Production of proteins of interest in a non-sporulating bacterial strain

Abstract

The present invention relates to a novel system for the production of proteins of interest composed of a non-sporulating bacterial strain of the genus Bacillus transformed with a plasmid containing an expression cassette of a protein of interest under the control of a strong promoter active in the stationary phase. The proteins of interest thus produced are present in a bacterial sacculus or anchored to the surface of the bacterium.

Description

[0001] DESCRIPTION

[0002] TITLE: Production of proteins of interest in a non-sporulating bacterial strain

[0003] The present invention relates to a new system for producing proteins of interest composed of a non-sporulating bacterial strain of the genus Bacillus transformed with a plasmid containing an expression cassette of a protein of interest controlled by a strong promoter active in stationary phase. The proteins of interest thus produced are contained in a bacterial sac consisting of the bacterial membrane or anchored to the surface of the bacterium.

[0004] The use of recombinant bacteria to produce proteins of interest, such as insulin and growth hormone, has been known for a long time and has been widely implemented, but it has also shown its limitations. Indeed, bacteria are incapable of producing proteins with a complex structure such as antibodies or blood clotting factors. To be stable and active in vivo and therefore effective in humans, these proteins must undergo multiple post-translational modifications.

[0005] Heterologous proteins of interest can also be toxic to the bacterial cell that produces them. Vincent Ecochard et al., in "Techniques et stratégies en biologie moléculaire", professional master's degree, October 2011, http: / / www.m2p-egpr.ups- tlse.fr / Documents%20archives / Cours / Cours%20partie%202.pdf, detail the solutions that can be used to produce such proteins in a bacterial system. However, it is not easy to identify the best solution in relation to the protein to be produced. The authors conclude that the last and best solution is to use an in vitro translation system.

[0006] Rosano et al., in "Recombinant protein expression in Escherichia coli: advances and challenges," Front. Microbiol., 17 April 2014, https: / / doi.org / 10.3389 / fmicb.2014.00172, indicate that only a few strains of E. coli are capable of producing toxic proteins, but the level of production of these proteins is low. A solution could be provided by secreting the protein outside the bacterial cell or into the periplasm, using different promoters.

[0007] A bacterial system for producing proteins of interest that is simple to implement and with a high yield is therefore necessary, in particular for the production of proteins of interest that may be toxic.

[0008] Bacillus thuringiensis (Bt) is a Gram-positive, spore-forming bacterium that produces large amounts of insecticidal proteins (Cry and Cyt proteins). When certain Bt sporulation genes are no longer expressed, such as spoOA, sigE, or sigF, or when their product is no longer functional following mutation, the bacterium is unable to enter sporulation and remains stuck in stationary phase. A consequence of sporulation gene inactivation is the cessation of bacterial multiplication, making the bacteria nonviable.

[0009] The inventors have shown that a non-sporulating Bt strain leads to the formation of bacterial sacs. Surprisingly, they have also shown that, in such non-sporulating strains, the production of proteins of interest can be obtained by placing the gene of interest under the control of a promoter specifically activated during the stationary phase. Thus, the protein of interest is produced during the stationary phase and remains encapsulated in the bacterial sacs. The inventors have also shown that these proteins are produced in large quantities and that their localization in the bacterial sacs protects them from degradation and greatly facilitates their recovery and purification. According to a particular embodiment, it is also possible to express the proteins of interest so that they anchor themselves to the surface of the bacterial cells.

[0010] This new system therefore makes it possible to produce proteins of interest, in particular proteins that are unstable or toxic for the producing bacterial cell, the latter being non-sporulating and non-viable.

[0011] Thus, the present invention relates to a non-sporulating bacterial strain of the genus Bacillus which contains a recombinant plasmid comprising an expression cassette composed of:

[0012] (i) a strong promoter active in stationary phase and regulated by a regulator selected from CodY, AbrB, SinR, PlcR and NprR; and

[0013] (ii) the sequence of a gene coding for a protein of interest.

[0014] Preferably, the bacterial strain is chosen from the strains of Bacillus thuringiensis, Bacillus cereus, Bacillus weihenstephanensis, and more preferably it is a strain of Bacillus thuringiensis. The strains Bacillus subtilis, Bacillus megaterium, Bacillus brevis, can also be used provided that they are previously transformed to express the papR and plcR genes activating the PpapR and PplcR promoters respectively and / or to express the npnR and nprX genes activating the PnprA promoter.

