Internal ribosome entry sites for improved polynucleotide translation

Abstract

This disclosure relates to internal ribosome entry site (IRES) elements that are capable of effectuating expression of a desired polynucleotide even in the absence of a 5' cap structure. The disclosure also provides polynucleotides (e.g., RNA molecules, such as circular or linear RNA molecules) containing such IRES elements. In some embodiments of the disclosure, the IRES element contains one or more nucleic acid segments that are enriched in uridine nucleosides or modified uridine nucleosides, such as 1 -methylpseudouridine nucleosides. In some embodiments, the IRES element contains one or more nucleic acid segments that feature a plurality of contiguous uridine nucleosides or modified uridine nucleosides (e.g., 1 -methylpseudouridine nucleosides). In some embodiments, the IRES elements described herein can recruit ribosomes and / or translation initiation factors by, e.g., binding to ribosomes, hybridizing to the ribosomal RNA of a ribosome, or binding to translation initiation factors. The polynucleotides (e.g., circular or linear RNA molecules) of the disclosure may be used to express a desired polypeptide in a subject, such as a subject having a disease or condition associated with a deficiency in the corresponding endogenous polypeptide.

Description

[0001] INTERNAL RIBOSOME ENTRY SITES FOR IMPROVED POLYNUCLEOTIDE TRANSLATION

[0002] SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on August 4, 2023, is named “50858-124WO2_Sequence_Listing_8_4_23” and is 315,392 bytes in size.

[0004] BACKGROUND

[0005] The use of exogenous nucleic acids has become a particularly effective strategy for delivering polypeptides of interest to a target cell, tissue, or organism, as a single protein-encoding nucleic acid can be translated to yield multiple copies of a desired polypeptide, allowing the administration of a small quantity of nucleic acid to achieve high levels of protein expression. As the nucleic acid therapeutic field has grown, steps have been taken to improve the pharmacokinetic properties of nucleic acid molecules. For example, efforts to further augment the half-lives of nucleic acid molecules, such as protein-encoding RNA molecules, have led to modifications that render nucleic acids less susceptible to nucleolytic degradation. Examples of these modifications are the inclusion of 5’ and / or 3’ chemical groups that sterically restrict the access of exonucleases to the 5’ and / or 3’ end of a nucleic acid, as well as nucleic acid circularization, which altogether removes the 5’ and 3’ ends that would otherwise be available for an exonuclease to engage and cleave.

[0006] Although the foregoing modifications promote nucleic acid stability by mitigating nucleolytic degradation, these modifications generally preclude the inclusion of a 5’ cap structure. 5’ cap structures are often included in protein-encoding nucleic acid (e.g., RNA) molecules, as the 5’ cap promotes ribosome binding and, thus, protein translation. Accordingly, although modifications such as 573’ blocking and circularization may confer the benefit of reduced exonuclease-mediated degradation, these modifications may hinder ribosomal recruitment due to the absence of a 5’ cap. There exists a need for improved strategies for effectuating ribosomal entry and the initiation of protein translation, particularly in nucleic acid molecules that lack a 5’ cap.

[0007] SUMMARY

[0008] The present disclosure features nucleic acid molecules, such as linear and circular RNA molecules, that are capable of recruiting and binding to ribosomes in a manner that is independent of a 5’ cap structure. Without being limited by mechanism, nucleic acid molecules generally employ 5’ cap structures in order to promote ribosomal binding and, thus, translation of an encoded protein. The presence of a 5’ cap that is susceptible to decapping - which, in turn, triggers subsequent degradation of the RNA - precludes the possibility of adding certain chemical modifications that extend the molecule’s half-life. Examples of these types of modifications include (i) the presence of 5’ chemical moieties that restrict the access of an exonuclease to the nucleic acid molecule, as well as (ii) circularization of a nucleic acid molecule, which removes 5’ and 3’ ends altogether. Both of these types of modifications provide the benefit of reducing or eliminating exonucleolytic cleavage by way of either chemically protecting, or removing, the 5’ and 3’ ends to which an exonuclease would bind. However, because these types of modifications alter or eliminate the 5’ end, they preclude the inclusion of a 5’ cap. The present disclosure features internal ribosome entry sites (IRESs) that can be incorporated into nucleic acids and that promote ribosome recruitment and protein translation in a manner that is independent of the presence of a 5’ cap. Significantly, the IRES elements of the disclosure can be used in nucleic acids (e.g., RNA molecules) that either lack or contain a 5’ cap, as the present IRES elements confer advantages to both types of molecules. For example, the IRES elements of the disclosure can be incorporated into a nucleic acid (e.g., a linear or circular RNA molecule) that lacks a 5’ cap, thereby providing a means by which the nucleic acid molecule may be bound - and translated - by a ribosome, notwithstanding the absence of a 5’ cap structure that would, ordinarily, be regarded as important for the onset of protein biosynthesis. In another example, the IRES elements of the disclosure can be incorporated into a nucleic acid (e.g., a linear RNA) that contains a 5’ cap. In this setting, the IRES element may provide the benefit of a means by which the nucleic acid may be translated even after the 5’ cap is removed by way of endogenous decapping processes. In this way, the inclusion of an IRES element of the disclosure can effectively extend the ability of decapped nucleic acids (e.g., decapped linear RNAs) to effectuate protein expression.

[0009] The IRES of the disclosure may recruit translation tractor and / or ribosomes to the nucleic acids described herein in order to promotes translation. For example, IRES of the disclosure (e.g., SEQ ID NOs: 173-205) may bind to translation initiation factors, thereby recruiting the molecular machinery needed for initiating translation of the nucleic acid. In another example, IRES of the disclosure (e.g., SEQ ID NOs: 185, 190, and 199-201 ) may bind directly to ribosomal subunits (e.g., eukaryotic 60S or 40S subunits) by, e.g., hybridizing directly to ribosomal RNA (rRNA), such as 25S, 28S, 18S, 5.8S, and / or 5S rRNA. By hybridizing directly with the ribosome, the IRES of the disclosure further provide the advantage of fast and efficient protein expression while reducing energy expenditure on the cell.

