / or a linking segment 16a to a linking nucleic acid 14 and / or a binding of a primer segment 16b and / or a primer segment 14b to the nucleic acid 22 and / or an amplicon 22b and / or a target has a similar melting temperature. Preferably, the melting temperatures differ by no more than ±5°C, particularly preferably no more than ±2°C.

[0146] The primer nucleic acids 16 and / or the connecting nucleic acids 14 and / or the primer complementary nucleic acids 30 can be configured such that a length of a connecting section 30a of a primer complementary nucleic acid 30 and / or a length of a connecting section 16a of a primer nucleic acid 16 has the same length as the connecting nucleic acid 14. According to another preferred embodiment, the primer nucleic acids 16 and / or the connecting nucleic acids 14 and / or the primer complementary nucleic acids 30 can be configured such that a length of a connecting section 30a of a primer complementary nucleic acid 30 and / or a length of a connecting section 16a of a primer nucleic acid 16 has a length different from the length of the connecting nucleic acid 14. The bond length is essentially determined by the shorter of the two lengths, ie by the shorter length of the connecting section 16a or30a and the connecting nucleic acid 14. This offers the advantage that in order to vary the bond length, only one of the components needs to be exchanged, ie either the connecting nucleic acid 14 or the primer nucleic acid 16 or the primer nucleic acid 30.

[0147] Particularly preferably, local heating elements with connecting nucleic acids of different lengths can be provided or offered, for example in a kit. By appropriately selecting primer nucleic acids 16 and / or primer complementary nucleic acids 30 with connecting segments 16a and 30a, respectively, which are longer than the longest connecting nucleic acids 14, the desired melting temperature or melting behavior can be achieved in a series of experiments by testing the various combinations.

[0148] Furthermore, the nanoparticles contain not only connecting nucleic acids 14 but also further filling nucleic acids, in particular filling oligonucleotides, which do not serve as connecting nucleic acids 14, but for example enable a saturation of the local heating element surface and / or the nanoparticle surface and / or a stabilization of the local heating elements 12 or the nanoparticles 12a and / or a better steric accessibility of the connecting nucleic acids 14.

[0149] Furthermore, the connecting nucleic acids 14 have a connecting nucleotide sequence and additionally a universal spacer sequence (between the nanoparticle surface and the connecting nucleotide sequence or connecting section 14a), which positions the connecting nucleic acid 14 or the connecting nucleotide sequence at the desired distance from the nanoparticle surface or from the local heating element 12, which can offer steric advantages during amplification.

[0150] The temperature in the reaction solution outside the heated environments of the local heating elements can be kept constant during a PCR or laser PCR or can be varied during the laser PCR.

[0151] Detection or quantification of the target copies of nucleic acid 22 generated in the amplification reaction can be carried out, for example, by (quantitative) real-time PCR and / or PCR and / or gel electrophoresis and / or by means of dye-labeled hybridization probes. Alternatively or additionally, the hybridization between nanoparticles 12a or the connection of the nanoparticles 12a can also be detected by hybridization of further nanoparticle-bound oligonucleotides or amplicons, for example as a red shift and broadening of the plasmon resonance in the extinction spectrum, and / or by measuring a change in transmission of the reaction solution 20 at one or more wavelengths, for example after optothermal excitation of the nanoparticles 12a and a resulting denaturation of the particle-connecting DNA.

[0152] The invention is explained below using various specific examples, but the invention is not limited to these examples. The specified nucleotide sequences are presented in an overview in the appendix. Example 1

[0153] Gold nanoparticles with a diameter of 60 nm (obtained from BBI Solutions) were used as local heating elements and functionalized with oligonucleotides as connecting nucleic acids according to the method of Hurst et al. (see J. Hurst et al., Anal Chem., 78(24), 8313-8318, 2006). The oligonucleotide with sequence 4 was used. After functionalization and four washing steps, the nanoparticles were suspended at 600 pM in a PBS buffer (10 mM NaCl, 2.11 mM KH 2 PO 4 (P8709 from Sigma), 2.89 mM K 2 HPO 4 (P8584 from Sigma), 0.01% Tween-20, 1 mM EDTA-S).

