Compounds and methods for modulating GFAP

DE602020056654T2Active Publication Date: 2025-08-13IONIS PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
DE602020056654
Authority / Receiving Office
DE · DE
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-07-26
Filing Date
2020-07-24
Publication Date
2025-08-13
Estimated Expiration
2040-07-24

AI Technical Summary

Technical Problem

There are no specific therapies for Alexander Disease (AxD), a rare leukodystrophy caused by mutations in the GFAP gene, leading to fatal neurodegeneration with symptoms like motor and cognitive delays, seizures, and intra-astrocytic inclusions.

Method used

Development of modified oligonucleotides, such as those with a chemical structure of m< C es A eo G eo T eo A eo T eo T ds A ds m< C ds m< C ds T ds m< C ds T ds A ds m< C ds T ds A eo G es T es m< C e (SEQ ID NO: 20), designed to reduce GFAP RNA and protein expression, formulated into pharmaceutical compositions for treatment.

Benefits of technology

The modified oligonucleotides effectively decrease GFAP RNA and protein levels, ameliorating symptoms like motor delays, seizures, and intra-astrocytic inclusions in AxD, providing a therapeutic approach for this currently untreatable condition.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

Sequence Listing

[0001] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0353UWOSEQ_ST25.txt, created on July 17, 2020, which is 592 KB in size.Field

[0002] Disclosed herein are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of GFAP RNA in a cell or subject, and in certain instances reducing the amount of glial fibrillary acidic protein (GFAP) in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a leukodystrophy. Such symptoms and hallmarks include motor delays, cognitive delays, paroxysmal deterioration, seizures, vomiting, swallowing difficulties, ataxic gait, palatal myoclonus, autonomic dysfunction, and intra-astrocytic inclusions called Rosenthal fibers. Such leukodystrophies include Alexander Disease.Background

[0003] Alexander Disease (AxD) is a rare developmental disorder that affects ~1 / 1,000,000 live births and is caused by a number of different autosomal dominant mutations in the gene encoding glial fibrillary acidic protein, GFAP. AxD is a typically fatal leukodystrophy with early onset (< age 4, Type I) or later onset ( > age 4 Type II) forms (Prust et al., (2011) GFAP mutations, age at onset, and clinical subtypes in Alexander disease. Neurol 77: 1287-1294). Symptoms include motor and cognitive delays, paroxysmal deterioration, seizures, encephalopathy, macrocephaly, and intra-astrocytic inclusions called Rosenthal fibers.

[0004] There are no specific therapies for AxD, with current treatments being limited to supportive treatments for individual symptoms (e.g., antiepileptics to prevent seizures; Messing, et. al., "Strategies for treatment in Alexander Disease", Neurotherapeutics: The Journal of the Am. Soc. For Expt. NeuroTher., 2016).

[0005] Currently there is a lack of acceptable options for treating leukodystrophies such as AxD. It is therefore an object herein to provide compounds, methods, and pharmaceutical compositions for the treatment of such diseases.

[0006] TRACY L. HAGEMANN ET AL., describes antisense suppression of glial fibrillary acidic protein as a treatment for Alexander disease.Summary of the Invention

[0007] The present invention is set out in the appended set of claims. In particular the present invention provides a modified oligonucleotide according to the following chemical structure: (SEQ ID NO: 20), or a salt thereof.

[0008] The present invention also provides a modified oligonucleotide according to the following chemical structure:

[0009] The present invention also provides an oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m< C es A eo G eo T eo A eo T eo T ds A ds m< C ds m< C ds T ds m< C ds T ds A ds m< C ds T ds A eo G es T es m< C e (SEQ ID NO: 20), wherein: A = an adenine nucleobase, m< C = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2'-β-D-OCH 2 CH 2 OCH 3 ribosyl sugar moiety, d = a 2'-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.

[0010] The present invention also provides a population of modified oligonucleotides of the invention, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

[0011] The present invention also provides a pharmaceutical composition comprising the modified oligonucleotide of the invention, the oligomeric compound of the invention, or the population of modified oligonucleotides of the invention, and a pharmaceutically acceptable diluent.

[0012] The present invention also provides a modified oligonucleotide of the invention, an oligomeric compound of the invention, a population of modified oligonucleotides of the invention, or a pharmaceutical composition of the invention for use in the treatment of a disease associated with GFAP, optionally wherein the disease associated with GFAP is a neurodegenerative disease.

[0013] Disclosed herein are compounds, methods and pharmaceutical compositions for reducing the amount or activity of GFAP RNA, and in certain embodiments reducing the expression of glial fibrillary acidic protein in a cell or subject. In certain embodiments, the subject has a leukodystrophy. In certain embodiments, the subject has Alexander Disease (AxD). Compounds useful for reducing the amount or activity of GFAP RNA may be oligomeric compounds. Compounds useful for reducing the amount or activity of GFAP RNA may be modified oligonucleotides. Compounds useful for decreasing expression of glial fibrillary acidic protein may be oligomeric compounds. Compounds useful for decreasing expression of glial fibrillary acidic protein may be modified oligonucleotides.

[0014] Also provided are pharmaceutical compositions for use in methods for ameliorating at least one symptom or hallmark of a leukodystrophy. In certain embodiments, the leukodystrophy is Alexander Disease. In certain embodiments, the symptom or hallmark includes motor delays, cognitive delays, paroxysmal deterioration, seizures, vomiting, swallowing difficulties, ataxic gait, palatal myoclonus, autonomic dysfunction, and presence of intra-astrocytic inclusions called Rosenthal fibers.Detailed Description of the Invention

[0015] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and / or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0016] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.Definitions

[0017] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art.

[0018] Unless otherwise indicated, the following terms have the following meanings:DEFINITIONS

[0019] As used herein, "2'-deoxynucleoside" means a nucleoside comprising a 2'-H(H) deoxyfuranosylsugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside and comprises a 2'-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2' -deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

[0020] As used herein, "2'-MOE" or "2'-MOE sugar moiety" means a 2'-OCH 2 CH 2 OCH 3 group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-MOE sugar moiety" means a sugar moiety with a 2'-OCH 2 CH 2 OCH 3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" means O-methoxyethyl.

[0021] As used herein, "2'-MOE nucleoside" means a nucleoside comprising a 2'-MOE sugar moiety.

[0022] As used herein, "2'-OMe" or "2'-O-methyl sugar moiety" means a 2'-OCH 3 group in place of the 2'-OH group of a furanosyl sugar moiety. A"2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" means a sugar moiety with a 2'-OCH 3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2'-OMe sugar moiety is in the β-D-ribosyl configuration.

[0023] As used herein, "2'-OMe nucleoside" means a nucleoside comprising a 2'-OMe sugar moiety.

[0024] As used herein, "2'-substituted nucleoside" means a nucleoside comprising a 2'-substituted sugar moiety. As used herein, "2'-substituted" in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.

[0025] As used herein, "5-methyl cytosine" means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine is a modified nucleobase.

[0026] As used herein, "administering" means providing a pharmaceutical agent to a subject.

[0027] As used herein, "antisense activity" means any detectable and / or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

[0028] As used herein, "antisense compound" means an oligomeric compound capable of achieving at least one antisense activity.

[0029] As used herein, "ameliorate" in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom. In certain embodiments, the symptom or hallmark is motor delays, cognitive delays, paroxysmal deterioration, seizures, vomiting, swallowing difficulties, ataxic gait, palatal myoclonus, autonomic dysfunction, and presence of intra-astrocytic inclusions called Rosenthal fibers.

[0030] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside comprising a bicyclic sugar moiety.

[0031] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

[0032] As used herein, "cerebrospinal fluid" or "CSF" means the fluid filling the space around the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" means a prepared or manufactured fluid that has certain properties of cerebrospinal fluid.

[0033] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.

[0034] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. As used herein, "complementary nucleobases" means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine ( m< C) and guanine (G). Complementary oligonucleotides and / or target nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, "fully complementary" or "100% complementary" in reference to an oligonucleotide, or a portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0035] As used herein, "conjugate group" means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0036] As used herein, "conjugate linker" means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

[0037] As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0038] As used herein, "contiguous" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

[0039] As used herein, "constrained ethyl" or "cEt" or "cEt modified sugar moiety" means a 4' to 2' bridge in place of the 2'OH-group of a ribosyl sugar moiety, wherein the bridge has the formula of 4'-CH(CH 3 )-O-2', and wherein the methyl group of the bridge is in the S configuration. A "cEt sugar moiety" is a bicyclic sugar moiety with a 4' to 2' bridge in place of the 2'OH-group of a ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH 3 )-O-2', and wherein the methyl group of the bridge is in the S configuration.

[0040] As used herein, "cEt nucleoside" means a nucleoside comprising a cEt sugar moiety.

[0041] As used herein, "chirally enriched population" means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

[0042] As used herein, "chirally controlled" in reference to an internucleoside linkage means chirality at that linkage is enriched for a particular stereochemical configuration.

[0043] As used herein, "deoxy region" means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides are 2'-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from a 2'-β-D-deoxynucleoside, a bicyclic nucleoside, and a 2'-susbstituted nucleoside. In certain embodiments, a deoxy region supports RNase H activity. In certain embodiments, a deoxy region is the gap or internal region of a gapmer.

[0044] As used herein, "gapmer" means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the "gap" and the external regions may be referred to as the "wings." The internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5'-end of the internal region. Unless otherwise indicated, "gapmer" refers to a sugar motif. Unless otherwise indicated, the sugar moiety of each nucleoside of the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap comprises one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2'-β-D-deoxynucleosides. As used herein, the term "MOE gapmer" indicates a gapmer having a gap comprising 2'-β-D-deoxynucleosides and wings comprising 2'-MOE nucleosides. As used herein, the term "mixed wing gapmer" indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified internucleoside linkages and / or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.

[0045] As used herein, "hotspot region" is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.

[0046] As used herein, "hybridization" means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0047] As used herein, "internucleoside linkage" means the covalent linkage between contiguous nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a phosphodiester internucleoside linkage. "Phosphorothioate internucleoside linkage or "PS internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0048] As used herein, "leukodystrophy" means a disorder due to abnormalities in the myelin sheath of neurons.

[0049] As used herein, "linker-nucleoside" means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

[0050] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

[0051] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.

[0052] As used herein, "motif" means the pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages, in an oligonucleotide.

[0053] As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A "5-methyl cytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.

[0054] As used herein, "nucleoside" means a compound, or a fragment of a compound, comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. "Linked nucleosides" are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).

[0055] As used herein, "oligomeric compound" means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A "singled-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "duplexed oligomeric compound."

[0056] As used herein, "oligonucleotide" means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

[0057] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.

[0058] As used herein, "pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0059] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.

[0060] As used herein, "prodrug" means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and / or by physiologic conditions.

[0061] As used herein, "reducing the amount or activity" refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.

[0062] As used herein, "RNA" means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.

[0063] As used herein, "RNAi compound" means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound modulates the amount, activity, and / or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.

[0064] As used herein, "self-complementary" in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

[0065] As used herein, "standard in vitroassay" means the assay described in Example 1 and reasonable variations thereof.

[0066] As used herein, "standard in vivo assay" means the assay described in Example 7 and reasonable variations thereof.

[0067] As used herein, "stereorandom chiral center" in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0068] As used herein, "subject" means a human or non-human animal.

[0069] As used herein, "sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" means a 2'-OH(H) β-D-ribosyl moiety, as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H) β-D-deoxyribosyl sugar moiety, as found in DNA (an "unmodified DNA sugar moiety"). Unmodified sugar moieties have one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or a sugar surrogate.

[0070] As used herein, "sugar surrogate" means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.

[0071] As used herein, "symptom or hallmark" means any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject. In certain embodiments, a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests. In certain embodiments, a hallmark is apparent on a brain MRI scan.

[0072] As used herein, "target nucleic acid" and "target RNA" mean a nucleic acid that an antisense compound is designed to affect.

[0073] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0074] As used herein, "terminal group" means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

[0075] As used herein, "therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves a symptom or hallmark of a disease.I. Certain Oligonucleotides

[0076] Disclosed herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage.A. Certain Modified Nucleosides

[0077] Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.1. Certain Sugar Moieties

[0078] Modified sugar moieties may be non-bicyclic modified sugar moieties. Modified sugar moieties may be bicyclic or tricyclic sugar moieties. Modified sugar moieties may be sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

[0079] Modified sugar moieties may be non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2', 4', and / or 5' positions. One or more non-bridging substituent of non-bicyclic modified sugar moieties may be branched. Examples of 2'-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2'-F, 2'-OCH 3 ("OMe" or "O-methyl"), and 2'-O(CH 2 ) 2 OCH 3 ("MOE" or "O-methoxyethyl"). 2'-substituent groups may be selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O-C 1 -C 10 alkoxy, O-C 1 -C 10 substituted alkoxy, O-C 1 -C 10 alkyl, O-C 1 -C 10 substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ) or OCH 2 C(=O)-N(R m )(R n ), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl, and the 2'-substituent groups described in Cook et al., U.S. 6,531,584; Cook et al., U.S. 5,859,221; and Cook et al., U.S. 6,005,087. 2'-substituent groups may be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4'-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of 5'-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. Non-bicyclic modified sugar moieties may comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0080] 2'-substituted non-bicyclic modified nucleoside may comprise a sugar moiety comprising a non-bridging 2'-substituent group selected from: F, NH 2 , N 3 , OCF 3 , OCH 3 , O(CH 2 ) 3 NH 2 , CH 2 CH=CH 2 , OCH 2 CH=CH 2 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(R m )(R n ), O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and N-substituted acetamide (OCH 2 C(=O)-N(R m )(R n )), where each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted C 1 -C 10 alkyl.

[0081] 2'-substituted non-bicyclic modified nucleoside may comprise a sugar moiety comprising a non-bridging 2'-substituent group selected from: F, OCF 3 , OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N(CH 3 ) 2 , and OCH 2 C(=O)-N(H)CH 3 ("NMA").

[0082] 2'-substituted non-bicyclic modified nucleoside may comprise a sugar moiety comprising a non-bridging 2'-substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .

[0083] Modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties may be further defined by isomeric configuration. For example, a 2'-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described in, e.g., WO 2019 / 157531. A 2'-modified sugar moiety has an additional stereocenter at the 2'-position relative to a 2'-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations. 2'-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0084] Certain modifed sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. The bicyclic sugar moiety may comprise a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4' to 2' bridging sugar substituents include but are not limited to: 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -O-2' ("LNA"), 4'-CH 2 -S-2', 4'-(CH 2 ) 2 -O-2' ("ENA"), 4'-CH(CH 3 )-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH 2 -O-CH 2 -2', 4'-CH 2 -N(R)-2', 4'-CH(CH 2 OCH 3 )-O-2' ("constrained MOE" or "cMOE") and analogs thereof (see, e.g., Seth et al., U.S. 7,399,845, Bhat et al., U.S. 7,569,686, Swayze et al., U.S. 7,741,457, and Swayze et al., U.S. 8,022,193), 4'-C(CH 3 )(CH 3 )-O-2' and analogs thereof (see, e.g., Seth et al., U.S. 8,278,283), 4'-CH 2 -N(OCH 3 )-2' and analogs thereof (see, e.g., Prakash et al., U.S. 8,278,425), 4'-CH 2 -O-N(CH 3 )-2' (see, e.g., Allerson et al., U.S. 7,696,345 and Allerson et al., U.S. 8,124,745), 4'-CH 2 -C(H)(CH 3 )-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH 2 -C(=CH 2 )-2' and analogs thereof (see e.g., Seth et al., U.S. 8,278,426), 4'-C(R a R b )-N(R)-O-2', 4'-C(R a R b )-O-N(R)-2', 4'-CH 2 -O-N(R)-2', and 4'-CH 2 -N(R)-O-2', wherein each R, R a , and R b is, independently, H, a protecting group, or C 1 -C 12 alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).

[0085] Such 4' to 2' bridges may independently comprise from 1 to 4 linked groups independently selected from: - [C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a ) 2 -, -S(=O) x -, and -N(R a )-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R a and R b is, independently, H, a protecting group, hydroxyl, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C 3 -C 7 alicyclic radical, substituted C 3 -C 7 alicyclic radical, halogen, OJ 1 , NJ 1 J 2 , SJ I , N 3 , COOJ 1 , acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O) 2 -J 1 ), or sulfoxyl (S(=O)-J 1 ); and each J 1 and J 2 is, independently, H, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C 1 -C 12 aminoalkyl, substituted C 1 -C 12 aminoalkyl, or a protecting group.

[0086] Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379;Wengel et a., U.S. 7,053,207; Imanishi et al., U.S. 6,268,490; Imanishi et al. U.S. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. 6,794,499; Wengel et al., U.S. 6,670,461; Wengel et al., U.S. 7,034,133; Wengel et al., U.S. 8,080,644; Wengel et al., U.S. 8,034,909; Wengel et al., U.S. 8,153,365; Wengel et al., U.S. 7,572,582; Ramasamy et al., U.S. 6,525,191; Torsten et al., WO 2004 / 106356; Wengel et al., WO 1999 / 014226; Seth et al., WO 2007 / 134181; Seth et al., U.S. 7,547,684; Seth et al., U.S. 7,666,854; Seth et al., U.S. 8,088,746; Seth et al., U.S. 7,750,131; Seth et al., U.S. 8,030,467; Seth et al., U.S. 8,268,980; Seth et al., U.S. 8,546,556; Seth et al., U.S. 8,530,640; Migawa et al., U.S. 9,012,421; Seth et al., U.S. 8,501,805; and U.S. Patent Publication Nos. Allerson et al., US2008 / 0039618 and Migawa et al., US2015 / 0191727.

[0087] Bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties may be further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration. α-L-methyleneoxy (4'-CH 2 -O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

[0088] Modified sugar moieties may comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5'-substituted and 4'-2' bridged sugars).

[0089] Modified sugar moieties may be sugar surrogates. The oxygen atom of the sugar moiety may be replaced, e.g., with a sulfur, carbon or nitrogen atom. Such modified sugar moieties may also comprise bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4'-sulfur atom and a substitution at the 2'-position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and / or the 5' position.

[0090] Sugar surrogates may comprise rings having other than 5 atoms. For example, a sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), manitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA: ("F-HNA", see e.g. Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S. 8,796,437; and Swayze et al., U.S. 9,005,906; F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of the modified THP nucleosides: Bx is a nucleobase moiety; T 3 and T 4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T 3 and T 4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each, independently, H, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, or substituted C 2 -C 6 alkynyl; and each of R 1 and R 2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ 1 J 2 , SJ 1 , N 3 , OC(=X)J 1 , OC(=X)NJ 1 J 2 , NJ 3 C(=X)NJ 1 J 2 , and CN, wherein X is O, S or NJ 1 , and each J 1 , J 2 , and J 3 is, independently, H or C 1 -C 6 alkyl.

[0091] Modified THP nucleosides are disclosed wherein q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. At least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 may be other than H. At least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 may be methyl. Modified THP nucleosides are disclosed wherein one of R 1 and R 2 is F. R 1 is F and R 2 may be H. R 1 may be methoxy and R 2 may be H. R 1 may be methoxyethoxy and R 2 may be H.

[0092] Sugar surrogates may comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,506). As used here, the term "morpholino" means a sugar surrogate having the following structure: Morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as "modifed morpholinos."

[0093] Sugar surrogates may comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid ("PNA"), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.

[0094] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.2. Certain Modified Nucleobases

[0095] In the invention, modified oligonucleotides comprise one or more nucleosides comprising an unmodified nucleobase, as defined in the claims. In the invention, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase, as defined in the claims. Modified oligonucleotides may comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.

[0096] Modified nucleobases may be selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH 3 ) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443.

[0097] Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003 / 0158403; Manoharan et al., US2003 / 0175906; Dinh et al., U.S. 4,845,205; Spielvogel et al., U.S. 5,130,302; Rogers et al., U.S. 5,134,066; Bischofberger et al., U.S. 5,175,273; Urdea et al., U.S. 5,367,066; Benner et al., U.S. 5,432,272; Matteucci et al., U.S. 5,434,257; Gmeiner et al., U.S. 5,457,187; Cook et al., U.S. 5,459,255; Froehler et al., U.S. 5,484,908; Matteucci et al., U.S. 5,502,177; Hawkins et al., U.S. 5,525,711; Haralambidis et al., U.S. 5,552,540; Cook et al., U.S. 5,587,469; Froehler et al., U.S. 5,594,121; Switzer et al., U.S. 5,596,091; Cook et al., U.S. 5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S. 5,681,941; Cook et al., U.S. 5,811,534; Cook et al., U.S. 5,750,692; Cook et al., U.S. 5,948,903; Cook et al., U.S. 5,587,470; Cook et al., U.S. 5,457,191; Matteucci et al., U.S. 5,763,588; Froehler et al., U.S. 5,830,653; Cook et al., U.S. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. 6,005,096.3. Certain Modified Internucleoside Linkages

[0098] Nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphodiesters, which contain a phosphodiester bond ("P(O 2 )=O") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates ("P(O 2 )=S"), and phosphorodithioates ("HS-P=S"). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (-CH 2 -N(CH 3 )-O-CH 2 -), thiodiester, thionocarbamate (-O-C(=O)(NH)-S-); siloxane (-O-SiH 2 -O-); and N,N'-dimethylhydrazine (-CH 2 -N(CH 3 )-N(CH 3 )-). Modified internucleoside linkages, compared to naturally occurring phosphodiester internucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. Internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

[0099] Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate internucleoside linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate internucleoside linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkage in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate internucleoside linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein "B" indicates a nucleobase: Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

[0100] Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH 2 -N(CH 3 )-O-5'), amide-3 (3'-CH 2 -C(=O)-N(H)-5'), amide-4 (3'-CH 2 -N(H)-C(=O)-5'), formacetal (3'-O-CH 2 -O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH 2 -O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (see for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.B. Certain Motifs

[0101] In the invention, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety, as defined in the claims. In the invention, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase, as defined in the claims. In the invention, modified oligonucleotides comprise one or more modified internucleoside linkage, as defined in the claims. The modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. The patterns of sugar moieties, nucleobases, and internucleoside linkages may be each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and / or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).1. Certain Sugar Motifs

[0102] In the invention, oligonucleotides comprise one or more type of modified sugar and / or unmodified sugar moiety arranged along the oligonucleotide or portion thereof in a defined pattern or sugar motif, as defined in the claims. Such sugar motifs may include but are not limited to any of the sugar modifications discussed herein.

[0103] Modified oligonucleotides may have a gapmer motif, which is defined by two external regions or "wings" and a central or internal region or "gap." The three regions of a gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing / gap junction). The sugar moieties within the gap may be the same as one another. The gap may include one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. The sugar motifs of the two wings may be the same as one another (symmetric gapmer). The sugar motif of the 5'-wing may differ from the sugar motif of the 3'-wing (asymmetric gapmer).

[0104] The wings of a gapmer may comprise 1-6 nucleosides. Each nucleoside of each wing of a gapmer may comprises a modified sugar moiety. At least one nucleoside of each wing of a gapmer may comprise a modified sugar moiety. At least two nucleosides of each wing of a gapmer may comprise a modified sugar moiety. At least three nucleosides of each wing of a gapmer may comprise a modified sugar moiety. At least four nucleosides of each wing of a gapmer may comprise a modified sugar moiety. At least five nucleosides of each wing of a gapmer may comprise a modified sugar moiety.

[0105] The gap of a gapmer may comprise 7-12 nucleosides. Each nucleoside of the gap of a gapmer may comprise a 2-deoxyribosyl sugar moiety. Each nucleoside of the gap of a gapmer may comprise a 2'-β-D-deoxyribosyl sugar moiety. At least one nucleoside of the gap of a gapmer may comprise a modified sugar moiety. At least one nucleoside of the gap of a gapmer may comprise a 2'-OMe sugar moiety.

[0106] The gapmer may be a deoxy gapmer. The nucleosides on the gap side of each wing / gap junction may comprise 2'- deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing / gap junction may comprise modified sugar moieties. Each nucleoside of the gap may comprise a 2-deoxyribosyl sugar moiety. Each nucleoside of each wing of a gapmer may comprise a modified sugar moiety. One nucleoside of the gap may comprise a modified sugar moiety and each remaining nucleoside of the gap may comprise a 2-deoxyribosyl sugar moiety.

[0107] Modified oligonucleotides may comprise or consist of a portion having a fully modified sugar motif. Each nucleoside of the fully modified portion of the modified oligonucleotide may comprise a modified sugar moiety. Each nucleoside of the entire modified oligonucleotide may comprise a modified sugar moiety. Modified oligonucleotides may comprise or consist of a portion having a fully modified sugar motif, wherein each nucleoside within the fully modified portion may comprise the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. A fully modified oligonucleotide may be a uniformly modified oligonucleotide. Each nucleoside of a uniformly modified oligonucleotide may comprise the same 2'-modification.

[0108] Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5'-wing] - [# of nucleosides in the gap] - [# of nucleosides in the 3'-wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprises a 2'- β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2'-MOE nucleosides in the 5'-wing, 10 linked 2'- β-D-deoxynucleosides in the gap, and 5 linked 2'-MOE nucleosides in the 3'-wing. A 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5'-wing, 10 linked 2'- β-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3'-wing. A 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5'-wing, 8 linked 2'-deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3'-wing. A mixed wing gapmer has at least two different modified sugars in the 5' and / or 3' wing. A 5-8-5 or 5-8-4 mixed wing gapmer has at least two different modified sugar moieties in the 5'- and / or the 3'-wing.

[0109] Modified oligonucleotides may be 5-10-5 MOE gapmers. Modified oligonucleotides may be 4-10-6 MOE gapmers. Modified oligonucleotides may be 6-10-4 MOE gapmers. Modified oligonucleotides may be 5-8-5 MOE gapmers. Modified oligonucleotides are X-Y-Z MOE gapmers, wherein X and Z may be independently selected from 1, 2, 3, 4, 5, or 6 and Y is 7, 8, 9, 10, or 11.

[0110] Modified oligonucleotides may have the following sugar motif (5' to 3'): meeemddddddddddmmmmm, wherein 'd' represents a 2'-deoxyribosyl sugar moiety, 'e' represents a 2'-MOE sugar moiety, and 'm' represents a 2'-OMe sugar moiety.2. Certain Nucleobase Motifs

[0111] In the invention, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or portion thereof in a defined pattern or motif, as defined in the claims. Each nucleobase may be modified. None of the nucleobases may be modified. Each purine or each pyrimidine may be modified. Each adenine may be modified. Each guanine may be modified. Each thymine may be modified. Each uracil may be modified. Each cytosine may be modified. Some or all of the cytosine nucleobases in a modified oligonucleotide may be 5-methyl cytosines. All of the cytosine nucleobases may be 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide may be unmodified nucleobases.

[0112] Modified oligonucleotides may comprise a block of modified nucleobases. The block may be at the 3'-end of the oligonucleotide. The block may be within 3 nucleosides of the 3'-end of the oligonucleotide. The block may be at the 5'-end of the oligonucleotide. The block may be within 3 nucleosides of the 5'-end of the oligonucleotide.

[0113] Oligonucleotides having a gapmer motif may comprise a nucleoside comprising a modified nucleobase. One nucleoside comprising a modified nucleobase may be in the central gap of an oligonucleotide having a gapmer motif. The sugar moiety of the nucleoside may be a 2'-deoxyribosyl sugar moiety. The modified nucleobase may be selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.3. Certain Internucleoside Linkage Motifs

[0114] In the invention, oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif, as defined in the claims. Each internucleoside linking group may be a phosphodiester internucleoside linkage (P=O). Each internucleoside linking group of a modified oligonucleotide may be a phosphorothioate internucleoside linkage (P=S). Each internucleoside linkage of a modified oligonucleotide may independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. Each phosphorothioate internucleoside linkage may be independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. The sugar motif of a modified oligonucleotide may be a gapmer and the internucleoside linkages within the gap may be all modified. Some or all of the internucleoside linkages in the wings may be unmodified phosphodiester internucleoside linkages. The terminal internucleoside linkages may be modified. The sugar motif of a modified oligonucleotide may be a gapmer, and the internucleoside linkage motif may comprise at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester internucleoside linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. All of the phosphorothioate internucleoside linkages may be stereorandom. All of the phosphorothioate internucleoside linkages in the wings may be (Sp) phosphorothioates, and the gap may comprise at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides may be enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

[0115] Modified oligonucleotides may have an internucleoside linkage motif of sooosssssssssssooss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Modified oligonucleotides may have an internucleoside linkage motif of (5' to 3'): sooooossssssssssoss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Modified oligonucleotides may have an internucleoside linkage motif of (5' to 3'): soooossssssssssooss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Modified oligonucleotides may have an internucleoside linkage motif of (5' to 3'):sooosssssssssooss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Modified oligonucleotides may have an internucleoside linkage motif of (5' to 3'): sooossssssssssoooss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5' to 3'): sooosssssssssssssss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.C. Certain Lengths

[0116] It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target nucleic acid in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target nucleic acid, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.

[0117] Oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. Oligonucleotides may consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. X and Y may be each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤Y. For example, oligonucleotides may consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.D. Certain Modified Oligonucleotides

[0118] In the invention, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide, as defined in the claims. Modified oligonucleotides may be characterized by their modification motifs and overall lengths. Such parameters may be each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.E. Certain Populations of Modified Oligonucleotides

[0119] Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. The modified oligonucleotides of a chirally enriched population may be enriched for β-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages may be stereorandom. The modified oligonucleotides of a chirally enriched population may be enriched for both β-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.F. Nucleobase Sequence

[0120] Oligonucleotides (unmodified or modified oligonucleotides) may be further described by their nucleobase sequence. Oligonucleotides may have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. A portion of an oligonucleotide may have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. The nucleobase sequence of a portion or entire length of an oligonucleotide may be at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.II. Certain Oligomeric Compounds

[0121] Provided herein are oligomeric compounds, which consist of an oligonucleotide (modified) and optionally one or more conjugate groups and / or terminal groups, as defined in the claims. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and / or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3' and / or 5'-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3'-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3'-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5'-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5'-end of oligonucleotides.

[0122] Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, abasic nucleosides, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.A. Certain Conjugate Groups

[0123] In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014 / 179620).

[0124] In certain embodiments, conjugate groups may be selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0125] In certain embodiments, conjugate groups may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, where the alkyl chain has one or more unsaturated bonds.1. Conjugate Moieties

[0126] Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0127] In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.2. Conjugate Linkers

[0128] Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

[0129] In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0130] In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides disclosed herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0131] Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C 1 -C 10 alkyl, substituted or unsubstituted C 2 -C 10 alkenyl or substituted or unsubstituted C 2 -C 10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0132] In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0133] Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

[0134] In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

[0135] In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate or phosphodiester internucleoside linkage between an oligonucleotide and a conjugate moiety or conjugate group.

[0136] In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and / or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphodiester internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate internucleoside linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.3. Cell-Targeting Moieties

[0137] In certain embodiments, a conjugate group comprises a cell-targeting moiety. In certain embodiments, a conjugate group has the general formula: wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

[0138] In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

[0139] In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.B. Certain Terminal Groups

[0140] In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to 5'-phosphonates, including, but not limited to 5'-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleoside is an abasic nucleoside.III. Oligomeric Duplexes

[0141] Oligomeric compounds described herein may comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes comprise a first oligomeric compound having a portion complementary to a target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group. The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.IV. Antisense Activity

[0142] Oligomeric compounds and oligomeric duplexes may be capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.

[0143] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. Described herein are antisense compounds that are sufficiently "DNA-like" to elicit RNase H activity. One or more non-DNA-like nucleoside in the gap of a gapmer may be tolerated.

[0144] In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

[0145] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

[0146] Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and / or a phenotypic change in a cell or subject.V. Certain Target Nucleic Acids

[0147] Oligomeric compounds may comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target nucleic acid is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. The target region may be entirely within an intron. The target region may span an intron / exon junction. The target region may be at least 50% within an intron.A. Complementarity / Mismatches to the Target Nucleic Acid

[0148] It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and a 28- and 42-nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.

[0149] Oligonucleotides may be complementary to the target nucleic acid over the entire length of the oligonucleotide. Oligonucleotides may be 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. Oligonucleotides may be at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a portion that is 100% or fully complementary to a target nucleic acid. The portion of full complementarity may be 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases in length.

[0150] Oligonucleotides may comprise one or more mismatched nucleobases relative to the target nucleic acid. Antisense activity against the target may be reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, selectivity of the oligonucleotide may be improved. The mismatch may be specifically positioned within an oligonucleotide having a gapmer motif. The mismatch may be at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5'-end of the gap region. The mismatch may be at position 1, 2, 3, 4, 5, or 6 from the 5'-end of the 5' wing region or the 3' wing region.B. GFAP

[0151] In the invention, oligomeric compounds comprise or consist of an oligonucleotide that is complementary to a target nucleic acid, as defined in the claims, wherein the target nucleic acid is a GFAP nucleic acid. GFAP nucleic acid may have the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_002055.4), SEQ ID NO: 2 (GENBANK Accession No. NC_000017.11 truncated from nucleotides 44903001 to 44919000), or SEQ ID NO: 3 (GENBANK Accession No. NM_001131019.2).

[0152] In certain embodiments, contacting a cell with an oligomeric compound complementary to any of SEQ ID NO: 1-3 reduces the amount of GFAP RNA and in certain embodiments reduces the amount of GFAP protein. In the invention, the oligomeric compound consists of a modified oligonucleotide, as defined in the claims. In certain embodiments, contacting a cell with an oligomeric compound, as defined in the claims, complementary to any of SEQ ID NO: 1-3 reduces the amount of GFAP RNA in a cell, and in certain embodiments reduces the amount of GFAP protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell in a subject with an oligomeric compound, as defined in the claims, complementary to any of SEQ ID NO: 1-3 ameliorates one or more symptom or hallmark of a leukodystrophy. In certain embodiments, the leukodystrophy is AxD. In certain embodiments, the symptom or hallmark is selected from motor delays, cognitive delays, paroxysmal deterioration, seizures, vomiting, swallowing difficulties, ataxic gait, palatal myoclonus, autonomic dysfunction, and presence of intra-astrocytic inclusions called Rosenthal fibers.

[0153] In certain embodiments, an oligomeric compound, as deifned in the claims, complementary to any of SEQ ID NO: 1-3 is capable of reducing the detectable amount of GFAP RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard cell assay. In certain embodiments, an oligomeric compound, as defined in the claims, complementary to SEQ ID NO: 1, SEQ ID NO: 2915, or SEQ ID NO: 2916 is capable of decreasing the amount of GFAP in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vitro assay. In certain embodiments, an oligomeric compound, as defined in the claims, complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 is capable of reducing the detectable amount of GFAP RNA in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound, as defined in the claims, complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 is capable of decreasing the detectable amount of GFAP in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.C. Certain Target Nucleic Acids in Certain Tissues

[0154] In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a portion that is complementary to a target nucleic acid, as defined in the claims, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissues are the cells and tissues that comprise the central nervous system (CNS). Such tissues include the brain and spinal cord. In certain embodiments, the pharmacologically relevant tissues include white matter tracts across the brain and spinal cord, such tissues include the corpus callosum, cortex, cerebellum, hippocampus, brain stem, striatum, and spinal cord. In certain embodiments, the pharmacologically relevant tissues include the cortex, cerebellum, hippocampus, brain stem, and spinal cord. In certain embodiments, the pharmacologically relevant cells are oligodendrocytes and oligodendrocyte progenitor cells. In certain embodiments, the pharmacologically relevant cells are Schwann cells or Schwann cell progenitors.VI. Certain Pharmaceutical Compositions

[0155] Provided herein are pharmaceutical compositions comprising one or more oligomeric compounds, as defined in the claims. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0156] In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0157] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

[0158] In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0159] In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.

[0160] Lipid moieties have been used in nucleic acid therapies for use in a variety of methods. In certain such uses in methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain uses in methods, DNA complexes with mono- or polycationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.