[0010] In one aspect, the disclosure provides a nucleic acid comprising:

[0011] (i) an internal ribosome entry site (IRES) comprising one or more polynucleotide tracts enriched in uridine or a modified uridine; operably linked to

[0012] (ii) an open reading frame encoding a polypeptide.

[0013] In some embodiments, the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the polynucleotide tracts enriched in uridine or a modified uridine). In some embodiments, the IRES comprises from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.

[0014] In some embodiments, at least 70% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be a uridine, a modified uridine, a cytidine, or a modified cytidine). In some embodiments, at least 75% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 85% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 90% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 95% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, all of the nucleosides in each of the polynucleotide tracts is a pyrimidine- containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.

[0015] In some embodiments, each polynucleotide tract, independently, is from 5 to 20 nucleosides in length (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length). In some embodiments, each polynucleotide tract, independently, is from 5 to 19 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 18 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 17 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 16 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 10 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 10 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 10 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length.

[0016] In some embodiments, each polynucleotide tract, independently, comprises from 5 to 20 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides, such as 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 15 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 14 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 13 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 12 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 1 1 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 10 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 15 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 14 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 13 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 12 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 1 1 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 10 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).

[0017] In some embodiments, each polynucleotide tract comprises at least 9 contiguous pyrimidine- containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract comprises 9 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).

[0018] In some embodiments, one or more (or all) of the polynucleotide tracts are enriched in modified uridine. In some embodiments, the modified uridine is 1 -methylpseudouridine. In other embodiments, the modified uridine is pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In preferred embodiments, the modified uridine is 1 -methylpseudouridine.

[0019] In some embodiments, the IRES is 100% modified at uridine, and the modification consists of 1 - methylpseudouridine. In some embodiments, the entire mRNA, including the IRES, is 100% modified at uridine, and the modification consists of 1 -methylpseudouridine.

[0020] In some embodiments, the IRES does not contain a chemical modification at uridine. In some embodiments, the IRES does not contain a chemical modification at any of the nucleosides therein.

[0021] In some embodiments, the IRES is located within a noncoding region of the nucleic acid. For example, the IRES may be located within a 5’ untranslated region (UTR) that is operably linked to the open reading frame. In some embodiments, the open reading frame is further operably linked to a 3’ UTR.

[0022] In some embodiments, the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleosides). In some embodiments, each of the spacers, independently, comprises from 10 to 40 nucleosides (e.g., 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides). In some embodiments, each of the spacers, independently, comprises 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.

[0023] In some embodiments, the IRES is represented by the formula:

[0024] [(N)n - ( U')m]p wherein: each N is, independently, any nucleoside residue; each t / 'is, independently, a pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides), preferably wherein each t / ' is, independently, uridine or a modified uridine, even more preferably wherein each t / 'is, independently, modified uridine (e.g., 1 - methylpseudouridine); each n is, independently, an integer from 1 to 100 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100); each m is, independently, an integer from 2 to 15 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, or 15); and p is an integer from 2 to 20 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20).

[0025] In some embodiments, N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.

[0026] In some embodiments, the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.

[0027] In some embodiments, the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 -methyl- pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O- methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 - thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.

[0028] In some embodiments, the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl- adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6- hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl- adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl- adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'- O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido-adenosine, 2’-F-ara- adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19-amino-pentaoxanonadecyl)-adenosine.

[0029] In some embodiments, the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio- guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl- 2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O- methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.

[0030] In some embodiments, the modified uridine of U’ is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 1 1 . In some embodiments, each m is 9. In some embodiments, p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6.

[0031] In some embodiments, the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular. In some embodiments, the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.

[0032] In some embodiments, the modified uridine of the open reading frame is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5- methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine of the open reading frame is 1 -methylpseudouridine.

[0033] In some embodiments, the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 -methyl- pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O- methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 - thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.

[0034] In some embodiments, the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl- adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6- hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl- adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl- adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'- O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido-adenosine, 2’-F-ara- adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19-amino-pentaoxanonadecyl)-adenosine.

[0035] In some embodiments, the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio- guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl- 2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O- methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.

[0036] In some embodiments, the polypeptide encoded by the open reading frame is a secreted protein, (e.g., a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, or a cell-penetrating peptide), an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.

[0037] In some embodiments, the nucleic acid does not comprise a 5’ cap.

[0038] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes the nucleotide sequence of any one of SEQ ID NOs: 173-190 and 202-205.

[0039] In some embodiments, the nucleic acid include a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES sequence presented in Table 2 (e.g., any one of IRES 1 to IRES 22).

[0040] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 173.

[0041] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 174.

[0042] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 175.

[0043] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 176.

[0044] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 177.

[0045] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 179.

[0046] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 180.

[0047] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 181 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 181 .

[0048] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 182.

[0049] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 183.

[0050] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 184.

[0051] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 185.

[0052] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 186.

[0053] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 187.

[0054] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 188.

[0055] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 189.

[0056] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 190.

[0057] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 202.

[0058] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 203.

[0059] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 205.

[0060] In another aspect, the disclosure provides a nucleic acid comprising:

[0061] (i) an IRES comprising one or more polynucleotides that specifically bind a translation initiation factor (for example, eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2, also referred to as Dap5), eukaryotic translation initiation factor 3 (elF3)), or IRES trans-acting factors (ITAfs), such as a polypyrimidine tract-binding protein (PTBP) or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as La) fused to an RNA-binding protein; operably linked to

[0062] (ii) an open reading frame encoding a polypeptide.