[0154] The final laser PCR reaction (sample volume: 40 µl per reaction tube) contained the following reagents: MgCl2 18 mM Tween 20 0,1% Apta Taq Genotyping Master (Roche) 1x Free forward primer (sequence 1, without junction) 700 nM Hydrolysis probe (TaqMan probe) (sequence 2 with FAM-TAMRA) 200 nM Reverse primer template (sequence 3) 5 nM or none Gold nanoparticles 60nm (with connecting nucleic acid (sequence 4)) 60 pM

[0155] In addition, 400,000 or 40,000 copies of DNA target (extracted genomic DNA from MRSA) were added to 40 µl of reaction solution. Water was used instead of target nucleic acid as a negative control. The forward primer and reverse primer template, as well as the TaqMan probe, were selected to amplify and detect the resistance gene MecA, which is present, for example, in the genome of methicillin-resistant Staphylococcus aureus (MRSA).

[0156] The reaction was carried out in two steps: First, a partial batch was prepared for hybridization of the connecting nucleic acids. The complete amount of sequence 4-functionalized gold particles and primer complementary nucleic acids or primer templates (sequence 3) for a complete 40 µl reaction was incubated in a volume of 10 µl in the presence of 15 mM MgCl 2 (effective concentration in 10 µl) in a 200 µl PCR tube for 15 min at 37°C. In a parallel batch, the primer template or primer complementary nucleic acids (sequence 3) were replaced with the corresponding volume of water and incubated analogously.

[0157] During incubation, the remaining reagents were mixed together to form a master mix. MgCl2 was only added proportionally because some of it was already included in the pre-incubation. 26 µl of master mix and 4 µl of 10x concentrated target nucleic acid or water for the negative control were added to the 10 µl from the pre-incubation and mixed. The 40 µl were filled into the reaction chambers of the sample plate and the filling openings were sealed with PCR sealing film. The sample chambers have a length of 6 mm, a width of 4 mm and a depth of 1.5 mm. The sample plate was placed in a plate holder, and the holder was inserted into the laser cycler. The sample plate was warmed to 69°C in the laser cycler for one minute before the laser PCR was started.According to this example, the samples are scanned in a meandering pattern in each cycle using a laser with a wavelength of 532 nm and an intensity of 5-15 kW / mm 2 . A focused laser beam is moved in two dimensions relative to the sample volume, so that each nanoparticle in the reaction volume is optothermally excited at least once per cycle. (Along the third axis of the sample volume (i.e., in its depth), the focal length of the laser focus is sufficient to irradiate all particles with sufficient intensity.) The two-dimensional scanning is achieved by means of a slow and a fast relative movement between the laser focus and the sample: The slow movement along the 6 mm longitudinal extent of the reaction chamber is achieved by moving the sample at a speed of 25 mm per second; at the same time, the laser beam is moved perpendicular to the direction of travel (i.e.,The sample is periodically deflected with a galvanometer (covering the 4 mm width of the reaction chamber) at a line frequency of 1428 Hz and an amplitude of approximately 5 mm, resulting in a focus travel speed of approximately 7.1 m / s in the transverse direction. With the typical focus size of 15-20 µm and the focus travel speed, this results in an excitation duration of approximately 2-3 µs per nanoparticle.

[0158] In total, each nanoparticle was optothermally excited at least once in each cycle, with the cycles being repeated 400 times. The time between two scans per sample was 5 s. The temperature was kept constant at 69°C.

[0159] The result is in Figure 6shown in which the change in fluorescence or the TaqMan signal, i.e. released fluorescence, since dye and quencher of the hydrolysis probe were separated from each other by 5'-3' exonuclease activity of the polymerase and thus by degradation of the hydrolysis probe, is plotted against time in minutes (horizontal axis) in a graph. The solid line corresponds to the sample with 400,000 copies of the target and 5 nM sequence 3. The dash-dot line corresponds to the sample with 40,000 copies of the target and 5 nM primer template (sequence 3). The long dashed line corresponds to the negative control with only 5 nM sequence 3. The short dashed line corresponds to 400,000 copies of the target and no sequence 3 and the dotted line corresponds to the negative control without ID3.It can be seen that only the reaction solutions containing both copies of the target and sequence 3 produce a change in fluorescence. All other reaction solutions essentially produce no signal that would be significantly different from the zero line.

