Core-encoded male sterility due to mutation in cytochrome P450 oxidase
Patent Information
- Application Number
- DE502017017135
- Authority / Receiving Office
- DE · DE
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2016-04-12
- Filing Date
- 2017-04-12
- Publication Date
- 2025-11-27
- Estimated Expiration
- 2037-04-12
AI Technical Summary
Current breeding programs for plants, particularly sugar beets, are labor-intensive and prone to errors due to the need for manual removal of pollen-bearing anthers and the parallel maintenance of fertile and sterile genotypes, which is complex and costly.
Introduction of a nuclear-encoded male-sterile phenotype in plants, specifically through mutations in the cytochrome P450 oxidase (CYPgst) gene, allowing for self-fertilization to segregate fertile and sterile genotypes, eliminating the need for manual anther removal and parallel genotype maintenance.
Simplifies breeding processes by ensuring automatic segregation of fertile and sterile plants, reducing labor and logistical complexities, and enabling efficient hybrid seed production without the need for manual intervention.
Description
AREA OF INVENTION
[0001] The present application concerns the field of simplifying labor-intensive breeding programs using molecular biological methods, marker technology, and genetic engineering. In particular, it discloses plants that, through spontaneous mutation of a gene region in the nuclear genome, exhibit a nuclear-encoded, male-sterile phenotype in the homozygous state, characterized by the fact that, unlike CMS ( cytoplasmic male sterility ) is obtained through a recessive trait expression, thus eliminating the need for parallel maintenance of sterile and fertile genotypes in breeding programs. In this regard, the present application discloses plants, in particular sugar beet or potato, in which a mutation in a cytochrome P450 oxidase ( CYPgst The gene that leads to the aforementioned trait expression has been identified, along with the corresponding method for identifying this mutation. Additionally, a CYPgst protein, a DNA molecule containing the mutated gene that leads to the aforementioned trait expression, a recombinant DNA molecule revealing the wild-type gene, a promoter for the specific expression of this gene or a heterologous gene in flowers and / or fruits of plants, and / or a nucleotide sequence encoding inhibitors of the CYPgst gene, as well as corresponding vectors and host cells, are provided.
[0002] Furthermore, the present application relates to genetically modified plants exhibiting a recessive, nuclear-encoded male sterile phenotype through inhibition of the expression of the CYPgst gene, the corresponding inhibitors, as well as methods for inhibiting the gene and methods for restoring fertility. The application also relates to the use of the plants in hybrid breeding, resistance breeding, and / or seed production. Seeds or offspring, organs, plant parts, tissues, or cells of these plants, as well as their use, are also covered. BACKGROUND OF THE INVENTION
[0003] To create controlled genetic variation in sugar beets ( Beta vulgaris subsp. vulgaris ) ,Crossbreeding is also carried out in all other cultivated plant species. In this process, pollen-bearing anthers are manually removed from the still-closed flowers of the parent plant. Pollination then occurs manually by applying pollen from the pollen donor to the stigma of the parent plant. Alternatively, after removing the anthers from the flowers of the parent plant, pollination can also be achieved by bringing the pollen donor into flowering and pollen release in close proximity to the parent plant. In any case, these are extremely labor-intensive protocols that are quite prone to error, as, for example, the unintentional partial removal of anthers from a flower can lead to self-pollination.
[0004] The production of (commercial) hybrid seed is currently often carried out by crossbreeding the parent seed component into CMS ( cytoplasmic male sterility ) -Bearing genotypes and subsequent backcrossing to increase the genetic contribution of the seed parent component. The resulting male-sterile seed parent component can then be cultivated on a large scale, and pollination is carried out by pollen donors growing in close proximity ( topcross (Procedure). Since CMS is inherited maternally in a dominant manner, the use of CMS lines requires the parallel availability of fertile lines. Maintainer- Lines (i.e., O-types not stored in CMS) ensure the pollination of the CMS lines. This entails significant planning and production effort, as well as complex logistics. For example, commercial sugar beets are currently produced as triple hybrids to generate seed of sufficiently high quality. The production of hybrids in breeding programs is also cost- and labor-intensive and is currently achieved by erecting partition walls.
[0005] In numerous plant species, there are descriptions of lineages or genotypes that exhibit naturally occurring nuclear-encoded male sterility. ms- ( male sterile This is usually caused by a spontaneous mutation of a gene in the nuclear genome, and this mutation is maintained through a recessive expression of the trait. The use of genotypes with nuclear-encoded male sterile phenotypes is suitable for simplifying parts of breeding processes and / or for using them to produce hybrid seeds. The male sterile phenotypes have the advantage that they do not need to be manually stripped of anthers for crosses, and the parallel maintenance of fertile and sterile genotypes is unnecessary, because through self-fertilization, the heterozygous genotypes segregate into fertile and sterile individuals in each propagation step.
[0006] The object of the present invention was therefore to provide means and methods for using nuclear-encoded male sterility in crop plants, in particular sugar beets. This object is achieved according to the invention by the embodiments characterized in the claims and in the description. SUMMARY OF THE INVENTION
[0007] The present application concerns the field of simplifying labor-intensive breeding programs, marker technology, and genetic engineering. It relates to plants that, through mutation in a DNA segment containing a cytochrome P450 oxidase (CYPgst), exhibit a nuclear-encoded, recessive, male-sterile phenotype. The CYPgst gene and the mutation were identified using marker technology and molecular biological methods. Since the mutation is maintained through the recessive expression of the trait, and since heterozygous genotypes are segregated into fertile and sterile genotypes at each propagation step through self-fertilization, the parallel maintenance of fertile and sterile genotypes is eliminated. Maintainer- lines . Additionally, the findings can be used to generate transgenic plants with a nuclear-encoded, recessive, male sterile phenotype and to restore fertility.
[0008] The present application discloses the following A plant, in particular a crop plant, exhibiting a recessive, nuclear-encoded male sterile phenotype, characterized in that the phenotype is encoded by a mutation encompassing the endogenous cytochrome P450 oxidase (CYPgst) gene, or by the absence or, compared to a corresponding (male-fertile) wild-type plant, by a low content or activity of a functional CYPgst protein encoded by the wild-type CYP gene. gst is encoded, correlated, characterized by the fact that the non-mutated CYP is gst Gene a) around the gene Bv CYP gst out of Beta vulgaris a) the gene which preferably comprises one of the nucleotide sequences shown in SEQ ID No.: 1 or 2 or encodes the amino acid sequence shown in SEQ ID No.: 3, or its homolog, analogue or ortholog, b) the gene St CYP gst out of Solanum tuberosum a) preferably comprising one of the nucleotide sequences shown in SEQ ID No.: 12 or 13 or encoding the amino acid sequence shown in SEQ ID No.: 14, or its homolog, analogue or ortholog, or c) the gene Zm CYP gst out of Zea mays a plant that preferably comprises one of the nucleotide sequences shown in SEQ ID No. 9 or 10 or encodes the amino acid sequence shown in SEQ ID No. 11, or its homolog, analogue, or ortholog; furthermore, a plant that is heterozygous for the mutation and male fertile, or homozygous for the mutation and male sterile, wherein in the sterile plant the formation of functional pollen is inhibited, preferably completely inhibited; furthermore, a plant wherein the CYP gst The gene is expressed at least in closed flowers and fruits; furthermore, such a plant, wherein the mutation prevents the transcription and / or translation of a functional protein, preferably wherein the mutation is a deletion, addition, insertion or substitution in the coding nucleotide sequence of the CYP gst Genes, a splicing signal or in a regulatory sequence, preferably the promoter sequence, of CYP gst This is a gene. In a preferred embodiment, the nucleic acid molecule has a mutation that is also found in the nucleotide sequence according to SEQ ID No. 8 when compared with the wild-type gene of SEQ ID No. 1. In particular, the mutation can be a deletion between nucleotide positions 1560 and 2095 of SEQ ID No. 1 or corresponding positions of SEQ ID No. 12 or 9. The deletion can have a length of at least 20, 30, or 50 consecutive base pairs, preferably at least 100, 150, 200, or 250 consecutive base pairs, and particularly preferably at least 300, 400, or 500 consecutive base pairs. In a particularly preferred embodiment, the nucleic acid molecule comprises a nucleotide sequence according to SEQ ID No. 8. In a further preferred embodiment, the nucleic acid molecule has a point mutation in the nucleotide sequence of SEQ ID No.1 according to Table 1, preferably between nucleotide positions 1560 and 2095 of SEQ ID No.: 1; furthermore, such a plant, wherein in . Beta vulgaris, preferably Beta vulgaris subsp. vulgaris, the deletion can be detected by the absence of one or both of the marker loci sle5983d14 (amplification product of the primers with SEQ ID No.: 4 and 5) and sle5983d17 (amplification product of the primers with SEQ ID No.: 6 and 7) and by the presence of a ubiquitous marker; furthermore, such a plant, wherein in Beta vulgaris, preferably Beta vulgaris subsp. vulgaris, the gene is located in a segment on chromosome 1 between the marker loci sxn2151s01 and s1e3305s02, with the sxn2151s01 marker sequence shown in SEQ ID No. 24 and the sle3305s02 marker sequence shown in SEQ ID No. 26 indicating the presence of the gst - Display the locus and the sxn2151s01 marker sequence shown in SEQ ID No. 25 and the sle3305s02 marker sequence shown in SEQ ID No. 27, the reference sequence; furthermore, such a plant, wherein the segment is about 50 to 5000 kbp in size, preferably 100 to 1000 kbp, more preferably 100 to 500 kbp and particularly preferably 200 to 250 kbp; furthermore, such a plant, wherein the non-mutated gene is the functional gene BvCYPgst out of Beta vulgaris, preferably Beta vulgaris subsp. vulgaris is a functional homologous, analogous, or orthologous gene of another cultivated or useful plant; furthermore, such a plant, wherein the homologous, analogous, or orthologous gene is a gene from Zea mays, which preferably comprises one of the nucleotide sequences shown in SEQ ID No.: 9 or 10 or encodes the amino acid sequence shown in SEQ ID No.: 11, from Solanum tuberosum, which preferably comprises one of the nucleotide sequences shown in SEQ ID No.: 12 or 13 or encodes the amino acid sequence shown in SEQ ID No.: 14, from Triticum aestivum, which preferably encodes the amino acid sequence shown in SEQ ID No.: 15, from Helianthus annuus, which preferably encodes the amino acid sequence shown in SEQ ID No.: 16, from Hordeum vulgare, which preferably encodes the amino acid sequence shown in SEQ ID No.: 17, from Brassica napus, which preferably encodes the amino acid sequence shown in SEQ ID No.: 18, from Brassica oleracea, which preferably encodes the amino acid sequence shown in SEQ ID No.: 19, from Brassica rapa, which preferably encodes the amino acid sequence shown in SEQ ID No.: 20, from Glycine max, which preferably encodes the amino acid sequence shown in SEQ ID No.: 21, from Gossypium, which preferably encodes the amino acid sequence shown in SEQ ID No.: 22, from Sorghum bicolor, which preferably encodes the amino acid sequence shown in SEQ ID No.: 23; furthermore, such a plant wherein the non-mutated gene (wild type gene) has a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence that has the nucleotide sequence shown in SEQ ID No.: 1 or SEQ ID No.: 2 or a functional fragment thereof (see e.g. Abb. 4A and 4B); (b) nucleotide sequence encoding the amino acid sequence shown in SEQ ID No.: 3; (c) nucleotide sequence capable of hybridizing to a nucleotide sequence complementary to a nucleotide sequence according to (a) or (b) under stringent conditions; (d) nucleotide sequence encoding an amino acid sequence that differs from the amino acid sequence according to SEQ ID No.: 3 in the form of amino acid deletions, substitutions, additions and / or insertions in the amino acid sequence and preferably has a sequence identity of at least 60% over the entire amino acid sequence; (e) nucleotide sequence encoding a protein with the same enzymatic activity as the protein encoded by a nucleotide sequence according to any one of (a) to (d); and (f) nucleotide sequence comprising at least 200 or 400, preferably at least 600 or 800, particularly preferably at least 1000 consecutive nucleotides from the promoter of the nucleic acid sequence of SEQ ID No.: 1 comprising nucleotide positions 1 to 1518, preferably nucleotide positions 518 to 1518, particularly preferably nucleotide positions 1318-1518 or a sequence hybridizing to this region, wherein the nucleotide sequence is able to specifically control the expression of the gene or of a heterologous nucleic acid molecule operatively linked to the nucleotide sequence in closed flowers and / or fruits; a nucleotide sequence according to (c), (d) or (e) is, for example, a nucleotide sequence comprising the nucleotide sequence shown in SEQ ID No.: 12 or SEQ ID No.: 13 or a functional fragment thereof, or encoding the amino acid sequence shown in SEQ ID No.: 14. Furthermore, a nucleotide sequence according to (c), (d) or (e) is, for example, a nucleotide sequence that has the nucleotide sequence shown in SEQ ID No.: 9 or SEQ ID No.: 10 or a functional fragment thereof, or that encodes the amino acid sequence shown in SEQ ID No.: 11.Furthermore, a nucleotide sequence according to (c), (d) or (e) is, for example, a nucleotide sequence encoding an amino acid sequence selected from the group consisting of SEQ ID No.: 15-23; furthermore, a nucleic acid molecule or recombinant DNA molecule comprising one of the above-mentioned nucleotide sequences; furthermore, such a recombinant DNA molecule comprising (i) a promoter with a nucleotide sequence as defined in