[0063] In some embodiments, the one or more polynucleotides specifically bind elF4G, elF4G2, elF3, La protein, or an ITAF, such as PTBP. In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ). In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1 ). In some embodiments, each of the one or more polynucleotides has the nucleic acid sequence of SEQ ID NO: 1 .

[0064] In some embodiments, each U residue in SEQ ID NO: 1 is replaced with a modified uridine, such as 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2- thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy- uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminornethyl)uridine, 5- (isopentenylaminornethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-rnethoxycarbonylmethyl-2'-O-rnethyl-uridine, 5- carbarnoylmethyl-2'-O-rnethyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylarninomethyl)-2'-O-rnethyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, each U residue in SEQ ID NO: 1 is replaced with 1 -methylpseudouridine.

[0065] In some embodiments, the IRES comprises one or more polynucleotides that specifically bind to a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein. As a non-limiting example, the RNA-binding protein may be an MS2-binding protein, and the one or more polynucleotides may comprise one or more MS2 RNA hairpins.

[0066] In some embodiments, the IRES comprises a plurality of polynucleotides that specifically bind a translation initiation factor (for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein. In some embodiments, the IRES comprises from 2 to 20 polynucleotides that specifically bind a translation initiation factor (for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 polynucleotides that specifically bind a translation initiation factor (for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein).

[0067] In some embodiments, the IRES comprises from 2 to 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).

[0068] In some embodiments, the IRES comprises from 3 to 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 3, 4, 5, 6, 7, 8, or 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein). In some embodiments, the IRES comprises from 4 to 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 4, 5, 6, 7, or 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).

[0069] In some embodiments, the IRES comprises from 5 to 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 5, 6, or 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).

[0070] In some embodiments, the IRES comprises 2 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 3 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 4 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 5 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 6 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA- binding protein. In some embodiments, the IRES comprises 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.

[0071] In some embodiments, the nucleic acid does not comprise a 5’ cap.

[0072] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes the nucleotide sequence of any one of SEQ ID NOs: 191 -201 .

[0073] In some embodiments, the nucleic acid include a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES sequence presented in Table 3 (e.g., any one of IRES 19 to IRES 29). In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 191 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 191 .

[0074] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 192.

[0075] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 193.

[0076] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 194.

[0077] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 195.

[0078] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 196.

[0079] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 197.

[0080] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 198.

[0081] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 199.

[0082] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 200.

[0083] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 201 .

[0084] In another aspect, the disclosure provides nucleic acid including:

[0085] (i) an internal ribosome entry site (IRES) including a nucleotide sequence having complementarity sufficient to hybridize to a region within a ribosomal RNA (rRNA), operably linked to

[0086] (ii) an open reading frame encoding a polypeptide.

[0087] In some embodiments, the IRES does not specifically bind to ribosomal protein.

[0088] In some embodiments, the nucleotide sequence of the IRES has at least 70% complementarity to the region within the rRNA, optionally wherein the IRES has at least 71%, 72%, 73%, 74%, 85%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the region within the rRNA.

[0089] In some embodiments, the nucleotide sequence of the IRES has at least 70% complementarity to at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA.

[0090] In some embodiments, the nucleotide sequence of the IRES has at least 75% complementarity to at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA, optionally wherein the nucleic acid sequences has at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA.

[0091] In some embodiments, the nucleotide sequence of the IRES includes at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.

[0092] In some embodiments, the nucleotide sequence of the IRES includes from 10 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 12 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 15 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 18 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 20 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 25 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.

[0093] In some embodiments, the nucleotide sequence of the IRES includes 9 or fewer nucleotide mismatches relative to the region of the rRNA, optionally wherein the antisense strand includes 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or only 1 mismatch relative to the region of the rRNA.

[0094] In some embodiments, the IRES does not include a chemically modified nucleoside. For example, in some embodiments the IRES includes nucleosides selected solely from adenosine, guanosine, cytidine, and uridine.

[0095] In some embodiments, the IRES includes one or more chemically modified nucleosides. In some embodiments, the IRES includes one or more chemically modified adenosine, guanosine, cytidine, and / or uridine nucleosides.

[0096] In some embodiments, at least 70% of the nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the nucleosides in the IRES are chemically modified).

[0097] In some embodiments, at least 70% of the adenosine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the adenosine nucleosides in the IRES are chemically modified).

[0098] In some embodiments, the IRES includes one or more chemically modified adenosine nucleosides. In some embodiments, the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl- adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6- hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl- adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl- adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'- O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido-adenosine, 2’-F-ara- adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19-amino-pentaoxanonadecyl)-adenosine.

[0099] In some embodiments, at least 70% of the guanosine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the guanosine nucleosides in the IRES are chemically modified). In some embodiments, the IRES includes one or more chemically modified guanosine nucleosides. In some embodiments, the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio- guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl- 2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O- methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.

[0100] In some embodiments, at least 70% of the cytidine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the cytidine nucleosides in the IRES are chemically modified).

[0101] In some embodiments, the IRES includes one or more chemically modified cytidine nucleosides. In some embodiments, the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3- methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo- cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 -methyl- pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O- methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 - thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.

[0102] In some embodiments, at least 70% of the uridine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the uridine nucleosides in the IRES are chemically modified).

[0103] In some embodiments, the IRES includes one or more chemically modified uridine nucleosides. In some embodiments, the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl- uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5- carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.