[0160] In the presence of 5 nM primer template (sequence 3), 400,000 and 40,000 target copies show a significant increase in fluorescence within a good 10 minutes, thus indicating positive detection of the target DNA. Without primer template, no signal increase is observed even with 400,000 target copies. The samples without gDNA target are also negative. Both demonstrate that the signal increase in the samples with target and primer template (sequence 3) is not an artifact. Example 2

[0161] The procedure for Example 2 was essentially the same as for Example 1, except that the primer template (sequence 3) was used at 1 nM to 20 nM or omitted. 40,000 copies of MRSA genomic DNA were used in each case. The result is shown in the graph in Figure 7 which is analogous to Figure 6 shows a change in fluorescence versus time in minutes. The lower dotted line corresponds to the reaction solution without sequence 3. The dash-dotted line corresponds to the reaction solution with 1 nM sequence 3. The upper dotted line corresponds to the reaction solution with 5 nM sequence 3. The solid line corresponds to the reaction solution with 10 nM sequence 3. The long-dashed line corresponds to the reaction solution with 15 nM sequence 3. The short-dashed line corresponds to the reaction solution with 20 nM sequence 3.

[0162] 5 nM and 10 nM primer template (sequence 3) provide the best results. The signal rises early and steeply. With 1 nM primer template (sequence 3), a later but equally steep signal rise is obtained. Amplification starts somewhat delayed here because the elongation of the connecting nucleic acids takes longer, but it is just as effective. With 15 nM and 20 nM primer template, the signal rises increasingly later and less steeply. This is because the primer template or the primer complement nucleic acids compete with the target for binding to the particle-bound primer and can thus inhibit amplification. Example 3

[0163] For rapid, effective elongation of the connecting nucleic acids, it would in principle be desirable to use the primer template at a high concentration. However, as can be seen in Example 2, this can lead to inhibition of the amplification reaction.

[0164] One solution to this problem may be the destruction or fragmentation of the primer template or primer complement nucleic acid after elongation of the connecting nucleic acids. This can be achieved by incorporating one or more ribonucleotides into the primer template or primer complement nucleic acid distributed over its entire length. After a preliminary step to elongate the connecting nucleic acids, the primer template can be enzymatically destroyed with an RNase before laser PCR is initiated.

[0165] Gold nanoparticles with a diameter of 60 nm (obtained from BBI Solutions) were functionalized with oligonucleotides according to the method of Hurst et al. (see J. Hurst et al., Anal Chem., 78(24), 8313-8318, 2006). The oligonucleotide with sequence 4 was used. After functionalization and four washing steps, the particles were suspended at 600 pM in PBS buffer (10 mM NaCl, 2.11 mM KH 2 PO 4 (P8709 from Sigma), 2.89 mM K 2 HPO 4 (P8584 from Sigma), 0.01% Tween-20, 1 mM EDTA-S).

[0166] The final laser PCR reaction (sample volume: 40 µl per reaction tube) contained the following reagents: MgCl2 18 mM Tween 20 0,1% Apta Taq Genotyping Master (Roche) 1x Free forward primer (Oligo ID1) 700 nM Hydrolysis probe (sequence 2 with FAM-TAMRA) 200 nM Ribonucleotide-containing reverse primer template (sequence 3-RN) 60 nM Gold nanoparticles 60nm (with connecting nucleic acid with sequence 4) 60 pM RNAse H2 (IDT) 1 mU / µl or none

[0167] In addition, 400,000 or 40,000 copies of target DNA (MRSA genomic DNA) were added to a 40 µl sample, with water used as a negative control instead of target DNA. The forward primer and reverse primer template, as well as the TaqMan probe, were selected to amplify and detect the resistance gene MecA, which is found, for example, in the genome of methicillin-resistant Staphylococcus aureus (MRSA).

[0168] The reaction took place in three steps: First, a partial batch was prepared for the upstream elongation of the connecting nucleic acids.

[0169] The complete amount of sequence 4 functionalized gold particles and primer template sequence 3-RN (with ribonucleotides) for a 40µl reaction were incubated in a volume of 10µl in the presence of 15mM MgCl2 and 1x Apta Taq Genotyping Master from Roche (each effective concentration in 10µl, assuming that approximately 3mM MgCl2 is already contained in the 1x Roche Apta Taq Genotyping Master) in a 200µl PCR tube for 5 min at 60°C.

[0170] Next, 2 µl of thermophilic RNase H2 from Pyrococcus abysii (IDT) was added at a concentration of 20 mU / µl, diluted in IDT's special dilution buffer (resulting in 1 mU / µl in a final volume of 40 µl). RNase H2 requires an additional 0.01% Triton-X-100 (alternatively Tween-20) for its activity. IDT's RNase H2 dilution buffer contains 0.1% Triton-X-100, so that with appropriate dilution of the enzyme, sufficient Triton-X-100 is included in the reaction. The laser PCR reaction itself already contains 0.1% Tween-20.