[0161] In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

[0162] In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents comprising an oligomeric compound disclosed herein to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

[0163] In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80 ™< and 65% w / v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80 ™< ; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

[0164] In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneural, perineural, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0165] Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term "oligonucleotide" is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term "or salt thereof" expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with a cation. In certain instances, one or more specific cation is identified.

[0166] In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve a desired pH.

[0167] Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid. For example, where a modified oligonucleotide or an oligomeric compound is in solution comprising sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with Na+ ions. However, the mass of the protons are nevertheless counted toward the weight of the dose, and the mass of the Na+ ions are not counted toward the weight of the dose. Thus, for example, a dose, or dosage unit, of 10 mg of Compound No. 1362458, equals the number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.47 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1362458. When an oligomeric compound comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.VII. Certain Compositions 1. Compound No. 1166998

[0168] In certain embodiments, Compound No. 1166998 is characterized as a 6-10-4 MOE gapmer having a sequence (from 5' to 3') of CAGTATTACCTCTACTAGTC (SEQ ID NO: 20), wherein each of nucleosides 1-6 and 17-20 (from 5' to 3') are 2'-β-D-MOE nucleosides and each of nucleosides 7-16 are 2'-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.

[0169] In certain embodiments, Compound No. 1166998 is represented by the following chemical notation: m< C es A eo G eo T eo A eo T eo T ds A ds m< C ds m< C ds T ds m< C ds T ds A ds m< C ds T ds A eo G es T es m< C e (SEQ ID NO: 20), wherein: A = an adenine nucleobase, m< C = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2'-β-D-MOE sugar moiety, d = a 2'-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.

[0170] In certain embodiments, Compound No. 1166998 is represented by the following chemical structure:

[0171] In certain embodiments, the sodium salt of Compound No. 1166998 is represented by the following chemical structure: 2. Compound No. 1166985

[0172] Compound No. 1166985 may be characterized as a 6-10-4 MOE gapmer having a sequence (from 5' to 3') of CACATTCACTAATATTTAAC (SEQ ID NO: 21), wherein each of nucleosides 1-6 and 17-20 (from 5' to 3') are 2'-β-D-MOE nucleosides and each of nucleosides 7-16 are 2'-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.

[0173] Compound No. 1166985 may be represented by the following chemical notation: m< C es A eo m< C eo A eo T eo T eo m< C ds A ds m< c ds T ds A ds A ds T ds A ds T ds T ds T eo A es A es m< C e (SEQ ID NO: 21), wherein: A = an adenine nucleobase, m< C = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2'- β-D-MOE sugar moiety, d = a 2'-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.

[0174] Compound No. 1166985 may be represented by the following chemical structure:

[0175] The sodium salt of Compound No. 1166985 may be represented by the following chemical structure: 3. Compound No. 1166954

[0176] Compound No. 1166954 may be characterized as a 5-10-5 MOE gapmer having a sequence (from 5' to 3') of CCAGTGTCTTCACTTTGCTC (SEQ ID NO: 825), wherein each of nucleosides 1-5 and 16-20 (from 5' to 3') are 2'-β-D-MOE nucleosides and each of nucleosides 6-15 are 2'-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.

[0177] Compound No. 1166954 may be represented by the following chemical notation: m< C es m< C eo A eo G eo T eo G ds T ds m< C ds T ds T ds m< C ds A ds m< C ds T ds T ds T eo G eo m< C es T es m< C e (SEQ ID NO: 825), wherein: A = an adenine nucleobase, m< C = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2'- β-D-MOE sugar moiety, d = a 2'-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.

[0178] Compound No. 1166954 may be represented by the following chemical structure:

[0179] The sodium salt of Compound No. 1166954 may be represented by the following chemical structure: 4. Compound No. 1072813

[0180] Compound No. 1072813 may be characterized as a 5-10-5 MOE gapmer having a sequence (from 5' to 3') of GCAACAGTTTCCATAACAAC (SEQ ID NO: 1499), wherein each of nucleosides 1-5 and 16-20 (from 5' to 3') are 2'-β-D-MOE nucleosides and each of nucleosides 6-15 are 2'-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.

[0181] Compound No. 1072813 may be represented by the following chemical notation: G es m< C eo A eo A eo m< C es A ds G ds T ds T ds T ds m< C ds m< C ds A ds T ds A ds A eo m< C eo A es A es m< C e (SEQ ID NO: 1499), wherein: A = an adenine nucleobase, m< C = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2'- β-D-MOE sugar moiety, d = a 2'-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.

[0182] Compound No. 1072813 may be represented by the following chemical structure:

[0183] The sodium salt of Compound No. 1072813 may be represented by the following chemical structure: 5. Compound No. 1199983

[0184] Compound No. 1199983 may characterized as a 5-10-5 MOE gapmer having a sequence (from 5' to 3') of TGGTCCTAAATATTCTAGTC (SEQ ID NO: 2170), wherein each of nucleosides 1-5 and 16-20 (from 5' to 3') are 2'-β-D-MOE nucleosides and each of nucleosides 6-15 are 2'-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.

[0185] Compound No. 1199983 may be represented by the following chemical notation: T es G eo G eo T eo m< C eo m< C ds T ds A ds A ds A ds T ds A ds T ds T ds m< C ds T eo A eo G es T es m< C e (SEQ ID NO: 2170), wherein: A = an adenine nucleobase, m< C = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2'- β-D-MOE sugar moiety, d = a 2'-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.

[0186] Compound No. 1199983 may be represented by the following chemical structure:

[0187] The sodium salt of Compound No. 1199983 may be represented by the following chemical structure: 6. Compound No. 1166721

[0188] Compound No. 1166721 may be characterized as a 5-8-5 MOE gapmer having a sequence (from 5' to 3') of TGGTCCTAAATATTCTAGTC (SEQ ID NO: 2818), wherein each of nucleosides 1-5 and 14-18 (from 5' to 3') are 2'-β-D-MOE nucleosides and each of nucleosides 6-15 are 2'-β-D-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 14 to 15 and 15 to 16 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 16 to 17, and 17 to 18 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methyl cytosine.

[0189] Compound No. 1166721 may be represented by the following chemical notation: T es G eo G eo m< C eo A es G ds T ds A ds T ds T ds A ds m< C ds m< C ds T eo m< C eo T es A es m< C e (SEQ ID NO: 2818), wherein: A = an adenine nucleobase, m< C = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2'- β-D-MOE sugar moiety, d = a 2'-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.

[0190] Compound No. 1166721 may be represented by the following chemical structure:

[0191] The sodium salt of Compound No. 1166721 may be represented by the following chemical structure: VIII. Certain Hotspot Regions

[0192] Nucleobases in the ranges specified below comprise a hotspot region of GFAP nucleic acid. Modified oligonucleotides that are complementary to a hotspot region of GFAP nucleic acid may achieve an average of more than 50% reduction of GFAP RNA in vitro in the standard cell assay. Modified oligonucleotides that are complementary to a hotspot region of GFAP nucleic acid may achieve an average of 75% or greater reduction of GFAP RNA in vivo in the standard in vivo assay.1. Nucleobases 9324-9348 of SEQ ID NO: 2

[0193] Nucleobases 9324-9348 of SEQ ID NO: 2 comprises a hotspot region. Modified oligonucleotides may be complementary to a portion of nucleobases 9324-9348 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. Modified oligonucleotides may be 18 nucleobases in length. Modified oligonucleotides may be gapmers. The gapmers may be MOE gapmers. The internucleoside linkages of the modified oligonucleotides may be phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. The phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages may be arranged in order from 5' to 3': Modified nucleotides may have an internucleoside linkage motif of sooosssssssssssooss, sooooossssssssssoss, soooossssssssssooss, sooosssssssssooss, or sooossssssssssoooss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0194] The nucleobase sequences of SEQ ID Nos: 21, 1177, 2321, 2398, 2808-2809, 2840-2842, and 2853-2854 are complementary to a portion of nucleobases 9324-9348 of SEQ ID NO: 2.

[0195] The nucleobase sequence of Compound Nos.: 1048181-1048182, 1104071-1104072, 1166746-1166748, 1166803-1166808, 1166894-1166899, 1166985-1166990, 1174016, and 1174018 are complementary to a portion of nucleobases 9324-9348 of SEQ ID NO: 2.

[0196] Modified oligonucleotides complementary to a portion of nucleobases 9324-9348 of SEQ ID NO: 2 may achieve at least 7% reduction of GFAP RNA in vitro in the standard cell assay. Modified oligonucleotides complementary to a portion of nucleobases 9324-9348 of SEQ ID NO: 2 may achieve an average of 42% reduction of GFAP RNA in vitro in the standard cell assay. Modified oligonucleotides complementary to a portion of nucleobases 9324-9348 of SEQ ID NO: 2 may achieve an average of 81% reduction of GFAP RNA in vivo in the standard in vivo assay.2. Nucleobases 9459-9480 of SEQ ID NO: 2

[0197] Nucleobases 9459-9480 of SEQ ID NO: 2 comprises a hotspot region. Modified oligonucleotides may be complementary to a portion of nucleobases 9459-9480 of SEQ ID NO: 2. Modified oligonucleotides may be 20 nucleobases in length. Modified oligonucleotides may be 18 nucleobases in length. Modified oligonucleotides may be gapmers. The gapmers may be MOE gapmers. The internucleoside linkages of the modified oligonucleotides may be phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. The phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages may be arranged in order from 5' to 3': Modified nucleotides may have an internucleoside linkage motif of sooosssssssssssooss or soooossssssssssooss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0198] The nucleobase sequences of SEQ ID Nos: 555, 2093, 2170, and 2813 are complementary to a portion of nucleobases 9459-9480 of SEQ ID NO: 2.

[0199] The nucleobase sequence of Compound Nos.: 1048190, 1104116-1104117, and 1199982-1199984 are complementary to a portion of nucleobases 9459-9480 of SEQ ID NO: 2.

[0200] Modified oligonucleotides complementary to a portion of nucleobases 9459-9480 of SEQ ID NO: 2 may achieve at least 26% reduction of GFAP RNA in vitro in the standard cell assay. Modified oligonucleotides complementary to a portion of nucleobases 9459-9480 of SEQ ID NO: 2 may achieve an average of 42% reduction of GFAP RNA in vitro in the standard cell assay. Modified oligonucleotides complementary to a portion of nucleobases 9459-9480 of SEQ ID NO: 2 may achieve an average of 91% reduction of GFAP RNA in vivo in the standard in vivo assay.3. Nucleobases 9530-9580 of SEQ ID NO: 2

[0201] Nucleobases 9530-9580 of SEQ ID NO: 2 comprises a hotspot region. Modified oligonucleotides may be complementary to a portion of nucleobases 9530-9580 of SEQ ID NO: 2. Modified oligonucleotides may be 20 nucleobases in length. Modified oligonucleotides may be 18 nucleobases in length. Modified oligonucleotides may be gapmers. The gapmers may be MOE gapmers. The internucleoside linkages of the modified oligonucleotides may be phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. The phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages may be arranged in order from 5' to 3': Modified nucleotides may have an internucleoside linkage motif of sooosssssssssssooss, sooooossssssssssoss, soooossssssssssooss, sooosssssssssooss, or sooossssssssssoooss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0202] The nucleobase sequences of SEQ ID Nos.: 20, 88, 166, 1331, 1408, 1485, 1637, 1713, 1714, 1789, 1790, 1637, 1638, 1865, 1866, 1941, 2018, 2095, 2172, 2249, 2326, 2403, 2480, 2557, 2633, 2709, 2785, 2816-2818, 2859, 2861, and 2886-2887 are complementary to a portion of nucleobases 9530-9580 of SEQ ID NO: 2.

[0203] The nucleobase sequence of Compound Nos.: 1048200-1048201, 1073062-1073064, 1104142-1104161, 1166719-1166721, 1166816-1166823, 1166826, 1166907-1166920, 1166998-1167011, 1174024, 1174026, and 1174029-1174030 are complementary to a portion of nucleobases 9530-9580 of SEQ ID NO: 2.

[0204] Modified oligonucleotides complementary to a portion of nucleobases 9530-9580 of SEQ ID NO: 2 may achieve at least 27% reduction of GFAP RNA in vitro in the standard cell assay. Modified oligonucleotides complementary to a portion of nucleobases 9530-9580 of SEQ ID NO: 2 may achieve an average of 52% reduction of GFAP RNA in vitro in the standard cell assay. Modified oligonucleotides complementary to a portion of nucleobases 9530-9580 of SEQ ID NO: 2 may achieve an average of 82% reduction of GFAP RNA in vivo in the standard in vivo assay.4. Nucleobases 12006-12038 of SEQ ID NO: 2

[0205] Nucleobases 12006-12038 of SEQ ID NO: 2 comprises a hotspot region. Modified oligonucleotides may be complementary to a portion of nucleobases 12006-12038 of SEQ ID NO: 2. Modified oligonucleotides may be 20 nucleobases in length. Modified oligonucleotides may be 18 nucleobases in length. Modified oligonucleotides may be gapmers. The gapmers may be MOE gapmers. The internucleoside linkages of the modified oligonucleotides may be phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. The phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages may be arranged in order from 5' to 3': Modified nucleotides may have an internucleoside linkage motif of sooosssssssssssooss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0206] The nucleobase sequences of SEQ ID Nos.: 815, 893, 971, 1049, 1269, 1270, 1346, 1423, 1499, 1500, 1660, 1736, 2655, and 2731 are complementary to a portion of nucleobases 12006-12038 of SEQ ID NO: 2.

[0207] The nucleobase sequence of Compound Nos.: 1047362-1047365, 1072813-1072818, and 1103276-1103279 are complementary to a portion of nucleobases 12006-12038 of SEQ ID NO: 2.

[0208] Modified oligonucleotides complementary to a portion of nucleobases 12006-12038 of SEQ ID NO: 2 may achieve at least 29% reduction of GFAP RNA in vitro in the standard cell assay. Modified oligonucleotides complementary to a portion of nucleobases 12006-12038 of SEQ ID NO: 2 may achieve an average of 52% reduction of GFAP RNA in vitro in the standard cell assay. Modified oligonucleotides complementary to a portion of nucleobases 12006-12038 of SEQ ID NO: 2 may achieve an average of 82% reduction of GFAP RNA in vivo in the standard in vivo assay.5. Nucleobases 13038-13058 of SEQ ID NO: 2

[0209] Nucleobases 13038-13058 of SEQ ID NO: 2 comprises a hotspot region. Modified oligonucleotides may be complementary to a portion of nucleobases 13038-13058 of SEQ ID NO: 2. Modified oligonucleotides may be 20 nucleobases in length. Modified oligonucleotides may be 18 nucleobases in length. Modified oligonucleotides may be gapmers. The gapmers may be MOE gapmers. The internucleoside linkages of the modified oligonucleotides may be phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. The phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages may be arranged in order from 5' to 3': Modified nucleotides may have an internucleoside linkage motif of sooosssssssssssooss, sooooossssssssssoss, or soooossssssssssooss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0210] The nucleobase sequences of SEQ ID Nos.: 825 and 1973 are complementary to a portion of nucleobases 13038-13058 of SEQ ID NO: 2.

[0211] The nucleobase sequence of Compound Nos.: 1047522, 1166954, and 1167046 are complementary to a portion of nucleobases 13038-13058 of SEQ ID NO: 2.

[0212] Modified oligonucleotides complementary to a portion of nucleobases 13038-13058 of SEQ ID NO: 2 may achieve at least 27% reduction of GFAP RNA in vitro in the standard cell assay. Modified oligonucleotides complementary to a portion of nucleobases 13038-13058 of SEQ ID NO: 2 may achieve an average of 41% reduction of GFAP RNA in vitro in the standard cell assay Modified oligonucleotides complementary to a portion of nucleobases 13038-13058 of SEQ ID NO: 2 may achieve an average of 84% reduction of GFAP RNA in vivo in the standard in vivo assay.6. Additional Hotspot Regions

[0213] The ranges described in the Table below comprise hotspot regions. Each hotspot region begins with the nucleobase of SEQ ID NO: 2 identified in the "Start Site SEQ ID NO: 2" column and ends with the nucleobase of SEQ ID NO: 2 identified in the "Stop Site SEQ ID NO: 2" column. Modified oligonucleotides may be complementary within any of the hotspot regions 1-14, as defined in the table below. Modified oligonucleotides may be 18 nucleobases in length. Modified oligonucleotides may be 20 nucleobases in length. Modified oligonucleotides may be gapmers. Modified oligonucleotides may be 5-8-5, 5-10-3, 4-10-6, 6-10-4, or 5-10-5 MOE gapmers.

[0214] The nucleobase sequence of compounds listed in the "Compound No. in range" column in the table below are complementary to SEQ ID NO: 2 within the specified hotspot region. The nucleobase sequence of the oligonucleotides listed in the "SEQ ID NO: in range" column in the table below are complementary to the target sequence, SEQ ID NO: 2, within the specified hotspot region.

[0215] Modified oligonucleotides complementary to nucleobases within the hotspot region may achieve at least "Min.% Red. in vitro" (minimum % reduction, relative to untreated control cells) of GFAP RNA in vitro in the standard cell assay, as indicated in the table below. Modified oligonucleotides complementary to nucleobases within the hotspot region may achieve an average of "Avg.% Red. in vitro" (average % reduction, relative to untreated control cells) of GFAP RNA in vitro in the standard cell assay, as indicated in the table belowModified oligonucleotides complementary to nucleobases within the hotspot region may achieve a maximum of "Max. % Red. in vitro" (maximum % reduction, relative to untreated control cells) of GFAP RNA in vitro in the standard cell assay, as indicated in the table below. Modified oligonucleotides complementary to nucleobases within the hotspot region may achieve an average of "Avg. % Red. in vivo" (average % reduction, relative to PBS-treated animals) of GFAP RNA in vivo in the standard in vivo assay, as indicated in the table below. Table 1 GFAP Hotspots Hots pot IDStart Site SEQ ID NO: 2Start Site SEQ ID NO: 2Min. % Red. in vitroMax. % Red. In vitroAvg. % Red. in vitroAvg. % Red. in vivoCompound No. in RangeSEQ ID NOs : in Range19324934877842811048181-1048182, 1104071-1104072, 1166746-1166748, 1166803-1166808, 1166894-1166899, 1166985-1166990, 1174016, 117401821, 1177, 2321, 2398, 2808-2809, 2840-2842, 2853-2854294599480266542911048190, 1104116-1104117, 1199982-1199984555, 2093, 2170, 2813395309580188252821048199-1048201, 1073062-1073064, 1104142-1104161, 1166719-1166721, 1166816-1166823, 1166826, 1166907-1166920, 1166998-1167011, 1174024, 1174026, 1174029-117403020, 88, 166, 1331, 1408, 1485, 1637, 1713, 1714, 1789, 1790, 1637, 1638, 1865, 1866, 1941, 2018, 2095, 2172, 2249, 2326, 2403, 2480, 2557, 2633, 2709, 2785, 2816-2818, 2859, 2861, 2886-288741200612038297552821047362-1047365, 1072813-1072818, 1103276-1103279815, 893, 971, 1049, 1269, 1270, 1346, 1423, 1499, 1500, 1660, 1736, 2655, 273151303813058275641841047522, 1166954, 1167046825, 1973685308557147952891047706-1047708, 1103567-1103571213, 291, 369, 1601, 1753, 1829, 1905, 1982787318754446453881047733-1047735, 1103591, 1103592, 1174050, 1174051, 1174056, 1174058, 1174062, 11740631072, 1149, 1227, 2291, 2368887498807259252751047601-1047610, 1072854-1072868, 1103462-1103472, 1166738-1166740, 1166742, 1166744, 1166793-1166795, 1166798-1166800, 1166885-1166890, 1166975, 1166982, 1174012-117401351, 129, 207, 752, 830, 908, 986, 1064, 1141, 1219, 1279, 1280-1282, 1356-1359, 1433-1436, 1510-1512, 1595, 1671, 1747, 2206, 2283, 2360, 2437, 2514, 2590, 2666, 2742, 2835-2837, 2839, 2850-2851, 2866995119536329055861048197, 1073060, 1104129-1104133, 1166749-1166751, 1166809-1166810, 1166812-1166813, 1166900-1166903, 1166991-1166994, 11740201100, 1484, 1864, 1940, 2017, 2094, 2171, 2819-2821, 28561095659602207553821048202-1048204, 1073065, 1104165-1104179, 1166757-1166760, 1166831, 1166835, 1166926-1166929, 1167012, 1167017, 1167018, 1174031, 1174034244, 322, 400, 1562, 1639, 1715, 1791, 1867, 1943, 2020, 2173, 2250, 2327, 2404, 2481, 2558, 2634, 2710, 2786, 2873-2876, 2888, 2891111115511184378269851073093-1073095, 1104307-1104312, 1167024-1167027, 1166761-1166763, 1166842-1166843, 1166845-1166847, 1166933-1166934, 1167024-1167027, 11740371339, 1569, 2028, 2105, 2182, 2259, 2336, 2413, 2822-2824, 2863121204412067496758851047372-1047374, 1072824-1072825, 1166852, 1167033-1167036348, 426, 504, 1425, 1502131208012108458868791047384-1047388, 1072834-1072835,1103284-1103285, 1166948, 116704037, 115, 193, 271, 349, 1274, 1351, 2041, 2118141333313367539375891047579-104592, 1072849-1072850, 1166775-1166787, 1166867, 1166869-1166875, 1166877-1166878, 1167050-1167051, 1167053-116706050, 283, 361, 439, 517, 595, 673, 751, 829, 907, 985, 1063, 1140, 1218, 1278, 1508, 2825-2833, 2843-2846 Nonlimiting disclosure

[0216] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same.

[0217] Although the sequence listing accompanying this filing identifies each sequence as either "RNA" or "DNA" as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2'-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar moiety (2'-OH in place of one 2'-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of a uracil of RNA). Accordingly, nucleic acid sequences disclosed herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence "AUCGAUCG" and those having some DNA bases and some RNA bases such as "AUCGATCG" and oligomeric compounds having other modified nucleobases, such as "AT m< CGAUCG," wherein m< C indicates a cytosine base comprising a methyl group at the 5-position.

[0218] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as α or β such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds disclosed herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds disclosed herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, all cis- and trans-isomers and tautomeric forms of the compounds herein are also included unless otherwise indicated. Oligomeric compounds described herein include chirally pure or enriched mixtures as well as racemic mixtures. For example, oligomeric compounds having a plurality of phosphorothioate internucleoside linkages include such compounds in which chirality of the phosphorothioate internucleoside linkages is controlled or is random. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

[0219] The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1< H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2< H or 3< H in place of 1< H, 13< C or 14< C in place of 12< C, 15< N in place of 14< N, 17< O or 18< O in place of 16< O, and 33< S, 34< S, 35< S, or 36< S in place of 32< S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.EXAMPLES

[0220] The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are disclosed, the inventors have contemplated generic application of those specific embodiments.Example 1: Effect of 5-10-5 MOE gapmer modified oligonucleotides on human GFAP RNA in vitro, single dose

[0221] Modified oligonucleotides complementary to human GFAP nucleic acid were designed and tested for their single dose effects on GFAP RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

[0222] The modified oligonucleotides in the tables below are 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages. The gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2'-β-D-deoxynucleosides and the 5' and 3' wing segments each consists of five 2'-MOE modified nucleosides. The sugar motif for the gapmers is (from 5' to 3'): eeeeeddddddddddeeeee; wherein 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, and 'e' represents a 2'-MOE sugar moiety. The internucleoside linkage motif for the gapmers is (from 5' to 3'): sooosssssssssssooss; wherein each 'o' represents a phosphodiester internucleoside linkage and each 's' represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