[10] (f) that is operatively linked to a heterologous nucleic acid molecule, or (ii) a coding nucleotide sequence as defined in
[10] (a) - (e) that is operatively linked to a heterologous promoter that is preferably able to control the expression of the nucleotide sequence specifically in closed flowers and / or fruits; furthermore, such a recombinant DNA molecule comprising a nucleotide sequence that is an shRNA (. small hairpin RNA ) , siRNA (small interfering RNA ) ,Antisense RNA, sense RNA or double-stranded RNA encodes which, after expression in a plant cell or after introduction into a plant cell, leads to the inhibition of the expression of the functional (non-mutated) CYPgst gene. In a preferred embodiment, the nucleotide sequence comprises at least 15, 16, 17, 18, 19 or 20, preferably at least 21, 22, 23, 24 or 25, particularly preferably at least 30, 35, 40, 45 or 50, and most preferably at least 100, 200, 300, 500 or 1000 consecutive nucleotides of SEQ ID No.: 1, 2, 9, 10, 12 or 13 in sense or antisense orientation or of at least one exon of SEQ ID No.: 1, 9 or 12 in sense or antisense orientation. Exon 1 of SEQ ID No. 1 extends from nucleotide positions 1762-2679, and exon 2 of SEQ ID No. 1 extends from nucleotide positions 3507-4142. Exon 1 of SEQ ID No. 12 extends from nucleotide positions 1762-2032, and exon 2 of SEQ ID No. 12 extends from nucleotide positions 1762-2032.: 12 from nucleotide positions 2449-3161 and exon 3 of SEQ ID No.: 12 from nucleotide positions 4032-4694. Exon 1 of SEQ ID No.: 9 extends from nucleotide positions 2001-2927 and exon 2 of SEQ ID No.: 9 from nucleotide positions 3018-3683. In a further preferred embodiment, the nucleotide sequence comprises at least 15, 16, 17, 18, 19 or 20, preferably at least 21, 22, 23, 24 or 25, particularly preferably at least 30, 35, 40, 45 or 50, and most preferably at least 100, 200, 300, 500 or 1000 consecutive nucleotides capable of hybridizing specifically to a nucleotide sequence as defined in
[10] or
[16] ; furthermore, such a nucleic acid molecule comprising a nucleotide sequence with a mutation in the form of a deletion, addition, insertion or substitution, wherein this mutation results in no functional CYP. gst Protein is synthesized. Preferably, the mutation is in the coding nucleotide sequence of CYP. gst Genes, a splicing signal, or in a regulatory sequence of CYP gst Genes, preferably in the promoter of the CYP gst Gene, localized. In a preferred embodiment, the nucleic acid molecule has a mutation that is also found in the nucleotide sequence according to SEQ ID No.: 8. In particular, the mutation may be a deletion between nucleotide positions 1560 and 2095 of SEQ ID No.: 1 or corresponding positions of SEQ ID No.: 12 or 9. The deletion may have a length of at least 20, 30, or 50 consecutive base pairs, preferably at least 100, 150, 200, or 250 consecutive base pairs, and particularly preferably at least 300, 400, or 500 consecutive base pairs. In a particularly preferred embodiment, the nucleic acid molecule comprises a nucleotide sequence according to SEQ ID No. 8. In a further preferred embodiment, the nucleic acid molecule has a point mutation in the nucleotide sequence of SEQ ID No. 1 according to Table 1, preferably between nucleotide positions 1560 and 2095 of SEQ ID No.: 1; furthermore, such a nucleic acid molecule of at least 15, 16, 17, 18, 19 or 20, preferably at least 21, 22, 23, 24 or 25, particularly preferably at least 30, 35, 40, 45 or 50, and most particularly preferably at least 100, 200, 300, 500 or 1000 consecutive nucleotides of SEQ ID No.: 1, 2, 9, 10, 12 or 13 in sense and / or antisense orientation or of at least one exon of SEQ ID No.: 1, 9 or 12 in sense or antisense orientation. Exon 1 of SEQ ID No. 1 extends from nucleotide positions 1762-2679, and exon 2 of SEQ ID No. 1 extends from nucleotide positions 3507-4142. Exon 1 of SEQ ID No. 12 extends from nucleotide positions 1762-2032, exon 2 of SEQ ID No. 12 from nucleotide positions 2449-3161, and exon 3 of SEQ ID No. 12 from nucleotide positions 4032-4694. Exon 1 of SEQ ID No. 9 extends from nucleotide positions 2001-2927, and exon 2 of SEQ ID No. 9 from nucleotide positions 3018-3683.In a particular embodiment, the nucleic acid molecule extends over at least one intron of SEQ ID No.: 1, SEQ ID No.: 9, or SEQ ID No.: 12, i.e., the nucleic acid molecule successively comprises i) at least one nucleotide from the 3' end of exon 1 of SEQ ID No.: 1 (preferably the last nucleotide of exon 1 of SEQ ID No.: 1 in the 5'-3' direction; corresponding to the nucleotide at position 583 of SEQ ID No.: 2) and at least one nucleotide from the 5' end of exon 2 of SEQ ID No.: 1 (preferably the first nucleotide of exon 2 of SEQ ID No.: 1 in the 5'-3' direction; corresponding to the nucleotide at position 584 of SEQ ID No.: 2), ii) at least one nucleotide from the 3' end of exon 1 of SEQ ID No.: 1. 12 (preferably the last nucleotide of exon 1 of SEQ ID No.: 12 in the 5'-3' direction; corresponding to the nucleotide at position 271 of SEQ ID No.: 13) and at least one nucleotide from the 5' end of exon 2 of SEQ ID No.: 12 (preferably the first nucleotide of exon 2 of SEQ ID No.: 12).: 12 in the 5'-3' direction; corresponding to nucleotide at position 272 of SEQ ID No.: 13), iii) at least one nucleotide from the 3' end of exon 2 of SEQ ID No.: 12 (preferably the last nucleotide of exon 2 of SEQ ID No.: 12 in the 5'-3' direction; corresponding to nucleotide at position 984 of SEQ ID No.: 13) and at least one nucleotide from the 5' end of exon 3 of SEQ ID No.: 12 (preferably the first nucleotide of exon 3 of SEQ ID No.: 12 in the 5'-3' direction; corresponding to nucleotide at position 985 of SEQ ID No.: 13), or iv) at least one nucleotide from the 3' end of exon 1 of SEQ ID No.: 9 (preferably the last nucleotide of exon 1 of SEQ ID No.: 9 in 5'-3' direction; corresponding to nucleotide at position 927 of SEQ ID No.: 10) and at least one nucleotide from the 5' end of exon 2 of SEQ ID No.: 9 (preferably the first nucleotide of exon 2 of SEQ ID No.: 9 in the 5'-3' direction; corresponding to nucleotide at position 928 of SEQ ID No.: 10).In a further preferred embodiment, the nucleotide sequence comprises at least 15, 16, 17, 18, 19 or 20, preferably at least 21, 22, 23, 24 or 25, particularly preferably at least 30, 35, 40, 45 or 50, and most preferably at least 100, 200, 300, 500 or 1000 consecutive nucleotides, which is capable of hybridizing specifically to a nucleotide sequence as defined in
[10] or
[16] ; furthermore, such an oligonucleotide, preferably with a length of no more than 50 nucleotides, comprising such a nucleic acid molecule or a nucleic acid molecule capable of specifically hybridizing to a nucleotide sequence according to SEQ ID No.: 8, and / or preferably having one of the following nucleotide sequences: (i) SEQ ID No.: 4, 6 or a complement thereof, or (ii) SEQ ID No.: 5, 7 or a complement thereof; a vector, preferably a plant vector, comprising such a DNA molecule ornucleic acid molecule; ; furthermore, such a vector, wherein the DNA molecule or nucleic acid molecule is able as a transgene to produce a functional CYP. gst to express and is preferably genetically linked to a further transgene which prevents the transmission of the DNA molecule or nucleic acid molecule via the pollen, preferably wherein the vector or the transgene further comprises an expression cassette which leads to the marking of the seeds, preferably by fluorescent labeling; furthermore, a host cell, preferably a plant cell containing such a recombinant DNA molecule or nucleic acid molecule; furthermore, a CYP gst Protein encoded by a nucleotide sequence as defined above, or a functional and / or immunologically active fragment thereof; preferably the CYP protein. gst Protein comprising a) the amino acid sequence selected from the group consisting of SEQ ID No.: 3, SEQ ID No.: 11 and SEQ ID Nos.: 14-23 or b) an amino acid sequence which is identical to the amino acid sequence according to SEQ ID No.: 3 to at least 80%, 82%, 84%, 86% or 88%, preferably to at least 90%, 91%, 92%, 93%, 94% or 95%, particularly preferably to at least 96%, 97%, 98%, 99% or 99.5%, preferably over the full length; furthermore an antibody which is specifically bound to the CYP gst binds protein or fragment thereof; furthermore, a kit comprising such a DNA molecule or nucleic acid molecule, oligonucleotide, vector, CYP gst Protein or fragment thereof and / or antibodies, and optionally reagents for nucleic acid-based or immunological detection methods; furthermore, a method for producing a plant, in particular a crop plant, which exhibits a recessive, nuclear-encoded, male-sterile phenotype in the homozygous state, characterized in that the expression of the CYPgst gene is inhibited; furthermore, such a method, characterized in that the method includes a step of introducing the said recombinant DNA molecule, nucleic acid molecule, or vector, for example, by means of Agrobacterium transformation, T-DNA tagging, homologous recombination, mutagenesis such as Tilling, and targeted mutagenesis, e.g., by the use of zinc finger nucleases, of TALE- ( Transcription Activator-like Effector ) nucleases and the CRISPR / Cas system, as a result of which the expression of the gene is inhibited, for example, by RNAi or co-suppression or due to the introduced mutation; furthermore, such a method for restoring the fertility of such a plant or a plant obtainable by the above-mentioned method comprising the introduction of a functional CYP gst Genes into the plant; also such a procedure, wherein the CYP gst The gene is introduced by means of such recombinant DNA or a vector, or by crossing a plant that carries the CYP gene. gst Wild-type gene or a functional CYP gst The gene is present, preferably in the homozygous state; optionally, selection for the presence of CYP can be performed after crossing. gst wild type gene or functional CYP gst Genes in the offspring generation; furthermore, a plant containing plant cells and / or obtainable by one of the above-mentioned methods; furthermore, an organ, plant part, tissue, or cell of this plant; furthermore, a seed or offspring of such a plant, wherein the seed or offspring has the mutation defined above and / or a recombinant DNA molecule or nucleic acid molecule or vector; furthermore, a method for identifying such a plant by detecting a mutation in the CYPgst gene or a marker linked to the mutation; furthermore, the use of such a DNA molecule or nucleic acid molecule, nucleic acid molecule, oligonucleotide, vector, CYP gst Proteins or fragments thereof, antibodies, and / or kits for identifying such a plant, in the production of a recessive, nuclear-encoded, male-sterile plant, in the production of a plant with restored fertility, in the production of a hybrid plant, in resistance breeding programs, or for seed production; furthermore, such use of the DNA molecule or the promoter defined above for the specific expression of heterologous nucleic acid molecules in flowers and / or fruits of plants; furthermore, such use of such a plant, organ, part of a plant, tissue or cell, seed or progeny, or of a plant identified by or obtained through such a method or its tissue, cell, progeny or seed, in the manufacture of food, materials, pharmaceuticals, or other products.Precursors thereof, diagnostics, cosmetics, fine chemicals, sugar, syrup, bioethanol or biogas; furthermore, a food, feed or material containing such a plant, organ, part of a plant, tissue or cell, seed or progeny, or a plant or its tissue, cell, progeny or seed identified by such a process or obtained by such use; furthermore, such use of such a plant for breeding or producing a progeny plant, using the nuclear-encoded male sterile phenotype for recurrent selection.
[0009] First, some of the terms used in this application are explained in more detail below: The term "chromosome segment", as well as variations of the terms such as "chromosomal segment" or "segment on chromosome" are used equivalently unless otherwise stated and refer to a specific chromosomal DNA section of a particular chromosome that includes at least one gene.
[0010] The "CYP gst Gene" or the "wild type gene of CYP" gst "codes for the "CYPgst protein", which plays a role in the formation of viable pollen, because a mutation in CYPgst leads to male-sterile plants by preventing the formation of functional pollen. This has been experimentally demonstrated in sugar beet ( Beta vulgaris subsp. vulgaris ). demonstrated. Homology comparisons revealed a similarity to the CYP703 gene from Arabidopsis thaliana It was determined which, according to the current state of the art (Morant et al., The Plant Cell, 19 (2007), 1473-1487), fulfills an essential function in the synthesis of sporopollenin (the main component of vital pollen) and preferably catalyzes the conversion of medium-chain saturated fatty acids into the corresponding monohydroxylated fatty acids, with a preferred hydroxylation of lauric acid at the C-7 position. The knockout of the CYP703 gene in Arabidopsis thaliana This led to partial male sterility. While the amount of pollen was reduced, functional pollen could still be produced. Therefore, the gene appears to be responsible. Beta vulgaris subsp. vulgaris to take on a different function, since its elimination leads to male sterility in the plant. Without being bound to any specific theory, it seems plausible that the CYP gst The gene belongs to a different class of CYP genes or has a different function or meaning in cultivated plants, especially crops like sugar beet, than in the low model plant. Arabidopsis thaliana ; see also the discussion in Example 1. The expert can further CYP gst Protein databases are extracted using suitable search profiles and computer programs for screening for homologous sequences or for sequence comparisons. A possible verification is whether the identified genes have the same function as CYP. gst Gene in Beta vulgaris subsp. vulgaris The fulfillment of the requirements can be verified by restoring the function of CYPgst in a male sterile sugar beet plant through heterologous expression of the identified genes, i.e., by restoring fertility through the transgene.
[0011] However, without being bound to a specific theory, it cannot be ruled out that the CYP gst Gene from Beta vulgaris subsp. vulgaris and the CYP703 gene from Arabidopsis thaliana belonging to the same CYP family and thus fulfilling the same or at least a similar function in the synthesis of sporopollenin, however, in cultivated plants that have been optimized through years of targeted selection and crossbreeding with regard to, among other things, yield, pest resistance, tolerance to abiotic stress factors, and the content of plant constituents, the ability to compensate for the missing sporopollenin has been lost, and thus the absence of sporopollenin leads to the inhibition of pollen formation and the plant is therefore male sterile.