[0171] RNase H2 from Pyrococcus abysii cleaves DNA-RNA heteroduplexes at the 5' end of individually interspersed ribonucleotides. These should be located at least 8-10 bases from the 5' end or at least 4 bases from the 3' end.

[0172] The primer template was incubated for another 5 minutes at 60°C to digest it as effectively as possible. The primer template sequence 3-RN contains 5 ribonucleotides evenly distributed throughout the sequence, thus being cleaved into up to six fragments.

[0173] In a parallel approach, only 2 µl of RNAse dilution buffer without enzyme was added instead of RNAse H2 and incubated analogously.

[0174] During incubation, the remaining reagents were mixed together to form a master mix. MgCl 2 and Apta Taq Genomic Master were added only partially because some of them were already included in the pre-incubation. 24 µl of master mix and 4 µl of 10-fold concentrated target were added to the 12 µl from the pre-incubation (including RNAse and buffer addition) and mixed. The 40 µl were filled into the reaction chambers of the sample plate as in Example 1, and the filler openings were sealed with PCR sealing film. Processing in the laser cycler was carried out analogously to Example 1.

[0175] The result is shown in the graph in Figure 8 shown, which shows a change in fluorescence against time in minutes. The solid line corresponds to the reaction solution with 400,000 copies of target DNA with RNAse. The long-dashed line corresponds to the reaction solution with 40,000 copies with RNAse. The medium-dashed line corresponds to the reaction solution with negative control with RNAse. The dash-dotted line corresponds to the reaction solution with 400,000 copies of target DNA without RNAse. The short-dashed line corresponds to the reaction solution with 40,000 copies of target DNA without RNAse. The dotted line corresponds to the reaction solution with negative control without RNAse.

[0176] The primer template sequence 3-RN with ribonucleotides can be used without any problems at 60 nM when performing an RNase digestion step. With 400,000 and 40,000 copies of target, the signal increases a few minutes earlier than in the format without RNase digestion, with the best result in the previous example ( Figure 7 ; 5 nM or 10 nM primer template sequence 3). However, if RNAse digestion is omitted, even 400,000 copies are almost undetectable. The signal only increases very late and is very flat. 40,000 copies are completely negative. This is consistent with the results for sequence 3 concentrations greater than 10 nM without digestion ( Figure 7 ).

[0177] Large amounts of intact primer template or primer complement nucleic acids inhibit amplification because the primer template competes with the target for binding to the particle-bound primer.

[0178] In the format with RNAse digestion, the primer template can be used in a much higher concentration than in the format without RNAse digestion, thus accelerating the amplification Example 4

[0179] Gold nanoparticles with a diameter of 60 nm (obtained from BBI Solutions) were functionalized with oligonucleotides according to the method of Hurst et al. (see J. Hurst et al., Anal Chem., 78(24), 8313-8318, 2006). The oligonucleotide with sequence 5 was used. After functionalization and four washing steps, the particles were suspended at 600 pM in PBS buffer (10 mM NaCl, 2.11 mM KH 2 PO 4 (P8709 from Sigma), 2.89 mM K 2 HPO 4 (P8584 from Sigma), 0.01% Tween-20, 1 mM EDTA-S).

[0180] The final laser PCR reaction (sample volume: 40 µl per reaction tube) contained the following reagents: MgCl2 18 mM Tween 20 0,1% Apta Taq Genotyping Master (Roche) 1x Forward primer nucleic acid (sequence 6) 30 nM Reverse primer nucleic acid (sequence 7) 30 nM Hydrolysis probe (sequence 2 with FAM-TAMRA) 200 nM Gold nanoparticles 60nm (with connecting nucleic acid with sequence 5) 60 pM

[0181] In addition, 400,000 or 40,000 copies of target DNA (MRSA genomic DNA) were added to a 40 µl sample, with water used as a negative control instead of target DNA. The forward and reverse primer nucleic acid and the TaqMan probe were selected to amplify and detect the resistance gene MecA, which is present, for example, in the genome of methicillin-resistant Staphylococcus aureus (MRSA).

[0182] In this example, the nanoparticle-bound linker nucleic acid with sequence 5 is attached to the nanoparticles with a 3'-thiol. Both the forward primer nucleic acid (oligonucleotide with sequence 6) and the reverse primer nucleic acid (oligonucleotide with sequence 7) each carry a linker at the part facing the 5' end and two spacer 9 modifications each as abasic modifications between the linker and the primer.