[0015] Preferably, the bacterial strains used are the Bt kurstaki HD-73 or Bt 407 strains. According to the invention, the bacterial strain is a non-sporulating strain. Indeed, non-sporulating strains are advantageous in that they do not exhibit cell lysis, thus, the proteins of interest produced are preserved in the producing bacterium and protected from degradation by extracellular proteases. In order to suppress the sporulation activity of a strain of the genus Bacillus, it is possible to inactivate any gene essential for sporulation such as the genes involved in the expression of the transcriptional regulator SpoOA responsible for the initiation of sporulation or in the expression of the sporulation sigma factors SigE, SigF, SigH and SigK; preferably, the inactivated gene is spoOA or sigE. Inactivation of these genes can be achieved by interruption or modification of the coding sequence, or by deletion of all or part of the gene.The deletion is achieved by double crossing-over between the adjacent regions located upstream and downstream of the gene, using plasmids whose replication is temperature-sensitive, for example, the plasmids pRN5101 (Lereclus et al., Expansion of insecticidal host range of Bacillus thuringiensis by in vivo genetic recombination. Biotechnology (NY) 10: 418-421,1992) or pMAD (Arnaud et al., New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl Environ Microbiol 70: 6887-6891,2004), and using the protocols described in these articles. The deletion of the spoOA gene (designated AspoOA) has a very early effect, as soon as the bacteria enter the stationary phase, notably preventing the bacteria from engaging in the sporulation process (Lereclus et al., Overproduction of encapsulated insecticidal crystal proteins in a Bacillus thuringiensis spoOA mutant. Biotechnology (NY) 13: 67-71, 1995).Deletion of the sigE gene (designated AsigE) has a later effect, blocking the progression of the sporulation process (Bravo et al., Analysis of crylAa expression in sigE and sigK mutants of Bacillus thuringiensis. Mol Gen Genet 250: 734-741, 1996). In both cases, the bacterium no longer multiplies, dies, and contains almost exclusively the protein of interest.

[0016] Preferably, the strain used is Bt kurstaki HD-73 AspoOA or Bt 407 AsigE.

[0017] The recombinant plasmids that can be used according to the invention typically comprise an origin of replication and at least one selection system consisting of one or more genes allowing the selection of transformed bacteria, for example antibiotic resistance genes. Any plasmid, preferably with a high copy number, adapted to the bacterial host used can be used.

[0018] Suitable plasmids according to the invention are plasmids allowing expression in bacteria of the genus Bacillus.

[0019] Preferably, the plasmids used are those exhibiting high segregational and / or structural stability.

[0020] The concept of segregational stability means that the plasmid is not lost over generations; in other words, it remains stable in the bacterial cell and is transmitted to daughter cells. The segregational stability of the plasmid pHT1030 has been demonstrated (Lereclus et al., 1992. spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive replicon. Mol. Microbiol. 7: 35-46). This stability is due to the presence of the spbA gene, which is also present in plasmids derived from pHT1030, such as pHT3101, pHT304, pHT315, and pHT370 (Arantes et al., 1991. Construction of cloning vectors for Bacillus thuringiensis. Gene 108: 115-119). The segregational stability of plasmid pBC16 and its derivatives was also determined (Lereclus et al., 1992. spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive replicon. Mol. Microbiol. 7: 35-46).

[0021] Structural stability is defined as non-intramolecular recombination of the plasmid. The structural stability of plasmid pHT1030 and its derivatives is demonstrated by the fact that they can carry large exogenous DNA fragments (> 10 kb) without undergoing molecular rearrangements (Lereclus et al., 1989. Transformation and expression of a cloned delta-endotoxin gene in Bacillus thuringiensis. FEMS Microbiol. Lett. 60: 211-217).

[0022] Preferably, these are high copy number plasmids, in particular derived from plasmid pHT1030, such as pH3101, pHT304, pHT315 and pHT370, preferably pH315, or derived from plasmid pBC16, pE194 or pC194 or low copy number plasmids such as pHT73, resident plasmid of Bt kurstaki strain HD-73 or pBMB299, resident plasmid of Bt kurstaki strain HD1.

[0023] According to the invention, the expression cassette inserted into said plasmid contains at least one strong promoter and the sequence of a gene coding for a protein of interest.

[0024] A strong promoter is one that allows strong transcription of the gene(s) it controls. The strong promoter can come from the host cell used for the expression of the protein of interest; it can also be an exogenous promoter. Strong promoters are preferentially promoters that are activated at the beginning of stationary phase and remain functional for a large part of this physiological state. Commonly, promoter expression is assessed with R-galactosidase activity (AS, in units / mg of protein) according to the calculation described in Perchât et al. ("A cell-cell communication system regulates protease production during sporulation in bacteria of the Bacillus cereus group", Molecular Biology, Vol. 82, 3, pp. 619-633, 2011): AS = (A 42ox 1500000) / (T x V x C).

[0025] A420: absorbance at 420 nm

[0026] T: reaction time in min

[0027] V: volume of the crude extract in pL

[0028] C: protein concentration in pg / mL

[0029] Using this formula, a promoter is considered to be strongly expressed when the AS is greater than 500 U / mg prot. According to a first embodiment of the invention, the strong promoter is regulated by a regulator selected from PlcR and NprR. Strong promoters are preferentially selected from PpapR (SEQ. ID. No. 1), PpIcB (SEQ. ID. No. 2), PnprA (SEQ. ID. No. 3) and PnprR (SEQ. ID. No. 4).