[0012] The term " gst -Locus" according to the invention refers to a genomic DNA region in a plant, in particular a crop plant, in which a mutation correlates with a recessively inherited, nuclear-encoded male sterility, wherein the mutation affects the cytochrome P450 oxidase (CYP). gst ) gene and leads to the mutation in an affected individual. gst In plants containing the CYP locus, and especially those homozygous for the mutation, the content or activity of a functional CYPgst protein is lower or completely absent compared to a corresponding (male fertile) plant containing the wild-type locus (wild-type plant). Typically, the mutation in the CYP locus results in... gst Gene that enables transcription and / or translation of a functional CYP gst Proteins prevent.
[0013] The term "closely flanked" means that two loci (for example, two marker loci) on a gene map are less than 15 cM, less than 12 cM, less than 10 cM, less than 8 cM, less than 7 cM, less than 6 cM, less than 5 cM, less than 4 cM, less than 3 cM, less than 2 cM, less than 1 cM, less than 0.5 cM, less than 0.2 cM, less than 0.1 cM, less than 0.05 cM apart.
[0014] Hybridization is understood to be a process in which a single-stranded nucleic acid molecule attaches to a largely complementary nucleic acid strand, i.e., forms base pairs with it. Standard procedures for hybridization are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001. Preferably, it is understood that at least 60%, more preferably at least 65%, 70%, 75%, 80%, or 85%, and particularly preferably 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases of the nucleic acid molecule form base pairs with the largely complementary nucleic acid strand. The possibility of such attachment depends on the stringency of the hybridization conditions. The term "strictness" refers to the hybridization conditions.High stringency is present when base pairing is hindered, low stringency when base pairing is facilitated. The stringency of the hybridization conditions depends, for example, on the salt concentration or ionic strength and the temperature. Generally, stringency can be increased by raising the temperature and / or lowering the salt concentration. "Strong hybridization conditions" are those in which hybridization occurs predominantly only between homologous nucleic acid molecules and homologs. The term "hybridization conditions" refers not only to the conditions prevailing during the actual addition of the nucleic acids, but also to the conditions prevailing during the subsequent washing steps.Stringent hybridization conditions are, for example, conditions under which predominantly only nucleic acid molecules hybridize that exhibit at least 70%, preferably at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity. Stringent hybridization conditions include, for example: hybridization in 4 x SSC at 65°C followed by multiple washes in 0.1 x SSC at 65°C for a total of approximately 1 hour. The term "stringent hybridization conditions" as used here can also mean: hybridization at 68°C in 0.25 M sodium phosphate, pH 7.2, 7% SDS, 1 mM EDTA, and 1% BSA for 16 hours, followed by two washes with 2 x SSC and 0.1% SDS at 68°C. Preferably, hybridization takes place under stringent conditions.
[0015] "Complementary" nucleotide sequence, referring to a nucleic acid in the form of double-stranded DNA, means that the second DNA strand, which is complementary to the first DNA strand, has the nucleotides that correspond to the bases of the first strand, according to the base pairing rules.
[0016] The term "(molecular) marker" refers to a nucleotide sequence used as a reference or point of orientation. A marker for detecting a recombination event should be suitable for monitoring differences or polymorphisms within a plant population. For markers, these differences are found at the DNA level and include, for example, polynucleotide sequence differences such as SSRs ( simple sequence repeats ), RFLPs ( restriction fragment length polymorphisms ) , FLPs ( fragment length polymorphisms ) or SNPs ( single nucleotide polymorphisms ) .Markers can be derived from genomic or expressed nucleic acids, such as spliced RNA, cDNA, or ESTs, and can also refer to nucleic acids used as probes or primer pairs suitable for amplifying a sequence fragment using PCR-based methods. Markers relating to genetic polymorphisms between parts of a population can be detected using established state-of-the-art techniques (An Introduction to Genetic Analysis, 7th Edition, Griffiths, Miller, Suzuki et al., 2000). These include, for example, DNA sequencing, PCR-based sequence-specific amplification, detection of RFLPs, detection of polynucleotide polymorphisms using allele-specific hybridization (ASH), and detection of SSRs, SNPs, or RFLPs. Furthermore, methods for detecting ESTs (expressed sequence tags) and RAPD (randomly amplified polymorphic DNA) are also known.Depending on the context, the term "marker" in the description can also refer to a specific chromosomal position in the genome of a species where a specific marker (e.g., SNP) can be found. Markers are also used in this invention to detect deletion events.
[0017] The term "useful plant" includes both wild and cultivated plants. Useful plants are defined as plants that are used by humans in some way, directly or indirectly; for example, as food, stimulants, medicines, as a source of timber, or as animal feed.
[0018] A "cultivated plant," unlike a wild plant, is a plant grown, cared for, and bred by humans for use as a crop or ornamental plant. The genetic basis for the development of cultivated plants includes point mutations, somatic mutations, chromosomal mutations, and polyploidization. These mutations provide the foundation for selection. They constitute the natural or artificially enhanced starting material of human-directed evolution (increased mutation rate, crossbreeding, treatment with colchicine, genetic engineering). Cultivated plants include, among others, food crops, industrial crops (e.g., fiber crops), forage crops, and ornamental plants. Important characteristics of these cultivated plants include increased plant size, particularly of the utilized parts, loss of bitter substances, pest resistance, and / or high nutrient content.
[0019] "Operationally linked" means connected within a common nucleic acid molecule in such a way that the linked elements are positioned and oriented relative to each other in a manner that allows transcription of the nucleic acid molecule to occur. A DNA molecule that is operationally linked to a promoter is under the transcriptional control of that promoter.
[0020] Unless otherwise specified, a "plant" within the meaning of this application can be any species from the dicotyledonous and monocotyledonous plants. Plants used in agriculture or horticulture, or for the production of bioenergy (bioethanol, biogas, etc.), are preferred. The plants shown in this application preferably feature storage organs such as tubers, roots, seeds, grains, fruits, etc. Examples include: Zea mays, Solanum tuberosum, Triticum aestivum, Triticum durum, Triticum spelta, Helianthus annuus, Secale cereale, Hordeum vulgare, Hordeum bulbosum, Brassica napus, Brassica oleracea, Brassica rapa, Brassica juncacea, Brassica nigra, Glycine max, Gossypium sp., Sorghum bicolor, Triticale Saccharum officinarum, Setaria italica, Oryza sativa, Oryza minuta, Oryza australiensis, Oryza alta, Brachypodium distachyon, Hordeum marinum, Aegilops tauschii, Daucus glochidiatus, Daucus pusillus, Daucus muricatus, Daucus carota, Eucalyptus grandis, Erythranthe guttata, Genlisea aurea, Musa sp., Avena sp., Nicotiana sylvestris, Nicotiana tabacum, Nicotiana tomentosiformis, Solanum lycopersicum, Coffea canephora, Vitis vinifera, Cucumis sativus, Morus notabilis, Crucihimalaya himalaica, Crucihimalaya wallichii, Cardamine flexuosa, Lepidium virginicum, Capsella bursa-pastoris, Olmarabidopsis pumila, Arabis hirsuta, Raphanus sativus, Eruca vesicaria sativa, Citrus sinensis, Jatropha curcas, Populus trichocarpa or Beta vulgaris.. A plant according to the invention is preferably a plant of the genus Beta, especially the sugar beet species ( Beta vulgaris ) , as well as the subspecies Beta vulgaris subsp. vulgaris.
[0021] Plant "organs" include, for example, leaves, stems, trunks, roots, vegetative buds, meristems, embryos, anthers, ovules, seeds, and fruits, especially seeds. The term "plant part" or "plant parts" includes, but is not limited to, the stem or culm, leaves, flowers, inflorescences, roots, fruits, seeds, and pollen. Plant "parts" also refer to a grouping of several organs, such as a flower or a seed, or a part of an organ, such as a cross-section of the stem. Plant "tissues" include, for example, callus tissue, storage tissue, meristematic tissue, leaf tissue, shoot tissue, root tissue, plant tumor tissue, or reproductive tissue, as well as the meristematic tissue, ground tissue (the so-called parenchyma), vascular tissue, supporting tissue, and the covering tissue (the so-called epidermis). However, this list does not exhaustively define the tissues that can be planted.Plant "cells" include, for example, isolated cells with a cell wall or aggregates thereof, or protoplasts.
[0022] The term "regulatory sequence" refers to a nucleotide sequence that influences specificity and / or expression strength, for example, by mediating a particular tissue specificity. Such a regulatory sequence can be located upstream of the transcription initiation point of a minimal promoter, but also downstream of it, such as in a transcribed but untranslated leader sequence or within an intron.
[0023] A "promoter" is an untranslated DNA segment, typically located upstream of a coding region, that contains the binding site for RNA polymerase and initiates DNA transcription. A promoter also contains other elements that function as regulatory genes for gene expression (e.g., cis-regulatory elements). A "core or minimal promoter" is a promoter that possesses at least the basic elements required for transcription initiation (e.g., the TATA box and / or initiator).
[0024] A "transgenic plant" refers to a plant in whose genome at least one polynucleotide, preferably a heterologous polynucleotide, is integrated. Preferably, the polynucleotide is stably integrated, meaning that the integrated polynucleotide remains stably present in the plant, is expressed, and can also be stably inherited by its offspring. The stably introduced polynucleotide into the genome of a plant also includes its integration into the genome of a plant of the preceding parental generation, where the polynucleotide can be stably inherited.The term "heterologous" means that the introduced polynucleotide originates, for example, from a cell or organism with a different genetic background of the same or a different species, or is homologous to the prokaryotic or eukaryotic host cell, but is then located in a different genetic environment and thus differs from a potentially naturally occurring corresponding polynucleotide. A heterologous polynucleotide can be present in addition to a corresponding endogenous gene.
[0025] Embodiments and embodiments of the present invention are described in an exemplary manner with reference to the attached figures and sequences: Abb. 1 : A, C) Flowers of fertile sugar beets ( Beta vulgaris subsp. vulgaris ) and B, D) Flowers of male sterile sugar beets whose phenotype is derived from donor C311 [2043_K5]. A, B) Closed flowers with their sepals and petals manually removed. The bright (yellow), vital anthers of the fertile genotype are clearly visible. (A). In contrast, the anthers of sterile genotypes are distinctly dark (brown). During flower maturation, the anthers of fertile genotypes open and release pollen. (C), while the anthers of sterile genotypes do not mature further and contain no pollen. Abb. 2 : Annotated gene model of BvCYP in RefBeet 1.2 gst (g6845.t1) in the reference genotype KWS2320. The protein, with a length of 517 amino acids, is encoded by two exons with a total length of 1554 bp. Genotypes expressing a male sterile phenotype show a deletion of 533 bp, encompassing portions of the 5' UTR and the first exon of the gene. This prevents correct transcription of the mRNA and translation of a functional protein. Abb. 3 :Alignment of a 4721 bp genomic DNA fragment representing the sugar beet gene model of BvCYP gst (g6845.t1) encodes sterile and fertile genotypes. The sequence of the sterile genotypes has a 533 bp deletion. Abb. 4 : Sequence analysis of the 4721 bp genomic DNA fragment containing the sugar beet gene BvCYP gst (g6845.t1) encodes sterile and fertile genotypes. A) The genomic DNA sequence of CYP is shown. gst Genes from Beta vulgaris subsp. vulgaris including the putative promoter region as well as the 5'UTR and 3'UTR. The putative promoter region is shown in bold, the 5'UTR and 3'UTR are underlined, exon 1 is bold and underlined, exon 2 is italic and underlined, and the intron is shown in italics. This sequence corresponds to the sequence stored in SEQ ID No. 1. The functional regions of the gene are located as follows: Putative promoter 1..1518; 5'UTR 1519..1761; transcribed region 1519..4275; exon 1762..2679; intron 2680..3506; exon 3507..4142; 3'UTR 4143..4275. B) The cDNA sequence of CYP is shown. gst Genes from Beta vulgaris subsp. vulgaris including the 5'UTR and 3'UTR. The 5'UTR and 3'UTR are underlined, exon 1 is bold and underlined, and exon 2 is italic and underlined. This sequence corresponds to the sequence stored in SEQ ID No. 2. The functional regions of the cDNA are located as follows: 5'UTR 1..243; exon 244..1161; exon 1162..1797; 3'UTR 1798..1930. C) The amino acid sequence of CYP is shown. gst Genes from Beta vulgaris subsp. vulgaris. This sequence corresponds to the sequence stored in SEQ ID No. 3. D) Shown is the genomic DNA sequence of the mutated CYPgst gene from Beta vulgaris subsp. vulgaris including the putative promoter region and the 3'UTR. The putative promoter region is shown in bold, the 3'UTR is underlined, the truncated exon 1 is bold and underlined, exon 2 is italic and underlined, and the intron is shown in italics. This sequence corresponds to the sequence stored in SEQ ID No. 8. The functional areas of the mutated CYP gst Genes are located as follows: Putative promoter 1..1353; transcribed region 1354..3542; truncated exon 1354..1938; intron 1939..2755; exon 2756..3394; 3'UTR 3395..3542. Abb. 5 : Gene expression analysis BvCYPgst ( GST, g6845.t1) by qRT-PCR. RNA was extracted from various tissues of fertile plants and the expression of the GST- Gene expression is shown in comparison to the expression of the gene g4645.t1. No expression is detectable. GST In the experiment shown, it is most strongly expressed in closed flowers. For comparison, no expression of the [gene name] is found in closed flowers of sterile genotypes. GST verifiable. DETAILED DESCRIPTION OF THE INVENTION
[0026] The present invention is defined by the features of the independent claims.
[0027] In one aspect, the invention relates to a plant of the species Beta vulgaris, which exhibits a recessive, nuclear-encoded male sterile phenotype, characterized in that the phenotype correlates with a mutation in the endogenous cytochrome P450 oxidase gene, characterized in that the non-mutated cytochrome P450 oxidase gene is a gene selected from the group consisting of: (a) a nucleotide sequence that includes the nucleotide sequence shown in SEQ ID No. 1 or SEQ ID No. 2, or a functional fragment thereof; (b) a nucleotide sequence that encodes the amino acid sequence shown in SEQ ID No. 3; (c) a nucleotide sequence capable of hybridizing to a nucleotide sequence complementary to a nucleotide sequence according to (a) or (b) under stringent conditions; and (d) a nucleotide sequence that encodes an amino acid sequence exhibiting at least 80% sequence identity over the entire amino acid sequence according to SEQ ID No. 3. wherein the mutation is a deletion, addition, insertion or substitution in the coding nucleotide sequence of the cytochrome P450 oxidase gene, in a splicing signal or in a regulatory sequence, preferably the promoter sequence, of the cytochrome P450 oxidase gene, and wherein said mutation reduces or prevents the transcription and / or translation of a functional cytochrome P450 oxidase protein.