[0183] After all components were mixed, they were transferred to the sample plates as in the previous examples and sealed. The sample plates were then heated to 88°C for 1 minute, then warmed to 69°C in the laser cycler for one minute before starting the laser PCR. Processing in the laser cycler was carried out analogously to Example 1, but with a line frequency of 800 Hz and 250 cycles.

[0184] The result is shown in the graph in Figure 9 , which shows a change in fluorescence over time in minutes. The solid line corresponds to the reaction solution containing 400,000 copies of the target DNA. The long-dashed line corresponds to the reaction solution containing 40,000 copies. The dotted line corresponds to the reaction solution with a negative control without target DNA.

[0185] In the presence of 400,000 and 40,000 copies of target, a clear increase in fluorescence is observed after approximately 8 minutes and 10 minutes, respectively, thus indicating positive detection of the target DNA. Without a target, there is hardly any signal increase. The nanoparticles have become universally applicable local heating elements through functionalization with connecting nucleic acids with sequence 5. The connecting nucleic acids with sequence 5 directly bound to the nanoparticles are not suitable as primers for the nucleic acid to be detected, if only because the 3' end of oligonucleotides with sequence 5, which can be elongated by the polymerase, is not freely accessible but is bound to the nanoparticle surface.By using forward primer nucleic acid (oligonucleotide with sequence 6) and reverse primer nucleic acid (oligonucleotide with sequence 7), each with a connecting segment and abasic modifications, the universally applicable local heating elements can still be used for the specific amplification and specific detection of the nucleic acid used. Reference symbol

[0186] 10System 12Local heating element 12aNanoparticle 12bMicroheating element 14Compound nucleic acid 16Primer nucleic acid 16aCompound section 16bPrimer section 18Reaction vessel 20Reaction solution 22Nucleic acid 22aAmplicon 24(further) primer 26Optical excitation 28Abasic modification 29Environment (of a local heating element) 30Complementary compound nucleic acid 30aCompound section 30bPrimer complement section Attachment

[0187] Sequence list (sequence order from 5' to 3'): Sequence 1:AGATGGTATGTGGAAGTTAGATTGG (SEQ ID No. 1) Sequence 2: 5'FAM-TCCTGGAATAATGACGCTATGATCCC-TAMRA (SEQ ID No. 2) FAM = 6-Carboxy-Fluorescein (Fluorescent Dye), TAMRA = 6-Carboxy-tetramethyl-rhodamine (Quencher); Sequence 3: GCAGAAAGACCAAAGCATACAT AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID No. 3) Sequence 3-RN: GCAGAAAGAcCAAAGCATAcAT AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID No. 4) Cleanliness of a ribonucleotide an Sequence 4: 5'Thiol - TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT (SEQ ID No. 5) Sequence 5: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT - 3'Thiol (C6) (SEQ ID No.6) Sequence 6: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA / Sp9 / / Sp9 / AGATGGTATGTGGAAGTTAGATTGG (SEQ ID No. 7; SEQ ID No. 8); Sequence 7: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA / Sp9 / / Sp9 / ATGTATGCTTTGGTCTTTCTGC (SEQ ID No. 9; SEQ ID No. 10) / Sp9 / is an Abasic modification of "Spacer9"

Claims

1. System (10) for amplifying a nucleic acid (22), comprising: - at least one local heating element (12) which is functionalized with at least one linking nucleic acid (14) and is designed to be in contact with a reaction solution (20) for carrying out a polymerase chain reaction for amplifying a nucleic acid (22), wherein the at least one local heating element (12) is designed as a nanoparticle (12a) and is in particular designed to transfer heat to its surroundings (29) by excitation, or wherein the at least one local heating element (12) is designed as a microheating element (12b) and is in particular designed to transfer heat to its surroundings (29) by resistive heating, and - at least one primer nucleic acid (16) which is designed to bind to the at least one linking nucleic acid (14) and to bind to the nucleic acid (22), and / or - at least one primer complementary nucleic acid (30) which is designed to bind to the at least one linking nucleic acid (14) and to elongate the linking nucleic acid (14) by a primer nucleotide sequence by means of an enzymatic reaction.