[0223] "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the Tables below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NM_002055.4), or SEQ ID NO: 2 (GENBANK Accession No. NC_000017.11 truncated from nucleotides 44903001 to 44919000). 'N / A' indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0224] Cultured U251 cells were treated with modified oligonucleotide at a concentration of 4,000nM using free uptake at a density of 10,000 cells per well. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and GFAP RNA levels were measured by quantitative real-time RTPCR. GFAP RNA levels were measured by human GFAP primer probe set RTS37485 (forward sequence CTGGAGGTTGAGAGGGACA, designated herein as SEQ ID NO: 11; reverse sequence GCTTCATCTGCTTCCTGTCT, designated herein as SEQ ID NO: 12; probe sequence CTGGAGCTTCTGCCTCACAGTGG, designated herein as SEQ ID NO: 13). GFAP RNA levels were normalized to total RNA content, as measured by RIBOGREEN ®< . Reduction of GFAP RNA is presented in the tables below as percent GFAP RNA amount relative to untreated control cells. Each table represents results from an individual assay plate. The values marked with an asterisk (*) indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region. Table 2 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 1047144173634653484CGAGGGCTTTATGAAGGAGT8022104716013115035793598GCCAGGAGCCAGGCCCCCCA6723104717624826736963715GGCCCGGGTCTCCTTGAAGC10924104719248850739363955GTCCTGTGCCAGATTGTCCC7*251047208579598N / AN / ACATCTGCTTCCTGTCTATAG6*26104722464966852385257CTCAAGAACCGGATCTCCTC10527104724081383256995718ACTCTTCGGCTTCATGCATG692810472561029104876017620GCGCCTCCTGATAACTGGCC80291047272125112701086510884CTTCTGACACAGACTTGGTG92301047288129813171091210931ATCCCGCATCTCCACGGTCT90311047304135113701164011659CTGCCTCACATCACATCCTT87321047320141614351170511724CGGAGCAACTATCCTGCTTC102331047336161716361190611925AAGCTGCTGGCCATGCCCCT87341047352166416831195311972TGCCCCCCGCCCTCCTCCCC83351047368173617551202512044GAGAGAACCTCCATCTCTGG47361047384179118101208012099TCAGTTTTCCTCCAGCAGCC55371047400185418731214312162GACAAAACAAGCCTCTGGCC66381047416203620551232512344CGTCCCCACCCATCTTAGAC60391047432218021991246912488GTGCTGAGAATCAAGCTCCC93401047448223722561252612545CCCCCTCTATCCCTCCCAGC11411047464228022991256912588CTGGGCTTGACCTCTCTGTA63421047480237923981266812687TGGTCACCCACAACCCCTAC81431047496245724761274612765CCCTTTCTCTCCTGTTTCAG79441047512248625051277512794AAGTCATGCCCTGCCCCCAT45451047528278027991306913088GCACCCGGCCTCCAGGCTGC76461047544286128801315013169GGCACAGATCCCACCAGTCT106471047560290329221319213211GAGAGGAGAACCCTGAAGTG72481047576303530541332413343CCTCAGCGACTAAAGGCAGC77491047592305830771334713366GCGCAGCATTTGTCTTTATT47501047608N / AN / A87778796GCTTTTGAGATATCTTGTGA8511047624N / AN / A90319050GTTTAATGTACAGTTACTCT71521047640N / AN / A90709089CCAAGGACTCACCACCTTTA75531047656N / AN / A92029221AGGGATGAAAGAATAAAGCA92541047672N / AN / A83818400CCTGCTGTACTGACCTCGAA94551047688N / AN / A84568475ATCCTCAGTCCCAGTCTGGA54561047704N / AN / A85048523CTGCAGTGTCACGAAGGCCC74571047720N / AN / A86378656TGTCAAGCTCTCACCCAGTT77581047736N / AN / A87378756TTGGTGCTTTTGCCCCCTGT56591047752N / AN / A40934112GGATAGTGCCCCATCAAGAG109601047768N / AN / A42644283AGTCACAAAGCCCAGCCATG95611047784N / AN / A43224341GCTTCCAACTCCTCCTTTAT101621047800N / AN / A43594378CAGAATCCAATCTCCCTCAT106631047816N / AN / A44054424GCTTTGCGCCCAGACCTGCC68641047832N / AN / A45254544ATTCCTCTGATCCCAGGTAA52651047848N / AN / A47044723CCTTAACTCATTACTAAGGT69661047864N / AN / A48064825GAGACCACCCCCACCCAGGA70671047880N / AN / A48684887GTCCAGGCTCTTCTGAGGAC66681047896N / AN / A50075026GTGGCCATCAATCCTTTCCT103691047912N / AN / A51175136CCCCAGGCTCCTTCTCCCCA74701047928N / AN / A53885407TGTCTCTACCTGCCAATCTC100711047944N / AN / A55215540CTCAGGGTACAGGCCACAGC90721047960N / AN / A57915810ACCCTCCTTCCCCCATTCTC94731047976N / AN / A59345953AGCTACTACTAATAATAGCA98741047992N / AN / A60236042ACTTCGGCTCTCTCATCTGT75751048008N / AN / A61466165AACCCAAAACAGACTGGCAG79761048024N / AN / A62816300CCCACACTACATATAAGCTC105771048040N / AN / A63296348CCTGTCCTGCCTAGCCCAAA71781048056N / AN / A64176436GGGCCCTGCCTCTCTGTGCT81791048072N / AN / A65446563ATAGCCCTTTCTCCCCTGCC86801048088N / AN / A69596978AATCCAGAACCTTCCACACT114811048104N / AN / A70737092TGGGACTTTTCCCAACAACT93821048120N / AN / A74127431CGCCCTCGACCCAGGTCCTC57831048136N / AN / A79077926AGTGACTGCCTGCTATGTGT94841048152N / AN / A79898008TTGGAGGGTGACCCAAGTCC81851048168N / AN / A82358254ACGCCCTTTTCCTTGCCAGG74861048184N / AN / A93739392TAGCTCCCCCCTCCCCCCGC52871048200N / AN / A95349553GCAGTATTACCTCTACTAGT45881048216N / AN / A96109629CCTGTCCCCTTTCCTCTTTC74891048232N / AN / A97919810CCACCAACCAGCCACATGAC98901048248N / AN / A98269845ATCAGGAGACCAGAGCTCAA78911048264N / AN / A1062210641GGCCTGGCTTCATTTCAGCC66921048280N / AN / A1073410753AGTATGAGAACCTATGCAAC80931048296N / AN / A1079310812GGGCATGAGCCATCCTCTCC35941048312N / AN / A1094210961GACTGGGCCCAAATCCCTCC87951048328N / AN / A1106311082CCTTGCTCTCCTCCAGAATT67961048344N / AN / A1122711246GCTACTAACTTTAATTCTCT41971048360N / AN / A1132111340CCTCTTCCCATTCCCCTGGT62981048376N / AN / A1148811507GGTCTTACTTTTCTTGATAG7299 Table 3 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 1047145183734663485GCGAGGGCTTTATGAAGGAG99100104716113315235813600CGGCCAGGAGCCAGGCCCCC82101104717726728637153734TCATCTCTGCCCGCTCACTG88102104719349050939383957AGGTCCTGTGCCAGATTGTC8*1031047209585604N / AN / ATGGCTTCATCTGCTTCCTGT5*104104722565167052405259TCCTCAAGAACCGGATCTCC37105104724182184057075726GCGGTACCACTCTTCGGCTT7710610472571051107076237642CCCTCTTCCTCCAGCCGCGC351071047273125212711086610885CCTTCTGACACAGACTTGGT861081047289130513241091910938CCTCTCCATCCCGCATCTCC871091047305135213711164111660CCTGCCTCACATCACATCCT661101047321141714361170611725GCGGAGCAACTATCCTGCTT961111047337163116501192011939CCTCATTCTAACGCAAGCTG581121047353166516841195411973GTGCCCCCCGCCCTCCTCCC461131047369173917581202812047TCCGAGAGAACCTCCATCTC721141047385179218111208112100CTCAGTTTTCCTCCAGCAGC501151047401187618951216512184TCCCACCTCATAAAAACCAA941161047417205920781234812367GGTGACTGCCCCAGGTGGCA681171047433218122001247012489AGTGCTGAGAATCAAGCTCC751181047449223822571252712546CCCCCCTCTATCCCTCCCAG601191047465231023291259912618GTCCCCTCCAGTCTGCACGG491201047481238023991266912688CTGGTCACCCACAACCCCTA821211047497245824771274712766CCCCTTTCTCTCCTGTTTCA291221047513249125101278012799GGACAAAGTCATGCCCTGCC851231047529278128001307013089AGCACCCGGCCTCCAGGCTG861241047545286228811315113170GGGCACAGATCCCACCAGTC651251047561292429431321313232CCCTTCTTCGGCCTTAGAGG621261047577304030591332913348TTTTTCCTCAGCGACTAAAG491271047593306030791334913368GGGCGCAGCATTTGTCTTTA591281047609N / AN / A87788797GGCTTTTGAGATATCTTGTG131291047625N / AN / A90369055TGCCAGTTTAATGTACAGTT721301047641N / AN / A90729091ACCCAAGGACTCACCACCTT891311047657N / AN / A92129231ATGGAGCCTCAGGGATGAAA691321047673N / AN / A83828401CCCTGCTGTACTGACCTCGA911331047689N / AN / A84608479CCTGATCCTCAGTCCCAGTC821341047705N / AN / A85068525CGCTGCAGTGTCACGAAGGC631351047721N / AN / A86438662GGCAGATGTCAAGCTCTCAC831361047737N / AN / A39633982TCCTCACTTCTGCCTCACAG661371047753N / AN / A40954114AAGGATAGTGCCCCATCAAG691381047769N / AN / A42654284CAGTCACAAAGCCCAGCCAT641391047785N / AN / A43244343CCGCTTCCAACTCCTCCTTT491401047801N / AN / A43614380CCCAGAATCCAATCTCCCTC851411047817N / AN / A44194438AGGCAGTCACCTGTGCTTTG961421047833N / AN / A45264545GATTCCTCTGATCCCAGGTA631431047849N / AN / A47054724GCCTTAACTCATTACTAAGG821441047865N / AN / A48074826AGAGACCACCCCCACCCAGG911451047881N / AN / A49104929TGGTTTCATCCTGGAGCCTG601461047897N / AN / A50125031GGTGGGTGGCCATCAATCCT711471047913N / AN / A51685187CATCTGCTTCCTGGAGTGGC311481047929N / AN / A54005419TCTTTCATTTCCTGTCTCTA811491047945N / AN / A55615580CCCGAACCTCCTGACCAGGG1171501047961N / AN / A58005819GCTTCCTCCACCCTCCTTCC751511047977N / AN / A59355954CAGCTACTACTAATAATAGC1041521047993N / AN / A60406059TTAGTTAACCTCTCTGGACT791531048009N / AN / A61476166TAACCCAAAACAGACTGGCA1011541048025N / AN / A62826301TCCCACACTACATATAAGCT831551048041N / AN / A63306349GCCTGTCCTGCCTAGCCCAA801561048057N / AN / A64646483GCCACTCACACTCCTCAGCT791571048073N / AN / A65486567TCTAATAGCCCTTTCTCCCC881581048089N / AN / A69616980AGAATCCAGAACCTTCCACA881591048105N / AN / A70747093CTGGGACTTTTCCCAACAAC861601048121N / AN / A74187437AGGCCCCGCCCTCGACCCAG951611048137N / AN / A79157934AAACATCTAGTGACTGCCTG871621048153N / AN / A80618080AAGGAGGCAGAAGAGATGGG591631048169N / AN / A82868305CTGGGACACCCCTAGGCTGG681641048185N / AN / A93749393TTAGCTCCCCCCTCCCCCCG841651048201N / AN / A95369555TGGCAGTATTACCTCTACTA431661048217N / AN / A96119630TCCTGTCCCCTTTCCTCTTT631671048233N / AN / A97929811GCCACCAACCAGCCACATGA891681048249N / AN / A1000510024CTGTAATCCCCTTACTCGGG941691048265N / AN / A1063610655CTGCTCTGTCTTCTGGCCTG651701048281N / AN / A1073510754GAGTATGAGAACCTATGCAA531711048297N / AN / A1079410813AGGGCATGAGCCATCCTCTC781721048313N / AN / A1094410963CTGACTGGGCCCAAATCCCT951731048329N / AN / A1107411093ACATTCAGTTTCCTTGCTCT891741048345N / AN / A1122811247AGCTACTAACTTTAATTCTC821751048361N / AN / A1133011349GCCAAATCCCCTCTTCCCAT191761048377N / AN / A1149111510CCAGGTCTTACTTTTCTTGA85177 Table 4 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 1047146587735063525CTCCTCTCCATCCTGCTCTG94178104716213815735863605GACGGCGGCCAGGAGCCAGG115179104717827429337223741AGCTCCATCATCTCTGCCCG117180104719449551439433962TGGCCAGGTCCTGTGCCAGA67*181104721058860751775196GGGTGGCTTCATCTGCTTCC18*182104722665667552455264GATCTTCCTCAAGAACCGGA62183104724282284157085727AGCGGTACCACTCTTCGGCT11318410472581052107176247643CCCCTCTTCCTCCAGCCGCG161851047274125312721086710886GCCTTCTGACACAGACTTGG113186104729013091328N / AN / AATGACCTCTCCATCCCGCAT1081871047306135313721164211661TCCTGCCTCACATCACATCC751881047322149915181178811807GCAAGCTGACCTAGGGACAG681891047338163216511192111940TCCTCATTCTAACGCAAGCT681901047354166616851195511974GGTGCCCCCCGCCCTCCTCC901911047370174017591202912048CTCCGAGAGAACCTCCATCT771921047386179318121208212101TCTCAGTTTTCCTCCAGCAG331931047402188819071217712196AGCATAGGGATATCCCACCT631941047418206320821235212371GGCAGGTGACTGCCCCAGGT1061951047434218222011247112490AAGTGCTGAGAATCAAGCTC1031961047450223922581252812547GCCCCCCTCTATCCCTCCCA1031971047466232923481261812637CTCCTCCATCTCTACCAGCG521981047482238124001267012689ACTGGTCACCCACAACCCCT791991047498246124801275012769CATCCCCTTTCTCTCCTGTT742001047514253225511282112840CGGCCTGGTATGACACAGCA912011047530278228011307113090GAGCACCCGGCCTCCAGGCT802021047546286428831315313172CTGGGCACAGATCCCACCAG1072031047562292729461321613235GGACCCTTCTTCGGCCTTAG692041047578304330621333213351TTATTTTTCCTCAGCGACTA752051047594306230811335113370AAGGGCGCAGCATTTGTCTT862061047610N / AN / A87828801GTGAGGCTTTTGAGATATCT332071047626N / AN / A90389057TCTGCCAGTTTAATGTACAG1142081047642N / AN / A90789097CTGCGCACCCAAGGACTCAC962091047658N / AN / A92579276CCTGAGGGAAGAATCCTCTG862101047674N / AN / A83908409CCACGAGGCCCTGCTGTACT1112111047690N / AN / A84618480CCCTGATCCTCAGTCCCAGT822121047706N / AN / A85348553CCCTGGTATGATAGGCTCTG622131047722N / AN / A86458664AGGGCAGATGTCAAGCTCTC1102141047738N / AN / A39683987TCCCCTCCTCACTTCTGCCT912151047754N / AN / A40974116GCAAGGATAGTGCCCCATCA942161047770N / AN / A42684287CCACAGTCACAAAGCCCAGC842171047786N / AN / A43254344TCCGCTTCCAACTCCTCCTT1072181047802N / AN / A43624381CCCCAGAATCCAATCTCCCT842191047818N / AN / A44774496CCACCGCTTCACAGCTGTGC772201047834N / AN / A45284547GGGATTCCTCTGATCCCAGG932211047850N / AN / A47064725TGCCTTAACTCATTACTAAG642221047866N / AN / A48094828ACAGAGACCACCCCCACCCA632231047882N / AN / A49594978CTGACCTGTCTATAGGCAGC89*2241047898N / AN / A50855104GCCTTACCCCTCCTTCTGGG1002251047914N / AN / A52685287TGCCCTGGCCTCACCTCCTC982261047930N / AN / A54015420GTCTTTCATTTCCTGTCTCT552271047946N / AN / A55625581TCCCGAACCTCCTGACCAGG1172281047962N / AN / A58035822CCAGCTTCCTCCACCCTCCT1372291047978N / AN / A59365955TCAGCTACTACTAATAATAG912301047994N / AN / A60776096AACTCTACCACTTAGGAGCT1302311048010N / AN / A61486167GTAACCCAAAACAGACTGGC852321048026N / AN / A62836302CTCCCACACTACATATAAGC822331048042N / AN / A63316350TGCCTGTCCTGCCTAGCCCA722341048058N / AN / A64676486TCTGCCACTCACACTCCTCA952351048074N / AN / A65496568TTCTAATAGCCCTTTCTCCC832361048090N / AN / A69907009TCAGCAAGCGAATGAATGAA1572371048106N / AN / A70757094GCTGGGACTTTTCCCAACAA912381048122N / AN / A74497468AGGCCCCGCCTCTAGCCCGG1102391048138N / AN / A79207939TCATCAAACATCTAGTGACT912401048154N / AN / A81128131TCTATCTGAAGGAAGATGGA902411048170N / AN / A83298348GTGATCCTGAAAGAAAGCAG682421048186N / AN / A93759394TTTAGCTCCCCCCTCCCCCC1262431048202N / AN / A95669585TGCTTTAGTGACCTGTGACT742441048218N / AN / A96149633CTTTCCTGTCCCCTTTCCTC1342451048234N / AN / A97939812AGCCACCAACCAGCCACATG832461048250N / AN / A1000610025CCTGTAATCCCCTTACTCGG922471048266N / AN / A1065210671GCTGCCAGAGTCCTGGCTGC812481048282N / AN / A1074210761CCATCATGAGTATGAGAACC882491048298N / AN / A1081410833GAGGCCTCTCATGGACTTTC842501048314N / AN / A1095310972AGCCAGAGCCTGACTGGGCC802511048330N / AN / A1108011099GGAATTACATTCAGTTTCCT722521048346N / AN / A1126811287CTCCCCATCCCCAACTGTGT1072531048362N / AN / A1133111350CGCCAAATCCCCTCTTCCCA1062541048378N / AN / A1149211511CCCAGGTCTTACTTTTCTTG80255 Table 5 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 1047147618035093528CGTCTCCTCTCCATCCTGCT74256104716313915835873606AGACGGCGGCCAGGAGCCAG100257104717927529437233742GAGCTCCATCATCTCTGCCC116258104719550051939483967CACAGTGGCCAGGTCCTGTG70*259104721158960851785197AGGGTGGCTTCATCTGCTTC37*260104722765767652465265GGATCTTCCTCAAGAACCGG90261104724382384257095728GAGCGGTACCACTCTTCGGC8326210472591054107376267645TGCCCCTCTTCCTCCAGCCG632631047275125412731086810887GGCCTTCTGACACAGACTTG116264104729113111330N / AN / ATAATGACCTCTCCATCCCGC912651047307135413731164311662GTCCTGCCTCACATCACATC882661047323152415431181311832CCTGATACTGACGGAGCCTA562671047339163316521192211941CTCCTCATTCTAACGCAAGC1162681047355166816871195711976TAGGTGCCCCCCGCCCTCCT682691047371175417731204312062ACAGTTCCCAGATACTCCGA802701047387179418131208312102GTCTCAGTTTTCCTCCAGCA122711047403196619851225512274CCAATCTATAATCCCAGCTA892721047419206520841235412373TGGGCAGGTGACTGCCCCAG1102731047435219222111248112500CAGATCCCCCAAGTGCTGAG872741047451224022591252912548AGCCCCCCTCTATCCCTCCC972751047467233523541262412643TGCCTCCTCCTCCATCTCTA722761047483238424031267312692GCAACTGGTCACCCACAACC492771047499246224811275112770ACATCCCCTTTCTCTCCTGT772781047515267526941296412983TTTGTGTGTGAGTAAGAAGG492791047531278528041307413093CCTGAGCACCCGGCCTCCAG802801047547286528841315413173TCTGGGCACAGATCCCACCA852811047563292829471321713236AGGACCCTTCTTCGGCCTTA702821047579304430631333313352TTTATTTTTCCTCAGCGACT472831047611N / AN / A88268845TTCCATTTACAATCTGGTGA932851047627N / AN / A90409059GCTCTGCCAGTTTAATGTAC1282861047643N / AN / A90799098ACTGCGCACCCAAGGACTCA772871047659N / AN / A92839302ACTTTATTCACTGCAAGAGC652881047675N / AN / A83988417TGCCCTTCCCACGAGGCCCT532891047691N / AN / A84628481GCCCTGATCCTCAGTCCCAG922901047707N / AN / A85358554ACCCTGGTATGATAGGCTCT462911047723N / AN / A86628681CTCAGGGATCTGCAGACAGG812921047739N / AN / A39693988ATCCCCTCCTCACTTCTGCC85*2931047755N / AN / A41194138GTCCCTCCCATCATGTTGGG832941047771N / AN / A42704289GCCCACAGTCACAAAGCCCA682951047787N / AN / A43274346TCTCCGCTTCCAACTCCTCC1092961047803N / AN / A43634382ACCCCAGAATCCAATCTCCC812971047819N / AN / A45034522ACCTTTTGAAATGAATTTTA652981047835N / AN / A45884607CTCCTGCACTTGAAGGCACA1012991047851N / AN / A47074726TTGCCTTAACTCATTACTAA773001047867N / AN / A48114830TCACAGAGACCACCCCCACC973011047883N / AN / A49644983CCTCCCTGACCTGTCTATAG103*3021047899N / AN / A50865105TGCCTTACCCCTCCTTCTGG763031047915N / AN / A52705289TCTGCCCTGGCCTCACCTCC1023041047931N / AN / A54035422TTGTCTTTCATTTCCTGTCT673051047947N / AN / A55635582TTCCCGAACCTCCTGACCAG1313061047963N / AN / A58045823CCCAGCTTCCTCCACCCTCC583071047979N / AN / A59375956ATCAGCTACTACTAATAATA1283081047995N / AN / A60786097CAACTCTACCACTTAGGAGC973091048011N / AN / A61506169CAGTAACCCAAAACAGACTG853101048027N / AN / A62846303GCTCCCACACTACATATAAG483111048043N / AN / A63526371CTTCTCTTCCTGTCCACAGC933121048059N / AN / A64716490GGCTTCTGCCACTCACACTC853131048075N / AN / A65506569GTTCTAATAGCCCTTTCTCC1243141048091N / AN / A69917010GTCAGCAAGCGAATGAATGA853151048107N / AN / A71097128CAGCACCCCAGTTAACCCCA733161048123N / AN / A74507469CAGGCCCCGCCTCTAGCCCG883171048139N / AN / A79287947CCATTCAGTCATCAAACATC763181048155N / AN / A81208139GGCGCATGTCTATCTGAAGG763191048171N / AN / A83308349GGTGATCCTGAAAGAAAGCA1033201048187N / AN / A93919410TGCAAGTAAAAAGTAATTTA693211048203N / AN / A95689587TGTGCTTTAGTGACCTGTGA313221048219N / AN / A96199638GGTCCCTTTCCTGTCCCCTT533231048235N / AN / A97949813TAGCCACCAACCAGCCACAT973241048251N / AN / A1000710026ACCTGTAATCCCCTTACTCG893251048267N / AN / A1065710676GTGCTGCTGCCAGAGTCCTG353261048283N / AN / A1075010769CCCCCTCCCCATCATGAGTA1003271048299N / AN / A1084110860GGCTGGTTTCTGCAGATGTG873281048315N / AN / A1095410973CAGCCAGAGCCTGACTGGGC1883291048331N / AN / A1108611105GGAAACGGAATTACATTCAG1303301048347N / AN / A1126911288CCTCCCCATCCCCAACTGTG993311048363N / AN / A1133211351ACGCCAAATCCCCTCTTCCC933321048379N / AN / A1150111520CCCCGACTTCCCAGGTCTTA91333 Table 6 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 104714811213135603579ACCATCATCTCCCCTGAGGA116334104716415016935983617TGCCAGGACCCAGACGGCGG96335104718027729637253744TTGAGCTCCATCATCTCTGC123336104719650352239513970CCTCACAGTGGCCAGGTCCT27*337104721261563452045223TCTTCCTCTCCAGATCCAGA77338104722865867752475266TGGATCTTCCTCAAGAACCG75339104724482484357105729GGAGCGGTACCACTCTTCGG7434010472601058107776307649GCTCTGCCCCTCTTCCTCCA823411047276125512741086910888TGGCCTTCTGACACAGACTT137342104729213121331N / AN / ATTAATGACCTCTCCATCCCG813431047308135613751164511664GGGTCCTGCCTCACATCACA693441047324152615451181511834GGCCTGATACTGACGGAGCC733451047340163416531192311942CCTCCTCATTCTAACGCAAG633461047356167216911196111980GTAGTAGGTGCCCCCCGCCC843471047372175517741204412063CACAGTTCCCAGATACTCCG493481047388179518141208412103AGTCTCAGTTTTCCTCCAGC243491047404199920181228812307GGAGAACAACCCTCTGAGCT753501047420210121201239012409CACTTGAGTCATCGCTCAGG1073511047436219322121248212501ACAGATCCCCCAAGTGCTGA733521047452224122601253012549CAGCCCCCCTCTATCCCTCC883531047468233723561262612645ATTGCCTCCTCCTCCATCTC933541047484239524141268412703AGAGGCCAAGTGCAACTGGT803551047500246324821275212771TACATCCCCTTTCTCTCCTG473561047516269927181298813007CACTACCTAGAATACTGGGT923571047532279428131308313102CGTGTCAGCCCTGAGCACCC1293581047548286628851315513174CTCTGGGCACAGATCCCACC1413591047564293129501322013239GGAAGGACCCTTCTTCGGCC673601047580304530641333413353CTTTATTTTTCCTCAGCGAC353611047612N / AN / A88278846GTTCCATTTACAATCTGGTG603631047628N / AN / A90539072TTACCACTAACAAGCTCTGC763641047644N / AN / A90819100CCACTGCGCACCCAAGGACT893651047660N / AN / A92909309ACATAAAACTTTATTCACTG743661047676N / AN / A83998418GTGCCCTTCCCACGAGGCCC1763671047692N / AN / A84638482TGCCCTGATCCTCAGTCCCA813681047708N / AN / A85368555TACCCTGGTATGATAGGCTC603691047724N / AN / A86698688GTGCTTGCTCAGGGATCTGC563701047740N / AN / A39713990CCATCCCCTCCTCACTTCTG85*3711047756N / AN / A41204139GGTCCCTCCCATCATGTTGG763721047772N / AN / A42724291CTGCCCACAGTCACAAAGCC1033731047788N / AN / A43284347TTCTCCGCTTCCAACTCCTC1333741047804N / AN / A43644383CACCCCAGAATCCAATCTCC783751047820N / AN / A45074526AACCACCTTTTGAAATGAAT1183761047836N / AN / A45964615CACATGTCCTCCTGCACTTG1083771047852N / AN / A47084727TTTGCCTTAACTCATTACTA913781047868N / AN / A48124831GTCACAGAGACCACCCCCAC1083791047884N / AN / A49654984ACCTCCCTGACCTGTCTATA833801047900N / AN / A50875106TTGCCTTACCCCTCCTTCTG1023811047916N / AN / A52825301AGCTTTCCTCCCTCTGCCCT923821047932N / AN / A54055424GTTTGTCTTTCATTTCCTGT823831047948N / AN / A55645583GTTCCCGAACCTCCTGACCA1033841047964N / AN / A58055824TCCCAGCTTCCTCCACCCTC783851047980N / AN / A59385957TATCAGCTACTACTAATAAT1063861047996N / AN / A60796098CCAACTCTACCACTTAGGAG963871048012N / AN / A61516170TCAGTAACCCAAAACAGACT1243881048028N / AN / A62856304GGCTCCCACACTACATATAA1343891048044N / AN / A63536372TCTTCTCTTCCTGTCCACAG933901048060N / AN / A64736492GTGGCTTCTGCCACTCACAC1293911048076N / AN / A65566575CCCTGGGTTCTAATAGCCCT893921048092N / AN / A69937012TGGTCAGCAAGCGAATGAAT813931048108N / AN / A71117130AGCAGCACCCCAGTTAACCC1043941048124N / AN / A74517470CCAGGCCCCGCCTCTAGCCC893951048140N / AN / A79327951CCATCCATTCAGTCATCAAA703961048156N / AN / A81428161GGCTTGAGTGTTATCTGGGA743971048172N / AN / A83328351ATGGTGATCCTGAAAGAAAG873981048188N / AN / A93929411ATGCAAGTAAAAAGTAATTT613991048204N / AN / A95819600TCTGCCATTTATCTGTGCTT614001048220N / AN / A96219640TAGGTCCCTTTCCTGTCCCC604011048236N / AN / A97959814TTAGCCACCAACCAGCCACA1064021048252N / AN / A1000910028GCACCTGTAATCCCCTTACT764031048268N / AN / A1065810677AGTGCTGCTGCCAGAGTCCT804041048284N / AN / A1075110770CCCCCCTCCCCATCATGAGT824051048300N / AN / A1092110940TACCTCTCCATCCCGCATCT1094061048316N / AN / A1097610995TGGCCTTGAGAATCCCTGGG994071048332N / AN / A1109011109CTGAGGAAACGGAATTACAT834081048348N / AN / A1127211291AGCCCTCCCCATCCCCAACT1214091048364N / AN / A1133311352TACGCCAAATCCCCTCTTCC924101048380N / AN / A1150411523AGTCCCCGACTTCCCAGGTC116411 Table 7 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 104714911313235613580CACCATCATCTCCCCTGAGG102412104716515117035993618GTGCCAGGACCCAGACGGCG120413104718127929837273746CATTGAGCTCCATCATCTCT924141047197525544N / AN / ATGGTTTCATCCTGGAGCTTC39*415104721361763652065225AATCTTCCTCTCCAGATCCA79416104722965967852485267GTGGATCTTCCTCAAGAACC83417104724582584457115730TGGAGCGGTACCACTCTTCG7741810472611060107976327651AGGCTCTGCCCCTCTTCCTC784191047277125712761087110890GGTGGCCTTCTGACACAGAC98420104729313131332N / AN / ACTTAATGACCTCTCCATCCC1054211047309135713761164611665TGGGTCCTGCCTCACATCAC1544221047325152915481181811837GCAGGCCTGATACTGACGGA464231047341163516541192411943TCCTCCTCATTCTAACGCAA534241047357168417031197311992GTGGAGGGCGATGTAGTAGG424251047373175617751204512064GCACAGTTCCCAGATACTCC334261047389181218311210112120CTTCCCTTTCCTGTCTGAGT644271047405200320221229212311TCTAGGAGAACAACCCTCTG1604281047421210321221239212411GACACTTGAGTCATCGCTCA634291047437219422131248312502AACAGATCCCCCAAGTGCTG854301047453224222611253112550GCAGCCCCCCTCTATCCCTC1734311047469234123601263012649CCCAATTGCCTCCTCCTCCA534321047485240724261269612715TTCCCACAATCCAGAGGCCA1014331047501246424831275312772ATACATCCCCTTTCTCTCCT634341047517270127201299013009GGCACTACCTAGAATACTGG734351047533283328521312213141GTCTGCTCAGTCAAAGCAGA934361047549287728961316613185CCCAGTCCCATCTCTGGGCA1344371047565293229511322113240GGGAAGGACCCTTCTTCGGC664381047581304630651333513354TCTTTATTTTTCCTCAGCGA414391047613N / AN / A88288847CGTTCCATTTACAATCTGGT474411047629N / AN / A90569075CCTTTACCACTAACAAGCTC1614421047645N / AN / A90869105CAGCTCCACTGCGCACCCAA854431047661N / AN / A93009319AGAGCAGGGAACATAAAACT694441047677N / AN / A84008419AGTGCCCTTCCCACGAGGCC854451047693N / AN / A84648483TTGCCCTGATCCTCAGTCCC1174461047709N / AN / A85478566CCACCTAGAAGTACCCTGGT754471047725N / AN / A86888707GAAAACACTCAGAAGGGCAG1014481047741N / AN / A39723991CCCATCCCCTCCTCACTTCT1334491047757N / AN / A41224141CTGGTCCCTCCCATCATGTT1364501047773N / AN / A42734292GCTGCCCACAGTCACAAAGC1264511047789N / AN / A43344353TCAACCTTCTCCGCTTCCAA664521047805N / AN / A43694388TTCTTCACCCCAGAATCCAA1234531047821N / AN / A45084527TAACCACCTTTTGAAATGAA754541047837N / AN / A46574676CTGCTCACACAGGCGCATCC974551047853N / AN / A47094728TTTTGCCTTAACTCATTACT1424561047869N / AN / A48134832TGTCACAGAGACCACCCCCA874571047885N / AN / A49684987TCCACCTCCCTGACCTGTCT844581047901N / AN / A50905109GCCTTGCCTTACCCCTCCTT864591047917N / AN / A52845303TGAGCTTTCCTCCCTCTGCC934601047933N / AN / A54175436TAGTGTCTTTCTGTTTGTCT824611047949N / AN / A55655584AGTTCCCGAACCTCCTGACC744621047965N / AN / A58065825CTCCCAGCTTCCTCCACCCT1014631047981N / AN / A59395958GTATCAGCTACTACTAATAA1374641047997N / AN / A60806099TCCAACTCTACCACTTAGGA1124651048013N / AN / A61526171CTCAGTAACCCAAAACAGAC794661048029N / AN / A62876306CTGGCTCCCACACTACATAT864671048045N / AN / A63546373TTCTTCTCTTCCTGTCCACA924681048061N / AN / A64746493AGTGGCTTCTGCCACTCACA884691048077N / AN / A65576576ACCCTGGGTTCTAATAGCCC1044701048093N / AN / A70087027ACCTAGCACAACACCTGGTC774711048109N / AN / A73187337GCGCTCACCGTGCCGCGCAG854721048125N / AN / A74977516GAGCCCCGACCCGACTTGGG554731048141N / AN / A79437962GTTGAATCCATCCATCCATT734741048157N / AN / A81958214AGCTTTTTCCCCAGCAGCCA914751048173N / AN / A83338352AATGGTGATCCTGAAAGAAA804761048189N / AN / A94159434AGCTAAGAATCATTTCAGGG774771048205N / AN / A95849603CTCTCTGCCATTTATCTGTG674781048221N / AN / A96229641ATAGGTCCCTTTCCTGTCCC674791048237N / AN / A97969815CTTAGCCACCAACCAGCCAC1234801048253N / AN / A1001010029CGCACCTGTAATCCCCTTAC974811048269N / AN / A1066610685ATCCCAATAGTGCTGCTGCC794821048285N / AN / A1075510774CGCACCCCCCTCCCCATCAT1094831048301N / AN / A1092510944TCCTTACCTCTCCATCCCGC1064841048317N / AN / A1099311012GGCTTTCCTCCATGGCCTGG934851048333N / AN / A1109211111GACTGAGGAAACGGAATTAC864861048349N / AN / A1127811297ATGGAAAGCCCTCCCCATCC864871048365N / AN / A1133411353ATACGCCAAATCCCCTCTTC1054881048381N / AN / A1150511524AAGTCCCCGACTTCCCAGGT79489 Table 8 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 104715011513435633582CCCACCATCATCTCCCCTGA93490104716615617536043623GGCGGGTGCCAGGACCCAGA79491104718235837738063825AGCTGGTTCAGCTCAGCAGC114492104719852854749134932GGTTGGTTTCATCCTGGAGC19*493104721461963852085227TCAATCTTCCTCTCCAGATC1154941047230680699N / AN / AGAGTTCCCGAACCTCCTCCT854951047246838857N / AN / AAGGTCTGCAAACTTGGAGCG9049610472621064108376367655CTTGAGGCTCTGCCCCTCTT884971047278125812771087210891AGGTGGCCTTCTGACACAGA94498104729413141333N / AN / ACCTTAATGACCTCTCCATCC1544991047310135813771164711666GTGGGTCCTGCCTCACATCA885001047326153015491181911838GGCAGGCCTGATACTGACGG1035011047342163616551192511944TTCCTCCTCATTCTAACGCA665021047358168517041197411993TGTGGAGGGCGATGTAGTAG505031047374175717761204612065GGCACAGTTCCCAGATACTC405041047390181318321210212121CCTTCCCTTTCCTGTCTGAG815051047406200420231229312312GTCTAGGAGAACAACCCTCT965061047422211221311240112420GTGGACTGAGACACTTGAGT545071047438220122201249012509CGTACACAACAGATCCCCCA615081047454224322621253212551GGCAGCCCCCCTCTATCCCT575091047470234223611263112650TCCCAATTGCCTCCTCCTCC665101047486241324321270212721CCTTAATTCCCACAATCCAG1475111047502246524841275412773GATACATCCCCTTTCTCTCC675121047518270227211299113010GGGCACTACCTAGAATACTG435131047534284328621313213151CTGCTCACCAGTCTGCTCAG975141047550287828971316713186TCCCAGTCCCATCTCTGGGC1065151047566293329521322213241AGGGAAGGACCCTTCTTCGG715161047582304730661333613355GTCTTTATTTTTCCTCAGCG95171047614N / AN / A88508869GCAGCTAACCGCGAGCCGGC1325191047630N / AN / A90579076ACCTTTACCACTAACAAGCT895201047646N / AN / A90889107AGCAGCTCCACTGCGCACCC1165211047662N / AN / A93119330ATTTAACATTAAGAGCAGGG455221047678N / AN / A84018420CAGTGCCCTTCCCACGAGGC1105231047694N / AN / A84678486CCTTTGCCCTGATCCTCAGT775241047710N / AN / A85498568CCCCACCTAGAAGTACCCTG995251047726N / AN / A86898708AGAAAACACTCAGAAGGGCA1695261047742N / AN / A39733992CCCCATCCCCTCCTCACTTC1005271047758N / AN / A41244143TTCTGGTCCCTCCCATCATG775281047774N / AN / A42774296GCTCGCTGCCCACAGTCACA1235291047790N / AN / A43384357GACATCAACCTTCTCCGCTT675301047806N / AN / A43754394CTCACTTTCTTCACCCCAGA1565311047822N / AN / A45104529GGTAACCACCTTTTGAAATG915321047838N / AN / A46594678TTCTGCTCACACAGGCGCAT1485331047854N / AN / A47124731GGCTTTTGCCTTAACTCATT725341047870N / AN / A48154834GCTGTCACAGAGACCACCCC935351047886N / AN / A49714990CCCTCCACCTCCCTGACCTG595361047902N / AN / A50925111CAGCCTTGCCTTACCCCTCC705371047918N / AN / A52855304TTGAGCTTTCCTCCCTCTGC805381047934N / AN / A54295448TTCCGTCTCCCTTAGTGTCT1055391047950N / AN / A55665585GAGTTCCCGAACCTCCTGAC705401047966N / AN / A58135832GGATATTCTCCCAGCTTCCT905411047982N / AN / A59455964AGAACAGTATCAGCTACTAC1065421047998N / AN / A60856104GGAAATCCAACTCTACCACT1065431048014N / AN / A61536172GCTCAGTAACCCAAAACAGA965441048030N / AN / A62886307CCTGGCTCCCACACTACATA1165451048046N / AN / A63566375CCTTCTTCTCTTCCTGTCCA1335461048062N / AN / A64866505TGCTCAGACACCAGTGGCTT1095471048078N / AN / A65676586GCCTGGCCTCACCCTGGGTT885481048094N / AN / A70237042CTGCCAGACCTCAGCACCTA815491048110N / AN / A73227341GGCCGCGCTCACCGTGCCGC1095501048126N / AN / A74987517GGAGCCCCGACCCGACTTGG1245511048142N / AN / A79447963GGTTGAATCCATCCATCCAT1055521048158N / AN / A81968215TAGCTTTTTCCCCAGCAGCC895531048174N / AN / A83348353GAATGGTGATCCTGAAAGAA815541048190N / AN / A94629481AGTGGTCCTAAATATTCTAG665551048206N / AN / A95859604TCTCTCTGCCATTTATCTGT915561048222N / AN / A96239642CATAGGTCCCTTTCCTGTCC715571048238N / AN / A97999818CAACTTAGCCACCAACCAGC1205581048254N / AN / A1057610595GGCTTTCTGAAAACCCAGCA725591048270N / AN / A1067310692CCCCCAAATCCCAATAGTGC1175601048286N / AN / A1075610775TCGCACCCCCCTCCCCATCA1065611048302N / AN / A1092610945CTCCTTACCTCTCCATCCCG1205621048318N / AN / A1099411013AGGCTTTCCTCCATGGCCTG915631048334N / AN / A1111011129TAGAACAGCCTATGGAGGGA525641048350N / AN / A1130011319GTTTCCTTTTACCAAGCTGG345651048366N / AN / A1133511354GATACGCCAAATCCCCTCTT945661048382N / AN / A1150811527GGGAAGTCCCCGACTTCCCA92567 Table 9 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 104715111613535643583CCCCACCATCATCTCCCCTG89568104716717319236213640CATTCGAGCCAGGGAGAGGC82569104718337239138203839GCTCCTTGGCCCGCAGCTGG147570104719952954849144933AGGTTGGTTTCATCCTGGAG47*571104721562063952095228CTCAATCTTCCTCTCCAGAT93572104723168370255695588CTGGAGTTCCCGAACCTCCT113573104724794396273007319AGAGACTCCAGGTCGCAGGT10457410472631098111776707689CCTGGTACTCCTGCAAGTGG1395751047279126012791087410893TGAGGTGGCCTTCTGACACA106576104729513191338N / AN / AGGACTCCTTAATGACCTCTC775771047311137013891165911678AGAGGCCACCAGGTGGGTCC885781047327153115501182011839TGGCAGGCCTGATACTGACG715791047343163716561192611945CTTCCTCCTCATTCTAACGC685801047359171417331200312022ACAGTTTCCATAACAACAGG1375811047375176017791204912068AAAGGCACAGTTCCCAGATA1065821047391181418331210312122GCCTTCCCTTTCCTGTCTGA345831047407200520241229412313AGTCTAGGAGAACAACCCTC1135841047423213821571242712446GATGGCATCCCTGGATGGCA1135851047439221922381250812527GCACCTCATCCCTCTCCACG755861047455224422631253312552AGGCAGCCCCCCTCTATCCC775871047471234323621263212651ATCCCAATTGCCTCCTCCTC965881047487241424331270312722TCCTTAATTCCCACAATCCA1055891047503246624851275512774GGATACATCCCCTTTCTCTC485901047519272727461301613035GCCTCAGTTTTACAATTGTA905911047535284428631313313152TCTGCTCACCAGTCTGCTCA925921047551288028991316913188CCTCCCAGTCCCATCTCTGG905931047567293729561322613245GGAGAGGGAAGGACCCTTCT1055941047583304830671333713356TGTCTTTATTTTTCCTCAGC105951047615N / AN / A88518870GGCAGCTAACCGCGAGCCGG925971047631N / AN / A90589077CACCTTTACCACTAACAAGC1055981047647N / AN / A90899108GAGCAGCTCCACTGCGCACC875991047663N / AN / A93129331TATTTAACATTAAGAGCAGG1066001047679N / AN / A84028421CCAGTGCCCTTCCCACGAGG786011047695N / AN / A84698488TCCCTTTGCCCTGATCCTCA746021047711N / AN / A85518570AGCCCCACCTAGAAGTACCC866031047727N / AN / A86908709CAGAAAACACTCAGAAGGGC936041047743N / AN / A39743993TCCCCATCCCCTCCTCACTT926051047759N / AN / A41264145GTTTCTGGTCCCTCCCATCA986061047775N / AN / A42784297AGCTCGCTGCCCACAGTCAC1706071047791N / AN / A43394358GGACATCAACCTTCTCCGCT986081047807N / AN / A43764395CCTCACTTTCTTCACCCCAG1046091047823N / AN / A45124531CAGGTAACCACCTTTTGAAA826101047839N / AN / A46614680GCTTCTGCTCACACAGGCGC966111047855N / AN / A47134732GGGCTTTTGCCTTAACTCAT896121047871N / AN / A48334852TCAGTCTCCCTTGAGGCAGC876131047887N / AN / A49724991CCCCTCCACCTCCCTGACCT1096141047903N / AN / A50935112TCAGCCTTGCCTTACCCCTC966151047919N / AN / A52865305GTTGAGCTTTCCTCCCTCTG826161047935N / AN / A54345453TCTCTTTCCGTCTCCCTTAG836171047951N / AN / A57245743GGCAGGGCTACCTTGGAGCG986181047967N / AN / A58145833AGGATATTCTCCCAGCTTCC746191047983N / AN / A59465965CAGAACAGTATCAGCTACTA766201047999N / AN / A60866105TGGAAATCCAACTCTACCAC1226211048015N / AN / A61546173GGCTCAGTAACCCAAAACAG826221048031N / AN / A62906309TTCCTGGCTCCCACACTACA1066231048047N / AN / A63626381GCCCTCCCTTCTTCTCTTCC846241048063N / AN / A64876506CTGCTCAGACACCAGTGGCT1116251048079N / AN / A65696588TCGCCTGGCCTCACCCTGGG1016261048095N / AN / A70247043GCTGCCAGACCTCAGCACCT1926271048111N / AN / A73287347TGCCCTGGCCGCGCTCACCG826281048127N / AN / A75027521CCGCGGAGCCCCGACCCGAC906291048143N / AN / A79457964TGGTTGAATCCATCCATCCA1176301048159N / AN / A81978216CTAGCTTTTTCCCCAGCAGC1006311048175N / AN / A93169335CTAATATTTAACATTAAGAG1286321048191N / AN / A94639482TAGTGGTCCTAAATATTCTA1066331048207N / AN / A95869605TTCTCTCTGCCATTTATCTG706341048223N / AN / A96259644CACATAGGTCCCTTTCCTGT746351048239N / AN / A98009819CCAACTTAGCCACCAACCAG966361048255N / AN / A1057710596TGGCTTTCTGAAAACCCAGC836371048271N / AN / A1067410693GCCCCCAAATCCCAATAGTG1166381048287N / AN / A1075710776ATCGCACCCCCCTCCCCATC1426391048303N / AN / A1092810947CCCTCCTTACCTCTCCATCC1176401048319N / AN / A1099611015CCAGGCTTTCCTCCATGGCC886411048335N / AN / A1111111130TTAGAACAGCCTATGGAGGG1156421048351N / AN / A1130111320AGTTTCCTTTTACCAAGCTG546431048367N / AN / A1133711356CGGATACGCCAAATCCCCTC1016441048383N / AN / A1153911558CAGGTCCACCACCACGAGGC138645 Table 10 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 104715211713635653584CCCCCACCATCATCTCCCCT104646104716817519436233642GGCATTCGAGCCAGGGAGAG90647104718443545438833902GTTGATCGAGCCGCAGCCGC104648104720053054949154934CAGGTTGGTTTCATCCTGGA56*649104721662164052105229ACTCAATCTTCCTCTCCAGA95650104723268470355705589CCTGGAGTTCCCGAACCTCC126651104724894696573037322CGCAGAGACTCCAGGTCGCA10465210472641100111976727691GTCCTGGTACTCCTGCAAGT896531047280127312921088710906ACGATGTTCCTCTTGAGGTG96654104729613201339N / AN / ATGGACTCCTTAATGACCTCT1016551047312137213911166111680GCAGAGGCCACCAGGTGGGT646561047328158015991186911888GGTGAGTTTCTTGTTAGTTG296571047344163816571192711946CCTTCCTCCTCATTCTAACG736581047360171517341200412023AACAGTTTCCATAACAACAG1156591047376176117801205012069CAAAGGCACAGTTCCCAGAT946601047392181518341210412123GGCCTTCCCTTTCCTGTCTG1046611047408202120401231012329TAGACTGATCAGGGTCAGTC1256621047424214821671243712456CGTGCCCACAGATGGCATCC876631047440222222411251112530CCAGCACCTCATCCCTCTCC1116641047456224622651253512554CCAGGCAGCCCCCCTCTATC876651047472234523641263412653CCATCCCAATTGCCTCCTCC766661047488241724361270612725ACTTCCTTAATTCCCACAAT1036671047504246824871275712776ATGGATACATCCCCTTTCTC736681047520272827471301713036TGCCTCAGTTTTACAATTGT1096691047536284528641313413153GTCTGCTCACCAGTCTGCTC1106701047552288329021317213191GGCCCTCCCAGTCCCATCTC856711047568295629751324513264AAAGGACACCAAGTCTTGGG696721047584304930681333813357TTGTCTTTATTTTTCCTCAG116731047616N / AN / A88528871AGGCAGCTAACCGCGAGCCG946751047632N / AN / A90599078CCACCTTTACCACTAACAAG896761047648N / AN / A91019120TCAGAGGCCCCAGAGCAGCT866771047664N / AN / A93149333AATATTTAACATTAAGAGCA1056781047680N / AN / A84048423CTCCAGTGCCCTTCCCACGA866791047696N / AN / A84718490GATCCCTTTGCCCTGATCCT766801047712N / AN / A85548573GCAAGCCCCACCTAGAAGTA766811047728N / AN / A86918710ACAGAAAACACTCAGAAGGG926821047744N / AN / A39844003AGGCCCCCCTTCCCCATCCC796831047760N / AN / A41384157GGCCCTGGGCCTGTTTCTGG866841047776N / AN / A42794298GAGCTCGCTGCCCACAGTCA1196851047792N / AN / A43404359TGGACATCAACCTTCTCCGC1026861047808N / AN / A43774396CCCTCACTTTCTTCACCCCA716871047824N / AN / A45134532CCAGGTAACCACCTTTTGAA1046881047840N / AN / A46864705GTGCCTTATCAGGGTTGGTG646891047856N / AN / A47144733TGGGCTTTTGCCTTAACTCA796901047872N / AN / A48354854CCTCAGTCTCCCTTGAGGCA1046911047888N / AN / A49764995CCCTCCCCTCCACCTCCCTG796921047904N / AN / A50945113CTCAGCCTTGCCTTACCCCT1216931047920N / AN / A53135332TCTCCCTCTCTCAGTTGCAA806941047936N / AN / A54365455TGTCTCTTTCCGTCTCCCTT766951047952N / AN / A57385757CAGGCTGGCCCACAGGCAGG966961047968N / AN / A58155834GAGGATATTCTCCCAGCTTC836971047984N / AN / A59936012CACCTACTTCATAGTAAGGT1446981048000N / AN / A60886107GTTGGAAATCCAACTCTACC756991048016N / AN / A61556174AGGCTCAGTAACCCAAAACA977001048032N / AN / A62986317CAGTGTCTTTCCTGGCTCCC727011048048N / AN / A63636382GGCCCTCCCTTCTTCTCTTC1067021048064N / AN / A64916510CACCCTGCTCAGACACCAGT1127031048080N / AN / A65706589CTCGCCTGGCCTCACCCTGG807041048096N / AN / A70287047GCGGGCTGCCAGACCTCAGC827051048112N / AN / A73357354CCCGTCCTGCCCTGGCCGCG927061048128N / AN / A78337852AAAAAGACTCAGTCCCTGAA1037071048144N / AN / A79467965TTGGTTGAATCCATCCATCC687081048160N / AN / A81988217CCTAGCTTTTTCCCCAGCAG717091048176N / AN / A93179336ACTAATATTTAACATTAAGA697101048192N / AN / A94659484TCTAGTGGTCCTAAATATTC1087111048208N / AN / A95939612TTCCTACTTCTCTCTGCCAT807121048224N / AN / A96339652GCTCAATACACATAGGTCCC827131048240N / AN / A98019820CCCAACTTAGCCACCAACCA1207141048256N / AN / A1057810597CTGGCTTTCTGAAAACCCAG1197151048272N / AN / A1067510694AGCCCCCAAATCCCAATAGT1167161048288N / AN / A1075910778CCATCGCACCCCCCTCCCCA887171048304N / AN / A1092910948TCCCTCCTTACCTCTCCATC737181048320N / AN / A1099711016CCCAGGCTTTCCTCCATGGC1137191048336N / AN / A1111211131CTTAGAACAGCCTATGGAGG747201048352N / AN / A1130211321TAGTTTCCTTTTACCAAGCT977211048368N / AN / A1133811357GCGGATACGCCAAATCCCCT747221048384N / AN / A1154111560CCCAGGTCCACCACCACGAG105723 Table 11 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 104715311913835673586GCCCCCCACCATCATCTCCC88724104716921022936583677CCAGGGAGAAATCCACCCGG81725104718544045938883907GGTGAGTTGATCGAGCCGCA70726104720153955849244943TTCCAGCCTCAGGTTGGTTT29*727104721762764652165235CCAGCGACTCAATCTTCCTC99728104723370372255895608TGCTGTCGGGCCAGCTGCTC1187291047249990100975627581CCTCCTGCTCGCGCATCTGC9373010472651101112076737692GGTCCTGGTACTCCTGCAAG1297311047281127412931088810907CACGATGTTCCTCTTGAGGT104732104729713211340N / AN / ATTGGACTCCTTAATGACCTC1107331047313139314121168211701TCGGGCCCCTCATGAGACGG997341047329160516241189411913ATGCCCCTCCAGACTGCCCC1097351047345164016591192911948CTCCTTCCTCCTCATTCTAA897361047361171617351200512024CAACAGTTTCCATAACAACA627371047377177017891205912078GAGGAAACTCAAAGGCACAG827381047393181618351210512124GGGCCTTCCCTTTCCTGTCT647391047409202420431231312332TCTTAGACTGATCAGGGTCA1247401047425216621851245512474GCTCCCACCTGCCCACAGCG797411047441222422431251312532TCCCAGCACCTCATCCCTCT1097421047457224722661253612555GCCAGGCAGCCCCCCTCTAT1007431047473236923881265812677CAACCCCTACTTGTATGCCT737441047489242924481271812737AGAGGATGAGTCACTTCCTT1167451047505246924881275812777CATGGATACATCCCCTTTCT837461047521274827671303713056CAGTGTCTTCACTTTGCTCG697471047537284628651313513154AGTCTGCTCACCAGTCTGCT1037481047553288429031317313192GGGCCCTCCCAGTCCCATCT1057491047569295729761324613265GAAAGGACACCAAGTCTTGG1177501047585305030691333913358TTTGTCTTTATTTTTCCTCA207511047601N / AN / A87518770GATTTTCCCCGTCTTTGGTG387521047617N / AN / A89018920GTGAGGCTCACTCCCTGTCA957531047633N / AN / A90609079ACCACCTTTACCACTAACAA1087541047649N / AN / A91079126GCTTGCTCAGAGGCCCCAGA597551047665N / AN / A93159334TAATATTTAACATTAAGAGC1357561047681N / AN / A84068425GACTCCAGTGCCCTTCCCAC1097571047697N / AN / A84738492TGGATCCCTTTGCCCTGATC907581047713N / AN / A85578576GCTGCAAGCCCCACCTAGAA697591047729N / AN / A86928711AACAGAAAACACTCAGAAGG977601047745N / AN / A39854004AAGGCCCCCCTTCCCCATCC1097611047761N / AN / A41584177TGCGGGCATCAGATCCCCGG1387621047777N / AN / A43134332TCCTCCTTTATATGGACACA1117631047793N / AN / A43414360ATGGACATCAACCTTCTCCG747641047809N / AN / A43784397TCCCTCACTTTCTTCACCCC1007651047825N / AN / A45144533CCCAGGTAACCACCTTTTGA927661047841N / AN / A46894708AAGGTGCCTTATCAGGGTTG747671047857N / AN / A47164735TGTGGGCTTTTGCCTTAACT1037681047873N / AN / A48414860TACCTGCCTCAGTCTCCCTT1307691047889N / AN / A49985017AATCCTTTCCTCCCTCCCCT1297701047905N / AN / A51035122TCCCCATTCCTCAGCCTTGC1127711047921N / AN / A53175336TGTCTCTCCCTCTCTCAGTT887721047937N / AN / A54385457CTTGTCTCTTTCCGTCTCCC1057731047953N / AN / A57395758GCAGGCTGGCCCACAGGCAG837741047969N / AN / A58165835AGAGGATATTCTCCCAGCTT807751047985N / AN / A59946013GCACCTACTTCATAGTAAGG657761048001N / AN / A60896108AGTTGGAAATCCAACTCTAC887771048017N / AN / A61576176AGAGGCTCAGTAACCCAAAA907781048033N / AN / A63066325CCCCTCTACAGTGTCTTTCC1017791048049N / AN / A63646383TGGCCCTCCCTTCTTCTCTT897801048065N / AN / A64976516GGCCCTCACCCTGCTCAGAC1437811048081N / AN / A65716590CCTCGCCTGGCCTCACCCTG1167821048097N / AN / A70567075ACTGTGACCCATGGATGCGG987831048113N / AN / A73437362CGCCCGTCCCCGTCCTGCCC927841048129N / AN / A78357854TGAAAAAGACTCAGTCCCTG1037851048145N / AN / A79477966ATTGGTTGAATCCATCCATC1067861048161N / AN / A81998218TCCTAGCTTTTTCCCCAGCA927871048177N / AN / A93189337CACTAATATTTAACATTAAG1207881048193N / AN / A94759494GACATGCATATCTAGTGGTC647891048209N / AN / A95959614CTTTCCTACTTCTCTCTGCC1077901048225N / AN / A96349653TGCTCAATACACATAGGTCC957911048241N / AN / A98069825GAAGTCCCAACTTAGCCACC1017921048257N / AN / A1057910598CCTGGCTTTCTGAAAACCCA707931048273N / AN / A1068310702GGCTGGAGAGCCCCCAAATC1447941048289N / AN / A1076610785GGCTTCCCCATCGCACCCCC1177951048305N / AN / A1093010949ATCCCTCCTTACCTCTCCAT1067961048321N / AN / A1099811017CCCCAGGCTTTCCTCCATGG817971048337N / AN / A1111311132CCTTAGAACAGCCTATGGAG1627981048353N / AN / A1130511324TGGTAGTTTCCTTTTACCAA897991048369N / AN / A1133911358GGCGGATACGCCAAATCCCC938001048385N / AN / A1154711566ACAGACCCCAGGTCCACCAC104801 Table 12 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 104715412013935683587GGCCCCCCACCATCATCTCC97802104717022624536743693GCATTGAGTGCCCCAGCCAG128803104718647149039193938CCCTCTCAACCTCCAGCCGG3*804104720254156049264945GCTTCCAGCCTCAGGTTGGT18*805104721862864752175236TCCAGCGACTCAATCTTCCT100806104723472374256095628CGTCAAGCTCCACATGGACC14480710472501017103675897608AACTGGCCGCCTCCCGCACG12780810472661206122583558374GGTTGGAGAAGGTCTGCACG778091047282127512941088910908CCACGATGTTCCTCTTGAGG1578101047298132213411161111630CTTGGACTCCTTAATGACCT648111047314139514141168411703GCTCGGGCCCCTCATGAGAC1008121047330160616251189511914CATGCCCCTCCAGACTGCCC1068131047346165716761194611965CGCCCTCCTCCCCTTCTCTC798141047362171817371200712026GGCAACAGTTTCCATAACAA318151047378177117901206012079TGAGGAAACTCAAAGGCACA798161047394183518541212412143CAGGGCTACCTTGTCTGTGG408171047410202520441231412333ATCTTAGACTGATCAGGGTC678181047426216721861245612475AGCTCCCACCTGCCCACAGC948191047442222622451251512534CCTCCCAGCACCTCATCCCT978201047458226822871255712576TCTCTGTACCCACAGCTGGG848211047474237123901266012679CACAACCCCTACTTGTATGC618221047490244224611273112750TTCAGCATCTTCAAGAGGAT928231047506247024891275912778CCATGGATACATCCCCTTTC1518241047522274927681303813057CCAGTGTCTTCACTTTGCTC448251047538284728661313613155CAGTCTGCTCACCAGTCTGC1038261047554288529041317413193TGGGCCCTCCCAGTCCCATC1728271047570295829771324713266GGAAAGGACACCAAGTCTTG908281047586305130701334013359ATTTGTCTTTATTTTTCCTC328291047602N / AN / A87548773TGTGATTTTCCCCGTCTTTG548301047618N / AN / A89028921GGTGAGGCTCACTCCCTGTC658311047634N / AN / A90619080CACCACCTTTACCACTAACA888321047650N / AN / A91099128CTGCTTGCTCAGAGGCCCCA1158331047666N / AN / A83728391CTGACCTCGAATCTGCAGGT848341047682N / AN / A84128431GGGCAGGACTCCAGTGCCCT1188351047698N / AN / A84748493CTGGATCCCTTTGCCCTGAT1008361047714N / AN / A86268645CACCCAGTTCTGCTGTCGAA948371047730N / AN / A86968715CAAAAACAGAAAACACTCAG1608381047746N / AN / A39874006ACAAGGCCCCCCTTCCCCAT578391047762N / AN / A42154234CACTGCTTTCCCCAGTAGGG488401047778N / AN / A43144333CTCCTCCTTTATATGGACAC968411047794N / AN / A43454364CCTCATGGACATCAACCTTC928421047810N / AN / A43794398TTCCCTCACTTTCTTCACCC1028431047826N / AN / A45154534TCCCAGGTAACCACCTTTTG768441047842N / AN / A46914710CTAAGGTGCCTTATCAGGGT788451047858N / AN / A47944813ACCCAGGACCAGTAGAGCAG848461047874N / AN / A48434862AATACCTGCCTCAGTCTCCC1068471047890N / AN / A49995018CAATCCTTTCCTCCCTCCCC1098481047906N / AN / A51045123CTCCCCATTCCTCAGCCTTG908491047922N / AN / A53345353CTCAGCTTCTCTGTCTCTGT1238501047938N / AN / A54655484CCCCTCGGCCAGGAGTTCGA1238511047954N / AN / A57815800CCCCATTCTCTTGTACAGAG988521047970N / AN / A58175836GAGAGGATATTCTCCCAGCT1518531047986N / AN / A60016020AAGAACAGCACCTACTTCAT858541048002N / AN / A60906109GAGTTGGAAATCCAACTCTA978551048018N / AN / A61596178GTAGAGGCTCAGTAACCCAA518561048034N / AN / A63106329ATGCCCCCTCTACAGTGTCT718571048050N / AN / A63666385AATGGCCCTCCCTTCTTCTC1778581048066N / AN / A65036522CCATCGGGCCCTCACCCTGC1108591048082N / AN / A69516970ACCTTCCACACTGACAGCTG1698601048098N / AN / A70587077CAACTGTGACCCATGGATGC788611048114N / AN / A73497368CTGCTCCGCCCGTCCCCGTC1208621048130N / AN / A78367855CTGAAAAAGACTCAGTCCCT1188631048146N / AN / A79497968ATATTGGTTGAATCCATCCA1028641048162N / AN / A82118230TCTAACTCCATCTCCTAGCT988651048178N / AN / A93199338TCACTAATATTTAACATTAA848661048194N / AN / A94929511GCTGAATTAAGTCCTGAGAC558671048210N / AN / A95969615TCTTTCCTACTTCTCTCTGC828681048226N / AN / A96629681AGGCTGTTAAACATGTGGCA718691048242N / AN / A98079826AGAAGTCCCAACTTAGCCAC858701048258N / AN / A1058010599ACCTGGCTTTCTGAAAACCC798711048274N / AN / A1069810717AGGCTCTTCCAAACGGGCTG1038721048290N / AN / A1076810787CCGGCTTCCCCATCGCACCC818731048306N / AN / A1093110950AATCCCTCCTTACCTCTCCA1168741048322N / AN / A1100411023TGCCAGCCCCAGGCTTTCCT668751048338N / AN / A1111711136CTCCCCTTAGAACAGCCTAT888761048354N / AN / A1130611325CTGGTAGTTTCCTTTTACCA1138771048370N / AN / A1134011359TGGCGGATACGCCAAATCCC758781048386N / AN / A1155511574GAGTTCACACAGACCCCAGG85879 Table 13 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 104715512114035693588AGGCCCCCCACCATCATCTC124880104717122824736763695CAGCATTGAGTGCCCCAGCC104881104718747249139203939TCCCTCTCAACCTCCAGCCG7*882104720354256149274946GGCTTCCAGCCTCAGGTTGG18*883104721962964852185237CTCCAGCGACTCAATCTTCC86884104723576178056475666GATCTCTTTCAGGGCTGCGG5188510472511019103875917610ATAACTGGCCGCCTCCCGCA143886104726712231242N / AN / AGGTTTCTCGAATCTGCAGGT658871047283128012991089410913CTTCACCACGATGTTCCTCT738881047299132313421161211631GCTTGGACTCCTTAATGACC918891047315139614151168511704TGCTCGGGCCCCTCATGAGA848901047331160716261189611915CCATGCCCCTCCAGACTGCC668911047347165816771194711966CCGCCCTCCTCCCCTTCTCT738921047363172117401201012029TCTGGCAACAGTTTCCATAA668931047379177217911206112080CTGAGGAAACTCAAAGGCAC1008941047395183718561212612145GCCAGGGCTACCTTGTCTGT808951047411202620451231512334CATCTTAGACTGATCAGGGT728961047427216921881245812477CAAGCTCCCACCTGCCCACA1118971047443223222511252112540TCTATCCCTCCCAGCACCTC808981047459226922881255812577CTCTCTGTACCCACAGCTGG858991047475237223911266112680CCACAACCCCTACTTGTATG699001047491244324621273212751TTTCAGCATCTTCAAGAGGA1219011047507247124901276012779CCCATGGATACATCCCCTTT799021047523275127701304013059AGCCAGTGTCTTCACTTTGC609031047539285528741314413163GATCCCACCAGTCTGCTCAC849041047555288629051317513194GTGGGCCCTCCCAGTCCCAT819051047571301030291329913318TGCCCTGAAGATTAGCAGCA1039061047587305230711334113360CATTTGTCTTTATTTTTCCT149071047603N / AN / A87558774TTGTGATTTTCCCCGTCTTT759081047619N / AN / A89698988ACGCAGTCCAGGCCCTTTAG579091047635N / AN / A90639082CTCACCACCTTTACCACTAA1139101047651N / AN / A91289147AGAGGTGAGACAGAGGCTGC1129111047667N / AN / A83748393TACTGACCTCGAATCTGCAG859121047683N / AN / A84328451CCTACAGGCCCTGGAGGAGG859131047699N / AN / A84768495AGCTGGATCCCTTTGCCCTG979141047715N / AN / A86308649CTCTCACCCAGTTCTGCTGT779151047731N / AN / A87238742CCCTGTAGTGACAAGCAGTT849161047747N / AN / A39974016CCTTCTGCTCACAAGGCCCC939171047763N / AN / A42574276AAGCCCAGCCATGAATGAAA839181047779N / AN / A43164335AACTCCTCCTTTATATGGAC919191047795N / AN / A43534372CCAATCTCCCTCATGGACAT669201047811N / AN / A43864405CTGCTCTTTCCCTCACTTTC1039211047827N / AN / A45164535ATCCCAGGTAACCACCTTTT859221047843N / AN / A46924711ACTAAGGTGCCTTATCAGGG1179231047859N / AN / A47954814CACCCAGGACCAGTAGAGCA569241047875N / AN / A48484867ACTTGAATACCTGCCTCAGT859251047891N / AN / A50015020ATCAATCCTTTCCTCCCTCC1029261047907N / AN / A51075126CTTCTCCCCATTCCTCAGCC569271047923N / AN / A53495368AGTGTCTCTCTCAGTCTCAG839281047939N / AN / A54775496CTCTTCTGCCTGCCCCTCGG1019291047955N / AN / A57835802TCCCCCATTCTCTTGTACAG499301047971N / AN / A58185837GGAGAGGATATTCTCCCAGC939311047987N / AN / A60076026CTGTCAAAGAACAGCACCTA1129321048003N / AN / A60916110AGAGTTGGAAATCCAACTCT929331048019N / AN / A62016220GGTCAGACACCTCTCTGTGT829341048035N / AN / A63216340GCCTAGCCCAAATGCCCCCT719351048051N / AN / A63846403GCTCTGTCCTCCACTAGGAA979361048067N / AN / A65046523CCCATCGGGCCCTCACCCTG889371048083N / AN / A69546973AGAACCTTCCACACTGACAG769381048099N / AN / A70607079AACAACTGTGACCCATGGAT749391048115N / AN / A73517370CCCTGCTCCGCCCGTCCCCG989401048131N / AN / A78377856GCTGAAAAAGACTCAGTCCC849411048147N / AN / A79737992GTCCTTGGCCTTGAGGCCTA959421048163N / AN / A82138232AGTCTAACTCCATCTCCTAG889431048179N / AN / A93229341CATTCACTAATATTTAACAT1109441048195N / AN / A95079526GTTAGCCTTTCTGATGCTGA539451048211N / AN / A95979616CTCTTTCCTACTTCTCTCTG919461048227N / AN / A97089727GGCCTACTTCTCTAGGTGGG829471048243N / AN / A98089827AAGAAGTCCCAACTTAGCCA1419481048259N / AN / A1060210621CCTCTGCAAGCCCTGGCCTG959491048275N / AN / A1069910718TAGGCTCTTCCAAACGGGCT899501048291N / AN / A1076910788CCCGGCTTCCCCATCGCACC799511048307N / AN / A1093410953CCAAATCCCTCCTTACCTCT1569521048323N / AN / A1101711036GGAACCTTCTATGTGCCAGC749531048339N / AN / A1113211151GCTTTGGTACCAAGGCTCCC1929541048355N / AN / A1130711326CCTGGTAGTTTCCTTTTACC529551048371N / AN / A1137911398GCTGGAGTAAGATGAGCTCC869561048387N / AN / A1157011589CAGTGCAACAGTTAGGAGTT66957 Table 14 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 104715612214135703589CAGGCCCCCCACCATCATCT90958104717223725636853704CCTTGAAGCCAGCATTGAGT89959104718847349239213940GTCCCTCTCAACCTCCAGCC6*960104720454556449304949CTCGGCTTCCAGCCTCAGGT37*961104722063465352235242TCCTCCTCCAGCGACTCAAT94962104723676678556525671GTGCGGATCTCTTTCAGGGC6396310472521020103975927611GATAACTGGCCGCCTCCCGC113964104726812251244N / AN / ACTGGTTTCTCGAATCTGCAG839651047284128313021089710916GGTCTTCACCACGATGTTCC949661047300134513641163411653CACATCACATCCTTGTGCTC759671047316139814171168711706TCTGCTCGGGCCCCTCATGA969681047332160816271189711916GCCATGCCCCTCCAGACTGC739691047348165916781194811967CCCGCCCTCCTCCCCTTCTC1079701047364172317421201212031TCTCTGGCAACAGTTTCCAT659711047380177317921206212081CCTGAGGAAACTCAAAGGCA929721047396183818571212712146GGCCAGGGCTACCTTGTCTG679731047412202720461231612335CCATCTTAGACTGATCAGGG769741047428217021891245912478TCAAGCTCCCACCTGCCCAC1279751047444223322521252212541CTCTATCCCTCCCAGCACCT429761047460227022891255912578CCTCTCTGTACCCACAGCTG949771047476237323921266212681CCCACAACCCCTACTTGTAT1159781047492244924681273812757CTCCTGTTTCAGCATCTTCA459791047508247224911276112780CCCCATGGATACATCCCCTT869801047524275927781304813067GGAATATGAGCCAGTGTCTT639811047540285728761314613165CAGATCCCACCAGTCTGCTC899821047556288929081317813197GAAGTGGGCCCTCCCAGTCC1139831047572301130301330013319GTGCCCTGAAGATTAGCAGC859841047588305330721334213361GCATTTGTCTTTATTTTTCC119851047604N / AN / A87568775CTTGTGATTTTCCCCGTCTT749861047620N / AN / A89728991ATGACGCAGTCCAGGCCCTT789871047636N / AN / A90649083ACTCACCACCTTTACCACTA859881047652N / AN / A91299148AAGAGGTGAGACAGAGGCTG669891047668N / AN / A83758394GTACTGACCTCGAATCTGCA969901047684N / AN / A84378456AGCAACCTACAGGCCCTGGA1169911047700N / AN / A84778496GAGCTGGATCCCTTTGCCCT829921047716N / AN / A86318650GCTCTCACCCAGTTCTGCTG839931047732N / AN / A87258744CCCCCTGTAGTGACAAGCAG719941047748N / AN / A40514070GAGGTTCGGCCCCTCCCTGA689951047764N / AN / A42584277AAAGCCCAGCCATGAATGAA1119961047780N / AN / A43174336CAACTCCTCCTTTATATGGA1049971047796N / AN / A43554374ATCCAATCTCCCTCATGGAC789981047812N / AN / A43884407GCCTGCTCTTTCCCTCACTT989991047828N / AN / A45204539TCTGATCCCAGGTAACCACC8110001047844N / AN / A46934712TACTAAGGTGCCTTATCAGG9210011047860N / AN / A48004819ACCCCCACCCAGGACCAGTA9410021047876N / AN / A48514870GACACTTGAATACCTGCCTC8910031047892N / AN / A50025021CATCAATCCTTTCCTCCCTC7910041047908N / AN / A51095128TCCTTCTCCCCATTCCTCAG8810051047924N / AN / A53555374TCTCTGAGTGTCTCTCTCAG9210061047940N / AN / A54785497CCTCTTCTGCCTGCCCCTCG11110071047956N / AN / A57845803TTCCCCCATTCTCTTGTACA9810081047972N / AN / A58365855GGTGAAAGTCAGTCACCTGG9010091047988N / AN / A60096028ATCTGTCAAAGAACAGCACC9610101048004N / AN / A60926111TAGAGTTGGAAATCCAACTC9210111048020N / AN / A62116230ACACCTTCCAGGTCAGACAC7110121048036N / AN / A63226341TGCCTAGCCCAAATGCCCCC11110131048052N / AN / A63866405AGGCTCTGTCCTCCACTAGG8710141048068N / AN / A65136532CCTCCCAGCCCCATCGGGCC14610151048084N / AN / A69556974CAGAACCTTCCACACTGACA12310161048100N / AN / A70657084TTCCCAACAACTGTGACCCA6910171048116N / AN / A73877406TGGCCCTTCTCCCCTGGCAT12210181048132N / AN / A78407859AAGGCTGAAAAAGACTCAGT8210191048148N / AN / A79828001GTGACCCAAGTCCTTGGCCT8510201048164N / AN / A82178236GGAAAGTCTAACTCCATCTC9310211048180N / AN / A93239342ACATTCACTAATATTTAACA9110221048196N / AN / A95109529CTGGTTAGCCTTTCTGATGC5110231048212N / AN / A95999618TCCTCTTTCCTACTTCTCTC7310241048228N / AN / A97099728GGGCCTACTTCTCTAGGTGG4810251048244N / AN / A98139832AGCTCAAGAAGTCCCAACTT8710261048260N / AN / A1061610635GCTTCATTTCAGCCCCTCTG8210271048276N / AN / A1070010719CTAGGCTCTTCCAAACGGGC9410281048292N / AN / A1077110790TGCCCGGCTTCCCCATCGCA9810291048308N / AN / A1093610955GCCCAAATCCCTCCTTACCT9510301048324N / AN / A1102111040GCTGGGAACCTTCTATGTGC6410311048340N / AN / A1113311152GGCTTTGGTACCAAGGCTCC8910321048356N / AN / A1130911328CCCCTGGTAGTTTCCTTTTA9410331048372N / AN / A1143311452TGGTGAGATAACACTGGGAA5110341048388N / AN / A1157111590ACAGTGCAACAGTTAGGAGT731035 Table 15 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 104715712314235713590CCAGGCCCCCCACCATCATC1161036104717323925836873706CTCCTTGAAGCCAGCATTGA951037104718947449339223941TGTCCCTCTCAACCTCCAGC11*1038104720554756649324951TTCTCGGCTTCCAGCCTCAG31*1039104722163765652265245ATCTCCTCCTCCAGCGACTC831040104723778680556725691ACGCCATTGCCTCATACTGC104104110472531021104075937612TGATAACTGGCCGCCTCCCG941042104726912271246N / AN / AGGCTGGTTTCTCGAATCTGC9210431047285128513041089910918ACGGTCTTCACCACGATGTT8610441047301134613651163511654TCACATCACATCCTTGTGCT7910451047317140614251169511714ATCCTGCTTCTGCTCGGGCC9810461047333161016291189911918TGGCCATGCCCCTCCAGACT7410471047349166016791194911968CCCCGCCCTCCTCCCCTTCT9810481047365172417431201312032ATCTCTGGCAACAGTTTCCA6010491047381177417931206312082GCCTGAGGAAACTCAAAGGC9110501047397183918581212812147TGGCCAGGGCTACCTTGTCT8210511047413203320521232212341CCCCACCCATCTTAGACTGA8410521047429217221911246112480AATCAAGCTCCCACCTGCCC4510531047445223422531252312542CCTCTATCCCTCCCAGCACC10410541047461227522941256412583CTTGACCTCTCTGTACCCAC6710551047477237523941266412683CACCCACAACCCCTACTTGT9710561047493245024691273912758TCTCCTGTTTCAGCATCTTC5810571047509247824971276712786CCCTGCCCCCATGGATACAT7610581047525276527841305413073GCTGCAGGAATATGAGCCAG8410591047541285828771314713166ACAGATCCCACCAGTCTGCT9810601047557289029091317913198TGAAGTGGGCCCTCCCAGTC8710611047573301630351330513324CAGCAGTGCCCTGAAGATTA4510621047589305430731334313362AGCATTTGTCTTTATTTTTC1710631047605N / AN / A87578776CCTTGTGATTTTCCCCGTCT6410641047621N / AN / A90239042TACAGTTACTCTGTACCACG11810651047637N / AN / A90659084GACTCACCACCTTTACCACT8710661047653N / AN / A91999218GATGAAAGAATAAAGCAGAG10210671047669N / AN / A83768395TGTACTGACCTCGAATCTGC9010681047685N / AN / A84398458GGAGCAACCTACAGGCCCTG10410691047701N / AN / A84788497AGAGCTGGATCCCTTTGCCC8710701047717N / AN / A86328651AGCTCTCACCCAGTTCTGCT6210711047733N / AN / A87318750CTTTTGCCCCCTGTAGTGAC5610721047749N / AN / A40884107GTGCCCCATCAAGAGGTAGG14710731047765N / AN / A42604279ACAAAGCCCAGCCATGAATG14210741047781N / AN / A43184337CCAACTCCTCCTTTATATGG7410751047797N / AN / A43564375AATCCAATCTCCCTCATGGA9310761047813N / AN / A43904409CTGCCTGCTCTTTCCCTCAC9910771047829N / AN / A45214540CTCTGATCCCAGGTAACCAC9610781047845N / AN / A47004719AACTCATTACTAAGGTGCCT10110791047861N / AN / A48014820CACCCCCACCCAGGACCAGT9010801047877N / AN / A48524871GGACACTTGAATACCTGCCT8410811047893N / AN / A50035022CCATCAATCCTTTCCTCCCT8210821047909N / AN / A51125131GGCTCCTTCTCCCCATTCCT9210831047925N / AN / A53685387TGTTTCTCTCCTCTCTCTGA11310841047941N / AN / A54845503TTGTGTCCTCTTCTGCCTGC9310851047957N / AN / A57865805CCTTCCCCCATTCTCTTGTA8710861047973N / AN / A58425861TTCTCTGGTGAAAGTCAGTC9510871047989N / AN / A60126031CTCATCTGTCAAAGAACAGC10210881048005N / AN / A61106129CTCCCAAGTGAGATGTGCTA11210891048021N / AN / A62126231CACACCTTCCAGGTCAGACA7010901048037N / AN / A63236342CTGCCTAGCCCAAATGCCCC8610911048053N / AN / A63966415TTCTGCCTCCAGGCTCTGTC11710921048069N / AN / A65196538GGAGGTCCTCCCAGCCCCAT9410931048085N / AN / A69566975CCAGAACCTTCCACACTGAC7910941048101N / AN / A70697088ACTTTTCCCAACAACTGTGA8410951048117N / AN / A73887407CTGGCCCTTCTCCCCTGGCA8110961048133N / AN / A78417860CAAGGCTGAAAAAGACTCAG12110971048149N / AN / A79858004AGGGTGACCCAAGTCCTTGG8910981048165N / AN / A82198238CAGGAAAGTCTAACTCCATC8010991048181N / AN / A93249343CACATTCACTAATATTTAAC93211048197N / AN / A95129531GCCTGGTTAGCCTTTCTGAT5911001048213N / AN / A96049623CCCTTTCCTCTTTCCTACTT7111011048229N / AN / A97279746TGTAAAATAAGGATGATGGG10111021048245N / AN / A98169835CAGAGCTCAAGAAGTCCCAA10111031048261N / AN / A1061710636GGCTTCATTTCAGCCCCTCT7311041048277N / AN / A1070210721GCCTAGGCTCTTCCAAACGG10511051048293N / AN / A1078410803CCATCCTCTCCCATGCCCGG10011061048309N / AN / A1093710956GGCCCAAATCCCTCCTTACC11811071048325N / AN / A1105811077CTCTCCTCCAGAATTCCCTG7611081048341N / AN / A1114911168TAGGATCCCATCTAGTGGCT5111091048357N / AN / A1131611335TCCCATTCCCCTGGTAGTTT5711101048373N / AN / A1143511454GGTGGTGAGATAACACTGGG8811111048389N / AN / A1160811627GGACTCCTTAATGACCTGCA531112 Table 16 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 104715812414335723591GCCAGGCCCCCCACCATCAT1021113104717424025936883707TCTCCTTGAAGCCAGCATTG1091114104719047749639253944GATTGTCCCTCTCAACCTCC17*1115104720656358249484967ATAGGCAGCCAGGTTGTTCT35*1116104722263865752275246GATCTCCTCCTCCAGCGACT751117104723880982856955714TTCGGCTTCATGCATGTTGC123111810472541026104575987617CCTCCTGATAACTGGCCGCC1171119104727012281247N / AN / AAGGCTGGTTTCTCGAATCTG11711201047286128613051090010919CACGGTCTTCACCACGATGT8911211047302134813671163711656CCTCACATCACATCCTTGTG10311221047318141314321170211721AGCAACTATCCTGCTTCTGC5811231047334161216311190111920GCTGGCCATGCCCCTCCAGA11411241047350166116801195011969CCCCCGCCCTCCTCCCCTTC9011251047366173117501202012039AACCTCCATCTCTGGCAACA5911261047382178218011207112090CTCCAGCAGCCTGAGGAAAC13111271047398184418631213312152GCCTCTGGCCAGGGCTACCT10011281047414203420531232312342TCCCCACCCATCTTAGACTG11311291047430217821971246712486GCTGAGAATCAAGCTCCCAC5411301047446223522541252412543CCCTCTATCCCTCCCAGCAC10011311047462227822971256712586GGGCTTGACCTCTCTGTACC7311321047478237623951266512684TCACCCACAACCCCTACTTG8111331047494245124701274012759CTCTCCTGTTTCAGCATCTT6111341047510248125001277012789ATGCCCTGCCCCCATGGATA8311351047526277727961306613085CCCGGCCTCCAGGCTGCAGG8911361047542285928781314813167CACAGATCCCACCAGTCTGC8511371047558290129201319013209GAGGAGAACCCTGAAGTGGG9511381047574301830371330713326AGCAGCAGTGCCCTGAAGAT7811391047590305530741334413363CAGCATTTGTCTTTATTTTT2111401047606N / AN / A87588777ACCTTGTGATTTTCCCCGTC7011411047622N / AN / A90249043GTACAGTTACTCTGTACCAC13811421047638N / AN / A90669085GGACTCACCACCTTTACCAC6811431047654N / AN / A92009219GGATGAAAGAATAAAGCAGA8511441047670N / AN / A83778396CTGTACTGACCTCGAATCTG9311451047686N / AN / A84438462GTCTGGAGCAACCTACAGGC7911461047702N / AN / A84958514CACGAAGGCCCCCAGGGAGA7711471047718N / AN / A86338652AAGCTCTCACCCAGTTCTGC10811481047734N / AN / A87338752TGCTTTTGCCCCCTGTAGTG4711491047750N / AN / A40904109TAGTGCCCCATCAAGAGGTA8811501047766N / AN / A42624281TCACAAAGCCCAGCCATGAA8911511047782N / AN / A43194338TCCAACTCCTCCTTTATATG8511521047798N / AN / A43574376GAATCCAATCTCCCTCATGG9411531047814N / AN / A43964415CCAGACCTGCCTGCTCTTTC8911541047830N / AN / A45234542TCCTCTGATCCCAGGTAACC7611551047846N / AN / A47014720TAACTCATTACTAAGGTGCC7911561047862N / AN / A48044823GACCACCCCCACCCAGGACC10511571047878N / AN / A48534872AGGACACTTGAATACCTGCC5611581047894N / AN / A50045023GCCATCAATCCTTTCCTCCC10011591047910N / AN / A51135132AGGCTCCTTCTCCCCATTCC9011601047926N / AN / A53795398CTGCCAATCTCTGTTTCTCT8511611047942N / AN / A54965515TTCCCCACGCCATTGTGTCC7611621047958N / AN / A57875806TCCTTCCCCCATTCTCTTGT12111631047974N / AN / A58515870CCATCTCACTTCTCTGGTGA8211641047990N / AN / A60196038CGGCTCTCTCATCTGTCAAA4311651048006N / AN / A61156134GCAGGCTCCCAAGTGAGATG9911661048022N / AN / A62216240CGTCAATATCACACCTTCCA9611671048038N / AN / A63246343CCTGCCTAGCCCAAATGCCC11911681048054N / AN / A64006419GCTTTTCTGCCTCCAGGCTC7711691048070N / AN / A65396558CCTTTCTCCCCTGCCTGCAG8911701048086N / AN / A69576976TCCAGAACCTTCCACACTGA8211711048102N / AN / A70707089GACTTTTCCCAACAACTGTG8411721048118N / AN / A73907409CCCTGGCCCTTCTCCCCTGG7611731048134N / AN / A78427861ACAAGGCTGAAAAAGACTCA8311741048150N / AN / A79868005GAGGGTGACCCAAGTCCTTG11011751048166N / AN / A82218240GCCAGGAAAGTCTAACTCCA7511761048182N / AN / A93269345GTCACATTCACTAATATTTA4411771048198N / AN / A95259544CCTCTACTAGTCAGCCTGGT6511781048214N / AN / A96069625TCCCCTTTCCTCTTTCCTAC7511791048230N / AN / A97729791CTCTGGGCAAGTTAATTGAC12211801048246N / AN / A98189837ACCAGAGCTCAAGAAGTCCC8311811048262N / AN / A1061810637TGGCTTCATTTCAGCCCCTC8111821048278N / AN / A1071010729CAGAGAGAGCCTAGGCTCTT9511831048294N / AN / A1078810807TGAGCCATCCTCTCCCATGC12511841048310N / AN / A1094010959CTGGGCCCAAATCCCTCCTT8311851048326N / AN / A1106011079TGCTCTCCTCCAGAATTCCC12311861048342N / AN / A1122311242CTAACTTTAATTCTCTTTCT11411871048358N / AN / A1131711336TTCCCATTCCCCTGGTAGTT8911881048374N / AN / A1143611455GGGTGGTGAGATAACACTGG10611891048390N / AN / A1160911628TGGACTCCTTAATGACCTGC681190 Table 17 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP RNA (% control) SEQ ID NO 104715912614535743593GAGCCAGGCCCCCCACCATC1041191104717524426336923711CGGGTCTCCTTGAAGCCAGC1251192104719148049939283947CCAGATTGTCCCTCTCAACC15*11931047207574593N / AN / AGCTTCCTGTCTATAGGCAGC37*1194104722363965852285247GGATCTCCTCCTCCAGCGAC791195104723981183056975716TCTTCGGCTTCATGCATGTT98119610472551028104776007619CGCCTCCTGATAACTGGCCG10511971047271124112601085510874AGACTTGGTGTCCAGGCTGG7911981047287128913081090310922CTCCACGGTCTTCACCACGA13811991047303134913681163811657GCCTCACATCACATCCTTGT11312001047319141414331170311722GAGCAACTATCCTGCTTCTG6812011047335161516341190411923GCTGCTGGCCATGCCCCTCC12312021047351166316821195211971GCCCCCCGCCCTCCTCCCCT7312031047367173417531202312042GAGAACCTCCATCTCTGGCA6712041047383179018091207912098CAGTTTTCCTCCAGCAGCCT109111047399185318721214212161ACAAAACAAGCCTCTGGCCA9012061047415203520541232412343GTCCCCACCCATCTTAGACT7612071047431217921981246812487TGCTGAGAATCAAGCTCCCA9112081047447223622551252512544CCCCTCTATCCCTCCCAGCA8312091047463227922981256812587TGGGCTTGACCTCTCTGTAC10312101047479237723961266612685GTCACCCACAACCCCTACTT8812111047495245624751274512764CCTTTCTCTCCTGTTTCAGC5412121047511248225011277112790CATGCCCTGCCCCCATGGAT8312131047527277927981306813087CACCCGGCCTCCAGGCTGCA10612141047543286028791314913168GCACAGATCCCACCAGTCTG10812151047559290229211319113210AGAGGAGAACCCTGAAGTGG12012161047575303430531332313342CTCAGCGACTAAAGGCAGCA5912171047591305630751334513364GCAGCATTTGTCTTTATTTT2212181047607N / AN / A87608779TGACCTTGTGATTTTCCCCG5912191047623N / AN / A90259044TGTACAGTTACTCTGTACCA10312201047639N / AN / A90679086AGGACTCACCACCTTTACCA7712211047655N / AN / A92019220GGGATGAAAGAATAAAGCAG6712221047671N / AN / A83788397GCTGTACTGACCTCGAATCT9412231047687N / AN / A84538472CTCAGTCCCAGTCTGGAGCA12312241047703N / AN / A85028521GCAGTGTCACGAAGGCCCCC8912251047719N / AN / A86358654TCAAGCTCTCACCCAGTTCT9612261047735N / AN / A87358754GGTGCTTTTGCCCCCTGTAG5512271047751N / AN / A40914110ATAGTGCCCCATCAAGAGGT13512281047767N / AN / A42634282GTCACAAAGCCCAGCCATGA12212291047783N / AN / A43214340CTTCCAACTCCTCCTTTATA9512301047799N / AN / A43584377AGAATCCAATCTCCCTCATG6712311047815N / AN / A43994418CGCCCAGACCTGCCTGCTCT9412321047831N / AN / A45244543TTCCTCTGATCCCAGGTAAC8612331047847N / AN / A47024721TTAACTCATTACTAAGGTGC8712341047863N / AN / A48054824AGACCACCCCCACCCAGGAC9612351047879N / AN / A48664885CCAGGCTCTTCTGAGGACAC11912361047895N / AN / A50055024GGCCATCAATCCTTTCCTCC8112371047911N / AN / A51155134CCAGGCTCCTTCTCCCCATT9212381047927N / AN / A53855404CTCTACCTGCCAATCTCTGT8612391047943N / AN / A54975516GTTCCCCACGCCATTGTGTC7812401047959N / AN / A57885807CTCCTTCCCCCATTCTCTTG10412411047975N / AN / A59335952GCTACTACTAATAATAGCAA9912421047991N / AN / A60216040TTCGGCTCTCTCATCTGTCA8012431048007N / AN / A61176136ATGCAGGCTCCCAAGTGAGA8812441048023N / AN / A62806299CCACACTACATATAAGCTCT16312451048039N / AN / A63256344TCCTGCCTAGCCCAAATGCC10012461048055N / AN / A64036422TGTGCTTTTCTGCCTCCAGG5212471048071N / AN / A65436562TAGCCCTTTCTCCCCTGCCT7712481048087N / AN / A69586977ATCCAGAACCTTCCACACTG8812491048103N / AN / A70727091GGGACTTTTCCCAACAACTG6812501048119N / AN / A73937412CGTCCCTGGCCCTTCTCCCC7712511048135N / AN / A78437862CACAAGGCTGAAAAAGACTC9412521048151N / AN / A79878006GGAGGGTGACCCAAGTCCTT3512531048167N / AN / A82228241TGCCAGGAAAGTCTAACTCC7712541048183N / AN / A93629381TCCCCCCGCCCCGCCCGAGA8812551048199N / AN / A95339552CAGTATTACCTCTACTAGTC64201048215N / AN / A96099628CTGTCCCCTTTCCTCTTTCC9812561048231N / AN / A97889807CCAACCAGCCACATGACTCT9112571048247N / AN / A98259844TCAGGAGACCAGAGCTCAAG9312581048263N / AN / A1062010639CCTGGCTTCATTTCAGCCCC8712591048279N / AN / A1071110730GCAGAGAGAGCCTAGGCTCT14312601048295N / AN / A1079210811GGCATGAGCCATCCTCTCCC12312611048311N / AN / A1094110960ACTGGGCCCAAATCCCTCCT10412621048327N / AN / A1106111080TTGCTCTCCTCCAGAATTCC9712631048343N / AN / A1122611245CTACTAACTTTAATTCTCTT9712641048359N / AN / A1131811337CTTCCCATTCCCCTGGTAGT8612651048375N / AN / A1148711506GTCTTACTTTTCTTGATAGT9412661048391N / AN / A1161011629TTGGACTCCTTAATGACCTG861267 Example 2: Effect of 5-10-5 MOE gapmer modified oligonucleotides on human GFAP RNA in vitro, single dose