[0028] According to a preferred embodiment of the present invention, said plant is homozygous for the mutation and male sterile, wherein the formation of functional pollen is prevented in the sterile plant.
[0029] The mutation is preferably a deletion between nucleotide positions 1560 and 2095 of SEQ ID No.: 1.
[0030] Preferably, the deletion in question can be detected by the absence of one or both of the marker loci sle5983d14 (amplification product of the primers with SEQ ID No.: 4 and 5) and sle5983d17 (amplification product of the primers with SEQ ID No.: 6 and 7) and by the presence of a ubiquitous marker.
[0031] According to a preferred embodiment of the present invention, in the plant according to the invention, the gene is located in a segment on chromosome 1 between the marker loci sxn2151s01 and sle3305s02, wherein the sxn2151s01 marker sequence shown in SEQ ID No.: 24 and the sle3305s02 marker sequence shown in SEQ ID No.: 26 indicate the presence of the locus that causes nuclear-encoded male sterility, and the sxn2151s01 marker sequence shown in SEQ ID No.: 25 and the sle3305s02 marker sequence shown in SEQ ID No.: 27 indicate the reference sequence.
[0032] In another aspect, the present invention relates to a recombinant DNA molecule comprising a nucleotide sequence that is an shRNA (small hairpin RNA), siRNA (small interfering RNA), Antisense RNA, sense RNA or double-stranded RNA encodes which, when expressed in or introduced into a plant cell, leads to the reduction or inhibition of the expression of said functional (non-mutated) cytochrome P450 oxidase gene, as defined above.
[0033] In another aspect, the present invention relates to a plant cell containing the said recombinant DNA molecule.
[0034] In another aspect, the present invention relates to a method for producing a male-sterile plant of the species Beta vulgaris, characterized in that the expression of the cytochrome P450 oxidase gene is reduced or inhibited according to one of the above-mentioned nucleotide sequences (a), (b), (c), or (d), wherein the method comprises a step of introducing the recombinant DNA molecule according to claim 8, wherein said step of the method comprises Agrobacterium transformation, T-DNA tagging, or mutagenesis by TILLING, or comprises a step of targeted mutagenesis of the nucleotide sequences (a), (b), (c), or (d), as a result of which the expression of the gene is reduced or inhibited, for example, by RNAi or co-suppression or due to the introduced mutation.
[0035] In a further aspect, the present invention relates to a plant according to the invention comprising a plant cell containing said recombinant DNA molecule and / or obtainable by one of the aforementioned methods for producing a male-sterile plant of the species Beta vulgaris.
[0036] In a further aspect, the present invention relates to a method for restoring the fertility of a plant according to the invention, comprising introducing a functional (non-mutated) cytochrome P450 oxidase gene into the plant by transformation using a recombinant DNA comprising a non-mutated nucleotide sequence with a coding sequence according to the above-mentioned nucleotide sequences (a) - (d), which is operatively linked to a heterologous promoter which is preferably able to control the expression of the nucleotide sequence specifically in closed flowers and / or fruits.
[0037] In another aspect, the present invention relates to an organ, plant part, tissue or cell of the plant according to the invention or to a seed or offspring of the plant according to the invention, wherein the seed or offspring has or have the mutation defined according to the invention and / or the recombinant DNA molecule according to the invention.
[0038] In another aspect, the present invention relates to a method for identifying a plant according to the invention by detecting the mutation in the cytochrome P450 oxidase gene or a marker that is linked to the mutation.
[0039] In a further aspect, the present invention relates to the use of a nucleic acid molecule of at least 15 nucleotides in length, which is specifically hybridized to one of the nucleotide sequences (a) - (d) defined above, and / or an oligonucleotide, preferably with a length of at most 50 nucleotides, which has one of the following nucleotide sequences: (i) SEQ ID No.: 4, 6 or a complement thereof, or (ii) SEQ ID No.: 5, 7 or a complement thereof, for the identification of a plant according to the invention.
[0040] The present invention provides a plant that is mutated in a DNA segment of the nuclear genome that expresses a cytochrome P450 oxidase (CYP). gst ) gene, exhibits a nuclear-encoded male sterile phenotype. This is characterized by the fact that the mutation is maintained through a recessive expression of the trait, thus allowing the plant to be used to simplify labor-intensive breeding programs. The identification of the gene responsible for this trait expression was carried out in the sugar beet ( Beta vulgaris subsp. vulgaris ) as described in Examples 1 and 2, along with Figures 1 to 5. Based on its structural features determined by sequence analysis, the gene in question was classified as a member of the cytochrome P450 oxidases (CYP) and, based on the nuclear male sterility phenotype observed in its mutant, was given the suffix "gst" provided. Since the gene was identified in sugar beet, the prefix " Bv " is used when referring specifically to the gene described in the examples.
[0041] In general, the present invention relates to a plant, in particular a cultivated or useful plant, which exhibits a recessive, nuclear-encoded male sterile phenotype, characterized in that the phenotype is associated with a mutation encoded by the endogenous cytochrome P450 oxidase (CYP). gst ) gene is included, or with the absence or low content or activity of a functional CYP compared to a corresponding (male fertile) wild-type plant. gst Proteins produced by the wild-type gene of CYP gst is encoded, correlated, characterized by the fact that the non-mutated CYP is gst gene around the gene Bv CYP gst out of Beta vulgaris This involves a sequence that comprises one of the nucleotide sequences shown in SEQ ID No. 1 or 2, or that encodes the amino acid sequence shown in SEQ ID No. 3, or is its homolog, analog, or ortholog. As described above and explained in the examples, further CYPs can be identified using classical bioinformatics approaches (database searches and computer programs for screening for homologous sequences). gst Proteins and their encoding genes, i.e., homologs, analogs, and orthologs, are identified in plants, assuming that a mutation will produce the same phenotype as observed in sugar beet. Thus, a plant is also revealed that is characterized by the fact that the non-mutated CYP gst gene around the gene St CYP gst out of Solanum tuberosum is a gene that preferably comprises one of the nucleotide sequences shown in SEQ ID No.: 12 or 13 or encodes the amino acid sequence shown in SEQ ID No.: 14, or is its homolog, analogue or ortholog; or that the non-mutated CYPgst gene is the gene Zm CYP gst out of Zea mays is a compound that preferably comprises one of the nucleotide sequences shown in SEQ ID No.: 9 or 10 or encodes the amino acid sequence shown in SEQ ID No.: 11, or its homolog, analog or ortholog.
[0042] The term homologous means that the genes in question (from two different plant species) have essentially the same function and a common ancestor, and therefore typically exhibit significant identity in their nucleic acid or encoded amino acid sequences. However, there are also many genes that are homologous to each other without their protein sequences showing a meaningful pairwise alignment. In contrast, the term analogous describes genes or proteins that (also) have an identical or similar function but did not originate from the same structure, i.e., they do not have a common ancestor. In this case, significant identity in their nucleic acid or encoded amino acid sequences is often not found, or at best, only in certain functional domains.
[0043] Homologs are further classified for annotation purposes in the context of genome sequencing. The terms orthology and paralogy were introduced for this purpose. Orthologs are genes linked via a speciation event. Paralogs are genes linked via a duplication event.
[0044] A gene is generally a homolog, analogue, or ortholog within the meaning of the present invention if it is capable of inducing the male sterile phenotype in the reference gene CYP. gst in sugar beet ( BvCYPgst ) to complement and / or a targeted mutation in the gene in question or changes in the biological activity of the gene product encoded by the homolog or analogue, resulting in a male sterile phenotype in the plant from which the gene originates. Accordingly, the homolog or analogue in question can be related to the CYP illustrated in the examples. gst The gene of the present invention is preferably characterized in that it is able to express the male sterile phenotype, which is responsible for the CYP gst The sugar beet mutant is observed to complement, i.e., to restore the fertile phenotype. Additionally or alternatively, the CYP gst The homolog or analogue is preferably characterized in that inhibition of its expression or the biological activity of the gene product encoded by the homolog or analogue induces a male sterile phenotype. Preferably, the male sterile phenotype exhibits the characteristics exemplified by the CYP gst Mutant from sugar beet, exhibiting properties particularly as described in the examples; see also the embodiments described above.
[0045] Corresponding techniques and procedures for complementation genetics are known to those skilled in the art; see, for example, Napoli et al., Plant Physiology 120 (1999), 615-622, which describes a mutation in an inbred line of petunia that exhibits, among other things, a male sterile phenotype, which was abolished by transgenic complementation with a functional chalcone synthase A cDNA, and thus it could be established that the chalcone synthase A gene is essential for the male sterile phenotype, or that the phenotype of male sterility was caused by a mutation in this gene.
[0046] In Jeong et al., J. Exp. Bot. 65 (2014), 6693-6709, male sterility was exacerbated in the so-called [unclear text] by complementation and transgenic expression of various candidate genes. ms10 35< Mutant of tomato complemented and repealed. Method for producing male sterility in transgenic plants by inhibiting a target gene, in this case CYP. gst are also known to those skilled in the art; see, for example, international application WO 1996 / 017945 and the embodiments described below.
[0047] Thus, in one embodiment of the present invention, a plant exhibiting a recessive, nuclear-encoded, male-sterile phenotype is characterized in that the phenotype is altered by a mutation encoded by the endogenous cytochrome P450 oxidase (CYP). gst The gene is included, and is caused by the absence or low content or activity of a functional CYP compared to a corresponding male-fertile wild-type plant. gst Proteins produced by the wild-type gene of CYP gst The encoded gene must be marked. A genomic sequence of the mutated gene, which can no longer be translated, is disclosed in SEQ ID No. 8. In particular, the application relates to a plant that is classified as a cultivated and useful plant.
[0048] The prior art (Morant et al., The Plant Cell, 19 (2007), 1473-1487) describes that knockout of the CYP703 gene in Arabidopsis thaliana ( CYP703A2 This leads to reduced pollen production and thus to partial male sterility. This is due to the fact that sporopollenin, the main component of the exin layer of pollen, was absent or structurally altered. Although it sounds plausible that the CYP gst Since the gene takes on a different function, as a mutation leads to nuclear-encoded, recessive male sterility and no pollen production occurs, it should not be ruled out that the CYP gst gene and the CYP703 gene from Arabidopsis thaliana They belong to the same gene family and thus fulfill the same or at least a similar function in the synthesis of sporopollenin. Without being bound to a specific theory, it sounds plausible that in cultivated plants, which have been optimized through years of targeted selection and crossbreeding with regard to, among other things, yield, pest resistance, tolerance to abiotic stress factors, and the content of plant constituents, the ability to compensate for the missing sporopollenin has been lost, and that thus the absence of sporopollenin leads to the inhibition of pollen formation and the plant is therefore male-sterile.
[0049] Since in Morant et al. (2007) describes that the CYP703A2 gene or corresponding knockout lines of Arabidopsis only exhibit a partially male sterile phenotype, and that such a phenotype is not suitable for hybrid breeding; in one embodiment, the CYP703A2 gene is removed from Arabidopsis thaliana or those in Morant et al. described mutants, especially those described in Figur 1 The sequences shown are excluded from the present invention.
[0050] As eukaryotes, plants possess two or more copies of their genetic information per cell. Each gene is generally represented by two alleles, which can be identical in the homozygous state and different in the heterozygous state. The phenotype of the plant according to the invention is caused by a mutation in the nuclear genome and is obtained through a recessive trait expression. Accordingly, the plant is male fertile if the mutation is heterozygous and male sterile if the mutation is homozygous.
[0051] In a sterile plant, the formation of functional pollen is prevented, preferably completely prevented, wherein in the context of the present invention the term "prevented" means that in a plant that is homozygous for the mutation in CYPgst The locus is sterile and male, and pollen production is 95%, preferably 96%, more preferably 97%, particularly preferably 98%, and especially preferably 99% absent, while "completely prevented" means that pollen production is prevented by more than 99%, preferably 100%. In this context, "preferably prevented" means that when such a plant is crossed as the male parent with a corresponding wild-type plant, essentially no seed production occurs and / or no offspring are produced.
[0052] In the case of Beta vulgaris subsp. vulgaris This will be done using Abb. 1 Clearly. In closed flowers whose sepals and petals have been manually removed, the light (yellow), vital anthers of the fertile genotype are clearly visible (A). In contrast, the anthers of the sterile genotypes are distinctly dark (brown) (B). During flower maturation, the anthers of the fertile genotypes open and release pollen (C), while the anthers of sterile genotypes do not mature further and do not release pollen (D).
[0053] In Arabidopsis thaliana The CYP703 protein catalyzes the conversion of medium-chain saturated fatty acids to the corresponding monohydroxylated fatty acids, with a preferential hydroxylation of lauric acid at the C7 position. Without being tied to a specific theory, it sounds plausible that the CYPgst The protein does not perform the same function, but a similar one to the CYP703 protein. Arabidopsis thaliana, because the deactivation of both genes affects pollen production. Thus, CYPgst a function is attributed to it in the synthesis of sporopollenin, the main component of the exin layer of vital pollen.
[0054] The CYP gst Protein could therefore have a function in the synthesis of sporopollenin and catalyze the conversion of medium-chain saturated fatty acids into the corresponding mono-hydroxylated fatty acids, preferably the hydroxylation of lauric acid at the C7 position.
[0055] Transcription analyses (Example 2) have shown that in fertile genotypes of Beta vulgaris subsp. vulgaris the CYP gst The gene was expressed in closed flowers and fruits, and no expression was detectable in roots and leaves ( Abb. 5 Accordingly, the application discloses a plant as described above, wherein the CYPgst gene is expressed at least in closed flowers and fruits, preferably specifically in closed flowers and fruits.