[0104] In some embodiments, the IRES includes one or more polynucleotide tracts enriched in uridine or a modified uridine

[0105] In some embodiments, the IRES includes from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 3 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 4 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 5 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 6 of the polynucleotide tracts enriched in uridine or a modified uridine.

[0106] In some embodiments, at least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine, preferably wherein all of the nucleosides in each of the polynucleotide tracts is a modified uridine.

[0107] In some embodiments, each polynucleotide tract, independently, is from 5 to 20 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 1 1 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length.

[0108] In some embodiments, each polynucleotide tract, independently, includes from 5 to 20 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, includes from 6 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, includes from 7 to 1 1 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract includes at least 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract includes 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract is enriched in the modified uridine.

[0109] In some embodiments, the modified uridine is 1 -methylpseudouridine, pseudouridine, pyridin-4- one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl- uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5- carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine is 1 -methylpseudouridine.

[0110] In some embodiments, the IRES is located within a noncoding region of the nucleic acid (e.g., a 5’ untranslated region (UTR)) that is operably linked to the open reading frame. In some embodiments, the open reading frame is further operably linked to a 3’ UTR.

[0111] In some embodiments, the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, include from 5 to 100 nucleosides. In some embodiments, each of the spacers, independently, includes from 10 to 40 nucleosides. In some embodiments, each of the spacers, independently, includes 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.

[0112] In some embodiments, the IRES is represented by the formula:

[0113] [(A n - ( CT)m]p wherein: each N is, independently, any nucleoside residue; each U’ s, independently, uridine or a modified uridine; each n is, independently, an integer from 1 to 100; each m is, independently, an integer from 2 to 15; and p is an integer from 2 to 20.

[0114] In some embodiments, each N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.

[0115] In some embodiments, the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine of N is 1 -methylpseudouridine.

[0116] In some embodiments, the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 -methyl- pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O- methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 - thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine. In some embodiments, the modified adenosine of A / is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl- adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6- hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl- adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl- adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'- O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido-adenosine, 2’-F-ara- adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19-amino-pentaoxanonadecyl)-adenosine.

[0117] In some embodiments, the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio- guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl- 2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O- methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.

[0118] In some embodiments, the modified uridine of U’ is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine of U’ is 1 -methylpseudouridine.

[0119] In some embodiments, each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 1 1 . In some embodiments, each m is 9.

[0120] In some embodiments, p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6.

[0121] In some embodiments, the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular.

[0122] In some embodiments, the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.

[0123] In some embodiments, the modified uridine of the open reading frame is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5- methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-0H-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine of the open reading frame is 1 -methylpseudouridine.

[0124] In some embodiments, the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 -methyl- pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O- methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 - thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.

[0125] In some embodiments, the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl- adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6- hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl- adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl- adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'- O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido-adenosine, 2’-F-ara- adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19-amino-pentaoxanonadecyl)-adenosine.

[0126] In some embodiments, the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio- guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl- 2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O- methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.

[0127] In some embodiments, the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membrane-bound protein, an intracellular membranebound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein. In some embodiments, the nucleic acid does not include a 5’ cap. In some embodiments, the nucleic acid includes a 5’ cap.

[0128] In some embodiments, the nucleotide sequence of the IRES includes at least 75% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES includes at least 80% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES includes at least 85% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES has at least 90% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES has a at least 95% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190, optionally wherein the nucleotide sequence of the IRES has at least 96%, 97%, 98%, or 99% sequence identity SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES is SEQ ID NO: 185 or SEQ ID NO: 190.

[0129] In some embodiments, the IRES includes one or more polynucleotides that specifically bind a translation initiation factor (e.g., eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2), eukaryotic translation initiation factor 3 (elF3), La protein, or an IRES transacting factors (ITAf)), or a fusion protein including a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein. In some embodiments, the one or more polynucleotides specifically bind elF4G.

[0130] In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 - methylpseudouridine.

[0131] In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 - methylpseudouridine.

[0132] In some embodiments, the IRES includes one or more polynucleotides that specifically bind to a fusion protein including a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein, optionally wherein the RNA-binding protein is MS2-binding protein and the one or more polynucleotides include one or more MS2 RNA hairpins.

[0133] In some embodiments, the nucleic acid does not include a 5’ cap. In some embodiments, the nucleic acid includes a 5’ cap.

[0134] In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes the nucleotide sequence of any one of SEQ ID NO: 191 -201.

[0135] In some embodiments, rRNA is a eukaryotic rRNA. In some embodiments, the rRNA is from a 60S or 40S ribosomal subunit, optionally wherein the rRNA is selected from the group consisting of a 25S, 28S, 18S, 5.8S, and 5S rRNA.

[0136] In some embodiments, in any of any of the foregoing aspects or embodiments of the disclosure, the nucleic acid sequence surrounding (e.g., 5’ and / or 3’ relative to) the IRES has a single stranded RNA structure.

[0137] In a further aspect, the disclosure provides a polypeptide expression system comprising:

[0138] (i) the nucleic acid of the foregoing aspect (or any of the above embodiments thereof); and

[0139] (ii) a nucleic acid comprising an open reading frame that encodes elF4G, La protein, or a functional variant thereof.

[0140] In some embodiments, the nucleic acid of (i) and the nucleic acid of (ii) are separate molecules.

[0141] In some embodiments, the nucleic acid of (ii) comprises, from 5’ to 3’:

[0142] (i) a 5’ UTR;

[0143] (ii) the open reading frame encoding the elF4G, La protein, or functional variant thereof; and

[0144] (iii) a 3’ UTR.

[0145] In some embodiments, the nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR.