[0030] According to a second embodiment of the invention, the strong promoter is regulated by a regulator chosen from CodY, AbrB and SinR and even more preferably the strong promoter is chosen from PoppA (SEQ. ID. No. 5), PnppC (SEQ. ID. No. 6), PinhAl (SEQ. ID. No. 7) and Pco / Y (SEQ. ID. No. 8).

[0031] Preferably, the regulator is CodY and the strong promoter is PoppA or PnppC.

[0032] The expression cassette according to the invention may further comprise:

[0033] - an mRNA stabilizing sequence positioned downstream of the promoter and upstream of the sequence of the gene coding for the heterologous protein; preferably, it is STAB-SD of sequence SEQ ID No. 9; preferably, the STAB-SD sequence is downstream of the transcription +1 and at a position between approximately 100 and 500 nucleotides upstream of the ribosomal binding site (RBS), preferably between 100 and 300 nucleotides and more preferably between 100 and 150 nucleotides; and / or

[0034] - a terminator sequence of the crylAc gene, designated TcrylAc, for example a sequence having at least 90% identity with SEQ ID No. 10, preferably, it is SEQ ID No. 10; this sequence is cloned downstream of the gene coding the protein of interest.

[0035] The choice of these sequences should not, however, be considered as limiting because it is within the reach of those skilled in the art to substitute these sequences with sequences with equivalent functions.

[0036] The term “protein of interest” means an endogenous protein or a protein which is not naturally expressed by the bacterial strain according to the invention, also referred to as a heterologous protein. Preferably, the protein of interest is a cytotoxic protein naturally expressed by a strain of the genus Bacillus or a protein of industrial interest such as enzymes, such as proteases, lipases, amylases; hormones; antigens, for example, usable as immunogens, peptides or proteins for therapeutic use; the protein of interest can thus find application in the field of crop protection, vector control, the commercial production of enzymes and the pharmaceutical industry, in particular for the production of vaccines.

[0037] The expression cassette according to the invention leads to the expression and then the accumulation of proteins of interest in bacterial sacs or to their anchoring to the surface of the bacteria. Its use is particularly suitable for the production of proteins that are unstable or toxic for the producing strain. The construction of the expression cassette according to the invention and its incorporation into a plasmid are carried out by molecular biology techniques well known to those skilled in the art as illustrated in the experimental part.

[0038] The plasmid according to the invention can be introduced into the host bacterium according to techniques known to those skilled in the art; in particular, the transformation of the host bacterium can be carried out by electroporation (Lereclus et al., 1989) or by heterogram conjugation (Tieu-Cuot et al., 1987). The expression cassette containing the gene of interest can also be introduced onto the bacterial chromosome or onto a resident plasmid by homologous recombination (Lereclus et al., 1992).

[0039] The present invention also relates to a method for producing a protein of interest comprising the steps of: a- preparation of the bacterial strain according to the invention; b- culture of said bacterial strain in stationary phase; and c- optionally, purification of said protein of interest.

[0040] The culture of the bacterial strain is carried out on a culture medium containing at least one source of nitrogen and glucose in appropriate concentrations at a temperature preferably between 25 and 35°C, preferably the temperature is of the order of 30°C; for example, the culture medium is LB medium.

[0041] Purification of the protein of interest can be carried out by centrifugation; in addition, exclusion chromatography, ion exchange chromatography or even affinity chromatography methods can be used.

[0042] According to a particular embodiment, a gene coding for an export protein domain (such as a signal peptide) or anchoring (such as LysM (SEQ ID No. 11), SLH (SEQ ID No. 12) or LPXTG (Navarre et al., Microbiol Mol Biol Rev 63(1):174-229.DOI: 10.1128, 1999)) of proteins on the surface of bacteria is cloned in cis of the gene coding for the protein of interest.

[0043] Thus, the expression cassette according to the invention can comprise:

[0044] (i) a strong promoter active in stationary phase selected from PpapR, PpIcB, PnprA, PnprR, PoppA, PnppC, PinhAl and PcalY and preferentially selected from PoppA and PnppC;

[0045] (ii) optionally, the sequence of a gene coding for an export or anchor protein;

[0046] (iii) the sequence of a gene encoding a protein of interest; and optionally an mRNA stabilizing sequence, preferably STAB-SD, and / or the terminator sequence of the crylAc gene, TcrylAc; or (i) a strong promoter active in stationary phase chosen from PpapR, PpIcB, PnprA, PnprR, PoppA, PnppC, PinhAl and PcalY and preferentially chosen from PoppA and PnppC;

[0047] (ii) optionally, the sequence of a gene coding for an export or anchor protein;

[0048] (iii) the sequence of a gene encoding a protein of interest; and an mRNA stabilizing sequence, preferably STAB-SD; or

[0049] (i) a strong promoter active in stationary phase selected from PpapR, PpIcB, PnprA, PnprR, PoppA, PnppC, PinhAl and PcalY and preferentially selected from PoppA and PnppC;