[0056] In one embodiment, the mutation prevents the transcription and / or translation of a functional protein in the plant according to the invention, wherein the mutation preferably involves a deletion, addition, insertion or substitution in the coding nucleotide sequence of the CYP gst Genes, a splicing signal or in a regulatory sequence, preferably the promoter sequence, of CYP gst Gens is involved.
[0057] A deletion of at least 500-600 bp is revealed, affecting the coding region or the promoter region of the CYP. gst This concerns genes. The deletion can also have a length of at least 20, 30, or 50 consecutive base pairs, at least 100, 150, 200, or 250 consecutive base pairs, or preferably at least 300, 400, or 500 consecutive base pairs. The addition preferably involves the insertion of one or more nucleotides into the genomic sequence, preferably into the coding gene sequence, resulting in a frameshift. The substitution preferably involves a point mutation in the genomic sequence, preferably in the coding gene sequence, generating stop codons or splicing errors.
[0058] By comparative sequencing of genomic DNA fragments that contain CYP gst The gene and the putative promoter region from both male sterile and male fertile genes. Beta vulgaris subsp. vulgaris In studies of plants, it emerged that a deletion of 533 bp is responsible for the male sterile phenotype (see Example 2 and Abb. 3 ) and the deletion lies between nucleotide positions 1560 and 2095 of SEQ ID No. 1.
[0059] Thus, in a further preferred embodiment, this is a deletion of 533 bp, which includes parts of the 5'UTR and the first exon of the CYPgst Genes from Beta vulgaris subsp. vulgaris includes; see Abb. 3 The functional gene Bv CYP gst It comprises two exons with a total length of 1554 bp. A gene model annotated in RefBeet 1.2 is in Abb. 2 The genomic DNA sequence of CYPgst with the deletion leading to a truncated exon 1 is shown and listed in SEQ ID No. 8. Possible point mutations leading to premature transcriptional termination of CYP are also shown. gst Genes from Beta vulgaris subsp. vulgaris The factors that could lead to or cause disrupted splicing are listed in Table 1, preferably being located between nucleotide positions 1560 and 2095 of SEQ ID No. 1.
[0060] As shown in Example 1 of the present invention, closely flanking markers of the CYP could be identified during the fine mapping process. gst Genes can be identified and thus the position of the CYP enzyme determined. gst Genes in the genome of Beta vulgaris subsp. vulgaris to be determined. This in turn formed the basis for the development of genetic markers with the help of which the deletion in CYP can be identified. gst The gene could be detected.
[0061] Accordingly, in one embodiment of the present invention, the plant is characterized in that sugar beet ( Beta vulgaris subsp. vulgaris The deletion can be detected by the absence of one or both of the marker loci sle5983d14 (amplification product of the primers with SEQ ID numbers 4 and 5) and sle5983d17 (amplification product of the primers with SEQ ID numbers 6 and 7) and by the presence of a ubiquitous marker. The ubiquitous marker confirms the sufficient quality of the DNA extraction.
[0062] Furthermore, in one embodiment the gene is from Beta vulgaris subsp. vulgaris (Sugar beet) is located in a segment on chromosome 1 between the marker loci sxn2151s01 and sle3305s02. In a preferred embodiment, these marker loci are located at 33.42 and 35.15 cM, respectively, on chromosome 1 (based on the genetic map ZR INT 1202), and based on the physical genome map (Physmapv2), this region has a physical size of 215.4 kbp and lies between positions 3185718 bp and 3401120 bp. KASP markers (KASP™, SNP Genotyping Chemistry by LGC Limited) have been developed for both of the above-mentioned marker loci, which can be used to identify the SNP to be detected or the corresponding reference sequence. The sxn2151s01 marker sequence shown in SEQ ID No. 24 and the sle3305s02 marker sequence shown in SEQ ID No. 26 indicate the presence of the gst -Locus; the sxn2151 s01 marker sequence shown in SEQ ID No. 25 and the sle3305s02 marker sequence shown in SEQ ID No. 27 indicate the reference sequence, where the marker sequences differ at nucleotide position 21 and a "G" is found at this position in the gst locus-bearing genotype and an "A" is found at this position in the reference genotype KWS2320.
[0063] According to the present disclosure, the segment can be about 50 to 5000 kbp in size, preferably 100 to 1000 kbp, more preferably 100 to 500 kbp and particularly preferably 200 to 250 kbp, wherein the segment has further protein-coding genes, preferably 21 genes.
[0064] According to the present disclosure, the non-mutated gene is the functional gene. BvCYPgst out of Beta vulgaris, preferably made of Beta vulgaris subsp. vulgaris or a functional homologous, analogous or orthologous gene of another crop or cultivated plant.
[0065] The expert can further CYP gst Proteins can be extracted from relevant literature and databases using suitable search profiles and computer programs for screening for homologous sequences or for sequence comparisons. Furthermore, a person skilled in the art can use conventional molecular biological techniques to identify additional CYPs. gst to independently discover protein-coding DNA sequences and use them within the scope of the present invention. For example, suitable hybridization probes can be derived from the sequence of CYP. gst Genes are derived and used for screening genomic and / or cDNA libraries of the desired organism. In this process, the skilled person can utilize familiar hybridization, cloning, and sequencing methods, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001. The skilled person can also use known sequences to derive oligonucleotide primers for CYP amplification. gst Synthesize and deploy sequences.
[0066] This reveals a gene from the homologous, analogous, or orthologous gene. Zea mays, which preferably comprises one of the nucleotide sequences shown in SEQ ID No.: 9 or 10 or encodes the amino acid sequence shown in SEQ ID No.: 11, from Solanum tuberosum, which preferably comprises one of the nucleotide sequences shown in SEQ ID No.: 12 or 13 or encodes the amino acid sequence shown in SEQ ID No.: 14, from Triticum aestivum, which preferably encodes the amino acid sequence shown in SEQ ID No.: 15, from Helianthus annuus, which preferably encodes the amino acid sequence shown in SEQ ID No.: 16, from Hordeum vulgare, which preferably encodes the amino acid sequence shown in SEQ ID No.: 17, from Brassica napus which preferably encodes the amino acid sequence shown in SEQ ID No.: 18, from Brassica oleracea, which preferably encodes the amino acid sequence shown in SEQ ID No.: 19, from Brassica rapa which preferably encodes the amino acid sequence shown in SEQ ID No.: 20, from Glycine max, which preferably encodes the amino acid sequence shown in SEQ ID No.: 21, from Gossypium, which preferably encodes the amino acid sequence shown in SEQ ID No.: 22, and from Sorghum bicolor which preferably encodes the amino acid sequence shown in SEQ ID No.: 23. The plants mentioned can be classified as useful plants and preferably as cultivated plants.
[0067] One embodiment of the plant according to the invention is a plant as described above, wherein the non-mutated gene (wild type gene) has a nucleotide sequence which is selected from the group consisting of a nucleotide sequence which has the nucleotide sequence shown in SEQ ID No. 1, 2.
[0068] In one embodiment, the non-mutated gene (wild type gene) has a nucleotide sequence that encodes the amino acid sequence shown in SEQ ID No. 3.
[0069] The nucleotide sequence can be introduced into the gene using conventional methods known in the prior art, for example, site-directed mutagenesis, PCR-mediated mutagenesis, transposon mutagenesis, genome editing, etc., by substitutions, deletions, insertions, additions and / or any other modification, either alone or in combinations, which change the nucleotide sequence but fulfill the same function as the original sequence.
[0070] Therefore, the invention also includes a plant as described above, wherein the nucleotide sequence may also comprise a functional fragment of the nucleotide sequences shown in SEQ ID Nos. 1 and 2. The term "fragment" includes genes with a nucleotide sequence sufficiently similar to the nucleotide sequence mentioned above. The term "sufficiently similar" means a first nucleotide sequence or amino acid sequence that has a sufficient or minimum number of identical or equivalent nucleotides or amino acid residues relative to a second nucleotide or amino acid sequence. With regard to the amino acid sequence, it also exhibits a common structural domain and / or possesses common functional activity even after modification by a method mentioned above.Nucleotide or amino acid sequences that are at least approximately 45%, at least approximately 50%, at least approximately 55%, at least approximately 60%, at least approximately 65%, at least approximately 70%, at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 91%, at least approximately 92%, at least approximately 93%, at least approximately 94%, at least approximately 95%, at least approximately 96%, at least approximately 97%, at least approximately 98%, at least approximately 99%, or at least approximately 100% identical are hereby defined as sufficiently similar. Preferably, sufficient similarity is established for the functional fragments if the nucleotide or amino acid sequence generally exhibits the same properties as the aforementioned nucleotide or amino acid sequences of the present invention.
[0071] Accordingly, in one embodiment, the non-mutated gene (wild-type gene) included in the plant has a nucleotide sequence capable of hybridizing under stringent conditions to a nucleotide sequence complementary to a nucleotide sequence of SEQ ID No. 1, 2, or to the nucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 3. Furthermore, in another embodiment, the non-mutated gene (wild-type gene) comprises a nucleotide sequence encoding an amino acid sequence that exhibits deviations from the amino acid sequence shown in SEQ ID No. 3 in the form of amino acid deletions, substitutions, additions, and / or insertions, preferably not more than 20%, 15%, 10%, 5%, 4%, 3%, 2%, or not more than 1% across the entire amino acid sequence.
[0072] In another or additional embodiment, the nucleotide sequence of the non-mutated gene (wild-type gene) encodes a protein with the same enzymatic activity as the protein encoded by the DNA of the preceding embodiments.
[0073] In a further embodiment, the non-mutated gene (wild-type gene) contained in the plant comprises DNA comprising at least 200 or 400, preferably at least 600 or 800, particularly preferably at least 1000 consecutive nucleotides from the promoter of the nucleic acid sequence of SEQ ID No. 1 from nucleotide positions 1 to 1518, preferably from nucleotide positions 518 to 1518, particularly preferably from nucleotide positions 1318 to 1518, or a sequence hybridizing to this region, wherein the nucleotide sequence is able to specifically control the expression of the gene or of a heterologous nucleic acid molecule operatively linked to the DNA in closed flowers and / or fruits.
[0074] According to the present disclosure, the plant can be an inbred plant or a hybrid plant. The inbred plant can be used as a parent plant for the production of hybrids. The advantage of using an inbred plant heterozygous for the recessive, nuclear-encoded male sterility trait is that it segregates into fertile and sterile individuals at each propagation step. The male-sterile individual can be used to produce hybrids, thus eliminating the need for manual removal of the anthers and also the parallel maintenance of a sterile line. Maintainer- A line is therefore no longer necessary.
[0075] Another embodiment of the present invention comprises not only the plant according to the invention, which has a mutation in the CYP gstnot only a gene, but also a DNA molecule that has a nucleotide sequence as defined above with a mutation in the form of a deletion, addition, insertion or substitution, whereby this mutation results in no functional CYP gst Protein is synthesized.
[0076] In a preferred embodiment, the mutation is in the coding nucleotide sequence of the CYP gst Genes, a splicing signal, or in a regulatory sequence of CYP gst Genes, preferably in the promoter of CYP gstThe mutation is located in the gene. In particular, the mutation may be a deletion between nucleotide positions 1560 and 2095 of SEQ ID No. 1. The deletion may have a length of at least 20, 30, or 50 consecutive base pairs, preferably at least 100, 150, 200, or 250 consecutive base pairs, and particularly preferably at least 300, 400, or 500 consecutive base pairs. In a further preferred embodiment, the nucleic acid molecule has a point mutation in the nucleotide sequence of SEQ ID No. 1 according to Table 1, preferably between nucleotide positions 1560 and 2095 of SEQ ID No. 1.
[0077] As previously described, DNA hybridization probes that are part of the CYP sequence can gstGene-derived probes are used for screening genomic and / or cDNA libraries of other organisms to identify homologous genes. To achieve specific hybridization, such probes should be specific and have a length of at least 15 nucleotides, preferably at least 20 nucleotides. The probes can be used to amplify the identified homologous genes by the well-known process of polymerase chain reaction (PCR). Furthermore, these probes can also be used to detect mutations in CYP. gstGenes can be used. Detailed instructions for nucleic acid hybridization can be found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, Part 1, Chapter 2, "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York (1993); and in Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al., eds, Greene Publishing and Wiley Interscience, New York (1995).
[0078] Therefore, a nucleic acid molecule of at least 15, 16, 17, 18, 19 or 20, preferably at least 21, 22, 23, 24 or 25, particularly preferably at least 30, 35, 40, 45 or 50, and most preferably at least 100, 200, 300, 500 or 1000 nucleotides in length is the subject of the present invention, wherein this nucleic acid molecule is specifically hybridized to a previously described nucleotide sequence comprising the non-mutated CYP703 wild-type gene or to a previously described DNA molecule with a mutation in the form of a deletion, addition, insertion or substitution that results in the absence of a functional CYP703 protein being formed.
[0079] The detailed mapping described above allowed the position of the CYP to be determined. gst Genes in the genome of Beta vulgaris subsp. vulgaris to be determined. This in turn formed the basis for the development of genetic markers with the help of which the deletion in CYP can be determined. gst The gene could be detected.
[0080] Therefore, in addition to the plants described above, the present invention also relates to markers in the form of oligonucleotides, in particular primer oligonucleotides. These comprise a nucleic acid molecule of at least 15 nucleotides in length, which is specifically linked to a previously defined nucleotide sequence or to a previously defined DNA molecule with a mutation in the form of a deletion, addition, insertion, or substitution that results in the absence of a functional CYP enzyme. gst Protein is formed, hybridized. Preferably, these oligonucleotides have a length of at most 50 nucleotides. More preferably, the oligonucleotides are shorter and have a length between 15 and 25 nucleotides. As shown in Example 2 of the present invention, the oligonucleotides preferably have one of the following nucleotide sequences: (i) SEQ ID No. 4, 6 or a complement thereof, or (ii) SEQ ID No. 5, 7 or a complement thereof.