[0146] In a further aspect, the disclosure provides a host cell comprising the nucleic acid or polypeptide expression system of any one of the above aspects or embodiments of the disclosure. In some embodiments, the host cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell.

[0147] In another aspect, the disclosure provides a method of expressing a polypeptide in a subject, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure.

[0148] In another aspect, the disclosure provides a method of expressing a polypeptide in a cell or population of cells, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure.

[0149] In another aspect, the disclosure provides a method of treating a disease or condition associated with a deficiency in an endogenous polypeptide, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure, with the proviso that the polypeptide encoded by the nucleic acid or polypeptide expression system corresponds to the polypeptide whose deficiency is associated with the disease or condition.

[0150] DEFINITIONS

[0151] In order that the present disclosure can be more readily understood, certain terms are first defined. As used in this application, except as otherwise expressly provided herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout the application. The present disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.

[0152] In this specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. The terms "a" (or "an"), as well as the terms "one or more," and "at least one" can be used interchangeably herein. In certain aspects, the term "a" or "an" means "single." In other aspects, the term "a" or "an" includes "two or more" or "multiple."

[0153] Furthermore, "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" as used in a phrase such as "A and / or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and / or" as used in a phrase such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0154] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure.

[0155] Wherever aspects are described herein with the language "comprising," otherwise analogous aspects described in terms of "consisting of" and / or "consisting essentially of" are also provided.

[0156] Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the present disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0157] Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Where a range of values is recited, it is to be understood that each intervening integer value, and each fraction thereof, between the recited upper and lower limits of that range is also specifically disclosed, along with each subrange between such values. The upper and lower limits of any range can independently be included in or excluded from the range, and each range where either, neither or both limits are included is also encompassed within the invention. Where a value is explicitly recited, it is to be understood that values which are about the same quantity or amount as the recited value are also within the scope of the present disclosure. Where a combination is disclosed, each subcombination of the elements of that combination is also specifically disclosed and is within the scope of the present disclosure. Conversely, where different elements or groups of elements are individually disclosed, combinations thereof are also disclosed. Where any element of an invention is disclosed as having a plurality of alternatives, examples of that invention in which each alternative is excluded singly or in any combination with the other alternatives are also hereby disclosed; more than one element of an invention can have such exclusions, and all combinations of elements having such exclusions are hereby disclosed.

[0158] As used herein, the term “about” refers to a value that is no more than 10% above or below the value being described. For example, the term “about 5 nM” indicates a range of from 4.5 nM to 5.5 nM.

[0159] As used herein, the term "biocompatible" means compatible with living cells, tissues, organs or systems posing little to no risk of injury, toxicity or rejection by the immune system.

[0160] As used herein, the term "biodegradable" means capable of being broken down into innocuous products by the action of living things.

[0161] As used herein, the phrase "biologically active" refers to a characteristic of any substance that has activity in a biological system and / or organism. For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active. In particular embodiments, a polynucleotide of the present disclosure can be considered biologically active if even a portion of the polynucleotide is biologically active or mimics an activity considered biologically relevant.

[0162] As used herein, the term "amino acid substitution" refers to the replacement of an amino acid residue present in a parent or reference polypeptide (e.g., a target polypeptide described herein) with another amino acid residue. An amino acid can be substituted in a parent or reference sequence, for example, via chemical peptide synthesis or through recombinant methods known in the art. Accordingly, a reference to a "substitution at position X" refers to the substitution of an amino acid present at position X with an alternative amino acid residue. In some aspects, substitution patterns can be described according to the scheme AnY, wherein A is the single letter code corresponding to the amino acid naturally or originally present at position n, and Y is the substituting amino acid residue. In some aspects, substitution patterns can be described according to the scheme An(YZ), wherein A is the single letter code corresponding to the amino acid residue substituting the amino acid naturally or originally present at position n, and Y and Z are alternative substituting amino acid residue.

[0163] In the context of the present disclosure, substitutions (even when they referred to as amino acid substitution) may be conducted at the nucleic acid level, i.e., substituting an amino acid residue with an alternative amino acid residue may be conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid.

[0164] As used herein, the terms “conservative mutation,” “conservative substitution,” “conservative amino acid substitution,” and the like refer to a substitution of one or more amino acids for one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and / or steric volume. These properties are summarized for each of the twenty naturally-occurring amino acids in Table 1 below.

[0165] Table 1. Representative physicochemical properties of naturally-occurring amino acids

[0166] From this table it is appreciated that the conservative amino acid families include, e.g., (i) G, A, V, L, I, P, and M; (ii) D and E; (iii) C, S and T; (iv) H, K and R; (v) N and Q; and (vi) F, Y and W. A conservative mutation or substitution is therefore one that substitutes one amino acid for a member of the same amino acid family (e.g., a substitution of Ser for Thr or Lys for Arg).

[0167] As used herein, the term “conjugate” refers to a compound formed by the chemical bonding of a reactive functional group of one molecule with an appropriately reactive functional group of another molecule. Conjugates may additionally be produced, e.g., as two polypeptide domains covalently bound to one another as part of a single polypeptide chain that is synthesized by the translation of a single RNA transcript encoding both polypeptides in frame with one another.

[0168] As used herein, the term "sequence optimization" refers to a process or series of processes by which nucleobases in a reference nucleic acid sequence are replaced with alternative nucleobases, resulting in a nucleic acid sequence with improved properties, e.g., improved protein expression or decreased immunogenicity. In general, the goal in sequence optimization is to produce a synonymous nucleotide sequence than encodes the same polypeptide sequence encoded by the reference nucleotide sequence. Thus, there are no amino acid substitutions (as a result of codon optimization) in the polypeptide encoded by the codon optimized nucleotide sequence with respect to the polypeptide encoded by the reference nucleotide sequence.