[0225] Modified oligonucleotides complementary to human GFAP nucleic acid were designed and tested for their single dose effects on GFAP RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

[0226] The modified oligonucleotides in the tables below are 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages. The gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2'-β-D-deoxynucleosides and the 5' and 3' wing segments each consists of five 2'-β-D-MOE modified nucleosides. The sugar motif for the gapmers is (from 5' to 3'): eeeeeddddddddddeeeee; wherein 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, and 'e' represents a 2'- β-D-MOE sugar moiety. The internucleoside linkage motif for the gapmers is (from 5' to 3'): sooosssssssssssooss; wherein each 'o' represents a phosphodiester internucleoside linkage and each 's' represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methyl cytosine.

[0227] "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the Tables below is 100% complementary to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 (GENBANK Accession No. NM_001131019.2). 'N / A' indicates that the modified oligonucleotide is not 100% complementary to that particular gene sequence.

[0228] Cultured U251 cells were treated with modified oligonucleotide at a concentration of 4,000nM using free uptake at a density of 10,000 cells per well. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and GFAP RNA levels were measured by quantitative real-time RTPCR. Human GFAP primer probe set RTS37485, described in Example 1 above, was used to measure RNA levels. GFAP RNA levels were normalized to total RNA content, as measured by RIBOGREEN ®< . Results are presented in the tables below as percent GFAP RNA levels relative to untreated control cells. The values marked with an asterisk (*) indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region. Table 18 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG85171072810170817271199712016TCCATAACAACAGGAATCAG6512681072814171917381200812027TGGCAACAGTTTCCATAACA3112691072818172817471201712036CTCCATCTCTGGCAACAGTT4212701072822175217711204112060AGTTCCCAGATACTCCGAGA5612711072826176317821205212071CTCAAAGGCACAGTTCCCAG5612721072830178618051207512094TTTCCTCCAGCAGCCTGAGG7912731072834179618151208512104GAGTCTCAGTTTTCCTCCAG1812741072838217321921246212481GAATCAAGCTCCCACCTGCC8712751072842217721961246612485CTGAGAATCAAGCTCCCACC9412761072846303930581332813347TTTTCCTCAGCGACTAAAGG4812771072850305930781334813367GGCGCAGCATTTGTCTTTAT4512781072854N / AN / A87688787ATATCTTGTGACCTTGTGAT5312791072858N / AN / A87748793TTTGAGATATCTTGTGACCT6612801072862N / AN / A87808799GAGGCTTTTGAGATATCTTG2812811072866N / AN / A87858804ATTGTGAGGCTTTTGAGATA6612821072870N / AN / A79807999GACCCAAGTCCTTGGCCTTG8112831072874N / AN / A79908009TTTGGAGGGTGACCCAAGTC7812841072878N / AN / A79978016CTCTTAGTTTGGAGGGTGAC6112851072882N / AN / A1129611315CCTTTTACCAAGCTGGAAAT7312861072886N / AN / A1130311322GTAGTTTCCTTTTACCAAGC3412871072890N / AN / A40334052GAGACTTCTCGGGCACTCCT7512881072894N / AN / A41334152TGGGCCTGTTTCTGGTCCCT6312891072898N / AN / A42084227TTCCCCAGTAGGGAGGTGCT10012901072902N / AN / A42854304ATAGGTGAGCTCGCTGCCCA8212911072906N / AN / A42974316CACAGGCTCAGAATAGGTGA6812921072910N / AN / A44584477CAAGTCAAAGTAACTTGATG8012931072914N / AN / A44924511TGAATTTTATTATGACCACC6412941072918N / AN / A45644583CATGTCCTGTCAGCTCAGTG6112951072922N / AN / A46384657CACAAGCATACACTCACTGT8412961072926N / AN / A46774696CAGGGTTGGTGCACCTGCTT7412971072930N / AN / A47484767TAGACAGAGGACTTGTCTGG9612981072934N / AN / A48264845CCCTTGAGGCAGCTGTCACA8712991072938N / AN / A50495068CATTGCTCTGGCGGGCTGAG8913001072942N / AN / A52965315CAATCTCTGTGTTGAGCTTT7013011072946N / AN / A53965415TCATTTCCTGTCTCTACCTG8513021072950N / AN / A55495568GACCAGGGTGAGAGAAGCGG7813031072954N / AN / A57455764GAGGAGGCAGGCTGGCCCAC8413041072958N / AN / A59005919AATAATGGGTACTTTTGAAA8813051072962N / AN / A59866005TTCATAGTAAGGTAATCCAT7513061072966N / AN / A60326051CCTCTCTGGACTTCGGCTCT8113071072970N / AN / A62406259GGCACTATGTTTGGGTGCAC8513081072974N / AN / A63026321TCTACAGTGTCTTTCCTGGC6713091072978N / AN / A64466465CTAGGTGCCCTGGCTAGGCT7213101072982N / AN / A65246543TGCAGGGAGGTCCTCCCAGC9613111072986N / AN / A69016920GCGAGCGGAGGCCTGGGTGT2613121072990N / AN / A69426961ACTGACAGCTGCATCTGCGG7913131072994N / AN / A69857004AAGCGAATGAATGAACAGTG6913141072998N / AN / A70797098CCTGGCTGGGACTTTTCCCA8413151073002N / AN / A71197138GGGAGGTGAGCAGCACCCCA8413161073006N / AN / A73587377TGGCCGTCCCTGCTCCGCCC9613171073010N / AN / A75107529GGCCGGTCCCGCGGAGCCCC8613181073014N / AN / A75217540GGGATGGAGCCGGCCGGTCC7713191073018N / AN / A77857804AGCAGGGAGACTTCCCCAGG8513201073022N / AN / A78277846ACTCAGTCCCTGAAGGGAGC9013211073026N / AN / A78987917CTGCTATGTGTGAGGCAGGC8313221073030N / AN / A80278046CAATCTTGGCTGGGAAGATG9013231073034N / AN / A80488067AGATGGGTGAGGTGAGGAGT3313241073038N / AN / A82318250CCTTTTCCTTGCCAGGAAAG7613251073042N / AN / A93809399AGTAATTTAGCTCCCCCCTC7613261073046N / AN / A94109429AGAATCATTTCAGGGCCAAT6713271073050N / AN / A94389457GAAGAAGAGGAATTTTGTTC8213281073054N / AN / A94869505TTAAGTCCTGAGACATGCAT5513291073058N / AN / A95009519TTTCTGATGCTGAATTAAGT8813301073062N / AN / A95439562TAGGATTTGGCAGTATTACC6213311073066N / AN / A96499668TGTGGCACATATTAGTGCTC7613321073070N / AN / A1000110020AATCCCCTTACTCGGGAGTC7613331073074N / AN / A1055110570TTGAAATCAGGAGACCAGGA7313341073078N / AN / A1056710586AAAACCCAGCACGGTATTGA7313351073082N / AN / A1071510734CCGAGCAGAGAGAGCCTAGG8813361073086N / AN / A1080510824CATGGACTTTCAGGGCATGA9013371073090N / AN / A1110511124CAGCCTATGGAGGGACTGAG8813381073094N / AN / A1116511184AAGAGAGAGTGTGTATTAGG6313391073098N / AN / A1120811227TTTCTCTCCCTGGCAAGCAA6513401073102N / AN / A1125611275AACTGTGTCTGCTAGAGTTG6613411073106N / AN / A1138611405GTAAGCTGCTGGAGTAAGAT4513421073110N / AN / A1147211491ATAGTAACCACAGCTGCCTT8113431073114N / AN / A1151611535GTAACCTTGGGAAGTCCCCG751344 Table 19 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG75171072811171117301200012019GTTTCCATAACAACAGGAAT8213451072815172017391200912028CTGGCAACAGTTTCCATAAC4013461072819174617651203512054CAGATACTCCGAGAGAACCT7513471072823175317721204212061CAGTTCCCAGATACTCCGAG6513481072827176617851205512074AAACTCAAAGGCACAGTTCC9913491072831178718061207612095TTTTCCTCCAGCAGCCTGAG8513501072835179718161208612105TGAGTCTCAGTTTTCCTCCA1813511072839217421931246312482AGAATCAAGCTCCCACCTGC8213521072843303630551332513344TCCTCAGCGACTAAAGGCAG5413531072847304130601333013349ATTTTTCCTCAGCGACTAAA5513541072851306130801335013369AGGGCGCAGCATTTGTCTTT5513551072855N / AN / A87718790GAGATATCTTGTGACCTTGT3713561072859N / AN / A87758794TTTTGAGATATCTTGTGACC6013571072863N / AN / A87818800TGAGGCTTTTGAGATATCTT3413581072867N / AN / A87868805TATTGTGAGGCTTTTGAGAT6013591072871N / AN / A79838002GGTGACCCAAGTCCTTGGCC7613601072875N / AN / A79918010GTTTGGAGGGTGACCCAAGT7013611072879N / AN / A1129011309ACCAAGCTGGAAATGGAAAG7013621072883N / AN / A1129711316TCCTTTTACCAAGCTGGAAA8313631072887N / AN / A1130411323GGTAGTTTCCTTTTACCAAG4913641072891N / AN / A40354054CTGAGACTTCTCGGGCACTC8713651072895N / AN / A41624181GGCATGCGGGCATCAGATCC8713661072899N / AN / A42214240CTCCTGCACTGCTTTCCCCA6413671072903N / AN / A42874306GAATAGGTGAGCTCGCTGCC8913681072907N / AN / A43044323ATATGGACACAGGCTCAGAA7913691072911N / AN / A44634482CTGTGCAAGTCAAAGTAACT7613701072915N / AN / A44934512ATGAATTTTATTATGACCAC6713711072919N / AN / A45814600ACTTGAAGGCACACATGCAT7013721072923N / AN / A46484667CAGGCGCATCCACAAGCATA8813731072927N / AN / A47324751CTGGAGGATGAGCAGATGTG5713741072931N / AN / A47794798AGCAGCAGGAGGATTAAGGG6813751072935N / AN / A48274846TCCCTTGAGGCAGCTGTCAC9613761072939N / AN / A50585077GGAGCAGCACATTGCTCTGG8013771072943N / AN / A52995318TTGCAATCTCTGTGTTGAGC5513781072947N / AN / A54525471AGTTCGAATGCTCTCTTGTC7813791072951N / AN / A57155734ACCTTGGAGCGGTACCACTC11113801072955N / AN / A58285847TCAGTCACCTGGAGAGGATA5813811072959N / AN / A59185937AGCAATAGTAGCAGTAATAA8213821072963N / AN / A59876006CTTCATAGTAAGGTAATCCA8413831072967N / AN / A61226141ATGGAATGCAGGCTCCCAAG7113841072971N / AN / A62516270TGTTCTCTACGGGCACTATG5813851072975N / AN / A63746393CCACTAGGAATGGCCCTCCC6113861072979N / AN / A64516470CTCAGCTAGGTGCCCTGGCT8013871072983N / AN / A65616580CCTCACCCTGGGTTCTAATA8313881072987N / AN / A69036922AGGCGAGCGGAGGCCTGGGT9713891072991N / AN / A69446963ACACTGACAGCTGCATCTGC7913901072995N / AN / A69977016CACCTGGTCAGCAAGCGAAT7813911072999N / AN / A70827101GGCCCTGGCTGGGACTTTTC7913921073003N / AN / A71257144AAATCAGGGAGGTGAGCAGC4613931073007N / AN / A73827401CTTCTCCCCTGGCATCTCCT7713941073011N / AN / A75177536TGGAGCCGGCCGGTCCCGCG8713951073015N / AN / A77577776TGAGGGCTCACCGGTTCTCC8113961073019N / AN / A77897808AGGCAGCAGGGAGACTTCCC8813971073023N / AN / A78557874AAGGGATCTGCACACAAGGC7913981073027N / AN / A79247943TCAGTCATCAAACATCTAGT7813991073031N / AN / A80288047CCAATCTTGGCTGGGAAGAT6614001073035N / AN / A80518070AAGAGATGGGTGAGGTGAGG3614011073039N / AN / A82748293TAGGCTGGGTCTTGGTGCGG7614021073043N / AN / A93819400AAGTAATTTAGCTCCCCCCT7614031073047N / AN / A94119430AAGAATCATTTCAGGGCCAA5414041073051N / AN / A94409459CAGAAGAAGAGGAATTTTGT7014051073055N / AN / A94879506ATTAAGTCCTGAGACATGCA6414061073059N / AN / A95029521CCTTTCTGATGCTGAATTAA7214071073063N / AN / A95529571GTGACTATCTAGGATTTGGC2314081073067N / AN / A96859704GAGGAGACAATTAACTAAAA6414091073071N / AN / A1012510144TCGAAAGCAGGCAAGCAAGC9914101073075N / AN / A1055210571ATTGAAATCAGGAGACCAGG6614111073079N / AN / A1061210631CATTTCAGCCCCTCTGCAAG7714121073083N / AN / A1072410743CCTATGCAACCGAGCAGAGA9514131073087N / AN / A1084810867GTGTCCAGGCTGGTTTCTGC8214141073091N / AN / A1112411143ACCAAGGCTCCCCTTAGAAC5914151073095N / AN / A1116611185AAAGAGAGAGTGTGTATTAG7814161073099N / AN / A1121011229TCTTTCTCTCCCTGGCAAGC7314171073103N / AN / A1128311302TGGAAATGGAAAGCCCTCCC7814181073107N / AN / A1139111410GAGTGGTAAGCTGCTGGAGT4214191073111N / AN / A1147411493TGATAGTAACCACAGCTGCC9214201073115N / AN / A1151811537GTGTAACCTTGGGAAGTCCC771421 Table 20 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG75171072812171317321200212021CAGTTTCCATAACAACAGGA5814221072816172217411201112030CTCTGGCAACAGTTTCCATA6914231072820174917681203812057TCCCAGATACTCCGAGAGAA7314241072824175817771204712066AGGCACAGTTCCCAGATACT3614251072828178418031207312092TCCTCCAGCAGCCTGAGGAA7114261072832178818071207712096GTTTTCCTCCAGCAGCCTGA6414271072836216821871245712476AAGCTCCCACCTGCCCACAG7314281072840217521941246412483GAGAATCAAGCTCCCACCTG7414291072844303730561332613345TTCCTCAGCGACTAAAGGCA6114301072848304230611333113350TATTTTTCCTCAGCGACTAA6914311072852306330821335213371GAAGGGCGCAGCATTTGTCT5714321072856N / AN / A87728791TGAGATATCTTGTGACCTTG4314331072860N / AN / A87768795CTTTTGAGATATCTTGTGAC6214341072864N / AN / A87838802TGTGAGGCTTTTGAGATATC4314351072868N / AN / A87888807CGTATTGTGAGGCTTTTGAG2014361072872N / AN / A79848003GGGTGACCCAAGTCCTTGGC1414371072876N / AN / A79928011AGTTTGGAGGGTGACCCAAG6114381072880N / AN / A1129311312TTTACCAAGCTGGAAATGGA8314391072884N / AN / A1129811317TTCCTTTTACCAAGCTGGAA7714401072888N / AN / A1131011329TCCCCTGGTAGTTTCCTTTT8514411072892N / AN / A40554074CAGGGAGGTTCGGCCCCTCC8314421072896N / AN / A41744193CTCCTGGCAGAAGGCATGCG7514431072900N / AN / A42314250GGCCCCGCTGCTCCTGCACT10514441072904N / AN / A42894308CAGAATAGGTGAGCTCGCTG8314451072908N / AN / A43074326TTTATATGGACACAGGCTCA8314461072912N / AN / A44824501TATGACCACCGCTTCACAGC9514471072916N / AN / A45584577CTGTCAGCTCAGTGAAGCGC8614481072920N / AN / A46284647CACTCACTGTTGCACACACA8914491072924N / AN / A46514670ACACAGGCGCATCCACAAGC9814501072928N / AN / A47394758GACTTGTCTGGAGGATGAGC7314511072932N / AN / A47854804CAGTAGAGCAGCAGGAGGAT8214521072936N / AN / A48824901GGACACATTCCTGGGTCCAG10014531072940N / AN / A51425161GGTGAGGAGTAGAGGGCCAC8814541072944N / AN / A53075326TCTCTCAGTTGCAATCTCTG8414551072948N / AN / A54535472GAGTTCGAATGCTCTCTTGT7514561072952N / AN / A57305749CCCACAGGCAGGGCTACCTT8914571072956N / AN / A58915910TACTTTTGAAAGCAATAGTG7714581072960N / AN / A59535972CTTAGAACAGAACAGTATCA10114591072964N / AN / A60286047TCTGGACTTCGGCTCTCTCA5514601072968N / AN / A61406159AAACAGACTGGCAGAGGCAT5914611072972N / AN / A62606279GAGCTGTGGTGTTCTCTACG5814621072976N / AN / A63806399TGTCCTCCACTAGGAATGGC7614631072980N / AN / A64596478TCACACTCCTCAGCTAGGTG3214641072984N / AN / A65636582GGCCTCACCCTGGGTTCTAA7614651072988N / AN / A69056924TTAGGCGAGCGGAGGCCTGG9514661072992N / AN / A69456964CACACTGACAGCTGCATCTG9014671072996N / AN / A70037022GCACAACACCTGGTCAGCAA7314681073000N / AN / A70857104GTTGGCCCTGGCTGGGACTT6314691073004N / AN / A71267145GAAATCAGGGAGGTGAGCAG6314701073008N / AN / A74757494GGTTTCGAGGCCCGGCCCCC7314711073012N / AN / A75187537ATGGAGCCGGCCGGTCCCGC9214721073016N / AN / A77627781TGTGATGAGGGCTCACCGGT6514731073020N / AN / A77977816CTACCGTGAGGCAGCAGGGA8614741073024N / AN / A78767895TGTGCTGGGCATTGAGGTGG6414751073028N / AN / A79677986GGCCTTGAGGCCTAATCAAT7814761073032N / AN / A80458064TGGGTGAGGTGAGGAGTCCA7314771073036N / AN / A80578076AGGCAGAAGAGATGGGTGAG6714781073040N / AN / A93559374GCCCCGCCCGAGAGAGAAAA9214791073044N / AN / A94079426ATCATTTCAGGGCCAATGCA6614801073048N / AN / A94239442TGTTCCTTAGCTAAGAATCA5814811073052N / AN / A94429461TCCAGAAGAAGAGGAATTTT9414821073056N / AN / A94889507AATTAAGTCCTGAGACATGC5114831073060N / AN / A95179536AGTCAGCCTGGTTAGCCTTT3614841073064N / AN / A95609579AGTGACCTGTGACTATCTAG3514851073068N / AN / A98899908TCTGCCGAAGGAAGGAAGGA7714861073072N / AN / A1012910148TCCGTCGAAAGCAGGCAAGC8314871073076N / AN / A1055510574GGTATTGAAATCAGGAGACC5914881073080N / AN / A1066210681CAATAGTGCTGCTGCCAGAG5414891073084N / AN / A1072710746GAACCTATGCAACCGAGCAG5614901073088N / AN / A1100811027TATGTGCCAGCCCCAGGCTT8914911073092N / AN / A1112811147TGGTACCAAGGCTCCCCTTA7414921073096N / AN / A1118711206GCCCCCGAGTTTGAGGGTGA9014931073100N / AN / A1124011259GTTGGAAGTGAAAGCTACTA5814941073104N / AN / A1136511384AGCTCCCACTGTGGTTGGAG8714951073108N / AN / A1139911418TGCCTGGCGAGTGGTAAGCT9114961073112N / AN / A1147611495CTTGATAGTAACCACAGCTG6314971073116N / AN / A1156111580AGTTAGGAGTTCACACAGAC721498 Table 21 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG85171072813171717361200612025GCAACAGTTTCCATAACAAC3214991072817172517441201412033CATCTCTGGCAACAGTTTCC6215001072821175117701204012059GTTCCCAGATACTCCGAGAG5315011072825175917781204812067AAGGCACAGTTCCCAGATAC5115021072829178518041207412093TTCCTCCAGCAGCCTGAGGA8915031072833178918081207812097AGTTTTCCTCCAGCAGCCTG4615041072837217121901246012479ATCAAGCTCCCACCTGCCCA6415051072841217621951246512484TGAGAATCAAGCTCCCACCT9015061072845303830571332713346TTTCCTCAGCGACTAAAGGC5215071072849305730761334613365CGCAGCATTTGTCTTTATTT2615081072853306430831335313372GGAAGGGCGCAGCATTTGTC4315091072857N / AN / A87738792TTGAGATATCTTGTGACCTT3215101072861N / AN / A87798798AGGCTTTTGAGATATCTTGT3515111072865N / AN / A87848803TTGTGAGGCTTTTGAGATAT4715121072869N / AN / A79777996CCAAGTCCTTGGCCTTGAGG9315131072873N / AN / A79888007TGGAGGGTGACCCAAGTCCT10715141072877N / AN / A79948013TTAGTTTGGAGGGTGACCCA6815151072881N / AN / A1129511314CTTTTACCAAGCTGGAAATG10315161072885N / AN / A1129911318TTTCCTTTTACCAAGCTGGA8015171072889N / AN / A40274046TCTCGGGCACTCCTTCTTGG9615181072893N / AN / A40844103CCCATCAAGAGGTAGGGAGG6615191072897N / AN / A41834202GACCCTGGACTCCTGGCAGA8315201072901N / AN / A42534272CCAGCCATGAATGAAACACA8215211072905N / AN / A42934312GGCTCAGAATAGGTGAGCTC6715221072909N / AN / A44354454GTCACAAGCTGGTGGCAGGC6915231072913N / AN / A44874506TTTATTATGACCACCGCTTC9215241072917N / AN / A45634582ATGTCCTGTCAGCTCAGTGA5015251072921N / AN / A46324651CATACACTCACTGTTGCACA8315261072925N / AN / A46694688GTGCACCTGCTTCTGCTCAC11115271072929N / AN / A47414760AGGACTTGTCTGGAGGATGA4715281072933N / AN / A48224841TGAGGCAGCTGTCACAGAGA10215291072937N / AN / A49044923CATCCTGGAGCCTGGAGTGG8715301072941N / AN / A52955314AATCTCTGTGTTGAGCTTTC5615311072945N / AN / A53085327CTCTCTCAGTTGCAATCTCT7515321072949N / AN / A54605479CGGCCAGGAGTTCGAATGCT8115331072953N / AN / A57335752TGGCCCACAGGCAGGGCTAC8315341072957N / AN / A58955914TGGGTACTTTTGAAAGCAAT7515351072961N / AN / A59655984AAAAGCACAGGGCTTAGAAC7615361072965N / AN / A60316050CTCTCTGGACTTCGGCTCTC8815371072969N / AN / A61676186GGCATATGGTAGAGGCTCAG5615381072973N / AN / A62706289TATAAGCTCTGAGCTGTGGT3715391072977N / AN / A64436462GGTGCCCTGGCTAGGCTAGC7715401072981N / AN / A64606479CTCACACTCCTCAGCTAGGT7715411072985N / AN / A68976916GCGGAGGCCTGGGTGTTTTG7515421072989N / AN / A69086927GTCTTAGGCGAGCGGAGGCC9015431072993N / AN / A69726991AACAGTGCCACAGAATCCAG9115441072997N / AN / A70517070GACCCATGGATGCGGGCAGG6815451073001N / AN / A70867105CGTTGGCCCTGGCTGGGACT7115461073005N / AN / A72017220TCTGTCAGGTCTGCAAACTA8315471073009N / AN / A74797498GGGAGGTTTCGAGGCCCGGC4115481073013N / AN / A75207539GGATGGAGCCGGCCGGTCCC8115491073017N / AN / A77647783GCTGTGATGAGGGCTCACCG6815501073021N / AN / A78187837CTGAAGGGAGCAAGATGAGC8215511073025N / AN / A78787897ACTGTGCTGGGCATTGAGGT7715521073029N / AN / A80058024GAGTATGCCTCTTAGTTTGG6315531073033N / AN / A80468065ATGGGTGAGGTGAGGAGTCC3615541073037N / AN / A80788097GTGGTGAAGAAAGTTCCAAG8815551073041N / AN / A93569375CGCCCCGCCCGAGAGAGAAA6415561073045N / AN / A94099428GAATCATTTCAGGGCCAATG2715571073049N / AN / A94259444TTTGTTCCTTAGCTAAGAAT6215581073053N / AN / A94449463AGTCCAGAAGAAGAGGAATT6815591073057N / AN / A94979516CTGATGCTGAATTAAGTCCT5015601073061N / AN / A95199538CTAGTCAGCCTGGTTAGCCT5715611073065N / AN / A95779596CCATTTATCTGTGCTTTAGT3915621073069N / AN / A98929911CGCTCTGCCGAAGGAAGGAA6115631073073N / AN / A1054810567AAATCAGGAGACCAGGAGGG5915641073077N / AN / A1056110580CAGCACGGTATTGAAATCAG4215651073081N / AN / A1069210711TTCCAAACGGGCTGGAGAGC8415661073085N / AN / A1080410823ATGGACTTTCAGGGCATGAG6415671073089N / AN / A1109711116GGAGGGACTGAGGAAACGGA6815681073093N / AN / A1115711176GTGTGTATTAGGATCCCATC2415691073097N / AN / A1119311212AGCAAGGCCCCCGAGTTTGA8115701073101N / AN / A1124611265GCTAGAGTTGGAAGTGAAAG6715711073105N / AN / A1136811387ATGAGCTCCCACTGTGGTTG7215721073109N / AN / A1142711446GATAACACTGGGAAAGCATT9115731073113N / AN / A1151411533AACCTTGGGAAGTCCCCGAC8515741073117N / AN / A1156311582ACAGTTAGGAGTTCACACAG751575 Table 22 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG55171103152416034893508CTGGCTCTGCTCGCTCCTGG911576110316827229137203739CTCCATCATCTCTGCCCGCT1061577110318456558449504969CTATAGGCAGCCAGGTTGTT69*1578110320076077956465665ATCTCTTTCAGGGCTGCGGT65157911032161062108176347653TGAGGCTCTGCCCCTCTTCC11115801103232133513541162411643CCTTGTGCTCCTGCTTGGAC8815811103248152715461181611835AGGCCTGATACTGACGGAGC7915821103264166916881195811977GTAGGTGCCCCCCGCCCTCC9015831103280173317521202212041AGAACCTCCATCTCTGGCAA6215841103296186018791214912168CCAAAAGACAAAACAAGCCT7515851103312188619051217512194CATAGGGATATCCCACCTCA11115861103328209421131238312402GTCATCGCTCAGGAGGTCCT6915871103344223122501252012539CTATCCCTCCCAGCACCTCA10915881103360242724461271612735AGGATGAGTCACTTCCTTAA7315891103376248425031277312792GTCATGCCCTGCCCCCATGG9015901103392251225311280112820AGGAAGAGGCCTTTAGAAAT6815911103408267226911296112980GTGTGTGAGTAAGAAGGGAC5515921103424272427431301313032TCAGTTTTACAATTGTAAAA8315931103440289929181318813207GGAGAACCCTGAAGTGGGCC7615941103472N / AN / A87878806GTATTGTGAGGCTTTTGAGA4315951103488N / AN / A88998918GAGGCTCACTCCCTGTCAAG6015961103504N / AN / A90459064AACAAGCTCTGCCAGTTTAA6615971103520N / AN / A92349253TGAGTCAGCACTGAGCTGAG9515981103536N / AN / A92709289CAAGAGCTGCGGTCCTGAGG5915991103552N / AN / A93109329TTTAACATTAAGAGCAGGGA6316001103568N / AN / A85328551CTGGTATGATAGGCTCTGGC8616011103584N / AN / A86508669CAGACAGGGCAGATGTCAAG9216021103600N / AN / A39994018CCCCTTCTGCTCACAAGGCC12116031103616N / AN / A41604179CATGCGGGCATCAGATCCCC8916041103632N / AN / A42754294TCGCTGCCCACAGTCACAAA10416051103648N / AN / A44074426GTGCTTTGCGCCCAGACCTG10516061103664N / AN / A44964515GAAATGAATTTTATTATGAC10616071103680N / AN / A46404659TCCACAAGCATACACTCACT8116081103696N / AN / A48374856TGCCTCAGTCTCCCTTGAGG10716091103712N / AN / A51005119CCATTCCTCAGCCTTGCCTT9816101103728N / AN / A53465365GTCTCTCTCAGTCTCAGCTT7816111103744N / AN / A54135432GTCTTTCTGTTTGTCTTTCA5716121103760N / AN / A54875506CCATTGTGTCCTCTTCTGCC10216131103776N / AN / A57765795TTCTCTTGTACAGAGCAAGA7916141103792N / AN / A58605879CTGGGCAAGCCATCTCACTT8616151103808N / AN / A59415960CAGTATCAGCTACTACTAAT8016161103824N / AN / A59785997AAGGTAATCCATGAAAAGCA8416171103840N / AN / A60246043GACTTCGGCTCTCTCATCTG8216181103856N / AN / A62046223CCAGGTCAGACACCTCTCTG8116191103872N / AN / A62676286AAGCTCTGAGCTGTGGTGTT3316201103888N / AN / A63156334CCCAAATGCCCCCTCTACAG9316211103904N / AN / A64146433CCCTGCCTCTCTGTGCTTTT9216221103920N / AN / A65176536AGGTCCTCCCAGCCCCATCG10816231103936N / AN / A69476966TCCACACTGACAGCTGCATC9216241103952N / AN / A70307049TAGCGGGCTGCCAGACCTCA10216251103968N / AN / A73267345CCCTGGCCGCGCTCACCGTG9616261103984N / AN / A74217440TTCAGGCCCCGCCCTCGACC8116271104000N / AN / A78147833AGGGAGCAAGATGAGCTCTA12016281104016N / AN / A79407959GAATCCATCCATCCATTCAG8616291104032N / AN / A80388057GGTGAGGAGTCCAATCTTGG7616301104048N / AN / A80808099AAGTGGTGAAGAAAGTTCCA10816311104064N / AN / A82518270CATCATGACAACTTGAACGC9816321104080N / AN / A93649383CCTCCCCCCGCCCCGCCCGA11116331104096N / AN / A94149433GCTAAGAATCATTTCAGGGC4016341104112N / AN / A94559474CTAAATATTCTAGTCCAGAA9716351104128N / AN / A95099528TGGTTAGCCTTTCTGATGCT8416361104144N / AN / A95359554GGCAGTATTACCTCTACTAG2816371104160N / AN / A95599578GTGACCTGTGACTATCTAGG4716381104176N / AN / A95799598TGCCATTTATCTGTGCTTTA5016391104192N / AN / A96659684TAAAGGCTGTTAAACATGTG5116401104208N / AN / A97859804ACCAGCCACATGACTCTGGG8316411104224N / AN / A1055810577CACGGTATTGAAATCAGGAG4716421104240N / AN / A1065410673CTGCTGCCAGAGTCCTGGCT8816431104256N / AN / A1075310772CACCCCCCTCCCCATCATGA8916441104272N / AN / A1081810837AGAGGAGGCCTCTCATGGAC9616451104288N / AN / A1108311102AACGGAATTACATTCAGTTT8116461104304N / AN / A1115211171TATTAGGATCCCATCTAGTG10316471104320N / AN / A1123011249AAAGCTACTAACTTTAATTC8116481104336N / AN / A1128811307CAAGCTGGAAATGGAAAGCC8316491104352N / AN / A1139011409AGTGGTAAGCTGCTGGAGTA8516501104368N / AN / A1149911518CCGACTTCCCAGGTCTTACT781651 Table 23 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG65171103150203934683487ATGCGAGGGCTTTATGAAGG821652110316626428337123731TCTCTGCCCGCTCACTGGCC1261653110318254956849344953TGTTCTCGGCTTCCAGCCTC40*1654110319875877756445663CTCTTTCAGGGCTGCGGTGA35165511032141049106876217640CTCTTCCTCCAGCCGCGCCA7016561103230132713461161611635TCCTGCTTGGACTCCTTAAT6916571103246150115201179011809CAGCAAGCTGACCTAGGGAC3916581103262166216811195111970CCCCCCGCCCTCCTCCCCTT9116591103278172917481201812037CCTCCATCTCTGGCAACAGT3416601103294185818771214712166AAAAGACAAAACAAGCCTCT8116611103310188419031217312192TAGGGATATCCCACCTCATA7416621103326206120801235012369CAGGTGACTGCCCCAGGTGG7316631103342222822471251712536TCCCTCCCAGCACCTCATCC8016641103358242424431271312732ATGAGTCACTTCCTTAATTC5816651103374246724861275612775TGGATACATCCCCTTTCTCT5916661103390251025291279912818GAAGAGGCCTTTAGAAATGG7616671103406266826871295712976GTGAGTAAGAAGGGACCGCA8216681103422271727361300613025TACAATTGTAAAATAGGGCA9016691103438284928681313813157ACCAGTCTGCTCACCAGTCT7416701103470N / AN / A87698788GATATCTTGTGACCTTGTGA3416711103486N / AN / A88978916GGCTCACTCCCTGTCAAGCT10016721103502N / AN / A90439062CAAGCTCTGCCAGTTTAATG3016731103518N / AN / A92249243CTGAGCTGAGCGATGGAGCC7116741103534N / AN / A92639282TGCGGTCCTGAGGGAAGAAT7616751103550N / AN / A93089327TAACATTAAGAGCAGGGAAC7716761103566N / AN / A85008519AGTGTCACGAAGGCCCCCAG4916771103582N / AN / A85848603GGACCAGGGCCTAGCAGGAC6916781103598N / AN / A39934012CTGCTCACAAGGCCCCCCTT9216791103614N / AN / A40494068GGTTCGGCCCCTCCCTGAGA6916801103630N / AN / A42504269GCCATGAATGAAACACAGGG6616811103646N / AN / A43914410CCTGCCTGCTCTTTCCCTCA7616821103662N / AN / A44904509AATTTTATTATGACCACCGC11016831103678N / AN / A46354654AAGCATACACTCACTGTTGC7816841103694N / AN / A48174836CAGCTGTCACAGAGACCACC10016851103710N / AN / A50975116TTCCTCAGCCTTGCCTTACC7816861103726N / AN / A53055324TCTCAGTTGCAATCTCTGTG8716871103742N / AN / A53985417TTTCATTTCCTGTCTCTACC8916881103758N / AN / A54815500TGTCCTCTTCTGCCTGCCCC9416891103774N / AN / A57265745CAGGCAGGGCTACCTTGGAG8716901103790N / AN / A58495868ATCTCACTTCTCTGGTGAAA9516911103806N / AN / A59235942ATAATAGCAATAGTAGCAGT10316921103822N / AN / A59745993TAATCCATGAAAAGCACAGG8416931103838N / AN / A60206039TCGGCTCTCTCATCTGTCAA5316941103854N / AN / A61996218TCAGACACCTCTCTGTGTCC8616951103870N / AN / A62576276CTGTGGTGTTCTCTACGGGC7816961103886N / AN / A63136332CAAATGCCCCCTCTACAGTG10516971103902N / AN / A64086427CTCTCTGTGCTTTTCTGCCT7116981103918N / AN / A65016520ATCGGGCCCTCACCCTGCTC10716991103934N / AN / A69046923TAGGCGAGCGGAGGCCTGGG9017001103950N / AN / A70177036GACCTCAGCACCTAGCACAA8217011103966N / AN / A73147333TCACCGTGCCGCGCAGAGAC10117021103982N / AN / A74167435GCCCCGCCCTCGACCCAGGT8817031103998N / AN / A78057824GATGAGCTCTACCGTGAGGC7117041104014N / AN / A79227941AGTCATCAAACATCTAGTGA4617051104030N / AN / A80358054GAGGAGTCCAATCTTGGCTG6717061104046N / AN / A80758094GTGAAGAAAGTTCCAAGGAG9317071104062N / AN / A82288247TTTCCTTGCCAGGAAAGTCT8117081104078N / AN / A93599378CCCCGCCCCGCCCGAGAGAG3617091104094N / AN / A94129431TAAGAATCATTTCAGGGCCA7117101104110N / AN / A94529471AATATTCTAGTCCAGAAGAA10317111104126N / AN / A95069525TTAGCCTTTCTGATGCTGAA5817121104142N / AN / A95309549TATTACCTCTACTAGTCAGC6517131104158N / AN / A95579576GACCTGTGACTATCTAGGAT1817141104174N / AN / A95769595CATTTATCTGTGCTTTAGTG3717151104190N / AN / A96609679GCTGTTAAACATGTGGCACA7417161104206N / AN / A97069725CCTACTTCTCTAGGTGGGAG6517171104222N / AN / A1055610575CGGTATTGAAATCAGGAGAC4717181104238N / AN / A1061010629TTTCAGCCCCTCTGCAAGCC6817191104254N / AN / A1074710766CCTCCCCATCATGAGTATGA9217201104270N / AN / A1081610835AGGAGGCCTCTCATGGACTT9317211104286N / AN / A1107811097AATTACATTCAGTTTCCTTG8817221104302N / AN / A1115011169TTAGGATCCCATCTAGTGGC6017231104318N / AN / A1122511244TACTAACTTTAATTCTCTTT4917241104334N / AN / A1128011299AAATGGAAAGCCCTCCCCAT9817251104350N / AN / A1138811407TGGTAAGCTGCTGGAGTAAG5517261104366N / AN / A1149411513TTCCCAGGTCTTACTTTTCT761727 Table 24 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG65171103151395834873506GGCTCTGCTCGCTCCTGGGA1081728110316726928837173736CATCATCTCTGCCCGCTCAC931729110318355357249384957AGGTTGTTCTCGGCTTCCAG55*1730110319975977856455664TCTCTTTCAGGGCTGCGGTG54173111032151050106976227641CCTCTTCCTCCAGCCGCGCC6417321103231133413531162311642CTTGTGCTCCTGCTTGGACT5317331103247151815371180711826ACTGACGGAGCCTAGGGCAG6117341103263166716861195611975AGGTGCCCCCCGCCCTCCTC9817351103279173017491201912038ACCTCCATCTCTGGCAACAG2517361103295185918781214812167CAAAAGACAAAACAAGCCTC7317371103311188519041217412193ATAGGGATATCCCACCTCAT7517381103327208621051237512394TCAGGAGGTCCTTCTGGGAT6717391103343223022491251912538TATCCCTCCCAGCACCTCAT6317401103359242524441271412733GATGAGTCACTTCCTTAATT3517411103375248325021277212791TCATGCCCTGCCCCCATGGA6917421103391251125301280012819GGAAGAGGCCTTTAGAAATG7417431103407267026891295912978GTGTGAGTAAGAAGGGACCG4617441103423272227411301113030AGTTTTACAATTGTAAAATA8817451103439286828871315713176ATCTCTGGGCACAGATCCCA9317461103471N / AN / A87708789AGATATCTTGTGACCTTGTG3517471103487N / AN / A88988917AGGCTCACTCCCTGTCAAGC6217481103503N / AN / A90449063ACAAGCTCTGCCAGTTTAAT5117491103519N / AN / A92259244ACTGAGCTGAGCGATGGAGC6517501103535N / AN / A92669285AGCTGCGGTCCTGAGGGAAG5917511103551N / AN / A93099328TTAACATTAAGAGCAGGGAA6817521103567N / AN / A85308549GGTATGATAGGCTCTGGCTA2117531103583N / AN / A86498668AGACAGGGCAGATGTCAAGC9017541103599N / AN / A39944013TCTGCTCACAAGGCCCCCCT5617551103615N / AN / A40534072GGGAGGTTCGGCCCCTCCCT9417561103631N / AN / A42514270AGCCATGAATGAAACACAGG11517571103647N / AN / A44014420TGCGCCCAGACCTGCCTGCT7517581103663N / AN / A44954514AAATGAATTTTATTATGACC8017591103679N / AN / A46364655CAAGCATACACTCACTGTTG6917601103695N / AN / A48204839AGGCAGCTGTCACAGAGACC9517611103711N / AN / A50995118CATTCCTCAGCCTTGCCTTA9517621103727N / AN / A53115330TCCCTCTCTCAGTTGCAATC7917631103743N / AN / A54125431TCTTTCTGTTTGTCTTTCAT7117641103759N / AN / A54825501GTGTCCTCTTCTGCCTGCCC5917651103775N / AN / A57755794TCTCTTGTACAGAGCAAGAA11017661103791N / AN / A58535872AGCCATCTCACTTCTCTGGT6717671103807N / AN / A59305949ACTACTAATAATAGCAATAG8217681103823N / AN / A59755994GTAATCCATGAAAAGCACAG9717691103839N / AN / A60226041CTTCGGCTCTCTCATCTGTC7617701103855N / AN / A62036222CAGGTCAGACACCTCTCTGT7617711103871N / AN / A62656284GCTCTGAGCTGTGGTGTTCT8817721103887N / AN / A63146333CCAAATGCCCCCTCTACAGT9217731103903N / AN / A64096428CCTCTCTGTGCTTTTCTGCC6017741103919N / AN / A65166535GGTCCTCCCAGCCCCATCGG7917751103935N / AN / A69066925CTTAGGCGAGCGGAGGCCTG8517761103951N / AN / A70217040GCCAGACCTCAGCACCTAGC6517771103967N / AN / A73167335GCTCACCGTGCCGCGCAGAG7617781103983N / AN / A74207439TCAGGCCCCGCCCTCGACCC8817791103999N / AN / A78067825AGATGAGCTCTACCGTGAGG6617801104015N / AN / A79307949ATCCATTCAGTCATCAAACA9017811104031N / AN / A80378056GTGAGGAGTCCAATCTTGGC7717821104047N / AN / A80768095GGTGAAGAAAGTTCCAAGGA5917831104063N / AN / A82298248TTTTCCTTGCCAGGAAAGTC7617841104079N / AN / A93609379CCCCCGCCCCGCCCGAGAGA10317851104095N / AN / A94139432CTAAGAATCATTTCAGGGCC6517861104111N / AN / A94549473TAAATATTCTAGTCCAGAAG8717871104127N / AN / A95089527GGTTAGCCTTTCTGATGCTG3017881104143N / AN / A95319550GTATTACCTCTACTAGTCAG5617891104159N / AN / A95589577TGACCTGTGACTATCTAGGA2917901104175N / AN / A95789597GCCATTTATCTGTGCTTTAG1017911104191N / AN / A96649683AAAGGCTGTTAAACATGTGG3917921104207N / AN / A97079726GCCTACTTCTCTAGGTGGGA6917931104223N / AN / A1055710576ACGGTATTGAAATCAGGAGA5517941104239N / AN / A1063910658TGGCTGCTCTGTCTTCTGGC5217951104255N / AN / A1074810767CCCTCCCCATCATGAGTATG7917961104271N / AN / A1081710836GAGGAGGCCTCTCATGGACT9517971104287N / AN / A1108211101ACGGAATTACATTCAGTTTC7717981104303N / AN / A1115111170ATTAGGATCCCATCTAGTGG6817991104319N / AN / A1122911248AAGCTACTAACTTTAATTCT9218001104335N / AN / A1128111300GAAATGGAAAGCCCTCCCCA11318011104351N / AN / A1138911408GTGGTAAGCTGCTGGAGTAA6018021104367N / AN / A1149811517CGACTTCCCAGGTCTTACTT741803 Table 25 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG75171103153446334923511GCTCTGGCTCTGCTCGCTCC831804110316935437338023821GGTTCAGCTCAGCAGCCAGC851805110318556658549514970TCTATAGGCAGCCAGGTTGT73*1806110320176278156485667GGATCTCTTTCAGGGCTGCG901807110321711851204N / AN / AGAATGGTGATCCGGTTCTCC2318081103233135013691163911658TGCCTCACATCACATCCTTG9818091103249152815471181711836CAGGCCTGATACTGACGGAG10318101103265167016891195911978AGTAGGTGCCCCCCGCCCTC7418111103281175017691203912058TTCCCAGATACTCCGAGAGA6518121103297186118801215012169ACCAAAAGACAAAACAAGCC11318131103313188719061217612195GCATAGGGATATCCCACCTC9518141103329209721161238612405TGAGTCATCGCTCAGGAGGT4718151103345233123501262012639TCCTCCTCCATCTCTACCAG4418161103361243124501272012739CAAGAGGATGAGTCACTTCC4918171103377248525041277412793AGTCATGCCCTGCCCCCATG4618181103393251625351280512824AGCAAGGAAGAGGCCTTTAG6818191103409267326921296212981TGTGTGTGAGTAAGAAGGGA3018201103425272527441301413033CTCAGTTTTACAATTGTAAA7118211103441290529241319413213GGGAGAGGAGAACCCTGAAG9818221103473N / AN / A88138832CTGGTGAGCCTGTATTGGTA6818231103489N / AN / A89758994AAAATGACGCAGTCCAGGCC10818241103505N / AN / A90469065TAACAAGCTCTGCCAGTTTA9218251103521N / AN / A92389257GAACTGAGTCAGCACTGAGC12418261103537N / AN / A92799298TATTCACTGCAAGAGCTGCG11118271103553N / AN / A93139332ATATTTAACATTAAGAGCAG8418281103569N / AN / A85338552CCTGGTATGATAGGCTCTGG5618291103585N / AN / A86558674ATCTGCAGACAGGGCAGATG11318301103601N / AN / A40014020AGCCCCTTCTGCTCACAAGG7418311103617N / AN / A41724191CCTGGCAGAAGGCATGCGGG12018321103633N / AN / A42954314CAGGCTCAGAATAGGTGAGC8018331103649N / AN / A44104429CCTGTGCTTTGCGCCCAGAC9218341103665N / AN / A45054524CCACCTTTTGAAATGAATTT6318351103681N / AN / A46414660ATCCACAAGCATACACTCAC6218361103697N / AN / A48454864TGAATACCTGCCTCAGTCTC6818371103713N / AN / A51015120CCCATTCCTCAGCCTTGCCT9518381103729N / AN / A53515370TGAGTGTCTCTCTCAGTCTC13218391103745N / AN / A54205439CCTTAGTGTCTTTCTGTTTG6918401103761N / AN / A54895508CGCCATTGTGTCCTCTTCTG8618411103777N / AN / A57785797CATTCTCTTGTACAGAGCAA10518421103793N / AN / A58615880CCTGGGCAAGCCATCTCACT11918431103809N / AN / A59435962AACAGTATCAGCTACTACTA8018441103825N / AN / A59795998TAAGGTAATCCATGAAAAGC10118451103841N / AN / A61086127CCCAAGTGAGATGTGCTAGA11818461103857N / AN / A62056224TCCAGGTCAGACACCTCTCT9718471103873N / AN / A62686287TAAGCTCTGAGCTGTGGTGT5118481103889N / AN / A63166335GCCCAAATGCCCCCTCTACA7318491103905N / AN / A64156434GCCCTGCCTCTCTGTGCTTT6418501103921N / AN / A65226541CAGGGAGGTCCTCCCAGCCC10118511103937N / AN / A69486967TTCCACACTGACAGCTGCAT7618521103953N / AN / A70777096TGGCTGGGACTTTTCCCAAC11318531103969N / AN / A73307349CCTGCCCTGGCCGCGCTCAC8718541103985N / AN / A74237442CGTTCAGGCCCCGCCCTCGA7818551104001N / AN / A78157834AAGGGAGCAAGATGAGCTCT7718561104017N / AN / A79567975CTAATCAATATTGGTTGAAT8718571104033N / AN / A80398058AGGTGAGGAGTCCAATCTTG8218581104049N / AN / A80828101GAAAGTGGTGAAGAAAGTTC10918591104065N / AN / A82528271CCATCATGACAACTTGAACG11018601104081N / AN / A93779396AATTTAGCTCCCCCCTCCCC8318611104097N / AN / A94179436TTAGCTAAGAATCATTTCAG12518621104113N / AN / A94569475CCTAAATATTCTAGTCCAGA4718631104129N / AN / A95119530CCTGGTTAGCCTTTCTGATG4718641104145N / AN / A95379556TTGGCAGTATTACCTCTACT1918651104161N / AN / A95619580TAGTGACCTGTGACTATCTA4718661104177N / AN / A95809599CTGCCATTTATCTGTGCTTT5218671104193N / AN / A96729691ACTAAAATAAAGGCTGTTAA6718681104209N / AN / A97869805AACCAGCCACATGACTCTGG9118691104225N / AN / A1055910578GCACGGTATTGAAATCAGGA3018701104241N / AN / A1065510674GCTGCTGCCAGAGTCCTGGC6918711104257N / AN / A1076110780CCCCATCGCACCCCCCTCCC10318721104273N / AN / A1084310862CAGGCTGGTTTCTGCAGATG9218731104289N / AN / A1108411103AAACGGAATTACATTCAGTT6718741104305N / AN / A1115311172GTATTAGGATCCCATCTAGT5818751104321N / AN / A1123111250GAAAGCTACTAACTTTAATT6018761104337N / AN / A1130811327CCCTGGTAGTTTCCTTTTAC5518771104353N / AN / A1139211411CGAGTGGTAAGCTGCTGGAG6918781104369N / AN / A1151211531CCTTGGGAAGTCCCCGACTT781879 Table 26 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG6517110315410912835573576ATCATCTCCCCTGAGGAGAC1391880110317037639538243843GTGGGCTCCTTGGCCCGCAG8918811103186576595N / AN / ACTGCTTCCTGTCTATAGGCA30*1882110320276378256495668CGGATCTCTTTCAGGGCTGC38188311032181202122183518370GGAGAAGGTCTGCACGGGAA4318841103234135513741164411663GGTCCTGCCTCACATCACAT8718851103250153215511182111840CTGGCAGGCCTGATACTGAC9318861103266167916981196811987GGGCGATGTAGTAGGTGCCC10018871103282176217811205112070TCAAAGGCACAGTTCCCAGA8918881103298186218811215112170AACCAAAAGACAAAACAAGC8018891103314188919081217812197CAGCATAGGGATATCCCACC8618901103330209821171238712406TTGAGTCATCGCTCAGGAGG4918911103346233223511262112640CTCCTCCTCCATCTCTACCA8118921103362243624551272512744ATCTTCAAGAGGATGAGTCA11618931103378248725061277612795AAAGTCATGCCCTGCCCCCA7418941103394252625451281512834GGTATGACACAGCAAGGAAG5918951103410267426931296312982TTGTGTGTGAGTAAGAAGGG5218961103426273027491301913038CGTGCCTCAGTTTTACAATT7318971103442296329821325213271TGGAGGGAAAGGACACCAAG7918981103458N / AN / A87408759TCTTTGGTGCTTTTGCCCCC5018991103474N / AN / A88148833TCTGGTGAGCCTGTATTGGT6619001103490N / AN / A89788997GGGAAAATGACGCAGTCCAG8019011103506N / AN / A90769095GCGCACCCAAGGACTCACCA11519021103522N / AN / A92409259CTGAACTGAGTCAGCACTGA9019031103538N / AN / A92859304AAACTTTATTCACTGCAAGA5719041103570N / AN / A85378556GTACCCTGGTATGATAGGCT2219051103586N / AN / A86848703ACACTCAGAAGGGCAGTGCT11519061103602N / AN / A40024021CAGCCCCTTCTGCTCACAAG7719071103618N / AN / A41814200CCCTGGACTCCTGGCAGAAG9819081103634N / AN / A43364355CATCAACCTTCTCCGCTTCC7519091103650N / AN / A44114430ACCTGTGCTTTGCGCCCAGA9219101103666N / AN / A45664585TGCATGTCCTGTCAGCTCAG12219111103682N / AN / A46454664GCGCATCCACAAGCATACAC11319121103698N / AN / A48464865TTGAATACCTGCCTCAGTCT10419131103714N / AN / A51405159TGAGGAGTAGAGGGCCACTG6419141103730N / AN / A53535372TCTGAGTGTCTCTCTCAGTC13519151103746N / AN / A54225441TCCCTTAGTGTCTTTCTGTT10119161103762N / AN / A54945513CCCCACGCCATTGTGTCCTC8519171103778N / AN / A57805799CCCATTCTCTTGTACAGAGC7219181103794N / AN / A58625881CCCTGGGCAAGCCATCTCAC8019191103810N / AN / A59485967AACAGAACAGTATCAGCTAC8219201103826N / AN / A59805999GTAAGGTAATCCATGAAAAG7319211103842N / AN / A61126131GGCTCCCAAGTGAGATGTGC11819221103858N / AN / A62076226CTTCCAGGTCAGACACCTCT7519231103874N / AN / A62696288ATAAGCTCTGAGCTGTGGTG5019241103890N / AN / A63176336AGCCCAAATGCCCCCTCTAC7719251103906N / AN / A64496468CAGCTAGGTGCCCTGGCTAG13119261103922N / AN / A65316550CCCTGCCTGCAGGGAGGTCC6919271103938N / AN / A69706989CAGTGCCACAGAATCCAGAA9419281103954N / AN / A71047123CCCCAGTTAACCCCAGGACG13019291103970N / AN / A73377356TCCCCGTCCTGCCCTGGCCG6519301103986N / AN / A74547473GCCCCAGGCCCCGCCTCTAG17419311104002N / AN / A78247843CAGTCCCTGAAGGGAGCAAG11319321104018N / AN / A79587977GCCTAATCAATATTGGTTGA7119331104034N / AN / A80418060TGAGGTGAGGAGTCCAATCT6919341104050N / AN / A81078126CTGAAGGAAGATGGAAAAGG7819351104066N / AN / A82548273GGCCATCATGACAACTTGAA10519361104082N / AN / A93789397TAATTTAGCTCCCCCCTCCC10619371104098N / AN / A94189437CTTAGCTAAGAATCATTTCA9619381104114N / AN / A94579476TCCTAAATATTCTAGTCCAG6319391104130N / AN / A95139532AGCCTGGTTAGCCTTTCTGA6819401104146N / AN / A95389557TTTGGCAGTATTACCTCTAC7319411104162N / AN / A95629581TTAGTGACCTGTGACTATCT9219421104178N / AN / A95829601CTCTGCCATTTATCTGTGCT4819431104194N / AN / A96759694TTAACTAAAATAAAGGCTGT13219441104210N / AN / A98109829TCAAGAAGTCCCAACTTAGC7419451104226N / AN / A1056010579AGCACGGTATTGAAATCAGG7719461104242N / AN / A1065610675TGCTGCTGCCAGAGTCCTGG8919471104258N / AN / A1077310792CATGCCCGGCTTCCCCATCG9819481104274N / AN / A1092310942CTTACCTCTCCATCCCGCAT10019491104290N / AN / A1108811107GAGGAAACGGAATTACATTC9519501104306N / AN / A1115411173TGTATTAGGATCCCATCTAG13519511104322N / AN / A1123211251TGAAAGCTACTAACTTTAAT7519521104338N / AN / A1131211331ATTCCCCTGGTAGTTTCCTT9719531104354N / AN / A1139311412GCGAGTGGTAAGCTGCTGGA5719541104370N / AN / A1152311542AGGCTGTGTAACCTTGGGAA751955 Table 27 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG7517110315511012935583577CATCATCTCCCCTGAGGAGA901956110317138039938283847CTTGGTGGGCTCCTTGGCCC10319571103187577596N / AN / ATCTGCTTCCTGTCTATAGGC33*1958110320376478356505669GCGGATCTCTTTCAGGGCTG651959110321912201239N / AN / ATTCTCGAATCTGCAGGTTGG11119601103235136113801165011669CAGGTGGGTCCTGCCTCACA14719611103251153315521182211841TCTGGCAGGCCTGATACTGA13419621103267168117001197011989GAGGGCGATGTAGTAGGTGC6619631103283176817871205712076GGAAACTCAAAGGCACAGTT7219641103299187018891215912178CTCATAAAAACCAAAAGACA12819651103315189019091217912198GCAGCATAGGGATATCCCAC8919661103331210721261239612415CTGAGACACTTGAGTCATCG4519671103347233423531262312642GCCTCCTCCTCCATCTCTAC5319681103363244024591272912748CAGCATCTTCAAGAGGATGA10919691103379248825071277712796CAAAGTCATGCCCTGCCCCC9419701103395252725461281612835TGGTATGACACAGCAAGGAA4819711103411267626951296512984TTTTGTGTGTGAGTAAGAAG4319721103427275027691303913058GCCAGTGTCTTCACTTTGCT7319731103443301330321330213321CAGTGCCCTGAAGATTAGCA6819741103459N / AN / A87418760GTCTTTGGTGCTTTTGCCCC5119751103475N / AN / A88158834ATCTGGTGAGCCTGTATTGG4519761103491N / AN / A89798998TGGGAAAATGACGCAGTCCA6119771103507N / AN / A90919110CAGAGCAGCTCCACTGCGCA12719781103523N / AN / A92419260TCTGAACTGAGTCAGCACTG8419791103539N / AN / A92869305AAAACTTTATTCACTGCAAG6419801103555N / AN / A83698388ACCTCGAATCTGCAGGTTGG13019811103571N / AN / A85388557AGTACCCTGGTATGATAGGC3319821103587N / AN / A87148733GACAAGCAGTTAAAAAAACA6219831103603N / AN / A40034022TCAGCCCCTTCTGCTCACAA5819841103619N / AN / A42104229CTTTCCCCAGTAGGGAGGTG8619851103635N / AN / A43434362TCATGGACATCAACCTTCTC8719861103651N / AN / A44144433GTCACCTGTGCTTTGCGCCC10719871103667N / AN / A45684587CATGCATGTCCTGTCAGCTC7219881103683N / AN / A46464665GGCGCATCCACAAGCATACA11219891103699N / AN / A48554874TGAGGACACTTGAATACCTG6719901103715N / AN / A51635182GCTTCCTGGAGTGGCAGGAG109*19911103731N / AN / A53625381TCTCCTCTCTCTGAGTGTCT6919921103747N / AN / A54245443TCTCCCTTAGTGTCTTTCTG6519931103763N / AN / A54995518GGGTTCCCCACGCCATTGTG10919941103779N / AN / A57825801CCCCCATTCTCTTGTACAGA13619951103795N / AN / A58815900AGCAATAGTGCCTGTGTGAC6919961103811N / AN / A59495968GAACAGAACAGTATCAGCTA9119971103827N / AN / A59816000AGTAAGGTAATCCATGAAAA10919981103843N / AN / A61136132AGGCTCCCAAGTGAGATGTG8919991103859N / AN / A62146233ATCACACCTTCCAGGTCAGA6820001103875N / AN / A62716290ATATAAGCTCTGAGCTGTGG8720011103891N / AN / A63186337TAGCCCAAATGCCCCCTCTA10120021103907N / AN / A64546473CTCCTCAGCTAGGTGCCCTG6620031103923N / AN / A65346553CTCCCCTGCCTGCAGGGAGG12420041103939N / AN / A69756994ATGAACAGTGCCACAGAATC12420051103955N / AN / A71057124ACCCCAGTTAACCCCAGGAC9020061103971N / AN / A73397358CGTCCCCGTCCTGCCCTGGC9320071103987N / AN / A74737492TTTCGAGGCCCGGCCCCCGG7820081104003N / AN / A78297848AGACTCAGTCCCTGAAGGGA8920091104019N / AN / A79597978GGCCTAATCAATATTGGTTG8020101104035N / AN / A80438062GGTGAGGTGAGGAGTCCAAT6220111104051N / AN / A81168135CATGTCTATCTGAAGGAAGA15920121104067N / AN / A82838302GGACACCCCTAGGCTGGGTC12120131104083N / AN / A93849403AAAAAGTAATTTAGCTCCCC10820141104099N / AN / A94199438CCTTAGCTAAGAATCATTTC7620151104115N / AN / A94589477GTCCTAAATATTCTAGTCCA5520161104131N / AN / A95149533CAGCCTGGTTAGCCTTTCTG3820171104147N / AN / A95399558ATTTGGCAGTATTACCTCTA5120181104163N / AN / A95639582TTTAGTGACCTGTGACTATC10820191104179N / AN / A95839602TCTCTGCCATTTATCTGTGC4820201104195N / AN / A96769695ATTAACTAAAATAAAGGCTG9020211104211N / AN / A98119830CTCAAGAAGTCCCAACTTAG8320221104227N / AN / A1056210581CCAGCACGGTATTGAAATCA5020231104243N / AN / A1065910678TAGTGCTGCTGCCAGAGTCC5420241104259N / AN / A1077710796CTCCCATGCCCGGCTTCCCC14720251104275N / AN / A1098111000TGGCCTGGCCTTGAGAATCC10820261104291N / AN / A1110011119TATGGAGGGACTGAGGAAAC10720271104307N / AN / A1115511174GTGTATTAGGATCCCATCTA1920281104323N / AN / A1123311252GTGAAAGCTACTAACTTTAA5120291104339N / AN / A1132511344ATCCCCTCTTCCCATTCCCC12820301104355N / AN / A1139411413GGCGAGTGGTAAGCTGCTGG9920311104371N / AN / A1152511544CGAGGCTGTGTAACCTTGGG992032 Table 28 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG14517110315614216135903609CCCAGACGGCGGCCAGGAGC1132033110317240842738563875GCAGCTCAGCCTGGTAGACG9220341103188582601N / AN / ACTTCATCTGCTTCCTGTCTA23*20351103204829848N / AN / AAACTTGGAGCGGTACCACTC10620361103220124912681086310882TCTGACACAGACTTGGTGTC11020371103236139714161168611705CTGCTCGGGCCCCTCATGAG1820381103252153415531182311842GTCTGGCAGGCCTGATACTG8420391103268168217011197111990GGAGGGCGATGTAGTAGGTG3120401103284179818171208712106CTGAGTCTCAGTTTTCCTCC4820411103300187118901216012179CCTCATAAAAACCAAAAGAC7620421103316189119101218012199GGCAGCATAGGGATATCCCA7420431103332210821271239712416ACTGAGACACTTGAGTCATC7720441103348233923581262812647CAATTGCCTCCTCCTCCATC9120451103364244424631273312752GTTTCAGCATCTTCAAGAGG6320461103380248925081277812797ACAAAGTCATGCCCTGCCCC8920471103396252825471281712836CTGGTATGACACAGCAAGGA6720481103412267726961296612985ATTTTGTGTGTGAGTAAGAA4920491103428275227711304113060GAGCCAGTGTCTTCACTTTG3820501103444301430331330313322GCAGTGCCCTGAAGATTAGC8820511103460N / AN / A87468765TCCCCGTCTTTGGTGCTTTT7420521103476N / AN / A88238842CATTTACAATCTGGTGAGCC10320531103492N / AN / A89819000CCTGGGAAAATGACGCAGTC8820541103508N / AN / A91039122GCTCAGAGGCCCCAGAGCAG11720551103524N / AN / A92429261CTCTGAACTGAGTCAGCACT9320561103540N / AN / A92889307ATAAAACTTTATTCACTGCA8220571103556N / AN / A83978416GCCCTTCCCACGAGGCCCTG10220581103572N / AN / A85408559GAAGTACCCTGGTATGATAG8020591103588N / AN / A87158734TGACAAGCAGTTAAAAAAAC9820601103604N / AN / A40044023TTCAGCCCCTTCTGCTCACA9720611103620N / AN / A42124231TGCTTTCCCCAGTAGGGAGG5220621103636N / AN / A43514370AATCTCCCTCATGGACATCA10220631103652N / AN / A44214440GCAGGCAGTCACCTGTGCTT8420641103668N / AN / A45764595AAGGCACACATGCATGTCCT10320651103684N / AN / A46634682CTGCTTCTGCTCACACAGGC10920661103700N / AN / A48564875CTGAGGACACTTGAATACCT12020671103716N / AN / A51655184CTGCTTCCTGGAGTGGCAGG123*20681103732N / AN / A53635382CTCTCCTCTCTCTGAGTGTC10020691103748N / AN / A54325451TCTTTCCGTCTCCCTTAGTG9420701103764N / AN / A55185537AGGGTACAGGCCACAGCTGG10120711103780N / AN / A57855804CTTCCCCCATTCTCTTGTAC10620721103796N / AN / A58835902AAAGCAATAGTGCCTGTGTG8020731103812N / AN / A59505969AGAACAGAACAGTATCAGCT9620741103828N / AN / A59826001TAGTAAGGTAATCCATGAAA11020751103844N / AN / A61266145AGGCATGGAATGCAGGCTCC10320761103860N / AN / A62156234TATCACACCTTCCAGGTCAG10220771103876N / AN / A62726291CATATAAGCTCTGAGCTGTG9120781103892N / AN / A63196338CTAGCCCAAATGCCCCCTCT10320791103908N / AN / A64566475CACTCCTCAGCTAGGTGCCC10420801103924N / AN / A65356554TCTCCCCTGCCTGCAGGGAG11120811103940N / AN / A69776996GAATGAACAGTGCCACAGAA9420821103956N / AN / A71067125CACCCCAGTTAACCCCAGGA10220831103972N / AN / A73407359CCGTCCCCGTCCTGCCCTGG9020841103988N / AN / A74747493GTTTCGAGGCCCGGCCCCCG11720851104004N / AN / A78317850AAAGACTCAGTCCCTGAAGG11920861104020N / AN / A79607979AGGCCTAATCAATATTGGTT11220871104036N / AN / A80448063GGGTGAGGTGAGGAGTCCAA6820881104052N / AN / A81178136GCATGTCTATCTGAAGGAAG9420891104068N / AN / A82898308TGCCTGGGACACCCCTAGGC12220901104084N / AN / A93859404TAAAAAGTAATTTAGCTCCC9120911104100N / AN / A94279446ATTTTGTTCCTTAGCTAAGA9620921104116N / AN / A94599478GGTCCTAAATATTCTAGTCC3520931104132N / AN / A95159534TCAGCCTGGTTAGCCTTTCT3720941104148N / AN / A95409559GATTTGGCAGTATTACCTCT5220951104164N / AN / A95649583CTTTAGTGACCTGTGACTAT8420961104180N / AN / A95889607ACTTCTCTCTGCCATTTATC11020971104196N / AN / A96779696AATTAACTAAAATAAAGGCT10820981104212N / AN / A98209839AGACCAGAGCTCAAGAAGTC11920991104228N / AN / A1056310582CCCAGCACGGTATTGAAATC8421001104244N / AN / A1066010679ATAGTGCTGCTGCCAGAGTC8821011104260N / AN / A1077910798CTCTCCCATGCCCGGCTTCC11221021104276N / AN / A1098311002CATGGCCTGGCCTTGAGAAT3121031104292N / AN / A1111511134CCCCTTAGAACAGCCTATGG11121041104308N / AN / A1115611175TGTGTATTAGGATCCCATCT4121051104324N / AN / A1123411253AGTGAAAGCTACTAACTTTA7821061104340N / AN / A1132611345AATCCCCTCTTCCCATTCCC10521071104356N / AN / A1139611415CTGGCGAGTGGTAAGCTGCT9121081104372N / AN / A1153511554TCCACCACCACGAGGCTGTG1012109 Table 29 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG8517110315715817736063625GAGGCGGGTGCCAGGACCCA452110110317340942838573876CGCAGCTCAGCCTGGTAGAC972111110318963665552255244TCTCCTCCTCCAGCGACTCA9221121103205843862N / AN / ACTGTCAGGTCTGCAAACTTG7421131103221126312821087710896TCTTGAGGTGGCCTTCTGAC10421141103237139914181168811707TTCTGCTCGGGCCCCTCATG7521151103253154415631183311852GGTGGGTGCCGTCTGGCAGG3421161103269168317021197211991TGGAGGGCGATGTAGTAGGT5821171103285180018191208912108GTCTGAGTCTCAGTTTTCCT2521181103301187218911216112180ACCTCATAAAAACCAAAAGA11621191103317189319121218212201TAGGCAGCATAGGGATATCC10121201103333211021291239912418GGACTGAGACACTTGAGTCA9621211103349234823671263712656GCGCCATCCCAATTGCCTCC9821221103365244624651273512754CTGTTTCAGCATCTTCAAGA4121231103381249325121278212801TGGGACAAAGTCATGCCCTG10521241103397253025491281912838GCCTGGTATGACACAGCAAG8521251103413269727161298613005CTACCTAGAATACTGGGTAC11021261103429275327721304213061TGAGCCAGTGTCTTCACTTT7021271103445301530341330413323AGCAGTGCCCTGAAGATTAG8621281103461N / AN / A87488767TTTCCCCGTCTTTGGTGCTT7721291103477N / AN / A88248843CCATTTACAATCTGGTGAGC6121301103493N / AN / A89829001TCCTGGGAAAATGACGCAGT11421311103509N / AN / A91429161TCCCAGTGACAGGAAGAGGT10521321103525N / AN / A92459264ATCCTCTGAACTGAGTCAGC9321331103541N / AN / A92929311GAACATAAAACTTTATTCAC11021341103557N / AN / A84038422TCCAGTGCCCTTCCCACGAG10421351103573N / AN / A85428561TAGAAGTACCCTGGTATGAT11021361103589N / AN / A87288747TTGCCCCCTGTAGTGACAAG10321371103605N / AN / A40054024ATTCAGCCCCTTCTGCTCAC10621381103621N / AN / A42134232CTGCTTTCCCCAGTAGGGAG9421391103637N / AN / A43674386CTTCACCCCAGAATCCAATC12421401103653N / AN / A44234442TGGCAGGCAGTCACCTGTGC13021411103669N / AN / A45774596GAAGGCACACATGCATGTCC10321421103685N / AN / A46654684ACCTGCTTCTGCTCACACAG9621431103701N / AN / A48584877TTCTGAGGACACTTGAATAC12821441103717N / AN / A51665185TCTGCTTCCTGGAGTGGCAG111*21451103733N / AN / A53645383TCTCTCCTCTCTCTGAGTGT10021461103749N / AN / A54405459CTCTTGTCTCTTTCCGTCTC10521471103765N / AN / A55355554AAGCGGTACCAGGGCTCAGG6221481103781N / AN / A58105829TATTCTCCCAGCTTCCTCCA11221491103797N / AN / A58885907TTTTGAAAGCAATAGTGCCT9421501103813N / AN / A59515970TAGAACAGAACAGTATCAGC9221511103829N / AN / A59896008TACTTCATAGTAAGGTAATC11221521103845N / AN / A61446163CCCAAAACAGACTGGCAGAG7921531103861N / AN / A62166235ATATCACACCTTCCAGGTCA8721541103877N / AN / A62736292ACATATAAGCTCTGAGCTGT10521551103893N / AN / A63336352CGTGCCTGTCCTGCCTAGCC9021561103909N / AN / A64576476ACACTCCTCAGCTAGGTGCC8721571103925N / AN / A65366555TTCTCCCCTGCCTGCAGGGA12021581103941N / AN / A69786997TGAATGAACAGTGCCACAGA11221591103957N / AN / A71077126GCACCCCAGTTAACCCCAGG9321601103973N / AN / A73417360CCCGTCCCCGTCCTGCCCTG9821611103989N / AN / A74767495AGGTTTCGAGGCCCGGCCCC9321621104005N / AN / A78517870GATCTGCACACAAGGCTGAA9921631104021N / AN / A79617980GAGGCCTAATCAATATTGGT11121641104037N / AN / A80478066GATGGGTGAGGTGAGGAGTC4021651104053N / AN / A81188137CGCATGTCTATCTGAAGGAA9021661104069N / AN / A83258344TCCTGAAAGAAAGCAGAGGG11421671104085N / AN / A93869405GTAAAAAGTAATTTAGCTCC12721681104101N / AN / A94289447AATTTTGTTCCTTAGCTAAG12521691104117N / AN / A94609479TGGTCCTAAATATTCTAGTC7421701104133N / AN / A95169535GTCAGCCTGGTTAGCCTTTC3021711104149N / AN / A95419560GGATTTGGCAGTATTACCTC5221721104165N / AN / A95659584GCTTTAGTGACCTGTGACTA4321731104181N / AN / A95899608TACTTCTCTCTGCCATTTAT7521741104197N / AN / A96789697CAATTAACTAAAATAAAGGC13021751104213N / AN / A98289847GGATCAGGAGACCAGAGCTC11821761104229N / AN / A1056410583ACCCAGCACGGTATTGAAAT10521771104245N / AN / A1067010689CCAAATCCCAATAGTGCTGC8021781104261N / AN / A1078210801ATCCTCTCCCATGCCCGGCT8721791104277N / AN / A1100611025TGTGCCAGCCCCAGGCTTTC12521801104293N / AN / A1111911138GGCTCCCCTTAGAACAGCCT11521811104309N / AN / A1115811177AGTGTGTATTAGGATCCCAT1821821104325N / AN / A1123511254AAGTGAAAGCTACTAACTTT10221831104341N / AN / A1132711346AAATCCCCTCTTCCCATTCC11021841104357N / AN / A1142811447AGATAACACTGGGAAAGCAT9721851104373N / AN / A1153711556GGTCCACCACCACGAGGCTG1082186 Table 30 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG7517110315820622536543673GGAGAAATCCACCCGGGTCG1552187110317441042938583877TCGCAGCTCAGCCTGGTAGA1272188110319064866752375256TCAAGAACCGGATCTCCTCC632189110320692694572837302GGTCAAGGACTGCAACTGGC9621901103222127012891088410903ATGTTCCTCTTGAGGTGGCC8621911103238140014191168911708CTTCTGCTCGGGCCCCTCAT5921921103254157315921186211881TTCTTGTTAGTTGGAGTTGC3321931103270168617051197511994ATGTGGAGGGCGATGTAGTA4921941103286180918281209812117CCCTTTCCTGTCTGAGTCTC7221951103302187318921216212181CACCTCATAAAAACCAAAAG10021961103318199620151228512304GAACAACCCTCTGAGCTGGG5721971103334212421431241312432ATGGCAGCTCAGGTGGACTG5421981103350236423831265312672CCTACTTGTATGCCTAGCGC7521991103366244724661273612755CCTGTTTCAGCATCTTCAAG4222001103382249425131278312802ATGGGACAAAGTCATGCCCT9822011103398256725861285612875AAGAAGCAGCAGTCCCAGGG7522021103414270027191298913008GCACTACCTAGAATACTGGG7622031103430275427731304313062ATGAGCCAGTGTCTTCACTT3722041103446301730361330613325GCAGCAGTGCCCTGAAGATT2922051103462N / AN / A87498768TTTTCCCCGTCTTTGGTGCT5622061103478N / AN / A88258844TCCATTTACAATCTGGTGAG4122071103494N / AN / A89839002TTCCTGGGAAAATGACGCAG9722081103510N / AN / A91449163CCTCCCAGTGACAGGAAGAG10422091103526N / AN / A92469265AATCCTCTGAACTGAGTCAG5422101103542N / AN / A92939312GGAACATAAAACTTTATTCA6922111103558N / AN / A84058424ACTCCAGTGCCCTTCCCACG2722121103574N / AN / A85438562CTAGAAGTACCCTGGTATGA9522131103590N / AN / A87308749TTTTGCCCCCTGTAGTGACA6722141103606N / AN / A40384057TCCCTGAGACTTCTCGGGCA11022151103622N / AN / A42144233ACTGCTTTCCCCAGTAGGGA7722161103638N / AN / A43714390CTTTCTTCACCCCAGAATCC13922171103654N / AN / A44244443GTGGCAGGCAGTCACCTGTG8322181103670N / AN / A45784597TGAAGGCACACATGCATGTC10522191103686N / AN / A46664685CACCTGCTTCTGCTCACACA15822201103702N / AN / A49604979CCTGACCTGTCTATAGGCAG92*22211103718N / AN / A51675186ATCTGCTTCCTGGAGTGGCA102*22221103734N / AN / A53655384TTCTCTCCTCTCTCTGAGTG10222231103750N / AN / A54425461CTCTCTTGTCTCTTTCCGTC6922241103766N / AN / A55365555GAAGCGGTACCAGGGCTCAG9522251103782N / AN / A58115830ATATTCTCCCAGCTTCCTCC9222261103798N / AN / A58935912GGTACTTTTGAAAGCAATAG4722271103814N / AN / A59555974GGCTTAGAACAGAACAGTAT8722281103830N / AN / A59966015CAGCACCTACTTCATAGTAA5422291103846N / AN / A61566175GAGGCTCAGTAACCCAAAAC6022301103862N / AN / A62176236AATATCACACCTTCCAGGTC13022311103878N / AN / A62756294CTACATATAAGCTCTGAGCT12722321103894N / AN / A63696388AGGAATGGCCCTCCCTTCTT9322331103910N / AN / A64586477CACACTCCTCAGCTAGGTGC7522341103926N / AN / A65416560GCCCTTTCTCCCCTGCCTGC10622351103942N / AN / A69806999AATGAATGAACAGTGCCACA11322361103958N / AN / A71147133GTGAGCAGCACCCCAGTTAA11722371103974N / AN / A73457364TCCGCCCGTCCCCGTCCTGC11922381103990N / AN / A74777496GAGGTTTCGAGGCCCGGCCC12922391104006N / AN / A78527871GGATCTGCACACAAGGCTGA11222401104022N / AN / A79627981TGAGGCCTAATCAATATTGG9622411104038N / AN / A80508069AGAGATGGGTGAGGTGAGGA3622421104054N / AN / A81408159CTTGAGTGTTATCTGGGAGG6122431104070N / AN / A83368355GGGAATGGTGATCCTGAAAG5322441104086N / AN / A93889407AAGTAAAAAGTAATTTAGCT8722451104102N / AN / A94299448GAATTTTGTTCCTTAGCTAA8022461104118N / AN / A94779496GAGACATGCATATCTAGTGG2322471104134N / AN / A95189537TAGTCAGCCTGGTTAGCCTT6322481104150N / AN / A95479566TATCTAGGATTTGGCAGTAT5822491104166N / AN / A95679586GTGCTTTAGTGACCTGTGAC2522501104182N / AN / A95919610CCTACTTCTCTCTGCCATTT7522511104198N / AN / A96799698ACAATTAACTAAAATAAAGG9522521104214N / AN / A1000310022GTAATCCCCTTACTCGGGAG8422531104230N / AN / A1056510584AACCCAGCACGGTATTGAAA11722541104246N / AN / A1067110690CCCAAATCCCAATAGTGCTG5922551104262N / AN / A1078610805AGCCATCCTCTCCCATGCCC13022561104278N / AN / A1101011029TCTATGTGCCAGCCCCAGGC8322571104294N / AN / A1112011139AGGCTCCCCTTAGAACAGCC7522581104310N / AN / A1115911178GAGTGTGTATTAGGATCCCA1822591104326N / AN / A1123711256GGAAGTGAAAGCTACTAACT4622601104342N / AN / A1132911348CCAAATCCCCTCTTCCCATT8122611104358N / AN / A1143011449TGAGATAACACTGGGAAAGC8922621104374N / AN / A1154311562ACCCCAGGTCCACCACCACG1012263 Table 31 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG7517110315921823736663685TGCCCCAGCCAGGGAGAAAT932264110317541143038593878CTCGCAGCTCAGCCTGGTAG692265110319165267152415260TTCCTCAAGAACCGGATCTC792266110320793094972877306CGCAGGTCAAGGACTGCAAC8422671103223127112901088510904GATGTTCCTCTTGAGGTGGC9422681103239140114201169011709GCTTCTGCTCGGGCCCCTCA5222691103255157515941186411883GTTTCTTGTTAGTTGGAGTT1922701103271168717061197611995GATGTGGAGGGCGATGTAGT6922711103287181118301210012119TTCCCTTTCCTGTCTGAGTC5622721103303187418931216312182CCACCTCATAAAAACCAAAA8922731103319199720161228612305AGAACAACCCTCTGAGCTGG6122741103335218322021247212491CAAGTGCTGAGAATCAAGCT8722751103351239824171268712706TCCAGAGGCCAAGTGCAACT5722761103367244824671273712756TCCTGTTTCAGCATCTTCAA6122771103383249525141278412803AATGGGACAAAGTCATGCCC8822781103399262926481291812937AAAAGCAGCCGGTCACTATG10022791103415270327221299213011AGGGCACTACCTAGAATACT7122801103431278928081307813097CAGCCCTGAGCACCCGGCCT10622811103447301930381330813327CAGCAGCAGTGCCCTGAAGA3822821103463N / AN / A87508769ATTTTCCCCGTCTTTGGTGC6522831103479N / AN / A88558874GGCAGGCAGCTAACCGCGAG8022841103495N / AN / A89849003GTTCCTGGGAAAATGACGCA8922851103511N / AN / A91469165GCCCTCCCAGTGACAGGAAG9622861103527N / AN / A92499268AAGAATCCTCTGAACTGAGT8522871103543N / AN / A92949313GGGAACATAAAACTTTATTC4222881103559N / AN / A84078426GGACTCCAGTGCCCTTCCCA9022891103575N / AN / A85448563CCTAGAAGTACCCTGGTATG6422901103591N / AN / A87328751GCTTTTGCCCCCTGTAGTGA3622911103607N / AN / A40394058CTCCCTGAGACTTCTCGGGC12922921103623N / AN / A42164235GCACTGCTTTCCCCAGTAGG8822931103639N / AN / A43724391ACTTTCTTCACCCCAGAATC10122941103655N / AN / A44564475AGTCAAAGTAACTTGATGGG9022951103671N / AN / A45794598TTGAAGGCACACATGCATGT10222961103687N / AN / A47284747AGGATGAGCAGATGTGGGCT7722971103703N / AN / A49614980CCCTGACCTGTCTATAGGCA105*22981103719N / AN / A51695188TCATCTGCTTCCTGGAGTGG49*22991103735N / AN / A53665385TTTCTCTCCTCTCTCTGAGT9523001103751N / AN / A54465465AATGCTCTCTTGTCTCTTTC8323011103767N / AN / A55375556AGAAGCGGTACCAGGGCTCA10023021103783N / AN / A58305849AGTCAGTCACCTGGAGAGGA7923031103799N / AN / A58985917TAATGGGTACTTTTGAAAGC10023041103815N / AN / A59565975GGGCTTAGAACAGAACAGTA7423051103831N / AN / A59976016ACAGCACCTACTTCATAGTA11323061103847N / AN / A61586177TAGAGGCTCAGTAACCCAAA7423071103863N / AN / A62186237CAATATCACACCTTCCAGGT7223081103879N / AN / A62776296CACTACATATAAGCTCTGAG9323091103895N / AN / A63706389TAGGAATGGCCCTCCCTTCT9123101103911N / AN / A64616480ACTCACACTCCTCAGCTAGG10023111103927N / AN / A65466565TAATAGCCCTTTCTCCCCTG9323121103943N / AN / A69827001CGAATGAATGAACAGTGCCA10823131103959N / AN / A71207139AGGGAGGTGAGCAGCACCCC10323141103975N / AN / A73477366GCTCCGCCCGTCCCCGTCCT6623151103991N / AN / A74787497GGAGGTTTCGAGGCCCGGCC11723161104007N / AN / A78537872GGGATCTGCACACAAGGCTG4923171104023N / AN / A79637982TTGAGGCCTAATCAATATTG11023181104039N / AN / A80528071GAAGAGATGGGTGAGGTGAG3623191104055N / AN / A81938212CTTTTTCCCCAGCAGCCAAC12523201104071N / AN / A93259344TCACATTCACTAATATTTAA7423211104087N / AN / A93899408CAAGTAAAAAGTAATTTAGC12023221104103N / AN / A94339452AGAGGAATTTTGTTCCTTAG9823231104119N / AN / A94819500TCCTGAGACATGCATATCTA8223241104135N / AN / A95209539ACTAGTCAGCCTGGTTAGCC6623251104151N / AN / A95499568ACTATCTAGGATTTGGCAGT3623261104167N / AN / A95699588CTGTGCTTTAGTGACCTGTG4223271104183N / AN / A96369655AGTGCTCAATACACATAGGT5823281104199N / AN / A96809699GACAATTAACTAAAATAAAG8723291104215N / AN / A1013110150ACTCCGTCGAAAGCAGGCAA9123301104231N / AN / A1056610585AAACCCAGCACGGTATTGAA7123311104247N / AN / A1069410713TCTTCCAAACGGGCTGGAGA9823321104263N / AN / A1079010809CATGAGCCATCCTCTCCCAT7023331104279N / AN / A1102311042TTGCTGGGAACCTTCTATGT9723341104295N / AN / A1112111140AAGGCTCCCCTTAGAACAGC6423351104311N / AN / A1116011179AGAGTGTGTATTAGGATCCC3123361104327N / AN / A1124211261GAGTTGGAAGTGAAAGCTAC6723371104343N / AN / A1134211361CGTGGCGGATACGCCAAATC9623381104359N / AN / A1143111450GTGAGATAACACTGGGAAAG6523391104375N / AN / A1155211571TTCACACAGACCCCAGGTCC962340 Table 32 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG6517110316022124036693688GAGTGCCCCAGCCAGGGAGA1192341110317644246138903909GCGGTGAGTTGATCGAGCCG862342110319265367252425261CTTCCTCAAGAACCGGATCT812343110320893295172897308GTCGCAGGTCAAGGACTGCA10023441103224129313121090710926GCATCTCCACGGTCTTCACC8523451103240140314221169211711CTGCTTCTGCTCGGGCCCCT8023461103256157715961186611885GAGTTTCTTGTTAGTTGGAG923471103272170017191198912008AACAGGAATCAGGGATGTGG3523481103288183618551212512144CCAGGGCTACCTTGTCTGTG9023491103304187818971216712186TATCCCACCTCATAAAAACC8823501103320200120201229012309TAGGAGAACAACCCTCTGAG6223511103336218522041247412493CCCAAGTGCTGAGAATCAAG5323521103352240024191268912708AATCCAGAGGCCAAGTGCAA9523531103368245224711274112760TCTCTCCTGTTTCAGCATCT2223541103384249625151278512804AAATGGGACAAAGTCATGCC9823551103400263726561292612945GCTTAGGGAAAAGCAGCCGG5123561103416270427231299313012TAGGGCACTACCTAGAATAC7523571103432279128101308013099GTCAGCCCTGAGCACCCGGC11623581103448302130401331013329GGCAGCAGCAGTGCCCTGAA3823591103464N / AN / A87528771TGATTTTCCCCGTCTTTGGT5823601103480N / AN / A88668885CGTGTCTGAGAGGCAGGCAG7623611103496N / AN / A89899008CTGCAGTTCCTGGGAAAATG7023621103512N / AN / A91479166GGCCCTCCCAGTGACAGGAA6823631103528N / AN / A92509269GAAGAATCCTCTGAACTGAG6423641103544N / AN / A92959314AGGGAACATAAAACTTTATT5723651103560N / AN / A84088427AGGACTCCAGTGCCCTTCCC5723661103576N / AN / A85468565CACCTAGAAGTACCCTGGTA10123671103592N / AN / A87348753GTGCTTTTGCCCCCTGTAGT4323681103608N / AN / A40404059CCTCCCTGAGACTTCTCGGG8623691103624N / AN / A42174236TGCACTGCTTTCCCCAGTAG10223701103640N / AN / A43734392CACTTTCTTCACCCCAGAAT13523711103656N / AN / A44654484AGCTGTGCAAGTCAAAGTAA8023721103672N / AN / A45844603TGCACTTGAAGGCACACATG5923731103688N / AN / A47294748GAGGATGAGCAGATGTGGGC6523741103704N / AN / A49624981TCCCTGACCTGTCTATAGGC95*23751103720N / AN / A51705189TTCATCTGCTTCCTGGAGTG72*23761103736N / AN / A53815400ACCTGCCAATCTCTGTTTCT9423771103752N / AN / A54475466GAATGCTCTCTTGTCTCTTT5423781103768N / AN / A55415560TGAGAGAAGCGGTACCAGGG7923791103784N / AN / A58325851AAAGTCAGTCACCTGGAGAG8723801103800N / AN / A59075926CAGTAATAATAATGGGTACT6723811103816N / AN / A59575976AGGGCTTAGAACAGAACAGT5023821103832N / AN / A60056024GTCAAAGAACAGCACCTACT12123831103848N / AN / A61606179GGTAGAGGCTCAGTAACCCA6823841103864N / AN / A62196238TCAATATCACACCTTCCAGG8023851103880N / AN / A62786297ACACTACATATAAGCTCTGA10923861103896N / AN / A63826401TCTGTCCTCCACTAGGAATG12023871103912N / AN / A64626481CACTCACACTCCTCAGCTAG8523881103928N / AN / A65546573CTGGGTTCTAATAGCCCTTT7723891103944N / AN / A69837002GCGAATGAATGAACAGTGCC7523901103960N / AN / A71227141TCAGGGAGGTGAGCAGCACC11123911103976N / AN / A73547373CGTCCCTGCTCCGCCCGTCC9323921103992N / AN / A75047523TCCCGCGGAGCCCCGACCCG9023931104008N / AN / A78577876GGAAGGGATCTGCACACAAG5923941104024N / AN / A79657984CCTTGAGGCCTAATCAATAT8023951104040N / AN / A80538072AGAAGAGATGGGTGAGGTGA8523961104056N / AN / A82018220TCTCCTAGCTTTTTCCCCAG13123971104072N / AN / A93279346CGTCACATTCACTAATATTT2223981104088N / AN / A93959414CCAATGCAAGTAAAAAGTAA9223991104104N / AN / A94349453AAGAGGAATTTTGTTCCTTA7224001104120N / AN / A94839502AGTCCTGAGACATGCATATC7724011104136N / AN / A95219540TACTAGTCAGCCTGGTTAGC6924021104152N / AN / A95509569GACTATCTAGGATTTGGCAG2224031104168N / AN / A95709589TCTGTGCTTTAGTGACCTGT5624041104184N / AN / A96379656TAGTGCTCAATACACATAGG5824051104200N / AN / A96819700AGACAATTAACTAAAATAAA8524061104216N / AN / A1013210151GACTCCGTCGAAAGCAGGCA6324071104232N / AN / A1057010589CTGAAAACCCAGCACGGTAT14224081104248N / AN / A1069510714CTCTTCCAAACGGGCTGGAG6924091104264N / AN / A1079110810GCATGAGCCATCCTCTCCCA12124101104280N / AN / A1102411043GTTGCTGGGAACCTTCTATG3424111104296N / AN / A1112211141CAAGGCTCCCCTTAGAACAG5624121104312N / AN / A1116211181AGAGAGTGTGTATTAGGATC3724131104328N / AN / A1124311262AGAGTTGGAAGTGAAAGCTA7324141104344N / AN / A1137011389AGATGAGCTCCCACTGTGGT7424151104360N / AN / A1143211451GGTGAGATAACACTGGGAAA4824161104376N / AN / A1155311572GTTCACACAGACCCCAGGTC962417 Table 33 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG5517110316122224136703689TGAGTGCCCCAGCCAGGGAG1682418110317744346238913910GGCGGTGAGTTGATCGAGCC1012419110319365467352435262TCTTCCTCAAGAACCGGATC682420110320994896773057324CGCGCAGAGACTCCAGGTCG11224211103225129513141090910928CCGCATCTCCACGGTCTTCA7424221103241140914281169811717ACTATCCTGCTTCTGCTCGG4124231103257157815971186711886TGAGTTTCTTGTTAGTTGGA2424241103273170217211199112010ACAACAGGAATCAGGGATGT9424251103289184018591212912148CTGGCCAGGGCTACCTTGTC9524261103305187918981216812187ATATCCCACCTCATAAAAAC10824271103321201320321230212321TCAGGGTCAGTCTAGGAGAA6324281103337218922081247812497ATCCCCCAAGTGCTGAGAAT9624291103353240324221269212711CACAATCCAGAGGCCAAGTG7024301103369245324721274212761TTCTCTCCTGTTTCAGCATC3224311103385249725161278612805GAAATGGGACAAAGTCATGC7924321103401263826571292712946GGCTTAGGGAAAAGCAGCCG14024331103417270527241299413013ATAGGGCACTACCTAGAATA11724341103433279228111308113100TGTCAGCCCTGAGCACCCGG6424351103449303130501332013339AGCGACTAAAGGCAGCAGCA6424361103465N / AN / A87538772GTGATTTTCCCCGTCTTTGG2624371103481N / AN / A88928911ACTCCCTGTCAAGCTGGGCA11024381103497N / AN / A89919010CACTGCAGTTCCTGGGAAAA9224391103513N / AN / A91709189TCCAGGCACAGCGAGACCCA12124401103529N / AN / A92519270GGAAGAATCCTCTGAACTGA8624411103545N / AN / A92969315CAGGGAACATAAAACTTTAT13524421103561N / AN / A84098428CAGGACTCCAGTGCCCTTCC9724431103577N / AN / A85488567CCCACCTAGAAGTACCCTGG7224441103593N / AN / A87368755TGGTGCTTTTGCCCCCTGTA8424451103609N / AN / A40444063GGCCCCTCCCTGAGACTTCT16124461103625N / AN / A42184237CTGCACTGCTTTCCCCAGTA12324471103641N / AN / A43814400CTTTCCCTCACTTTCTTCAC13524481103657N / AN / A44794498GACCACCGCTTCACAGCTGT11824491103673N / AN / A45944613CATGTCCTCCTGCACTTGAA6624501103689N / AN / A47454764ACAGAGGACTTGTCTGGAGG7724511103705N / AN / A49634982CTCCCTGACCTGTCTATAGG97*24521103721N / AN / A51715190CTTCATCTGCTTCCTGGAGT78*24531103737N / AN / A53825401TACCTGCCAATCTCTGTTTC7924541103753N / AN / A54495468TCGAATGCTCTCTTGTCTCT9224551103769N / AN / A55435562GGTGAGAGAAGCGGTACCAG14124561103785N / AN / A58345853TGAAAGTCAGTCACCTGGAG10224571103801N / AN / A59085927GCAGTAATAATAATGGGTAC6924581103817N / AN / A59585977CAGGGCTTAGAACAGAACAG6124591103833N / AN / A60146033CTCTCATCTGTCAAAGAACA8724601103849N / AN / A61616180TGGTAGAGGCTCAGTAACCC6024611103865N / AN / A62466265TCTACGGGCACTATGTTTGG7924621103881N / AN / A62796298CACACTACATATAAGCTCTG18824631103897N / AN / A63986417TTTTCTGCCTCCAGGCTCTG9324641103913N / AN / A64696488CTTCTGCCACTCACACTCCT10124651103929N / AN / A68066825GTCAGTGGCACAATCCCGGG7624661103945N / AN / A69877006GCAAGCGAATGAATGAACAG7624671103961N / AN / A71237142ATCAGGGAGGTGAGCAGCAC5124681103977N / AN / A73607379GGTGGCCGTCCCTGCTCCGC8924691103993N / AN / A77607779TGATGAGGGCTCACCGGTTC7724701104009N / AN / A78967915GCTATGTGTGAGGCAGGCAC13824711104025N / AN / A79797998ACCCAAGTCCTTGGCCTTGA7924721104041N / AN / A80548073CAGAAGAGATGGGTGAGGTG7124731104057N / AN / A82028221ATCTCCTAGCTTTTTCCCCA14724741104073N / AN / A93459364AGAGAGAAAAATATAACACG9024751104089N / AN / A94019420TCAGGGCCAATGCAAGTAAA5324761104105N / AN / A94369455AGAAGAGGAATTTTGTTCCT6824771104121N / AN / A94849503AAGTCCTGAGACATGCATAT6424781104137N / AN / A95229541CTACTAGTCAGCCTGGTTAG6824791104153N / AN / A95519570TGACTATCTAGGATTTGGCA3824801104169N / AN / A95719590ATCTGTGCTTTAGTGACCTG8024811104185N / AN / A96389657TTAGTGCTCAATACACATAG7524821104201N / AN / A96829701GAGACAATTAACTAAAATAA8624831104217N / AN / A1013310152AGACTCCGTCGAAAGCAGGC7824841104233N / AN / A1057110590TCTGAAAACCCAGCACGGTA11624851104249N / AN / A1069610715GCTCTTCCAAACGGGCTGGA11624861104265N / AN / A1079510814CAGGGCATGAGCCATCCTCT10124871104281N / AN / A1105611075CTCCTCCAGAATTCCCTGGG14024881104297N / AN / A1113011149TTTGGTACCAAGGCTCCCCT7224891104313N / AN / A1117811197TTTGAGGGTGAGAAAGAGAG8224901104329N / AN / A1125911278CCCAACTGTGTCTGCTAGAG4724911104345N / AN / A1137111390AAGATGAGCTCCCACTGTGG11124921104361N / AN / A1143411453GTGGTGAGATAACACTGGGA4324931104377N / AN / A1155711576AGGAGTTCACACAGACCCCA922494 Table 34 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG6517110316222424336723691ATTGAGTGCCCCAGCCAGGG942495110317846848739163935TCTCAACCTCCAGCCGGGCG23*2496110319468770655735592GCTCCTGGAGTTCCCGAACC1392497110321094996873067325CCGCGCAGAGACTCCAGGTC982498110322613161335N / AN / ACTCCTTAATGACCTCTCCAT9524991103242141914381170811727AGGCGGAGCAACTATCCTGC15025001103258157915981186811887GTGAGTTTCTTGTTAGTTGG3525011103274170617251199512014CATAACAACAGGAATCAGGG4925021103290184618651213512154AAGCCTCTGGCCAGGGCTAC11325031103306188018991216912188GATATCCCACCTCATAAAAA9825041103322201520341230412323GATCAGGGTCAGTCTAGGAG4625051103338219622151248512504ACAACAGATCCCCCAAGTGC8925061103354240524241269412713CCCACAATCCAGAGGCCAAG7925071103370245424731274312762TTTCTCTCCTGTTTCAGCAT3125081103386249825171278712806AGAAATGGGACAAAGTCATG10225091103402264326621293212951CCCTTGGCTTAGGGAAAAGC10225101103418270627251299513014AATAGGGCACTACCTAGAAT13025111103434279328121308213101GTGTCAGCCCTGAGCACCCG7325121103450303230511332113340CAGCGACTAAAGGCAGCAGC7625131103466N / AN / A87598778GACCTTGTGATTTTCCCCGT5525141103482N / AN / A88938912CACTCCCTGTCAAGCTGGGC11225151103498N / AN / A90289047TAATGTACAGTTACTCTGTA8025161103514N / AN / A92069225CCTCAGGGATGAAAGAATAA5625171103530N / AN / A92529271GGGAAGAATCCTCTGAACTG8325181103546N / AN / A92979316GCAGGGAACATAAAACTTTA13225191103562N / AN / A84418460CTGGAGCAACCTACAGGCCC10325201103578N / AN / A85508569GCCCCACCTAGAAGTACCCT8325211103594N / AN / A87388757TTTGGTGCTTTTGCCCCCTG7625221103610N / AN / A40454064CGGCCCCTCCCTGAGACTTC9225231103626N / AN / A42194238CCTGCACTGCTTTCCCCAGT12425241103642N / AN / A43844403GCTCTTTCCCTCACTTTCTT11125251103658N / AN / A44804499TGACCACCGCTTCACAGCTG6625261103674N / AN / A45984617CGCACATGTCCTCCTGCACT12225271103690N / AN / A47464765GACAGAGGACTTGTCTGGAG6925281103706N / AN / A49664985CACCTCCCTGACCTGTCTAT165*25291103722N / AN / A51735192GGCTTCATCTGCTTCCTGGA11*25301103738N / AN / A53905409CCTGTCTCTACCTGCCAATC9325311103754N / AN / A54565475CAGGAGTTCGAATGCTCTCT7725321103770N / AN / A55555574CCTCCTGACCAGGGTGAGAG9125331103786N / AN / A58385857CTGGTGAAAGTCAGTCACCT8425341103802N / AN / A59095928AGCAGTAATAATAATGGGTA12225351103818N / AN / A59605979CACAGGGCTTAGAACAGAAC10125361103834N / AN / A60156034TCTCTCATCTGTCAAAGAAC8125371103850N / AN / A61626181ATGGTAGAGGCTCAGTAACC6625381103866N / AN / A62476266CTCTACGGGCACTATGTTTG7225391103882N / AN / A62866305TGGCTCCCACACTACATATA8925401103898N / AN / A64016420TGCTTTTCTGCCTCCAGGCT8225411103914N / AN / A64766495CCAGTGGCTTCTGCCACTCA9225421103930N / AN / A68986917AGCGGAGGCCTGGGTGTTTT7425431103946N / AN / A69887007AGCAAGCGAATGAATGAACA11625441103962N / AN / A71247143AATCAGGGAGGTGAGCAGCA7125451103978N / AN / A73847403CCCTTCTCCCCTGGCATCTC13025461103994N / AN / A77927811GTGAGGCAGCAGGGAGACTT8025471104010N / AN / A79047923GACTGCCTGCTATGTGTGAG11825481104026N / AN / A79818000TGACCCAAGTCCTTGGCCTT10925491104042N / AN / A80568075GGCAGAAGAGATGGGTGAGG7525501104058N / AN / A82078226ACTCCATCTCCTAGCTTTTT9525511104074N / AN / A93479366CGAGAGAGAAAAATATAACA12925521104090N / AN / A94039422TTTCAGGGCCAATGCAAGTA4925531104106N / AN / A94479466TCTAGTCCAGAAGAAGAGGA7625541104122N / AN / A94949513ATGCTGAATTAAGTCCTGAG3825551104138N / AN / A95239542TCTACTAGTCAGCCTGGTTA6825561104154N / AN / A95539572TGTGACTATCTAGGATTTGG6825571104170N / AN / A95729591TATCTGTGCTTTAGTGACCT5325581104186N / AN / A96399658ATTAGTGCTCAATACACATA10125591104202N / AN / A96839702GGAGACAATTAACTAAAATA9425601104218N / AN / A1013510154TAAGACTCCGTCGAAAGCAG13125611104234N / AN / A1057210591TTCTGAAAACCCAGCACGGT11025621104250N / AN / A1070810727GAGAGAGCCTAGGCTCTTCC7025631104266N / AN / A1079610815TCAGGGCATGAGCCATCCTC6025641104282N / AN / A1106511084TTCCTTGCTCTCCTCCAGAA15625651104298N / AN / A1114411163TCCCATCTAGTGGCTTTGGT4825661104314N / AN / A1121211231TCTCTTTCTCTCCCTGGCAA7425671104330N / AN / A1126411283CCATCCCCAACTGTGTCTGC6425681104346N / AN / A1138111400CTGCTGGAGTAAGATGAGCT9925691104362N / AN / A1147811497TTCTTGATAGTAACCACAGC5325701104378N / AN / A1155811577TAGGAGTTCACACAGACCCC1642571 Table 35 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG8517110316323325236813700GAAGCCAGCATTGAGTGCCC1092572110317948450339323951TGTGCCAGATTGTCCCTCTC13*2573110319571373255995618CACATGGACCTGCTGTCGGG1072574110321195197073087327TGCCGCGCAGAGACTCCAGG902575110322713171336N / AN / AACTCCTTAATGACCTCTCCA15125761103243143414531172311742GAAATGTGCCAGCAGAGGCG9625771103259158116001187011889GGGTGAGTTTCTTGTTAGTT1525781103275171217311200112020AGTTTCCATAACAACAGGAA9125791103291185118701214012159AAAACAAGCCTCTGGCCAGG11525801103307188119001217012189GGATATCCCACCTCATAAAA10725811103323203020491231912338CACCCATCTTAGACTGATCA11625821103339219722161248612505CACAACAGATCCCCCAAGTG11025831103355240924281269812717AATTCCCACAATCCAGAGGC7225841103371245524741274412763CTTTCTCTCCTGTTTCAGCA2025851103387250625251279512814AGGCCTTTAGAAATGGGACA7625861103403265626751294512964GGACCGCAAGAGGCCCTTGG8325871103419270727261299613015AAATAGGGCACTACCTAGAA10025881103435283128501312013139CTGCTCAGTCAAAGCAGAGT9925891103467N / AN / A87658784TCTTGTGACCTTGTGATTTT5525901103483N / AN / A88948913TCACTCCCTGTCAAGCTGGG13025911103499N / AN / A90299048TTAATGTACAGTTACTCTGT9825921103515N / AN / A92149233CGATGGAGCCTCAGGGATGA5725931103531N / AN / A92539272AGGGAAGAATCCTCTGAACT5925941103547N / AN / A92989317AGCAGGGAACATAAAACTTT7925951103563N / AN / A84588477TGATCCTCAGTCCCAGTCTG9525961103579N / AN / A85528571AAGCCCCACCTAGAAGTACC13125971103595N / AN / A39653984CCTCCTCACTTCTGCCTCAC77*25981103611N / AN / A40464065TCGGCCCCTCCCTGAGACTT7425991103627N / AN / A42204239TCCTGCACTGCTTTCCCCAG8026001103643N / AN / A43854404TGCTCTTTCCCTCACTTTCT11926011103659N / AN / A44844503ATTATGACCACCGCTTCACA5426021103675N / AN / A46034622ACACACGCACATGTCCTCCT15726031103691N / AN / A47514770CCTTAGACAGAGGACTTGTC9026041103707N / AN / A49674986CCACCTCCCTGACCTGTCTA102*26051103723N / AN / A53015320AGTTGCAATCTCTGTGTTGA10526061103739N / AN / A53915410TCCTGTCTCTACCTGCCAAT8126071103755N / AN / A54575476CCAGGAGTTCGAATGCTCTC9726081103771N / AN / A55575576AACCTCCTGACCAGGGTGAG8726091103787N / AN / A58395858TCTGGTGAAAGTCAGTCACC9926101103803N / AN / A59105929TAGCAGTAATAATAATGGGT5326111103819N / AN / A59675986TGAAAAGCACAGGGCTTAGA11826121103835N / AN / A60166035CTCTCTCATCTGTCAAAGAA6426131103851N / AN / A61646183ATATGGTAGAGGCTCAGTAA7026141103867N / AN / A62536272GGTGTTCTCTACGGGCACTA8726151103883N / AN / A62896308TCCTGGCTCCCACACTACAT10926161103899N / AN / A64026421GTGCTTTTCTGCCTCCAGGC3226171103915N / AN / A64896508CCCTGCTCAGACACCAGTGG15726181103931N / AN / A68996918GAGCGGAGGCCTGGGTGTTT12326191103947N / AN / A70057024TAGCACAACACCTGGTCAGC9226201103963N / AN / A71277146GGAAATCAGGGAGGTGAGCA5826211103979N / AN / A73857404GCCCTTCTCCCCTGGCATCT8326221103995N / AN / A77997818CTCTACCGTGAGGCAGCAGG9726231104011N / AN / A79097928CTAGTGACTGCCTGCTATGT11226241104027N / AN / A80078026GGGAGTATGCCTCTTAGTTT5526251104043N / AN / A80718090AGAAAGTTCCAAGGAGGCAG11226261104059N / AN / A82088227AACTCCATCTCCTAGCTTTT8526271104075N / AN / A93489367CCGAGAGAGAAAAATATAAC6626281104091N / AN / A94049423ATTTCAGGGCCAATGCAAGT8526291104107N / AN / A94489467TTCTAGTCCAGAAGAAGAGG7226301104123N / AN / A94959514GATGCTGAATTAAGTCCTGA4126311104139N / AN / A95279546TACCTCTACTAGTCAGCCTG7826321104155N / AN / A95549573CTGTGACTATCTAGGATTTG7026331104171N / AN / A95739592TTATCTGTGCTTTAGTGACC5426341104187N / AN / A96429661CATATTAGTGCTCAATACAC5926351104203N / AN / A97039722ACTTCTCTAGGTGGGAGAGA5826361104219N / AN / A1013610155GTAAGACTCCGTCGAAAGCA9926371104235N / AN / A1057310592TTTCTGAAAACCCAGCACGG13226381104251N / AN / A1073010749TGAGAACCTATGCAACCGAG6226391104267N / AN / A1079810817TTTCAGGGCATGAGCCATCC14026401104283N / AN / A1107011089TCAGTTTCCTTGCTCTCCTC8226411104299N / AN / A1114611165GATCCCATCTAGTGGCTTTG3926421104315N / AN / A1121311232TTCTCTTTCTCTCCCTGGCA8526431104331N / AN / A1126511284CCCATCCCCAACTGTGTCTG7326441104347N / AN / A1138411403AAGCTGCTGGAGTAAGATGA12226451104363N / AN / A1148311502TACTTTTCTTGATAGTAACC7426461104379N / AN / A1155911578TTAGGAGTTCACACAGACCC852647 Table 36 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG10517110316425427337023721CTCACTGGCCCGGGTCTCCT1332648110318048550439333952CTGTGCCAGATTGTCCCTCT16*2649110319671473356005619CCACATGGACCTGCTGTCGG121265011032121046106576187637TTCCTCCAGCCGCGCCAGCG13526511103228132413431161311632TGCTTGGACTCCTTAATGAC9726521103244143614551172511744GGGAAATGTGCCAGCAGAGG3926531103260160116201189011909CCCTCCAGACTGCCCCTTGG9526541103276172617451201512034CCATCTCTGGCAACAGTTTC7126551103292185618751214512164AAGACAAAACAAGCCTCTGG8826561103308188219011217112190GGGATATCCCACCTCATAAA8826571103324203120501232012339CCACCCATCTTAGACTGATC10026581103340219822171248712506ACACAACAGATCCCCCAAGT9026591103356241024291269912718TAATTCCCACAATCCAGAGG11526601103372245924781274812767TCCCCTTTCTCTCCTGTTTC10126611103388250825271279712816AGAGGCCTTTAGAAATGGGA10226621103404266226811295112970AAGAAGGGACCGCAAGAGGC8326631103420271527341300413023CAATTGTAAAATAGGGCACT11526641103436283528541312413143CAGTCTGCTCAGTCAAAGCA12126651103468N / AN / A87668785ATCTTGTGACCTTGTGATTT7526661103484N / AN / A88958914CTCACTCCCTGTCAAGCTGG9826671103500N / AN / A90339052CAGTTTAATGTACAGTTACT9026681103516N / AN / A92159234GCGATGGAGCCTCAGGGATG2826691103532N / AN / A92549273GAGGGAAGAATCCTCTGAAC8626701103548N / AN / A93059324CATTAAGAGCAGGGAACATA8526711103564N / AN / A84928511GAAGGCCCCCAGGGAGAGCT7226721103580N / AN / A85538572CAAGCCCCACCTAGAAGTAC10726731103596N / AN / A39663985CCCTCCTCACTTCTGCCTCA98*26741103612N / AN / A40474066TTCGGCCCCTCCCTGAGACT7726751103628N / AN / A42274246CCGCTGCTCCTGCACTGCTT12326761103644N / AN / A43874406CCTGCTCTTTCCCTCACTTT11026771103660N / AN / A44854504TATTATGACCACCGCTTCAC8526781103676N / AN / A46044623CACACACGCACATGTCCTCC10626791103692N / AN / A47544773GGGCCTTAGACAGAGGACTT9726801103708N / AN / A49704989CCTCCACCTCCCTGACCTGT91*26811103724N / AN / A53025321CAGTTGCAATCTCTGTGTTG12726821103740N / AN / A53925411TTCCTGTCTCTACCTGCCAA15326831103756N / AN / A54755494CTTCTGCCTGCCCCTCGGCC10926841103772N / AN / A55585577GAACCTCCTGACCAGGGTGA11626851103788N / AN / A58405859CTCTGGTGAAAGTCAGTCAC11226861103804N / AN / A59115930GTAGCAGTAATAATAATGGG9326871103820N / AN / A59695988CATGAAAAGCACAGGGCTTA9426881103836N / AN / A60176036GCTCTCTCATCTGTCAAAGA5926891103852N / AN / A61976216AGACACCTCTCTGTGTCCTG6026901103868N / AN / A62556274GTGGTGTTCTCTACGGGCAC9526911103884N / AN / A63086327GCCCCCTCTACAGTGTCTTT8526921103900N / AN / A64056424TCTGTGCTTTTCTGCCTCCA5926931103916N / AN / A64936512CTCACCCTGCTCAGACACCA10526941103932N / AN / A69006919CGAGCGGAGGCCTGGGTGTT5926951103948N / AN / A70067025CTAGCACAACACCTGGTCAG10626961103964N / AN / A71957214AGGTCTGCAAACTAGGTGGG9326971103980N / AN / A74147433CCCGCCCTCGACCCAGGTCC12126981103996N / AN / A78027821GAGCTCTACCGTGAGGCAGC10126991104012N / AN / A79117930ATCTAGTGACTGCCTGCTAT9527001104028N / AN / A80318050AGTCCAATCTTGGCTGGGAA8027011104044N / AN / A80738092GAAGAAAGTTCCAAGGAGGC9427021104060N / AN / A82098228TAACTCCATCTCCTAGCTTT8927031104076N / AN / A93499368CCCGAGAGAGAAAAATATAA9927041104092N / AN / A94069425TCATTTCAGGGCCAATGCAA6327051104108N / AN / A94509469TATTCTAGTCCAGAAGAAGA12727061104124N / AN / A95049523AGCCTTTCTGATGCTGAATT5227071104140N / AN / A95289547TTACCTCTACTAGTCAGCCT7527081104156N / AN / A95559574CCTGTGACTATCTAGGATTT5227091104172N / AN / A95749593TTTATCTGTGCTTTAGTGAC5027101104188N / AN / A96519670CATGTGGCACATATTAGTGC9727111104204N / AN / A97049723TACTTCTCTAGGTGGGAGAG8327121104220N / AN / A1013710156AGTAAGACTCCGTCGAAAGC12427131104236N / AN / A1057410593CTTTCTGAAAACCCAGCACG8727141104252N / AN / A1073110750ATGAGAACCTATGCAACCGA6827151104268N / AN / A1080710826CTCATGGACTTTCAGGGCAT8427161104284N / AN / A1107611095TTACATTCAGTTTCCTTGCT10827171104300N / AN / A1114711166GGATCCCATCTAGTGGCTTT9427181104316N / AN / A1122211241TAACTTTAATTCTCTTTCTC13527191104332N / AN / A1126611285CCCCATCCCCAACTGTGTCT8027201104348N / AN / A1138511404TAAGCTGCTGGAGTAAGATG9227211104364N / AN / A1148411503TTACTTTTCTTGATAGTAAC8927221104380N / AN / A1157311592GCACAGTGCAACAGTTAGGA382723 Table 37 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound No. SEQ ID NO: 1 Start Site SEQ ID NO: 1 Stop Site SEQ ID NO: 2 Start Site SEQ ID NO: 2 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 1047582304730661333613355GTCTTTATTTTTCCTCAGCG6517110316526128037093728CTGCCCGCTCACTGGCCCGG982724110318150552439533972TGCCTCACAGTGGCCAGGTC45*2725110319775677556425661CTTTCAGGGCTGCGGTGAGG99272611032131048106776207639TCTTCCTCCAGCCGCGCCAG5327271103229132513441161411633CTGCTTGGACTCCTTAATGA7327281103245149715161178611805AAGCTGACCTAGGGACAGAG10627291103261160216211189111910CCCCTCCAGACTGCCCCTTG7327301103277172717461201612035TCCATCTCTGGCAACAGTTT4827311103293185718761214612165AAAGACAAAACAAGCCTCTG7127321103309188319021217212191AGGGATATCCCACCTCATAA15927331103325205720761234612365TGACTGCCCCAGGTGGCAGG11627341103341219922181248812507TACACAACAGATCCCCCAAG8627351103357241124301270012719TTAATTCCCACAATCCAGAG10427361103373246024791274912768ATCCCCTTTCTCTCCTGTTT7627371103389250925281279812817AAGAGGCCTTTAGAAATGGG7127381103405266326821295212971TAAGAAGGGACCGCAAGAGG8127391103421271627351300513024ACAATTGTAAAATAGGGCAC8127401103437283728561312613145ACCAGTCTGCTCAGTCAAAG9027411103469N / AN / A87678786TATCTTGTGACCTTGTGATT5427421103485N / AN / A88968915GCTCACTCCCTGTCAAGCTG7627431103501N / AN / A90429061AAGCTCTGCCAGTTTAATGT5727441103517N / AN / A92169235AGCGATGGAGCCTCAGGGAT8327451103533N / AN / A92559274TGAGGGAAGAATCCTCTGAA9227461103549N / AN / A93069325ACATTAAGAGCAGGGAACAT10527471103565N / AN / A84998518GTGTCACGAAGGCCCCCAGG7227481103581N / AN / A85568575CTGCAAGCCCCACCTAGAAG9427491103597N / AN / A39894008TCACAAGGCCCCCCTTCCCC9827501103613N / AN / A40484067GTTCGGCCCCTCCCTGAGAC9027511103629N / AN / A42284247CCCGCTGCTCCTGCACTGCT8327521103645N / AN / A43894408TGCCTGCTCTTTCCCTCACT8827531103661N / AN / A44894508ATTTTATTATGACCACCGCT9727541103677N / AN / A46254644TCACTGTTGCACACACACAC12427551103693N / AN / A47754794GCAGGAGGATTAAGGGTTGG7627561103709N / AN / A50105029TGGGTGGCCATCAATCCTTT9727571103725N / AN / A53035322TCAGTTGCAATCTCTGTGTT6527581103741N / AN / A53945413ATTTCCTGTCTCTACCTGCC9527591103757N / AN / A54805499GTCCTCTTCTGCCTGCCCCT9027601103773N / AN / A57225741CAGGGCTACCTTGGAGCGGT7127611103789N / AN / A58485867TCTCACTTCTCTGGTGAAAG8227621103805N / AN / A59125931AGTAGCAGTAATAATAATGG8627631103821N / AN / A59735992AATCCATGAAAAGCACAGGG8827641103837N / AN / A60186037GGCTCTCTCATCTGTCAAAG2427651103853N / AN / A61986217CAGACACCTCTCTGTGTCCT10827661103869N / AN / A62566275TGTGGTGTTCTCTACGGGCA6227671103885N / AN / A63126331AAATGCCCCCTCTACAGTGT11027681103901N / AN / A64066425CTCTGTGCTTTTCTGCCTCC6727691103917N / AN / A65006519TCGGGCCCTCACCCTGCTCA9227701103933N / AN / A69026921GGCGAGCGGAGGCCTGGGTG1227711103949N / AN / A70167035ACCTCAGCACCTAGCACAAC9027721103965N / AN / A71977216TCAGGTCTGCAAACTAGGTG7227731103981N / AN / A74157434CCCCGCCCTCGACCCAGGTC13127741103997N / AN / A78047823ATGAGCTCTACCGTGAGGCA8827751104013N / AN / A79137932ACATCTAGTGACTGCCTGCT9427761104029N / AN / A80348053AGGAGTCCAATCTTGGCTGG7427771104045N / AN / A80748093TGAAGAAAGTTCCAAGGAGG9527781104061N / AN / A82158234AAAGTCTAACTCCATCTCCT13127791104077N / AN / A93589377CCCGCCCCGCCCGAGAGAGA8327801104093N / AN / A94089427AATCATTTCAGGGCCAATGC2427811104109N / AN / A94519470ATATTCTAGTCCAGAAGAAG12327821104125N / AN / A95059524TAGCCTTTCTGATGCTGAAT5727831104141N / AN / A95299548ATTACCTCTACTAGTCAGCC5927841104157N / AN / A95569575ACCTGTGACTATCTAGGATT8227851104173N / AN / A95759594ATTTATCTGTGCTTTAGTGA4127861104189N / AN / A96529671ACATGTGGCACATATTAGTG9827871104205N / AN / A97059724CTACTTCTCTAGGTGGGAGA7927881104221N / AN / A1013810157GAGTAAGACTCCGTCGAAAG8927891104237N / AN / A1060810627TCAGCCCCTCTGCAAGCCCT8527901104253N / AN / A1073210751TATGAGAACCTATGCAACCG7227911104269N / AN / A1080810827TCTCATGGACTTTCAGGGCA11227921104285N / AN / A1107711096ATTACATTCAGTTTCCTTGC10327931104301N / AN / A1114811167AGGATCCCATCTAGTGGCTT9127941104317N / AN / A1122411243ACTAACTTTAATTCTCTTTC9627951104333N / AN / A1127411293AAAGCCCTCCCCATCCCCAA12827961104349N / AN / A1138711406GGTAAGCTGCTGGAGTAAGA2627971104365N / AN / A1148511504CTTACTTTTCTTGATAGTAA3627981104381N / AN / A1160511624CTCCTTAATGACCTGCAGGG742799 Table 38 Reduction of GFAP RNA by 5-10-5 MOE gapmers with mixed PO / PS internucleoside linkages in U251 cellsCompound Number SEQ ID NO: 3 Start Site SEQ ID NO: 3 Stop Site Sequence (5' to 3') GFAP (%UTC) SEQ ID NO 110345112201239CCCTCGAATCTGCAGGTTGG942800110345212271246TTTTGCCCCCTCGAATCTGC1062801110345312281247CTTTTGCCCCCTCGAATCTG842802110345412291248GCTTTTGCCCCCTCGAATCT952803110345512311250GTGCTTTTGCCCCCTCGAAT592804110345612331252TGGTGCTTTTGCCCCCTCGA922805110345712351254TTTGGTGCTTTTGCCCCCTC602806110355418131832TTAATATTTAACATTAAGAG772807104759512221241CCCCCTCGAATCTGCAGGTT109284104759612231242GCCCCCTCGAATCTGCAGGT107362104759712251244TTGCCCCCTCGAATCTGCAG65440104759812301249TGCTTTTGCCCCCTCGAATC115518104759912321251GGTGCTTTTGCCCCCTCGAA43596104760012341253TTGGTGCTTTTGCCCCCTCG86674 Example 3: Effect of modified oligonucleotides on human GFAP RNA in vitro, multiple doses