2. System (10) according to claim 1, wherein the primer complementary nucleic acid (30) has at least one linking portion (30a) designed to bind to the at least one linking nucleic acid (14), and wherein the primer complementary nucleic acid (30) has at least one primer complementary portion (30b) which is designed to elongate the linking nucleic acid (14) by a primer nucleotide sequence by means of an enzymatic reaction, and wherein a nucleotide sequence in the linking portion (30a) of the primer complementary nucleic acid (30) is at least partially complementary to a nucleotide sequence of the linking nucleic acid (14) and / or wherein a nucleotide sequence in the primer complementary portion (30b) is at least partially complementary to the primer nucleotide sequence.

3. System (10) according to claim 2, wherein the primer nucleic acid (16) has at least one abasic modification (28) between the at least one linking portion (16a) and the at least one primer portion (16b) and / or wherein the linking nucleic acid (14) has an abasic modification (28).

4. System (10) according to any of the preceding claims, comprising a plurality of primer nucleic acids (16) of which the primer portions (16b) are designed as forward primers and / or as reverse primers.

5. System (10) according to any of the preceding claims, wherein the at least one linking nucleic acid (14) and / or the at least one primer nucleic acid (16) and / or the at least one primer complementary nucleic acid (30) are each at least partially formed as an oligonucleotide.

6. System (10) according to any of the preceding claims, wherein the linking nucleic acid (14) and / or the primer nucleic acid (16) comprise at least one immobilizing element which is designed to immobilize primer nucleic acid (16), when bound to the linking nucleic acid (14), on the linking nucleic acid (14) such that the primer nucleic acid (16) remains bound to the linking nucleic acid (14) during a denaturation step, wherein the at least one immobilizing element is designed to immobilize the primer nucleic acid (16) on the linking nucleic acid (14) by means of a chemical reaction.

7. Local heating element (12) for a polymerase chain reaction for amplifying a nucleic acid (22), wherein the local heating element is functionalized with at least one linking nucleic acid (14) and a primer nucleic acid (16) and / or a primer complementary nucleic acid (30) is bound to the at least one linking nucleic acid (14), wherein the at least one primer complementary nucleic acid (30) is designed to elongate the linking nucleic acid (14) by a primer nucleotide sequence by means of an enzymatic reaction, and wherein the at least one local heating element (12) is designed as a nanoparticle (12a) and is in particular designed to transfer heat to its surroundings (29) by excitation, or wherein the at least one local heating element (12) is designed as a microheating element (12b) and is in particular designed to transfer heat to its surroundings (29) by resistive heating.

8. Method for amplifying a nucleic acid (22) in a reaction solution (20), comprising the steps of: - providing at least one local heating element (12) in the reaction solution (20), wherein the local heating element (12) is functionalized with at least one linking nucleic acid (14), wherein the at least one local heating element (12) is designed as a nanoparticle (12a) which transfers heat to its surroundings (29) by excitation, wherein the excitation takes place as an optical excitation (26), or wherein the at least one local heating element (12) is designed as a microheating element (12b) which transfers heat to its surroundings (29) by resistive heating; - providing and / or generating at least one primer nucleic acid (16) in the reaction solution (20), wherein the primer nucleic acid (16) is designed to bind to the at least one linking nucleic acid (14) and to bind to the nucleic acid (22); - transferring heat via the local heating element (12) to the surroundings (29) of the local heating element (12) such that a nucleic acid (22) connected to the at least one local heating element (12) via the at least one primer nucleic acid (16) and the at least one linking nucleic acid (14) is heated to and / or above a denaturation temperature.

9. Method according to claim 8, wherein generating the at least one primer nucleic acid (16) comprises providing a primer complementary nucleic acid (30) in the reaction solution (20), wherein the primer complementary nucleic acid (30) has a linking portion (30a) which is designed to bind to the at least one linking nucleic acid (14) and a primer complementary portion (30b) having a nucleotide sequence that is at least partially complementary to the primer nucleic acid (16) to be generated, and wherein the method, after generating the at least one primer nucleic acid (16), further comprises the step of: - comminuting the at least one primer complementary nucleic acid (30), wherein the primer complementary nucleic acid (30) is provided at least partially with uracil bases and particularly the comminution of the at least one primer complementary nucleic acid (30) is carried out at least partially by hydrolyzing the uracil bases.

10. Method according to one of claims 8 to 9, further comprising the step of: - immobilizing the primer nucleic acid (16) on the linking nucleic acid (14) such that the primer nucleic acid (16) remains bound to the linking nucleic acid (14) during a denaturation step.

11. Method according to any of claims 8 to 10, wherein the amplification of the nucleic acid (22) in the reaction solution (20) is carried out by means of a polymerase chain reaction.