[0169] As used herein, the terms "codon substitution" or "codon replacement" in the context of sequence optimization refer to replacing a codon present in a reference nucleic acid sequence with another codon. A codon can be substituted in a reference nucleic acid sequence, for example, via chemical peptide synthesis or through recombinant methods known in the art. Accordingly, references to a "substitution" or "replacement" at a certain location in a nucleic acid sequence (e.g., an mRNA) or within a certain region or subsequence of a nucleic acid sequence (e.g., an mRNA) refer to the substitution of a codon at such location or region with an alternative codon.

[0170] As used herein, the terms "coding region" and "region encoding" and grammatical variants thereof, refer to an Open Reading Frame (ORF) in a polynucleotide that upon expression yields a polypeptide or protein.

[0171] The term “complementarity sufficient to hybridize,” as used herein, refers to a nucleic acid sequence or a portion thereof that need not be fully complementary (e.g., 100% complementary) to a target region or a nucleic acid sequence or a portion thereof that has one or more nucleotide mismatches relative to the target region but that is still capable of hybridizing to the target region under specified conditions. For example, the nucleic acid may be, e.g., 95% complementary, 90%, complementary, 85% complementary, 80% complementary, 75% complementary, 70% complementary, 65% complementary, 60% complementary, 55% complementary, 50% complementary, or less, but still form sufficient base pairs with the target so as to hybridize across its length.

[0172] As used herein, the term “contacting” means establishing a physical connection between two or more entities. For example, contacting a mammalian cell with a nanoparticle composition means that the mammalian cell and a nanoparticle are made to share a physical connection. Methods of contacting cells with external entities both in vivo and ex vivo are well known in the biological arts. For example, contacting a nanoparticle composition and a mammalian cell disposed within a mammal can be performed by varied routes of administration (e.g., intravenous, intramuscular, intradermal, and subcutaneous) and can involve varied amounts of nanoparticle compositions. Moreover, more than one mammalian cell can be contacted by a nanoparticle composition.

[0173] As used herein, the term “delivering” means providing an entity to a destination. For example, delivering a polynucleotide to a subject can involve administering a nanoparticle composition including the polynucleotide to the subject (e.g., by an intravenous, intramuscular, intradermal, or subcutaneous route). Administration of a nanoparticle composition to a mammal or mammalian cell can involve contacting one or more cells with the nanoparticle composition.

[0174] As used herein, "delivery agent" refers to any substance that facilitates, at least in part, the in vivo, in vitro, or ex vivo delivery of a polynucleotide to targeted cells.

[0175] As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1 ) production of an mRNA template from a DNA sequence (e.g., by transcription); (2) processing of an mRNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing); (3) translation of an mRNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein. As used herein, the term “lipid nanoparticle” refers to a transfer vehicle including one or more lipids (e.g., cationic lipids, non-cationic lipids, and PEG-modified lipids). Exemplary lipid nanoparticles are formulated to deliver one or more mRNA to one or more target cells. Examples of suitable lipids include, for example, the phosphatidyl compounds (e.g., phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides). Lipid nanoparticles may contain a cationic lipid, or a lipid species with a net positive charge at a selected pH (e.g., physiological pH), to encapsulate and / or enhance the delivery of mRNA into the target cells.

[0176] As used herein, the term “helper lipid” refers to a compound or molecule that includes a lipidic moiety (for insertion into a lipid layer, e.g., lipid bilayer) and a polar moiety (for interaction with physiologic solution at the surface of the lipid layer). Typically the helper lipid is a phospholipid. A function of the helper lipid is to “complement” the amino lipid and increase the fusogenicity of the bilayer and / or to help facilitate endosomal escape, e.g., of nucleic acid delivered to cells. Helper lipids are also believed to be a key structural component to the surface of the LNP.

[0177] As used herein, the term “ionizable amino lipid” includes those lipids having one, two, three, or more fatty acid or fatty alkyl chains and a pH-titratable amino head group (e.g., an alkylamino or dialkylamino head group). An ionizable amino lipid is typically protonated (i.e., positively charged) at a pH below the pKa of the amino head group and is substantially not charged at a pH above the pKa. Such ionizable amino lipids include, but are not limited to DLin-MC3-DMA (MC3), (13Z,165Z)-N,N-dimethyl-3- nonydocosa-13-16-dien-1 -amine (L608), and a compound of any one of Formula I, II, and II described herein (e.g., any one of Compound 1-1 , Compound I-2, Compound I-3, or Compound l-VI).

[0178] As used herein, a "linker" refers to a group of atoms, e.g., 10-1 ,000 atoms, and can be comprised of the atoms or groups such as, but not limited to, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine. The linker can be attached to a modified nucleoside or nucleotide on the nucleobase or sugar moiety at a first end, and to a payload, e.g., a detectable or therapeutic agent, at a second end. The linker can be of sufficient length as to not interfere with incorporation into a nucleic acid sequence. The linker can be used for any useful purpose, such as to form polynucleotide multimers (e.g., through linkage of two or more chimeric polynucleotides molecules or IVT polynucleotides) or polynucleotides conjugates, as well as to administer a payload, as described herein. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted, as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethylene glycols (e.g., ethylene or propylene glycol monomeric units, e.g., diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol), and dextran polymers and derivatives thereof., Other examples include, but are not limited to, cleavable moieties within the linker, such as, for example, a disulfide bond (-S-S-) or an azo bond (-N=N-), which can be cleaved using a reducing agent or photolysis. Non-limiting examples of a selectively cleavable bond include an amido bond can be cleaved for example by the use of tris(2- carboxyethyl)phosphine (TCEP), or other reducing agents, and / or photolysis, as well as an ester bond can be cleaved for example by acidic or basic hydrolysis.