[0229] Modified oligonucleotides selected from the examples above were tested at various doses in U251 cells. Cultured U251 cells at a density of 10,000 cells per well were treated using free uptake with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and GFAP RNA levels were measured by quantitative real-time RTPCR. Human GFAP primer probe set RTS37485 was used to measure RNA levels, as described above. GFAP RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ®< . Results are presented as percent of GFAP RNA, relative to untreated control cells (% control). Where possible, the half maximal inhibitory concentration (IC 50 ) of each modified oligonucleotide was calculated using a linear regression on a log / linear plot of the data in Excel. In some cases, an IC 50 could not be reliably calculated and the data point is marked as "NC". Modified oligonucleotides marked with an asterisk (*) indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region. Table 39 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC 50 (µM) 125nM 500nM 2000nM 8000nM 1047225765747422.01047257605139330.51047258515038290.21047386998241261.910473871097333131.31047448851229994NC10474661078277467.81047497120117107136NC10475121161129787NC1047584945423100.810476081251337952NC1047609888257333.01047610927543191.51047913987249251.910482031209557313.31048267991009370NC104829699917372NC104834477978886NC10483619211585109NC Table 40 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC 50 (µM) 125nM 500nM 2000nM 8000nM 104732581867667NC1047357746347221.1104737214514312599NC10473731057343211.7104737415012284467.3104738810811662324.210475001001057460NC104751593958165NC1047518125998151NC1047579921138153NC1047580968858414.31047581736032170.7104758272291270.310475841006023110.610476131071077944NC104766299868347NC10477071001269175NC104802782835956NC10483501048557363.4 Table 41 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC 50 (µM) 125nM 500nM 2000nM 8000nM 104723580816857NC1047328917955393.510473621107752202.01047391877961455.51047394787452362.6104750392948059NC104752281816350NC1047583975419120.81047584815019100.61047585857338181.21047586756441231.11047587926641191.3104759992948378NC1047601103896850NC104776299847071NC1047955951048692NC104801885847451NC104835198977559NC10483551141149061NC Table 42 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC 50 (µM) 125nM 500nM 2000nM 8000nM 1047429805832150.8104744480988373NC104749292997958NC1047573807459444.7104758487532080.71047588694924140.510475891017947242.01047590705535240.71047591926734211.2104773486756960NC1047990757558404.110480551039661425.01048151947623161.11048182857656352.910481951051048787NC104819694917362NC104822891818793NC1048341807161466.1104837294888459NC Table 43 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC 50 (µM) 125nM 500nM 2000nM 8000nM 104732194918479NC104733794896861NC104736886827981NC104738586806358NC104743289847589NC1047465826762497.31047469104957358NC10475131061009680NC104757682836349NC1047584886331141.0104762586807355NC1047675101889282NC10476889910096100NC1047705100927868NC104786690817178NC1048125103918684NC1048187100888274NC104818899648081NC1048201806541231.2 Table 44 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC 50 (µM) 125nM 500nM 2000nM 8000nM 104729887837475NC1047474102939487NC1047523887661424.61047582793718120.410475841007243201.6104760792856856NC10477171061109280NC1047746108110106110NC104779091868170NC10477991041009593NC104784092887558NC104785996878778NC104788684796868NC104790797908071NC104809397899390NC10481441019399108NC104820797827674NC104822391777768NC10483501048057444.4 Table 45 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC50 (µM) 370nM 1111nM 3333nM 10000nM 1047582251175NC1072814624522140.71072815865742282.31072818785433161.510728343322138NC10728355430159NC1072855644427160.8107286259402090.61072863835435201.7107286880502391.21072872211397NC1072886886042212.21072986846822111.7107300393797152NC1073034978030302.91073035788041272.810730635329157NC1073106877657395.21073107796558333.7 Table 46 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC50 (µM) 370nM 1111nM 3333nM 10000nM 1047582361586NC1072813695836171.41072824856338232.21072849663221140.610728531169870245.11072856905732141.81072857664532171.01072861684528161.01072864876243222.310729731017440132.5107298039452716NC1073009877583358.21073033874419241.41073045604324120.71073060684328160.91073064614131190.71073065696136181.51073077957044232.81073093573320100.5 Table 47 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC50 (µM) 370nM 1111nM 3333nM 10000nM 10475827030950.6110319891868273NC1103246102848162NC110327889967251NC1103279866943302.91103359827555395.0110347086887355NC1103471686345362.61103502104937551NC1103567886645232.5110401491915656NC11040789210010392NC1104127675242331.61104144936334162.11104158505155231.01104159655940251.61104174919363437.91104175694623130.91104191847652344.0 Table 48 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC50 (µM) 370nM 1111nM 3333nM 10000nM 104758266301160.61103202797954436.0110321777381650.91103218927450333.7110333084795651NC1103345112125111149NC1103377115134142151NC110340982937045NC1103570796443242.311035711017461344.61103872937928212.4110397088787574NC110409610911265479.21104131877954446.11104145998965396.71104161102907552NC110417872675753NC1104225878257395.41104307978757324.7 Table 49 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC50 (µM) 370nM 1111nM 3333nM 10000nM 104758258291070.41103236816227121.61103253685636371.81103268866237302.41103285917956294.01103300100988381NC1103365838664428.21103428877350263.2110349186707055NC110362090626573NC1104037779266387.81104116856342232.31104118997438202.611041321077953354.51104133706743292.31104165918659324.81104276947118151.91104309736036201.61104310825730131.6 Table 50 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC50 (µM) 370nM 1111nM 3333nM 10000nM 104758269301170.6110324187716050NC1103257758347263.11103258817044232.41103272949152264.01103369887859385.41103370838859448.01103400951018776NC1103448917349323.61103465886847313.11103592961117548NC1103722*21242119NC11038161081189576NC11040721118363173.8110412284736548NC110415378835550NC11042801118455253.91104312917152323.71104361878165427.4 Table 51 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC50 (µM) 370nM 1111nM 3333nM 10000nM 104758260361280.51103244997955425.71103259857042262.61103322878266469.51103371869764387.311035161041239069NC1103837826240262.2110389994876848NC110393274836864NC110393379631191.31104093906133242.11104123911148161NC110415683867155NC1104173878960427.211042981051028057NC11042991011098472NC11043491047157354.31104365957563405.81104380958361457.3 Table 52 Dose-dependent percent of human GFAP RNA compared to untreated control in U251 cells by modified oligonucleotidesCompound No. GFAP RNA (% control) IC50 (µM) 370nM 1111nM 3333nM 10000nM 104758263261060.51103254938562375.81103255594923140.81103256845422101.41103366105795858NC1103368927944212.91103430978660426.31103446847951364.31103447887949323.71103478909562469.11103558829259325.21103591736951313.01104038685131361.41104039806843363.11104151806546282.61104152947147222.81104166947045273.01104311706040221.7110432697856452NC Example 4: Tolerability of modified oligonucleotides complementary to human GFAP in wild-type mice, 3 hour study