[0050] (ii) optionally, the sequence of a gene coding for an export or anchor protein;

[0051] (iii) the sequence of a gene encoding a protein of interest; and the terminator sequence of the crylAc gene, TcrylAc; or

[0052] (i) a strong promoter active in stationary phase selected from PpapR, PpIcB, PnprA, PnprR, PoppA, PnppC, PinhAl and PcalY and preferentially selected from PoppA and PnppC;

[0053] (ii) optionally the sequence of a gene coding for an export or anchor protein;

[0054] (iii) the sequence of a gene encoding a protein of interest; and an mRNA stabilizing sequence, preferably STAB-SD, and the terminator sequence of the crylAc gene, TcrylAc.

[0055] According to particular embodiments, the strain used is a bacterium of the genus Bacillus l spoOA, preferably Bt AspoOA, more preferably Bt HD73 AspoOA, and the expression cassette comprises:

[0056] (i) a strong promoter active in stationary phase selected from PpapR, PpIcB, PoppA, PnprR, PnppC and PnprA and preferentially selected from PoppA and PnppC;

[0057] (ii) optionally, the sequence of a gene coding for an export or anchor protein;

[0058] (iii) the sequence of a gene encoding a protein of interest; and optionally an mRNA stabilizing sequence, preferably STAB-SD, and / or the terminator sequence of the crylAc gene, TcrylAc; or

[0059] (i) a strong promoter active in stationary phase selected from PpapR, PpIcB, PoppA, PnprR, PnppC and PnprA and preferentially selected from PoppA and PnppC; (ii) optionally, the sequence of a gene coding for an export or anchor protein;

[0060] (iii) the sequence of a gene encoding a protein of interest; and an mRNA stabilizing sequence, preferably STAB-SD; or

[0061] (i) a strong promoter active in stationary phase selected from PpapR, PpIcB, PoppA, PnprR, PnppC and PnprA and preferentially selected from PoppA and PnppC;

[0062] (ii) optionally, the sequence of a gene coding for an export or anchor protein;

[0063] (iii) the sequence of a gene encoding a protein of interest; and the terminator sequence of the crylAc gene, TcrylAc; or

[0064] (i) a strong promoter active in stationary phase selected from PpapR, PpIcB, PoppA, PnprR, PnppC and PnprA and preferentially selected from PoppA and PnppC;

[0065] (ii) optionally the sequence of a gene coding for an export or anchor protein;

[0066] (iii) the sequence of a gene encoding a protein of interest; and an mRNA stabilizing sequence, preferably STAB-SD, and the terminator sequence of the crylAc gene, TcrylAc.

[0067] According to other particular embodiments, the strain used is a bacterium of the genus Bacillus AsigE, preferably Bt AsigE, even more preferably Bt 407 AsigE and the expression cassette comprises:

[0068] (i) a strong promoter active in stationary phase selected from PcalY and PinhAl;

[0069] (ii) optionally, the sequence of a gene coding for an export or anchor protein;

[0070] (iii) the sequence of a gene encoding a protein of interest; and optionally an mRNA stabilizing sequence, preferably STAB-SD, and / or the terminator sequence of the crylAc gene, TcrylAc; or

[0071] (i) a strong promoter active in stationary phase selected from PcalY and PinhAl;

[0072] (ii) optionally, the sequence of a gene coding for an export or anchor protein;

[0073] (iii) the sequence of a gene encoding a protein of interest, preferably STAB-SD; and a stabilizing sequence of the mRNA; or

[0074] (i) a strong promoter active in stationary phase selected from PcalY and PinhAl;

[0075] (ii) optionally, the sequence of a gene coding for an export or anchor protein;

[0076] (iii) the sequence of a gene encoding a protein of interest; and the terminator sequence of the crylAc gene, TcrylAc; or

[0077] (i) a strong promoter active in stationary phase selected from PcalY and PinhAl;

[0078] (ii) optionally the sequence of a gene coding for an export or anchor protein;

[0079] (iii) the sequence of a gene encoding a protein of interest; and an mRNA stabilizing sequence, preferably STAB-SD, and the terminator sequence of the crylAc gene, TcrylAc.

[0080] According to a particular embodiment, the protein of interest produced is an insecticidal protein of B. thuringiensis.

[0081] It is known that such proteins can be used as biopesticides in preparations conventionally containing the free insecticidal protein in crystal form and bacterial spores, to combat crop pests as well as disease vectors such as mosquitoes. In particular, these may be proteins of the Cry family (crystal proteins) or proteins of the Cyt family (cytolytic insecticidal toxins) or Vip3 proteins (toxins active against lepidopteran insects) and more preferably proteins of the Cry family.

[0082] After their expression, they are protected from degradation by the bacterial membrane that constitutes the envelope of the bacterial sac. In addition, the non-sporulation of the bacteria gives the invention the advantage of not disseminating the spores into the environment.