[0179] As used herein, the terms “messenger RNA” or “mRNA” refer to any polynucleotide which encodes a polypeptide of interest and which is capable of being translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo. Traditionally, the basic components of an mRNA molecule include a coding region, a 5’UTR, a 3’UTR, a 5’ cap, and a poly-A tail.

[0180] As used herein the term "modified" refers to a changed state or structure of a molecule of the present disclosure. Molecules can be modified in many ways, including chemically, structurally, and functionally. In some embodiments, the mRNA molecules of the present disclosure are modified by the introduction of non-natural nucleosides and / or nucleotides, e.g., as it relates to the natural ribonucleotides A, U, G, and / or C. Examples of “modified” nucleosides are provided herein.

[0181] As used herein, the terms “modified messenger RNA” or “modified mRNA” refer to mRNA polynucleotides that include naturally occurring and / or non-naturally occurring modifications, for example, of a sugar, a nucleobase, or an internucleoside linkage (e.g., to a linking phosphate, to a phosphodiester linkage, or to the phosphodiester backbone). Non-natural modified nucleotides may be introduced during synthesis of post-synthesis of the polynucleotides to achieve desired functions or properties. The modifications may be present on an internucleoside linkage, purine or pyrimidine base, or sugar. The modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a polynucleotide may be chemically modified.

[0182] As used herein, "unmodified" refers to any substance, compound, or molecule prior to being changed in some way. Unmodified can, but does not always, refer to the wild type or native form of a biomolecule. Molecules can undergo a series of modifications whereby each modified molecule can serve as the "unmodified" starting molecule for a subsequent modification.

[0183] Uracil is one of the four nucleobases in the nucleic acid of RNA, and it is represented by the letter U. Uracil can be attached to a ribose ring, or more specifically, a ribofuranose via an Ni-glycosidic bond to yield the nucleoside uridine. The nucleoside uridine is also commonly abbreviated according to the one letter code of its nucleobase, i.e., U. Thus, in the context of the present disclosure, when a monomer in a polynucleotide sequence is U, such U is designated interchangeably as a "uracil" or a "uridine."

[0184] The terms "uridine content" or "uracil content" are interchangeable and refer to the amount of uracil or uridine present in a certain nucleic acid sequence. Uridine content or uracil content can be expressed as an absolute value (total number of uridine or uracil in the sequence) or relative (uridine or uracil percentage respect to the total number of nucleobases in the nucleic acid sequence).

[0185] The terms "uridine-modified sequence" refers to a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with a different overall or local uridine content (higher or lower uridine content) or with different uridine patterns (e.g., gradient distribution or clustering) with respect to the uridine content and / or uridine patterns of a candidate nucleic acid sequence. In the content of the present disclosure, the terms "uridine-modified sequence" and "uracil-modified sequence" are considered equivalent and interchangeable.

[0186] A "high uridine codon" is defined as a codon comprising two or three uridines, a "low uridine codon" is defined as a codon comprising one uridine, and a "no uridine codon" is a codon without any uridines. In some embodiments, a uridine-modified sequence comprises substitutions of high uridine codons with low uridine codons, substitutions of high uridine codons with no uridine codons, substitutions of low uridine codons with high uridine codons, substitutions of low uridine codons with no uridine codons, substitution of no uridine codons with low uridine codons, substitutions of no uridine codons with high uridine codons, and combinations thereof. In some embodiments, a high uridine codon can be replaced with another high uridine codon. In some embodiments, a low uridine codon can be replaced with another low uridine codon. In some embodiments, a no uridine codon can be replaced with another no uridine codon. A uridine-modified sequence can be uridine enriched or uridine rarefied.

[0187] As used herein, the terms "uridine enriched" and grammatical variants refer to the increase in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence. Uridine enrichment can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine enrichment can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence).

[0188] As used herein, the terms "uridine rarefied" and grammatical variants refer to a decrease in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence. Uridine rarefication can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine rarefication can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence).

[0189] As used herein, the term “initiation codon”, used interchangeably with the term “start codon”, refers to the first codon of an open reading frame that is translated by the ribosome and is comprised of a triplet of linked adenine-uracil-guanine nucleobases. The initiation codon is depicted by the first letter codes of adenine (A), uracil (U), and guanine (G) and is often written simply as “AUG”. Although natural mRNAs may use codons other than AUG as the initiation codon, which are referred to herein as “alternative initiation codons”, the initiation codons of polynucleotides described herein use the AUG codon. During the process of translation initiation, the sequence comprising the initiation codon is recognized via complementary base-pairing to the anticodon of an initiator tRNA (Met-tRNAiMet) bound by the ribosome. Open reading frames may contain more than one AUG initiation codon, which are referred to herein as “alternate initiation codons”.

[0190] The initiation codon plays an important role in translation initiation. The initiation codon is the first codon of an open reading frame that is translated by the ribosome. Typically, the initiation codon comprises the nucleotide triplet AUG, however, in some instances translation initiation can occur at other codons comprised of distinct nucleotides. The initiation of translation in eukaryotes is a multistep biochemical process that involves numerous protein-protein, protein-RNA, and RNA-RNA interactions between messenger RNA molecules (mRNAs), the 40S ribosomal subunit, other components of the translation machinery (e.g., eukaryotic initiation factors; elFs). The current model of mRNA translation initiation postulates that the pre-initiation complex (alternatively “43S pre-initiation complex”; abbreviated as “PIC”) translocates from the site of recruitment on the mRNA (typically the 5' cap) to the initiation codon by scanning nucleotides in a 5' to 3' direction until the first AUG codon that resides within a specific translation-promotive nucleotide context (the Kozak sequence) is encountered (Kozak (1989) J Cell Biol 108:229-241 ). Scanning by the PIC ends upon complementary base-pairing between nucleotides comprising the anticodon of the initiator Met-tRNAiMettransfer RNA and nucleotides comprising the initiation codon of the mRNA. Productive base-pairing between the AUG codon and the Met-tRNAiMet anticodon elicits a series of structural and biochemical events that culminate in the joining of the large 60S ribosomal subunit to the PIC to form an active ribosome that is competent for translation elongation.