[0230] Modified oligonucleotides described above were tested in wild-type female C57 / Bl6 mice to assess the tolerability of the oligonucleotides. Wild-type female C57 / Bl6 mice each received a single ICV dose of 700 µg of modified oligonucleotide listed in the table below. Each treatment group consisted of 4 mice. A group of 4 mice received PBS as a negative control for each experiment (identified in separate tables below). At 3 hours post-injection, mice were evaluated according to seven different criteria. The criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli; (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to tail pinching; (7) regular breathing. For each of the 7 criteria, a mouse was given a subscore of 0 if it met the criteria and 1 if it did not (the functional observational battery score or FOB). After all 7 criteria were evaluated, the scores were summed for each mouse and averaged within each treatment group. The results are presented in the tables below. Table 53 Tolerability scores in mice at 700 µg doseCompound No. 3 hr. FOB PBS0104719831047258310473287104736201047373010473864104738701047388210473915104758001047582510475832104758411047585010475860104758701047588010475891104759021047591410476105104820351048267610483504 Table 54 Tolerability scores in mice at 700 µg doseCompound No. 3 hr. FOB PBS0104725751047357710473745104739461047429010474442104744801047492210474972104750011047518510475731104758111047599110476016104760821047609510479131104799021048027210481514104818201048296310483610 Table 55 Tolerability scores in mice at 700 µg doseCompound No. 3 hr. FOB PBS0104721121047223010472251104729801047306010473162104735241047353210474022104743201047522010475232104753221047579210475984104760251047662410476792104771121047811010478843104820111048204010482271 Table 56 Tolerability scores in mice at 700 µg doseCompound No. 3 hr. FOB PBS0107281301072814110728184107283441072835010728495107285541072856610728574107286161072862410728633107286871072872510728861107298011072986610730335107304561073060610730636107306461073065610730936 Table 57 Tolerability scores in mice at 700 µg doseCompound No. 3 hr. FOB PBS0110321751103368311033703110337131103465611035025110351671103567511038374110389921104093511041186110413361104145211041525110415831104166511041684110417561104307411043095110431061104311511043497 Table 58 Tolerability scores in mice at 700 µg doseCompound No. 3 hr. FOB PBS01103202511032187110325371103255711032567110325761103258711032596110326811103279611032857110341171103471611035706110372211103872411039337110403871104116111041273110414431104159511042761 Example 5: Design of MOE gapmer modified oligonucleotides with mixed PO / PS internucleoside linkages complementary to a human GFAP nucleic acid

[0231] Modified oligonucleotides complementary to human GFAP nucleic acid were designed. The modified oligonucleotides in the table below are 6-10-4 MOE gapmers. The gapmers are 20 nucleosides in length and have a central gap segment that consists of ten 2'- β-D-deoxynucleosides, a 5' wing segment that consists of six 2'-β-D-MOE nucleosides, and a 3' wing segment that consists of four 2'-β-D-MOE nucleosides. The sugar motif of the gapmers is (from 5' to 3'): eeeeeeddddddddddeeee; wherein 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, and 'e' represents a 2'- β-D-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (from 5' to 3'): sooooossssssssssoss; wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleoside is a 5-methyl cytosine. Table 59 6-10-4 MOE gapmers with mixed PO / PS internucleoside linkages complementary to human GFAPCompound No. SEQUENCE (5' to 3') SEQ ID No: 1 Start Site SEQ ID No: 1 Stop Site SEQ ID No: 2 Start Site SEQ ID No: 2 Stop Site SEQ ID No. 1166991CAGCCTGGTTAGCCTTTCTGN / AN / A9514953320171166992TCAGCCTGGTTAGCCTTTCTN / AN / A9515953420941166993GTCAGCCTGGTTAGCCTTTCN / AN / A9516953521711166994AGTCAGCCTGGTTAGCCTTTN / AN / A9517953614841166996CTAGTCAGCCTGGTTAGCCTN / AN / A9519953815611166997ACTAGTCAGCCTGGTTAGCCN / AN / A9520953923251166998CAGT...

Claims

1. A modified oligonucleotide according to the following chemical structure: or a salt thereof.

2. A modified oligonucleotide according to the following chemical structure:

3. The modified oligonucleotide of claim 1, which is the sodium salt or potassium salt of the chemical structure.

4. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: mCesAeoGeoTeoAeoTeoTdsAdsmCdsmCdsTdsmCdsTdsAdsmCdsTdsAeoGesTesmCe (SEQ ID NO: 20), wherein: A = an adenine nucleobase, mC = a 5-methyl cytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, e = a 2'-β-D-OCH2CH2OCH3 ribosyl sugar moiety, d = a 2'-β-D-deoxyribosyl sugar moiety, s = a phosphorothioate internucleoside linkage, and o = a phosphodiester internucleoside linkage.

5. The oligomeric compound of claim 4, comprising the modified oligonucleotide covalently linked to a conjugate group.

6. A population of modified oligonucleotides of any of claims 1-3, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

7. A pharmaceutical composition comprising the modified oligonucleotide of any of claims 1-3, the oligomeric compound of any of claims 4-5, or the population of modified oligonucleotides of claim 6, and a pharmaceutically acceptable diluent.

8. The pharmaceutical composition of claim 7, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).

9. The pharmaceutical composition of claim 8, wherein the pharmaceutical composition consists of the modified oligonucleotide, oligomeric compound, or population of modified oligonucleotides and aCSF.

10. The pharmaceutical composition of claim 8, wherein the pharmaceutical composition consists of the modified oligonucleotide, oligomeric compound, or population of modified oligonucleotides and PBS.

11. The pharmaceutical composition of claim 8, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, oligomeric compound, or population of modified oligonucleotides and aCSF.

12. A modified oligonucleotide of any of claims 1-3, an oligomeric compound of any of claims 4-5, a population of modified oligonucleotides of claim 6, or a pharmaceutical composition of any of claims 7-11 for use in the treatment of a disease associated with GFAP, optionally wherein the disease associated with GFAP is a neurodegenerative disease.

13. The modified oligonucleotide, oligomeric compound, population of modified oligonucleotides, or pharmaceutical composition for use according to claim 12, wherein the disease associated with GFAP is Alexander disease.

14. The modified oligonucleotide, oligomeric compound, population of modified oligonucleotides, or pharmaceutical composition for use according to claim 12 or claim 13, wherein the modified oligonucleotide, oligomeric compound, population of modified oligonucleotides, or pharmaceutical composition is administered to the central nervous system and / or systemically.

15. The modified oligonucleotide, oligomeric compound, population of modified oligonucleotides, or pharmaceutical composition for use according to any of claims 12-14, wherein the oligonucleotide, oligomeric compound, population of modified oligonucleotides, or pharmaceutical composition is administered intrathecally.