[0083] According to another embodiment, the protein of interest produced may be an enzyme of industrial interest (proteases, lipases, amylases, etc.) or medical interest. The encapsulation of this protein in the bacterial sac facilitates its recovery and purification, and therefore reduces production costs.

[0084] According to a third embodiment, the protein of interest produced may be a whole protein or a protein fragment which can serve as an antigen, for example proteins from microorganisms (viruses, bacteria, fungi) or parasites.

[0085] In this embodiment, it may be advantageous for the protein or its fragment to be anchored to the surface of the bacterial sac. This embodiment is of significant interest for the preparation of vaccines. Thus, the present invention provides a bacterial platform that can be advantageously exploited for the production of proteins of interest in multiple fields such as crop protection, vector control, commercial production of enzymes and the pharmaceutical industry. In addition, this technology has a low cost and excellent yield allowing mass production.

[0086] FIGURES

[0087] [Fig 1] A, strain HD73 wt; B, strain HD73 AspoOA.

[0088] [Fig 2] strain 407 AsigE

[0089] [Fig 3] Measurement of R-galactosidase activity in HD73 wt bacteria carrying the Pp / cB-STAB-SD- / ocZ transcriptional fusion (black curve) or the PpIcB-lacZ transcriptional fusion (grey curve).

[0090] [Fig 4] Measurement of R-galactosidase activity in HD73 AspoOA bacteria carrying the transcriptional fusion PpopR-STAB-SD- / ocZ (grey curve) or the transcriptional fusion PoppA-STAB-SD- lacZ (black curve).

[0091] [Fig 5] Measurement of R-galactosidase activity in 407 ksigE bacteria carrying the transcriptional fusion Pco / Z-STAB-SD-ZocZ-TermCrylAc (black curve) or the transcriptional fusion Pco / Z-STAB-SD-ZocZ (grey curve).

[0092] [Fig 6] Fluorescence measurement at different culture times, in HD73 wt (grey) and HD73 AspoOA (black) bacteria carrying the PpopR-STAB-SD-g / p-TermCrylAc transcriptional fusion.

[0093] [Fig 7] Production of toxins of interest under the control of the PoppA and PpapR promoters associated with the stabilizing elements STAB-SD and TermCrylAc. Microscopic observation of an HD73 AspoOA strain transformed with a plasmid carrying the transcriptional fusions PoppA-STAB-SD-toxl-TermCrylAc and PpopR-STAB-SD-tox2-TermCrylAc (A) or of an HD73 AspoOA strain not containing the plasmid described above (B). SDS-polyacrylamide gel electrophoresis of the strain producing the toxins of interest (C). M, molecular weight marker.

[0094] EXAMPLES

[0095] 1. Effect of creating a non-sporulating phenotype on bacterial sac formation

[0096] The asporulating strains correspond to the Bt HD73 wt strain in which the spoOA gene was deleted (Bt HD73 AspoOA) or to the Bt 407 wt strain in which the sigE gene was deleted (Bt 407 AsigE). For these two strains, the spoOA and sigE genes were deleted by double crossing over using the pMAD plasmid and the protocol described by Arnaud et al. (Arnaud et al., 2004).

[0097] The culture corresponding to the Bt HD73 wt strain consists almost exclusively of spores (Figure 1A). In contrast, no spores are visible in the case of the Bt HD73 AspoOA mutant (Figure 1B). The Bt HD73 spoOA mutant shows the formation of bacterial sacs (light gray in Figure 1B). Similarly, unlike the Bt 407 wt strain, the Bt 407 AsigE strain does not form any spores and is composed of bacterial sacs (Figure 2). The Bt HD73 wt and spoOA strains were grown in HCT YEG liquid medium at 30°C for 72 h before being examined under a microscope. This medium is composed of HCT medium (0.7% casein hydrolyzate, 0.5% tryptone, 0.68% KH2PO4, 0.012% MgSO4 7H2O, 0.00022% MnSO4 4H2O, 0.0014% ZnSO4 7H2O, 0.008% ferric ammonium citrate, 0.018% CaCl2 4H2O at pH 7.2) supplemented with 0.3% glucose and 0.05% yeast extract.

[0098] The Bt 407 AsigE strain was cultured in HCT YEG liquid medium at room temperature for 96 h before being examined under a microscope.

[0099] 2. Effect of the stabilizing sequence STAB-SD on the promoter activity of a stationary phase gene

[0100] The inventors added the STAB-SD RNA stabilizing sequence between the PpicB promoter and the lacZ reporter gene on the plasmid pHT304-18Z-PplcB to generate the plasmid pHT304-18-PplcB-STAB-SD-lacZ. The STAB-SD RNA stabilizing sequence was first cloned between the XbaI and BamHI restriction sites of the vector pHT304-18. Then, the PpicB promoter was cloned upstream between the PstI and XbaI restriction sites.