[0081] Further disclosed herein is a CYPgst protein encoded by a previously described nucleotide sequence and a functional and / or immunologically active fragment thereof, as well as an antibody that binds specifically to the CYPgst protein or to its fragment described herein. The recombinant production of proteins and fragments is familiar to those skilled in the art and is described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001, or Wingfield, PT 2008. Production of Recombinant Proteins. Current Protocols in Protein Science, 52:5.0:5.0.1–5.0.4. Polyclonal or monoclonal antibodies to the protein can be produced by those skilled in the art using known methods, such as those described in E. Harlow et al., editors, Antibodies: A Laboratory Manual (1988).The production of monoclonal antibodies, as well as Fab and F(ab') 2 fragments, which are also useful in protein detection methods, can be carried out using various common methods as described in Goding, Mononoclonal Antibodies: Principles and Practice, pp. 98-118, New York: Academic Press (1983). The antibody can then be used for screening expression cDNA libraries to identify identical, homologous, or heterologous genes by immunological screening (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989 or Ausubel et al., 1994, "Current Protocols in Molecular Biology", John Wiley & Sons).
[0082] The CYPgst protein comprises the amino acid sequences listed in SEQ ID No. 3, or an amino acid sequence that is identical to the amino acid sequence listed in SEQ ID No. 3 to at least 80%, 82%, 84%, 86% or 88%, preferably to at least 90%, 91%, 92%, 93%, 94% or 95%, particularly preferably to at least 96%, 97%, 98%, 99% or 99.5%, preferably over its entire length.
[0083] Furthermore, a recombinant DNA molecule containing the non-mutated CYP is revealed. gstThe recombinant DNA molecule comprises a gene (wild-type gene) and exhibits the aforementioned nucleotide sequence characteristics. Preferably, the recombinant DNA molecule includes or is associated with a promoter and / or other transcription or translation control elements. The promoters used will primarily be cell-specific promoters that enable DNA transcription only in predetermined cells. In addition to promoters, there are numerous other transcription control elements, such as enhancers, operators, repressors, and transcription termination signals, but not limited to these, which are functionally linked to the DNA to enable directed, cell-specific transcription. Promoters and other transcription regulatory elements are generally known and accessible to those skilled in the art; see, for example, WO 00 / 75359, page 23, line 5 to page 24, line 17.This recombinant DNA molecule can be used to restore fertility in plants with a nuclear-encoded, recessive, male sterile phenotype.
[0084] Since, as previously described, the CYP gst Since the gene is expressed in closed flowers and fruits and not in roots and / or leaves, the recombinant DNA molecule in a preferred embodiment comprises either a promoter having a previously described nucleotide sequence and operatively linked to a heterologous nucleic acid molecule, or a previously defined coding nucleotide sequence comprising the wild-type CYPgst gene and operatively linked to a heterologous promoter. Preferably, this promoter is capable of specifically controlling the expression of the nucleotide sequence in closed flowers and / or fruits. More preferably, the recombinant DNA molecule comprises the native promoter of the non-mutated CYPgst gene. Beta vulgarissubsp. vulgaris (SEQ ID No. 1).
[0085] Accordingly, the present invention also includes the use of the DNA molecule or promoter described herein for the specific expression of heterologous nucleic acid molecules in flowers and / or fruits of plants. This requires the operative linkage of the heterologous nucleic acid molecule with the corresponding promoter and the introduction of this recombinant DNA molecule into the target cell, which is preferably a plant cell. Methods for the heterologous expression of recombinant DNA molecules will be described in more detail later.
[0086] Another object of the present invention is a recombinant DNA molecule comprising a nucleotide sequence according to the invention, which is an shRNA ( small hairpin RNA ) , siRNA ( small interfering RNA ) ,Antisense RNA, sense RNA, or double-stranded RNA encodes these molecules. Through base pairing, they mediate the inhibition of translation. CYPgst mRNA or the degradation of CYPgst mRNA in the cell. Therefore, the introduction and / or expression of the recombinant DNA molecule in a plant leads to the inhibition of the expression of the functional (non-mutated) CYPgst gene.
[0087] This document discloses vectors comprising recombinant DNA molecules or nucleic acid sequences or nucleic acid molecules. One vector may contain the non-mutated CYPgst gene (wild-type gene) with the aforementioned nucleotide sequence characteristics and preferably one of the previously described promoters. Another vector may contain a recombinant DNA molecule containing the promoter of the non-mutated CYP gstA wild-type gene linked to a heterologous nucleic acid molecule may be included, or a recombinant DNA molecule may be included, comprising a previously described nucleotide sequence operatively linked to a heterologous promoter. In both cases, the promoter is preferably capable of specifically controlling the expression of the nucleotide sequence in closed flowers and / or fruits. Furthermore, a vector may contain a recombinant DNA molecule possessing a nucleotide sequence encoding an shRNA, siRNA, antisense RNA, sense RNA, or double-stranded RNA, and thus, upon expression in a plant cell, inhibiting the expression of CYP. gst Gens leads.
[0088] Furthermore, a vector can contain a DNA molecule with a previously defined mutation or can contain the previously described nucleic acid molecule that is specifically linked to the non-mutated (wild-type) CYP. gstnucleotide sequence or the mutated CYP gst The nucleotide sequence binds.
[0089] The described vector can be a plasmid, a cosmid, a phage, an expression vector, a transformation vector, a shuttle vector, or a cloning vector; it can be double- or single-stranded, linear or circular, or it can transform a prokaryotic or eukaryotic host either by integration into its genome or extrachromosomally. Preferably, the DNA molecule or nucleic acid molecule according to the invention is surgically linked in an expression vector with one or more regulatory sequences that permit transcription and, optionally, expression in a prokaryotic or eukaryotic host cell; see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001, and international application WO 00 / 75359, page 21, line 20 to page 22, line 32.Preferably, these regulatory sequences are promoters or terminators, in particular a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and / or a polyadenylation signal. The vectors also typically contain indicator / reporter genes or resistance genes to detect the transfer of the desired vector or DNA / nucleic acid molecule and to select the individuals containing them, since direct detection via gene expression is usually rather difficult. Examples of indicator / reporter genes include the luciferase gene and the gene encoding green fluorescent protein (GFP). These also allow investigations into the activity and / or regulation of a gene promoter.Examples of resistance genes, specifically for plant transformations, include the neomycin phosphotransferase gene, the hygromycin phosphotransferase gene, and the gene encoding phosphinothricin acetyltransferase. This does not, however, exclude other indicator / reporter genes or resistance genes known to those skilled in the art. In a preferred embodiment, the vector is a plant vector.
[0090] Also revealed is a previously described vector, in which the DNA molecule, as a transgene, is capable of producing a functional CYP. gst The gene is expressed and preferably genetically linked to another transgene that prevents the transfer of the DNA molecule via the pollen. By introducing this vector into a mutant that has a mutation in the CYP gstIf the gene is male sterile, fertility can be restored. By preventing the transmission of the transgenic functional CYPgst gene via pollen, self-fertilization of the transgenic line produces only hemizygous seeds.
[0091] Preferably, the vector or transgene further includes an expression cassette that leads to seed labeling, preferably by fluorescent labeling. This approach allows for easy differentiation between transgenic and non-transgenic seeds. This system for utilizing nuclear-encoded male sterility was developed by Pioneer. The system, named SEED PRODUCTION TECHNOLOGY (SPT) (US 2006288440 A1), was developed for maize and is based on the principle that a sterile mutant resulting from a mutation in a known nuclear-encoded gene can be restored by inserting a transgene. The transgene contains the non-mutated allele of the sterility gene, thus functioning as a wild-type allele. The fertility-restoring transgene is genetically linked to another transgene that prevents the transmission of the transgene via pollen (pollen killer).This results in only hemizygous seeds being produced during self-fertilization of the transgenic line, which is very important for the efficiency of the system.
[0092] The transgene also contains an expression cassette that causes the seeds to fluoresce red. This makes it easy to distinguish transgenic from non-transgenic seeds. Since the transgenic seeds are fertile, this also automatically results in the separation of fertile and sterile plants. Sowing the non-transgenic seeds thus yields the mother plants necessary for hybrid production, while the transgenic seeds can be used as the paternal line for the further propagation of the maternal line ( Maintainer -line) and can also be propagated through simple self-pollination ( Figure 5The SPT system can theoretically be applied to all plant species. However, this requires the existence of a genetically male sterile line and knowledge of the gene responsible for the genetically male sterility phenotype. Therefore, the SPT system could theoretically also be used to develop a hybrid system for any crop such as sugar beet or potato.
[0093] Host cells containing the described vectors, recombinant DNA molecules, and / or nucleic acid molecules are also disclosed. A host cell can be a prokaryotic (e.g., bacterial) or eukaryotic cell (e.g., a plant cell or a yeast cell). Preferably, the host cell is an Agrobacterium or a plant cell. The present invention relates to a transgenic plant cell comprising the nucleic acid molecule according to the invention as a transgene or the vector of the present invention. Such a transgenic plant cell is, for example, a plant cell that has been transformed, preferably stably, with the nucleic acid molecule or the vector of the present invention. In a preferred embodiment of the transgenic plant cell, the nucleic acid molecule is operationally linked to one or more regulatory sequences that permit transcription and, optionally, expression in the plant cell.The complete construct consisting of the nucleic acid molecule according to the invention and the regulatory sequence(s) then constitutes the transgene. Such regulatory sequences are, for example, a promoter or a terminator. Numerous functional promoters and terminators applicable in plants are known to those skilled in the art.
[0094] In an additional aspect of the invention, the identification of the CYPgst Genes responsible for the expression of recessive, nuclear-encoded male sterility were used to produce transgenic plants with this trait and to restore fertility.
[0095] Disclosed herein is a kit comprising the necessary recombinant DNA molecules, nucleic acid molecules, and vectors, as previously described, for producing plants with nuclear-encoded recessive male sterility and for restoring fertility in plants exhibiting this phenotype. This kit also includes recombinant DNA molecules comprising either a promoter with a predefined nucleotide sequence or a heterologous promoter, the former containing a heterologous nucleic acid molecule and the latter containing a predefined nucleotide sequence specific to the non-mutated (wild-type) CYP gene. gstThe kit may contain a vector containing a DNA molecule that, as a transgene, is capable of expressing a functional CYPgst gene and is preferably genetically linked to another transgene that prevents the transfer of the DNA molecule via pollen and includes an expression cassette that leads to seed marking. To identify the mutation in the CYPgst gene, the kit may contain a predefined nucleic acid molecule hybridized to a nucleotide sequence described above, comprising the non-mutated (wild-type) CYPgst gene or the corresponding gene with a predefined mutation, or it may contain the previously defined oligonucleotides. The kit may also contain the previously described CYP gstThe kit contains a protein or fragment thereof, as well as the described antibody. Preferably, the kit also includes reagents for nucleic acid-based or immunological detection methods.
[0096] A transgenic plant is, for example, a plant containing plant cells transformed with the DNA molecule / nucleic acid molecule according to the invention or with the vector of the present invention. In a preferred embodiment of the transgenic plant, the DNA molecule / nucleic acid molecule is operationally linked to one or more regulatory sequences that permit transcription and, optionally, expression in the plant. The overall construct consisting of the nucleic acid molecule according to the invention and the regulatory sequence(s) then constitutes the transgene. The term "transgene" is thus understood to mean the nucleic acid sequence encoding a recombinant polypeptide.
[0097] The oligonucleotides, nucleic acids, DNA molecules, and vectors described above can also be used to produce a transgenic plant. Therefore, the present invention also relates to the use of these in the production of a transgenic plant that exhibits a recessive, nuclear-encoded, male-sterile phenotype in the homozygous state, characterized in that the expression of CYP gst Gene inhibition is used in the production of a plant according to the invention with restored fertility or in the production of a transgenic plant cell. Furthermore, the previously described oligonucleotides, nucleic acids, DNA molecules, and vectors are also used in the corresponding processes for the production of these transgenic plants or plant cells. The transgenic plant is preferably a crop plant and more preferably a cultivated plant.
[0098] There are various prior art methods for producing, identifying, and selecting transgenic plants in which either the transcription / translation of a protein is inhibited or the restoration trait is introduced. Methods for producing transgenic crops and identifying them using molecular biological methods are known to those skilled in the art; see, for example, international applications WO 99 / 023232 and WO2004 / 074492 for transgenic glyphosate-resistant sugar beets, and WO2000 / 018939 and WO2013 / 138309 for plant transformation in general.
[0099] One embodiment of the present invention is therefore a method for producing a plant that exhibits a recessive, nuclear-encoded, male-sterile phenotype in the homozygous state, characterized in that the expression of the CYPgst gene is inhibited. To produce this transgenic plant according to the invention, a recombinant DNA molecule expressing a polynucleotide can be introduced into the plant cell, for example by means of a vector, via transformation, such that the expression of the polynucleotide leads to the inhibition of the CYPgst protein.
[0100] For example, the previously described mutation that leads to the inhibition of CYP gstExpression is achieved through genetic recombination during a cross between two plants, one of which carries the mutated CYPgst allele. Besides using conventional breeding techniques to generate genetic recombination, modern biotechnology provides experts with various other tools that enable precise genome engineering. For example, T-DNA tagging could be used to... CYPgst to destroy the gene by insertional mutagenesis. Furthermore, the CYP gst Genes can be completely or partially deleted by gene mutation using TALE nucleases (TALENs) or zinc finger nucleases (ZFNs) as well as CRISPR / Cas systems, which are described, among others, in WO 2014 / 144155 Al (Engineering plant genomes using CRISPR / Cas systems) and in Osakabe & Osakabe, Plant Cell Physiol, 56 (2015), 389-400, so that expression of the CYPgstGenes is excluded. This could also be achieved by using the term TILLING ( Targeted Induced Local Lesions in Genomes The method described above is achieved by inducing point mutations in the wild-type gene, as described, for example, in German patent application DE 10 2013 101 617, and subsequently selecting plants that exhibit a suitable, i.e., resistance-conferring, mutation, such as barley resistant to yellow mosaic virus; see DE 10 2013 101 617 on pages 4, 8 and 12 in paragraphs
[0014] ,
[0026] and
[0038] . The TILLING method is also described in detail in the publication by Henikoff. et al. described (Henikoff et al., Plant Physiol. 135, 2004, 630-636. Point mutations in the CYPgst gene of Beta vulgaris subsp. vulgaris, The errors that could lead to stop codons or splicing errors are listed in Table 1.