[0101] The Bt HD73 wt strain was transformed with plasmids pHT304-18Z-PplcB and pHT304-18—PplcB-STAB-SD-lacZ and then cultured in LB medium at 30°C.

[0102] LB (Luria Bertani) culture medium is a complex medium classically used for the cultivation of bacterial strains, it is composed of tryptone, 10 g / L; yeast extract, 5 g / L; NaCl, 10 g / L. The components are solubilized in 800 mL of demineralized water, the pH is then adjusted to 7.0 and the volume is made up to 1 L. The medium is sterilized by autoclaving at 121 9 C for 15 minutes. tO corresponds to the beginning of the transition phase between the exponential phase and the stationary phase of growth.

[0103] Thus, the activity of PpicB, a promoter active in stationary phase, was compared in the presence and absence of STAB-SD.

[0104] The results in Figure 3 show that the PpicB promoter is active in both vector constructs: in the presence and absence of STAB-SD. The presence of STAB-SD increases the expression of β-galactosidase.

[0105] 3. Activity of stationary phase promoters in the AspoOA mutant

[0106] DNA fragments corresponding to the promoter sequences of the stationary-phase genes PoppA or PpapR followed by the STAB-SD sequence were synthesized and cloned into the pHT315 vector. The lacZ reporter gene was cloned downstream of these sequences. The vectors were introduced into Bt HD73 spoOA cells. t0 corresponds to the beginning of the transition phase between the exponential phase and the stationary phase of growth.

[0107] Bacterial strains were cultured in HCT YEG medium at 30°C.

[0108] The R-galactosidase activity of these strains was measured during their growth and shows a strong activity of these promoters at the times indicated in Figure 4, and a greater activity for the PoppA promoter from t0.

[0109] 4. Effect of the se stabilizer on the I' of a gene of stationary

[0110] The sequence corresponding to the terminator of the crylAc gene was cloned downstream of the transcriptional fusion between the promoter of a gene expressed in stationary phase (PcalY) and the lacZ reporter gene on plasmid pHT304.18Z to generate plasmid pPcalY-STAB-SD- / ocZ-

[0111] TermCrylAc. This vector was introduced into Bt 407 AsigE cells. tO corresponds to the beginning of the transition phase between the exponential phase and the stationary phase of growth.

[0112] The bacterial strains were cultured in LB medium at 30°C.

[0113] The R-galactosidase activity of this strain was measured and compared to that of a strain carrying the same vector except for the TermCrylAc sequence. The results show that both plasmids allow the expression of R-galactosidase, the fusion carrying the TermCrylAc sequence leads to a stronger expression than the one not carrying it (Figure 5).

[0114] 5. Effect of the association of generic elements on the I'

[0115] Bt HD73 wt and Bt HD73 AspoOA strains were transformed with plasmid pHT315 carrying the PpapR-STAB-SD-g / p-TermCrylAc transcriptional fusion to measure the activity of this transcriptional fusion in the AspoOA genetic background and compare it to the activity of the wt strain (Figure 6).

[0116] The plasmid was constructed as follows. The DNA fragment corresponding to the PpapR promoter sequence followed by the STAB-SD and TermCrylAC sequences was synthesized and cloned into the pHT315 vector. The gfp reporter gene was cloned downstream of this sequence. t0 corresponds to the beginning of the transition phase between the exponential phase and the stationary phase of growth.

[0117] Bacterial strains were cultured in HCT YEG medium at 30°C.

[0118] The results show that the association of the different genetic elements (plasmid, promoter

[0119] PpapR, STAB-SD sequence and TermCrylAc sequence) is functional in the HD73 spoOA strain.

[0120] Furthermore, measurement of fluorescence produced by HD73 AspoOA and HD73 wt strains shows that gfp gene expression is stronger in the AspoOA genetic background than in the wild-type background.

[0121] 6. Effect of the association of genetic elements on the production of insecticidal proteins

[0122] An HD73 spoOA strain was transformed with a plasmid carrying the transcriptional fusions PoppA-STAB-SD-crylAh-TermCrylAc and PpopR-STAB-SD-crylCo-TermCrylAc. The production of the toxins of interest CrylAb and CrylCa corresponding to the crylAb and crylCa genes, respectively, was verified by phase contrast microscopy and SDS-polyacrylamide gel electrophoresis (Figure 7). Bacteria were grown in PEP YEGx medium at 30°C and harvested 48h post-inoculation. This medium is composed of 0.7% casein hydrolyzate, 0.5% peptone, 0.68% KH2PO4, 0.012% MgSO4 7H2O, 0.00022% MnSO4 4H2O, 0.0014% ZnSO4 7H2O, 0.008% ferric ammonium citrate, 0.018% CaCl2 4H2O, at pH 7.2 supplemented with 0.3% glucidex and 0.05% yeast extract.

[0123] The results show the production of toxins in crystal form in HD73 bacterial sacs

[0124] AspoOA carrying PoppA-STAB-SD-crylAh-TermCrylAc and PpopR-STAB-SD-crylCo-TermCrylAc (Figure 7 A) while an HD73 spoOA strain not containing the plasmid described above exhibits bacterial sacs without crystals (Figure 7 B). Moreover, SDS-polyacrylamide gel electrophoresis shows that the toxins of interest represent the majority of proteins in bacterial sacs (Figure 7 C).

[0125] SEQUENCES

[0126] SEQ ID No. 1 - PpapR Promoter region of the papR gene from Bacillus thuringiensis

[0127] CTAGAACCATGAATTAAAAGAATCACTTATAAAAAAAATGAAGAAATAAAAAAGACATAAAGAACAAATA

[0128] TGCATAATTGCATAAAGTCTGGATAATTTTTCATGATATATTTAAAGAAAAAAATGCGG

[0129] SEQ ID No. 2 - PpIcB Promoter region of the pIcB gene of Bacillus thuringiensis

[0130] AGCATGTTGATGCTTTACTCTTTTTTACATTAGTTTAGACAAGCCTTAATAATAGTTTATTAAAATGAAAGT

[0131] GTATTCATTCATTATATTCACTGTGTATAAAGTTATAATGATATGAACATTTGCATATTTTAATTTAGTGATA

[0132] GAATTTCGTGAAAGGTGGGATATTCTAGTCATAGGTTAACCGGACGACATCATAGGATCCTAACAAAATG

[0133] TTTACAATAATTCAATTATAAAATGGAGG

[0134] SEQ ID n°3 - PnprA Promoter region of Bacillus thuringiensis nprA gene

[0135] TTTTTTCAATTTGTTCCTCAAAATTCTACAAAACTTGAAATAAATTGAATTTTAGTATATTATA

[0136] GTGGAAACATAATGCTAATATGAAACTACTCTTTTCAAAAAATTTTTATTAGGGGAAGGTTCATG

[0137] SEQ ID No. 4 - PnprR Promoter region of Bacillus thuringiensis nprR gene

[0138] GAAGTGAAGTCAAGAGAAAAAAAATGAAATTATGCATATTTTTTAGAAAATTTATATTTATCAATTTAT

[0139] TTCTCCGAATTTTGTTATTAGAGTAATGGGGTAATGAGAATGGAGG

[0140] SEQ ID n°5 - PoppA Promoter region of the oppA gene of Bacillus thuringiensis

[0141] CTAGACCGTCAAAATATTACTAGAATTATTATACTATAAAAGCTATAATAAGTACTAGTTAATTTTGAA

[0142] AATTACGCAATTAAAGGTCTGATTTTAAGATGGTAGCAATGTTAATGTATCCCTTTACGAAAAATTT

[0143] AAAATAAAATATTTTTAAAATTTTAACAAAAACAAAAAACTATAIIG Ç ATTGTTATATTATGT

[0144] ATAATGAAAATGTAGAAACTTGGAGATTATTCTTTCAATTCTACTTTTTAACAGTGAGGGTACAGGAAGT

[0145] GCAATTAGGGGAGG

[0146] SEQ ID No. 6 - PnppC Promoter region of Bacillus thuringiensis nppC gene

[0147] ATTCCACTTTTATAAAAGATTTGAATATTTTCAACTTACCCTTGTCAAACATTGTCAATTTATATTTA

[0148] AAATAACAACATACAAAATATTTAGTCTTTTCAAAAGATGGAGGGATAGCCATG

[0149] SEQ ID n°7 - PinhAl Bacillus thuringiensis inhAlde gene promoter region

[0150] AATGTGATATATTCGTATGCTAACTATGAAATTTTTCAAAATATTAAATATTACATGATATGACTAAAA

[0151] THERE

[0152] GGATG

[0153] SEQ ID No. 8 - PcalY Promoter region of the calY gene of Bacillus thuringiensis.

[0154] AAGCAAGACTAGTAATATTTATACGAGTGTGAGGGAACGTTAGCCCTCACCTCTTTGTTTTTCTTTTTTCTTA

[0155] TAGTATTAAATGATTTGAGTGTGAAAAAAGTTATAAATTATCATTGTTTTTTTCTGAAAAGTCTAAATGATAT

[0156] TGAGAAATAAAAATAACTGAAAATATTAATAAATATGTGTTGTGTTTATATAGGGTTGTTCGTTATAATGAA

[0157] CATAAGGTTTTTAAAAAAGAACACATATTAGCTAAGCTAATATAGTTTTCTTTACATCTCTTATTGAAAAATA

[0158] AGTGATAAAAATATAAAAAAAAGCTAGGGGGAATTGATT The transcription +1 is indicated in bold. The -10 promoter boxes are underlined with a thin line. The -35 boxes are underlined with 2 lines. The DNA sequence recognized by PlcR (PlcR box) of the PpapR and PpIcB promoters is underlined with a thick line.