[0101] Inhibition of expression is also possible via RNAi or co-suppression. This involves introducing the previously defined recombinant DNA molecule or nucleic acid molecule, or the corresponding vector, into the plant, whereby the expression of the encoded shRNA, antisense RNA, or sense RNA molecules inhibits the expression of CYP. gst Genes. Such RNAi and / or co-suppression-based methods are common techniques for inhibiting gene expression and are well-known to those skilled in the art. A SENS approach, comprising a target-specific non-polyadenylated RNA molecule to inhibit CYP expression, can also be employed. gst Genes are used. This method is described, for example, in the international application WO2001 / 012824.
[0102] Another embodiment of the invention is a method for restoring the fertility of a plant according to the invention, which involves the introduction of a functional CYP. gstThe genes in the plant are included. This can involve the CYP enzyme. gst The gene is introduced by genetic engineering methods; by means of a recombinant DNA according to the invention, which preferably contains transcription control elements, preferably a promoter for the specific expression of the gene in closed flowers and / or fruits, or by means of the vectors according to the invention. The CYP gst However, the gene can also be passed through crossbreeding with a plant that carries the CYP gene. gst Wild-type gene or a functional CYP gst The gene, preferably in the homozygous state, is introduced. Optionally, selection for the presence of CYP can be performed after the cross. gst wild type gene or functional CYP gst Genes are passed on to the next generation.
[0103] The present invention relates to a plant containing a previously defined plant cell and / or obtained by the methods described above. That is to say, a plant with a nuclear-encoded, recessive male sterile phenotype, as well as a plant with restored fertility, was either produced by genetic recombination using conventional breeding methods, or it is a transgenic plant in which the expression of CYP was altered by the various methods mentioned above. gst Genes were inhibited, resulting in a nuclear-encoded, recessive, male sterile phenotype, or in which fertility was restored by introducing recombinant DNA molecules.
[0104] Besides the plants that have a nuclear-encoded, recessive, male-sterile phenotype due to mutation in the CYP gstThe invention relates to organs, plant parts, tissues, cells, and seeds or offspring of plants in which this phenotype has been induced by genome engineering using modern biotechnology, and in which fertility has been restored by the corresponding methods. In one embodiment, the seeds or offspring exhibit one or more of the previously defined mutations that inhibit the expression of the gene. CYPgst The genes carry and / or the seeds or offspring exhibit a previously described recombinant DNA molecule or nucleic acid molecule or vector.
[0105] In this invention, a method for identifying a plant according to the invention is also a further embodiment. With this method, both the plant exhibiting a nuclear-encoded, recessive, male-sterile phenotype due to mutation in the CYP enzyme can be identified. gstA plant can be identified by this method if it exhibits a gene or if it is a plant in which this phenotype has been induced by genome engineering using modern biotechnology. Furthermore, a plant in which fertility has been restored by the appropriate methods can be identified using this method. To identify this plant according to the invention, a previously defined nucleic acid molecule can be used as a hybridization probe, which has a length of at least 15 nucleotides and is specifically linked to a previously defined nucleotide sequence comprising the non-mutated (wild-type) CYP. gst gene as well as the CYP gst Bind to a gene with a previously defined mutation that leads to the inhibition of gene expression. It is revealed here that the previously defined oligonucleotide, the previously defined CYP, is used for identification. gst Protein or a fragment thereof and the antibody, as well as components of the previously described kit, can be used.
[0106] The present invention also relates to the use of recombinant DNA molecules or nucleic acid molecules according to the invention in the production of a recessive, nuclear-encoded, male-sterile plant, in the production of a plant with restored fertility.
[0107] A method for producing reversible male sterility in a plant, in which the CYP gst The gene can be used, for example, is described in detail in the international application WO96 / 017945: (a) Introducing a first recombinant DNA molecule into the genome of a pollen-producing plant that can be genetically transformed, wherein the first recombinant DNA molecule comprises: (i) a nucleotide sequence encoding a gene product which, after expression in a plant, inhibits pollen production or its function, here according to the invention the CYP gst(i) Gene or gene product, for example by expression of an RNAi sequence; (ii) an operator that controls the expression of the nucleotide sequence; and (iii) a promoter that is specific to cells critical for pollen production or their function, the promoter being functionally linked to the nucleotide sequence encoding a gene product; (b) optionally, breeding the plant obtained in step (a) under conditions that allow male sterility to be achieved as a result of the expression of the nucleotide sequences;(c) Crossing the male sterile plant from (a) or (b) with pollen from a male fertile line to produce a hybrid plant that is male fertile, wherein the pollen has incorporated a second recombinant DNA molecule into its genome, the second recombinant DNA molecule comprising: a nucleotide sequence encoding a DNA-binding protein that causes repression of transcription, and a promoter that controls the expression of the nucleotide sequence, wherein the DNA-binding protein is able to bind the operator of the recombinant DNA of the male sterile plant and cause repression of transcription.
[0108] Another system for producing pollen-sterile plants, in which foreign DNA is introduced into the nuclear genome and which can be used according to the invention, is described in European patent application EP 0 344 029.
[0109] Furthermore, the use of the plants according to the invention for breeding or for producing offspring plants is disclosed herein, wherein the nuclear-encoded male sterile phenotype is used for recurrent selection. Also disclosed are seeds or offspring, or organs, plant parts, tissues, or cells thereof, for the production of products typically made from renewable raw materials, such as food and feed, preferably sugar or syrup (molasses), wherein the molasses is also used for industrial applications, for example, in alcohol production or as a nutrient medium for the production of biotechnological products, in the production of materials or substances for the chemical industry, e.g., fine chemicals, pharmaceuticals or precursors thereof, diagnostics, cosmetics, bioethanol, or biogas.An example of the use of sugar beet as a biogenic raw material in biogas plants is described in application DE 10 2012 022 178 A1, see e.g. paragraph 10.
[0110] Also disclosed herein are products obtainable from plants, organs, plant parts, tissues, cells, seeds and offspring, such as food, feed and materials containing a plant, seeds, offspring, organs, plant parts, tissues or cells or components thereof according to the invention.
[0111] Unless otherwise stated, standard molecular biology methods were used in the following examples; see, for example, (Sambrook et al., Molecular Cloning: A Laboratory Manual 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001), Fritsch. et al.,Cold Spring Harbor Laboratory Press: 1989; Mayer et al., Immunochemical Methods In Cell And Molecular Biology, eds., Academic Press, London, 1987) and Weir et al., Handbook Of Experimental Immunology, Volumes I-IV, Blackwell, eds., 1986). EXAMPLES 1. Identification of a locus that causes nuclear-encoded male sterility
[0112] A donor plant with internal designation C311 [2043_K5] was used as a starting plant to identify a locus that causes nuclear-encoded male sterility in sugar beet. This donor plant has a recessive, nuclear-encoded, male sterile phenotype (working name). gst). However, the presence and zygosity level of the gst locus originating from this donor and underlying the trait expression could not be checked in advance (i.e., before flowering) in the breeding material. Instead, a large number of putatively sterile plants had to be brought to flowering in the field, or self-fertilization block (S-block). Flowering plants were then manually assessed for the traits of fertility and sterility ( Fig. 1 Subsequently, fertile individuals could be removed and seeds from sterile individuals could be harvested.
[0113] To genetically and physically delineate the gst locus that causes nuclear-encoded male sterility, a sugar beet mapping population expressing the trait was created. The target region on chromosome 1 was already known from initial genome-wide mapping data. For further fine-tuning, male-sterile individuals of the gst donor C311 [2043_K5] were crossed with an annual line, and the resulting F1 individuals were propagated by self-fertilization. Finally, offspring of the S1 generation were phenotyped and characterized using KASP DNA markers (KASP™, SNP Genotyping Chemistry by LGC Limited). Two KASP DNA markers, sxn2151s01 and s1e3305s02, were developed, enabling the gst-The genotype carrying the gst locus can be distinguished from the reference genotype KWS2320 by identifying a SNP. The sxn2151s01 marker sequence shown in SEQ ID No. 24 and the sle3305s02 marker sequence shown in SEQ ID No. 26 indicate the presence of the gst locus; the sxn2151s01 marker sequence shown in SEQ ID No. 25 and the sle3305s02 marker sequence shown in SEQ ID No. 27 indicate the reference sequence, where the marker sequences differ at nucleotide position 21, with a "G" at this position in the genotype carrying the gst locus and an "A" at this position in the reference genotype KWS2320. As a result of this fine mapping, the region on chromosome 1 of the sugar beet genome was strongly narrowed down, flanked by the KASP DNA markers sxn2151s01 at 33.42 cM and s1e3305s02 at 35.15 cM (based on the genetic map ZR INT 1202) and the gst-Locus. Based on the physical genome map (Physmapv2), this region has a physical size of 215.4 kbp and lies between positions 3185718 bp and 3401120 bp. Based on the identified position and the publicly available genome annotation RefBeet 1.2 (http: / / bvseq.molgen.mpg.de / ), 21 protein-coding genes were identified as being localized in this genome region.
[0114] Homologous genes in model plants (e.g., Arabidopsis thaliana and Oryza sativa) was sought. Based on the identified homologs in model plants, a comprehensive analysis and evaluation was performed. Based on this comprehensive analysis of sequence and predicted structures, one of the genes encoded at the gst locus was identified as a member of the cytochrome P450 monooxygenase (CYP) family. Despite considerable sequence diversity among cytochrome P450 monooxygenases, all CYPs share common structural features, which are highly conserved, particularly in the active site (see, e.g., Fischer et al., Bioinformatics 23 (2007), 2015-2017), and which also apply to the putative gst -gene were found. Therefore, this gene was CYP gst named.
[0115] Upon closer characterization of this gene, a Arabidopsis thaliana CYP gene identified, i.e. CYP703A2 that has a high sequence identity to this gene from the gst -locus. A Arabidopsis thalianaThe mutant in which this gene was inactivated by T-DNA insertion exhibits a partially or semi-male sterile phenotype (Morant et al. Plant Cell 19 (2007), 1473-1487). This is explained mechanistically by a function of CYP703A2 in the synthesis of sporopollenin, the main component of the exin layer of viable pollen. A missing exin layer disrupts pollen maturation or makes it highly susceptible to environmental influences. However, there are two significant differences in the sugar beet phenotype. gst -phenotype to the phenotype of the described Arabidopsis Mutant: (i) in contrast to Arabidopsis generates the knockout of the gene in sugar beets confers complete male sterility and (ii) while in Arabidopsis Mutant pollen grains are generally produced, but are sterile; according to current analyses, this leads to... gst -Sugar beets are not suitable for pollen production.
[0116] Therefore, it cannot be ruled out that these are different members of the CYP family and / or that the functions of both proteins are different. Arabidopsis and sugar beets are different. In addition, that Arabidopsis A wild herb from the Brassicaceae family with a compact, small genome is the succulent, whereas the sugar beet is a cultivated plant, i.e., a plant grown, cared for, and bred by humans for use as a crop. Therefore, experiments on Arabidopsis as a study object and its results cannot be readily transferred to cultivated plants. Furthermore, there are also important, agriculturally relevant processes in crop plants that are not directly applicable to crops. Arabidopsis not occur at all. This includes, for example, the formation of beet bodies, tubers, and grains, which serve as storage organs and as vegetative propagation organs, interactions with symbiotic mycorrhizal fungi, or pathogens that do not occur with Arabidopsis are connected. 2. Characterization of the CYPgst gene
[0117] After identifying the potential gene that causes the gst -phenotype caused, comparative sequencing of an approximately 5 kbp fragment of genomic DNA was performed. The fertile sugar beet reference genotype KWS2320, the sterile gst donor C311, and three individuals each from the fine mapping population classified as sterile and homozygous fertile based on phenotype and marker data were sequenced. The sequenced genome region comprised the area described in Figure 2 depicted gene model of BvCYP703A2 ( GST g6845.t1) and additionally about 1.5 kbp of the putative promoter region. Comparative sequencing revealed, in addition to a number of Small Nucleotide Polymorphisms (SNPs) between sterile and fertile individuals a 533 bp deletion in sterile genotypes, which includes the 5' UTR and the first exon of the gene model ( Figure 2 and Figure 3 ).
[0118] Analysis of all identified polymorphisms revealed that only the deletion affects the encoded protein, while all other mutations are either located in untranslated regions or produce synonymous codons. The deletion in question, however, prevents correct transcription of the mRNA, thus precluding the translation of a functional protein. Subsequent transcription analyses confirmed this finding. Figure 5 ). In fertile genotypes BvCYP703A2 ( GST g6845.t1) is expressed very specifically in closed flowers and fruits. No expression is detectable in roots and leaves. In sterile genotypes, however, no expression of the GST- Genes detectable in closed flowers, suggesting a complete knockout of the gene in sterile genotypes.