[0159] SEQ ID No. 9 - STAB-SD Bacillus thuringiensis gaaaggaggg atgcc

[0160] SEQ ID N°10 - TcrylAc - Bacillus thuringiensis aaactcaggt ttaaatatcg ttttcaaatc aattgtccaa gagcagcatt acaaatagat aagtaatttg ttgtaatgaa aaacggacat cacctccatt gaaacggagt gatgtccgtt ttactatgtt attttagt agcatat cgtacaat cgtacaat cagagatatt ttcacctatc gatgaaaata tctctgcttt ttcttttttt at

[0161] SEQ ID N°ll Sequence containing 2 LysM domains as described by Shao et al., 2009, Microb Cell Fact 8, 48. doi:10.1186 / 1475-2859-8-48.

[0162] ATGATTCAAATTGTAACGGTTCGTAGCGGTGATAGCGTATATAGCTTGGCATCAAAATATGGATCAACACC TGACGAAATAGTAAAAGACAATGGACTAAATCCCGCTGAAACGCTCGTTGTTGGTCAGGCACTTATCGTTA ATACGAAAGGAAATATTATTATTGTACAGCCTGGTGACACTGATTGATTGATTGTTTCCCTT CCCTCGCTAGTTTAGCTAAAGTTAATATTATCTTTAAAATCTATTCTCCATGTCGGACAACAATTATGT ACCAAAAGGCACA

[0163] SEQ ID N° 12 : Sequence containing 3 SLH domains as described by Fedhila et al., 2006, Mol. Microbiol. 62: 339-355. doi: 10.1111 / j.1365-2958.2006.05362.x.

[0164] GAAGATGAGAAAACAGAAGTGGTAGAATTTAAAGATGTACCAAAGGGACATTGGTCAGAAGAAGCAATT

[0165] AATTACTTAGCGAAAGAAAAATTATTTATAGGCTATGGAAATGGTGAATTTGGATTTGGTGATAACATTACT

[0166] CGTGGACAAGTAGCACTTCTAATACAAAGATATTTAAAATTAGAAAATAATCTAGAACAAAAAACGGCATT TACAGATACGAAAGGAAATATGTATGAAACGGCTATTGATGCAGTGGTTCAAGCTGGAATTATGACAGGC TATGGAAATGGTATGTTCCGTCCGGATGGAGTATTAACTCGATATGAAATGTCAGTAGTACTACAAAGAGT ATTTCAGTTAAAAGAAAATGAAAATAGTGCAGAGAATTTTAAAGATGTACCAAATGGCCATTGGGCGAAA GGATATGTGAAAGCTTTAGTGGATAATAAAATATCAAAAGGCGACGGGGAAGGGAATTTTTTAGGAGATA ATTTCGTAACACGTGAACAATACGCACAGTTTTTGTATAATGCAATAAAGAAA

Claims

DEMANDS 1. Non-spore-forming bacterial strain of the genus Bacillus containing a recombinant plasmid comprising an expression cassette composed of: (i) of a highly active promoter in the stationary phase and regulated by a regulator chosen from CodY, AbrB, SinR, PlcR and NprR; (ii) of the sequence of a gene encoding a protein of interest.

2. Bacterial strain according to claim 1, characterized in that said strong promoter is chosen from PoppA, PnppC, PinhAl, PcalY, PpapR, PpIcB, PnprR and PnprA, preferably said strong promoter is chosen from PoppA or PnppC.

3. Bacterial strain according to claim 1 or claim 2, characterized in that the sporulation gene selected from spoOA and sigE is inactivated by interruption or modification of the sequence or by deletion of all or part of the gene.

4. Bacterial strain according to any one of claims 1 to 3, characterized in that: (i) said strain is mutated in the spoOA gene; and (ii) said strong promoter is chosen from PpapR, PnprA, PnprR, PpIcB, PoppA and PnppC.

5. Bacterial strain according to any one of claims 1 to 3, characterized in that: (i) said strain is mutated in the sigE gene; and (ii) said strong promoter is chosen from among PinhAl and PcalY.

6. Bacterial strain according to any one of claims 1 to 5, characterized in that said expression cassette further comprises an mRNA stabilizing sequence and / or a crylAc gene terminator sequence.

7. Bacterial strain according to claim 6, characterized in that the stabilizing sequence of the mRNA is the sequence STAB-SD.

8. Bacterial strain according to claims 1 to 1, characterized in that said plasmid is a plasmid selected from pHT304, pHT315 and pHT370, pHT73, pBC16, pE194, pC194 and pBM299.

9. A bacterial strain according to any one of claims 1 to 8, characterized in that said expression cassette further comprises sequences encoding a protein anchoring or export sequence.

10. A bacterial strain according to claim 1, characterized in that it is a strain of Bacillus thuringiensis.

11. A process for producing a protein of interest comprising the steps of: a- preparing the bacterial strain according to any one of claims 1 to 10; b- culturing said bacterial strain in stationary phase; and c- optionally, purifying said protein of interest.

Images