[0119] Finally, DNA markers were developed that can discriminate between sterile and fertile genotypes. For this purpose, KASP markers were developed that dominantly indicate the fertile allele (insertion) (sle5983d14, s1e5983d17). maName Primer_forward Primer_reverse SEQ ID NO: 4: SEQ ID NO: 5: s1e5983d14 ACCAAAATTTTATACCAATGGCTCAAG GGCCGGGAGGGAGTTTGTATGTT s1e5983d17 SEQ ID NO: 6: SEQ ID NO: 7: AGAAATCATACGTGAGATCTTAGTTCG GGTATGTGGACGAGACGCAAATACAT
[0120] This allows for indirect inference of the homozygous deletion if both dominant markers (sle5983d14, s1e5983d17) indicate a null allele and a third, ubiquitous marker confirms the sufficient quality of the DNA extraction. Potential point mutations in Bv CYP gst Genes that could lead to premature termination of transcription of the CYPgst gene or cause disrupted splicing, and which can be tested for using standard methods for the detection of DNA point mutations (SNP analysis), are listed in Table 1 below. Tabelle 1: gst Beta vulgaris vulgaris, gst Potential point mutations in the CYP gene from subsp. that can lead to premature termination of CYP gene transcription or cause impaired splicing. Position gemäß SEQ ID Nr. 1 Nukleotid Mutation Auswirkung der Mutation 1771 G T STOP Codon 1778 T A or G STOP Codon 1788 T A or G STOP Codon 1790 T A or G STOP Codon 1797 T A STOP Codon 1813 A T STOP Codon 1820 T A or G STOP Codon 1824 C A or G STOP Codon 1825 C T STOP Codon 1829 G A STOP Codon 1830 G A STOP Codon 1834 A T STOP Codon 1842 C A or G STOP Codon 1844 T A or G STOP Codon 1848 C A or G STOP Codon 1857 C A or G STOP Codon 1858 A T STOP Codon 1883 G A STOP Codon 1884 G A STOP Codon 1889 T A or G STOP Codon 1894 G T STOP Codon 1906 C T STOP Codon 1940 C A or G STOP Codon 1947 T A STOP Codon 1948 G T STOP Codon 1951 A T STOP Codon 1956 T A or G STOP Codon 1964 T A or G STOP Codon 1971 C A or G STOP Codon 2014 G T STOP Codon 2026 G T STOP Codon 2033 T A or G STOP Codon 2038 C T STOP Codon 2041 C T STOP Codon 2075 T A or G STOP Codon 2090 T A STOP Codon 2097 C A or G STOP Codon 2117 T A STOP Codon 2128 G T STOP Codon 2138 G A STOP Codon 2139 G A STOP Codon 2140 A T STOP Codon 2143 A T STOP Codon 2149 A T STOP Codon 2160 C A STOP Codon 2164 G T STOP Codon 2171 T A STOP Codon 2182 A T STOP Codon 2185 C T STOP Codon 2191 G T STOP Codon 2218 G T STOP Codon 2224 C T STOP Codon 2231 T A STOP Codon 2236 C T STOP Codon 2246 T A or G STOP Codon 2260 A T STOP Codon 2266 A T STOP Codon 2279 T A STOP Codon 2284 G T STOP Codon 2291 T A or G STOP Codon 2320 A T STOP Codon 2327 T A STOP Codon 2335 A T STOP Codon 2338 C T STOP Codon 2343 C A or G STOP Codon 2368 C T STOP Codon 2380 G T STOP Codon 2401 G T STOP Codon 2405 T A STOP Codon 2411 G A STOP Codon 2412 G A STOP Codon 2414 T A or G STOP Codon 2423 T A STOP Codon 2430 C A or G STOP Codon 2432 T A STOP Codon 2442 T A or G STOP Codon 2444 T A STOP Codon 2453 G A STOP Codon 2454 G A STOP Codon 2459 G A STOP Codon 2460 G A STOP Codon 2472 T A or G STOP Codon 2473 G T STOP Codon 2478 T A STOP Codon 2479 G T STOP Codon 2482 A T STOP Codon 2485 A T STOP Codon 2494 G T STOP Codon 2500 G T STOP Codon 2503 A T STOP Codon 2527 A T STOP Codon 2536 G T STOP Codon 2539 G T STOP Codon 2548 A T STOP Codon 2551 G T STOP Codon 2554 A T STOP Codon 2557 A T STOP Codon 2563 A T STOP Codon 2566 G T STOP Codon 2569 G T STOP Codon 2575 G T STOP Codon 2584 G T STOP Codon 2590 G T STOP Codon 2612 T A STOP Codon 2615 T A STOP Codon 2621 T A STOP Codon 2629 G T STOP Codon 2635 G T STOP Codon 2641 G T STOP Codon 2665 A T STOP Codon 2677 C T STOP Codon 2679 G A Spleiß-Mutation 2680 G A Spleiß-Mutation 2681 T A Spleiß-Mutation 3505 A C or G or T Spleiß-Mutation 3506 G A or C or T Spleiß-Mutation 3535 C A or G STOP Codon 3549 G T STOP Codon 3553 G A STOP Codon 3554 G A STOP Codon 3564 G T STOP Codon 3573 A T STOP Codon 3594 A T STOP Codon 3600 C T STOP Codon 3603 C T STOP Codon 3606 G T STOP Codon 3624 G T STOP Codon 3633 C T STOP Codon 3645 G T STOP Codon 3649 C A or G STOP Codon 3671 C A or G STOP Codon 3680 T A STOP Codon 3690 G T STOP Codon 3699 C T STOP Codon 3724 T A or G STOP Codon 3735 G T STOP Codon 3739 C A or G STOP Codon 3767 T A or G STOP Codon 3811 T A or G STOP Codon 3813 G T STOP Codon 3825 A T STOP Codon 3832 G A STOP Codon 3833 G A STOP Codon 3843 G T STOP Codon 3854 C A or G STOP Codon 3858 G T STOP Codon 3861 A T STOP Codon 3868 G A STOP Codon 3869 G A STOP Codon 3874 T A STOP Codon 3879 G T STOP Codon 3885 A T STOP Codon 3891 G T STOP Codon 3903 G T STOP Codon 3915 A T STOP Codon 3922 T A or G STOP Codon 3939 A T STOP Codon 3942 A T STOP Codon 3945 A T STOP Codon 3950 T A STOP Codon 3982 T A STOP Codon 3987 G T STOP Codon 3991 T A STOP Codon 4018 G A STOP Codon 4019 G A STOP Codon 4021 T A or G STOP Codon 4032 G T STOP Codon 4038 A T STOP Codon 4044 G T STOP Codon 4047 G T STOP Codon 4059 A T STOP Codon 4062 G T STOP Codon 4070 T A or G STOP Codon 4086 A T STOP Codon 4092 C T STOP Codon 4099 T A or G STOP Codon 4108 T A STOP Codon 4113 A T STOP Codon 4132 T A or G STOP Codon 4136 T A or G STOP Codon 3. Verwendung des CYPgst Gens bzw. -Lokus in der Hybridzüchtung
[0121] As described above, the male sterile phenotype produced by the gst locus is used in resistance breeding programs for easy crossbreeding in recurrent selection. Before cloning the gene according to the present invention and the associated development of genomic markers, four times more plants than needed had to be cultivated and released due to the expected 3:1 phenotypic segregation. These plants had to be assessed for sterility within a short time at the onset of flowering, and fertile individuals had to be removed to prevent self-pollination. Assuming several thousand plants per year, this manual selection is very labor-intensive and also prone to errors. According to the invention, genomic markers are now provided, see Example 2 and Abbildung 2 with which it was possible, for example, to test 30,000 plants and select 7,500 male sterile individuals that were subsequently planted.
[0122] There is a constant effort to simplify breeding programs and seed production for sugar beets, thereby reducing costs. Currently, commercial sugar beets are produced as triple hybrids to ensure sufficiently high-quality seed. The production of hybrids in breeding programs, i.e., in the non-commercial sector, is also costly and labor-intensive and is currently achieved by using partitions. With the aid of the gst phenotype according to the invention and associated DNA markers, it is now possible—after introducing the gst locus or mutation / inhibition of the CYPgst gene into the breeding programs—to select male-sterile plants before planting using DNA markers, thus simplifying production processes. The parallel development of multi-germ tester genotypes (MUS testers) would also become unnecessary.In the long term, it is also conceivable to replace currently used CMS technology with an alternative system that can put the sperm parent component into a male sterile state, for example by means of the aforementioned and in . Abbildung 5 to replace the SPT system shown. Accordingly, it is also reasonable to assume that the CYPgst system according to the invention will find application in other cultivated plants, in particular crops, such as in the commercial production of double hybrids, such as maize. In maize ( Zea mays ) play ms-Gene a major role in the development of alternative systems for producing hybrid seeds. Sequence analyses revealed that a putative maize homolog to Bv CYP gst exists (GRMZM5g830329). Likewise, a large number of ms -mutants in maize, of which only a portion have been cloned so far. Using the present invention, the ms mutants can now be isolated, which ms -phenotype due to a mutation or inhibition of the maize homolog to Bv CYP gst This invention is attributable to and can be used specifically in seed production. Likewise, the present invention is used in the development of a hybrid potato, for example, to introduce targeted mutations in the potato homolog of the Bv CYP gst to introduce genes and use the resulting male sterility in the potato to develop a diploid hybrid potato in accordance with the SPT system.
[0123] Finally, the specific expression of the gene enables BvCYPgst In flowers and the tapetum, the promoter is used biotechnologically, for example for the expression of a sense / antisense RNA or a ribozyme to inhibit the BvCYPgst Genes or for the expression of a functional CYP gst Proteins or a putative homolog, analogue or ortholog of the BvCYPgst Genes for complementing the mutation and restoring the male fertile phenotype. It is assumed that the provision of the gene locus and the nucleic and amino acid sequences of the BvCYPgst Genes, along with genetic markers and the resulting modifications, bring about a significant simplification and cost savings for breeding programs, as, among other things, early selection of sterile individuals is made possible. Likewise, logistical simplification and breeding expansion of the programs involved can be achieved.
Claims
1. A plant of the species Beta vulgaris, showing a recessive, nuclear-encoded male sterile phenotype, characterized in that the phenotype is associated with a mutation in the endogenous cytochrome P450 oxidase gene, characterized in that the non-mutated cytochrome P450 oxidase gene is a gene selected from the group consisting of: (a) a nucleotide sequence that has the nucleotide sequence shown in SEQ ID No.: 1 or SEQ ID No.: 2 or a functional fragment thereof; (b) a nucleotide sequence encoding the amino acid sequence shown in SEQ ID No.: 3; (c) a nucleotide sequence capable of hybridizing to a nucleotide sequence complementary to a nucleotide sequence according to (a) or (b) under stringent conditions; and (d) a nucleotide sequence encoding an amino acid sequence that has a sequence identity of at least 80% over the entire amino acid sequence according to SEQ ID No.: 3, wherein the mutation is a deletion, addition, insertion or substitution in the coding nucleotide sequence of the cytochrome P450 oxidase gene, in a splicing signal or in a regulatory sequence, preferably the promoter sequence of the cytochrome P450 oxidase gene, and wherein said mutation in question reduces or prevents the transcription and / or translation of a functional cytochrome P450 oxidase protein.
2. The plant according to claim 1 which is homozygous for the mutation and male-sterile, wherein the formation of functional pollen is inhibited in the sterile plant.
3. The plant according to claim 1, wherein the mutation is a deletion between the nucleotide positions 1560 and 2095 of SEQ ID No.: 1.
4. The plant according to claim 1, wherein the deletion can be detected by the absence of one or both of the marker loci sle5983d14 (amplification product of the primers with SEQ ID Nos.: 4 and 5) and s1e5983d17 (amplification product of the primers with SEQ ID Nos.: 6 and 7) and by the presence of a ubiquitous marker.
5. The plant according to any one of claims 1-2, wherein the gene is localized in a segment on chromosome 1 between the marker loci sxn2151s01 and sle3305s02, wherein the sxn2151s01 marker sequence shown in SEQ ID No.: 24 and the sle3305s02 marker sequence shown in SEQ ID No.: 26 indicate the presence of the locus causing the nuclear-encoded male sterility, and the sxn2151s01 marker sequence shown in SEQ ID No.: 25 and the SLE3305S02 marker sequence shown in SEQ ID No.: 27 show the reference sequence.
6. Recombinant DNA molecule comprising a nucleotide sequence that encodes an shRNA (small hairpin RNA), siRNA (small interfering RNA), antisense RNA, sense RNA or double-stranded RNA which, after expression in a plant cell or after introduction into a plant cell, results in the reduction or inhibition of the expression of the functional (non-mutated) cytochrome P450 oxidase gene as defined in claim 1.
7. Plant cell comprising the recombinant DNA molecule according to claim 6.
8. Method of producing a male sterile plant of the species Beta vulgaris, characterized in that the expression of the cytochrome P450 oxidase gene is reduced or inhibited according to one of the nucleotide sequences according to claim 1 (a), (b), (c), or (d), wherein the method comprises a step of introduction of the recombinant DNA molecule according to claim 6, wherein said step of the method comprises an agrobacterium transformation, a T-DNA tagging, or mutagenesis by TILLING, or a step of targeted mutagenesis of the nucleotide sequences according to claim 1 (a), (b), (c), or (d), as a result of which the expression of the gene is reduced or inhibited, e.g., by RNAi or co-suppression or due to the introduced mutation.
9. Plant comprising plant cells according to claim 7 and / or obtained by a method according to claim 8.
10. A method for restoring the fertility of a plant according to any one of claims 1 to 5 or a plant according to claim 9, comprising the introduction of a functional (non-mutated) cytochrome P450 oxidase gene into the plant by transformation by means of a recombinant DNA comprising a non-mutated nucleotide sequence having a coding sequence according to any one of claims 1 (a)-(d) which is surgically linked to a heterologous promoter, which is preferably able to control the expression of the nucleotide sequence specifically in closed flowers and / or fruits.
11. An organ, plant part, tissue or cell of the plant according to any one of claims 1 to 5 or 9 or seed or descendants of the plant according to any one of claims 1 to 5 or 9, wherein the seed or descendants having the mutation defined in any one of claims 1 to 5 and / or the recombinant DNA molecule according to claim 6.
12. A method for identifying a plant according to any one of claims 1 to 5 by demonstrating the mutation in the cytochrome P450 oxidase gene or a marker coupled with the mutation.
13. Use of a nucleic acid molecule of at least 15 nucleotides in length which hybridises specifically to a nucleotide sequence as defined in claim 1 and / or an oligonucleotide, preferably having a length of no more than 50 nucleotides, having one of the following nucleotide sequences: (i) SEQ ID No.: 4, 6 or a complement thereof, or (ii) SEQ ID No.: 5, 7 or a complement thereof, for identifying a plant according to any of claims 1 to 5.