[0191] The term “Kozak sequence” (also referred to as “Kozak consensus sequence”) refers to a translation initiation enhancer element to enhance expression of a gene or open reading frame, and which in eukaryotes, is located in the 5' UTR. The Kozak consensus sequence was originally defined as the sequence GCCRCC (SEQ ID NO: 2), where R = a purine, following an analysis of the effects of single mutations surrounding the initiation codon (AUG) on translation of the preproinsulin gene (Kozak (1986) Cell 44:283-292). Polynucleotides disclosed herein comprise a Kozak consensus sequence, or a derivative or modification thereof. (Examples of translational enhancer compositions and methods of use thereof, see U.S. Pat. No. 5,807,707 to Andrews et al., incorporated herein by reference in its entirety; U.S. Pat. No. 5,723,332 to Chernajovsky, incorporated herein by reference in its entirety; U.S. Pat. No. 5,891 ,665 to Wilson, incorporated herein by reference in its entirety.)

[0192] As used herein, the term “nucleobase” (alternatively “nucleotide base” or “nitrogenous base”) refers to a purine or pyrimidine heterocyclic compound found in nucleic acids, including any derivatives or analogs of the naturally occurring purines and pyrimidines that confer improved properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof. Adenine, cytosine, guanine, thymine, and uracil are the nucleobases predominately found in natural nucleic acids. Other natural, non-natural, and / or synthetic nucleobases, as known in the art and / or described herein, can be incorporated into nucleic acids. Unless otherwise specified, the nucleobase sequence of a SEQ ID NO described herein encompasses both natural nucleobases and chemically modified nucleobases (e.g., a “U” designation in a SEQ ID NO encompasses both uracil and chemically modified uracil).

[0193] As used herein, the term “nucleoside” refers to a compound containing a sugar molecule (e.g., a ribose in RNA or a deoxyribose in DNA), or derivative or analog thereof, covalently linked to a nucleobase (e.g., a purine or pyrimidine), or a derivative or analog thereof (also referred to herein as “nucleobase”), but lacking an internucleoside linking group (e.g., a phosphate group). As used herein, the term “nucleotide” refers to a nucleoside covalently bonded to an internucleoside linking group (e.g., a phosphate group), or any derivative, analog, or modification thereof that confers improved chemical and / or functional properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof.

[0194] As used herein, the term “open reading frame”, abbreviated as “ORF”, refers to a segment or region of an mRNA molecule that encodes a polypeptide. The ORF comprises a continuous stretch of non-overlapping, in-frame codons, beginning with the initiation codon and ending with a stop codon, and is translated by the ribosome.

[0195] As used herein, the term “translational regulatory activity” (used interchangeably with “translational regulatory function”) refers to a biological function, mechanism, or process that modulates (e.g., regulates, influences, controls, varies) the activity of the translational apparatus, including the activity of the PIC and / or ribosome. In some aspects, the desired translation regulatory activity promotes and / or enhances the translational fidelity of mRNA translation. In some aspects, the desired translational regulatory activity reduces and / or inhibits leaky scanning. As used herein, the terms "nucleic acid" and “polynucleotide” are used interchangeably. In their broadest sense, these terms include any compound and / or substance that comprises a polymer of nucleotides. Exemplary nucleic acids or polynucleotides of the present disclosure include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a p- D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino- a-LNA having a 2'-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or hybrids or combinations thereof.

[0196] Nucleic acid molecules of the disclosure may be, for example, triple-, double-, or single-stranded deoxyribonucleic acid ("DNA"), as well as triple-, double- and single-stranded ribonucleic acid ("RNA"). This term also includes modified, for example, by alkylation, and / or by capping, and unmodified forms of the corresponding unmodified nucleic acid. In particular aspects, the nucleic acid comprises an mRNA. In other aspect, the mRNA is a synthetic mRNA. In some aspects, the synthetic mRNA comprises at least one unnatural nucleobase. In some aspects, all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 1 -methylpseudouridine). In some aspects, the polynucleotide (e.g., a synthetic RNA or a synthetic DNA) comprises only natural nucleobases, i.e., A (adenosine), G (guanosine), C (cytidine), and T (thymidine) in the case of a synthetic DNA, or A, C, G, and U (uridine) in the case of a synthetic RNA.

[0197] The skilled artisan will appreciate that the T bases in the codon maps disclosed herein are present in DNA, whereas the T bases would be replaced by U bases in corresponding RNAs. For example, a codon-nucleotide sequence disclosed herein in DNA form, e.g., a vector or an in-vitro translation (IVT) template, would have its T bases transcribed as U based in its corresponding transcribed mRNA. In this respect, both codon-optimized DNA sequences (comprising T) and their corresponding mRNA sequences (comprising U) are considered codon-optimized nucleotide sequence of the present disclosure. A skilled artisan would also understand that equivalent codon-maps can be generated by replaced one or more bases with non-natural bases. Thus, e.g., a TTC codon (DNA map) would correspond to a UUC codon (RNA map), which in turn would correspond to a ψψC codon (RNA map in which U has been replaced with pseudouridine).

[0198] Standard A-T and G-C base pairs form under conditions which allow the formation of hydrogen bonds between the N3-H and C4-oxy of thymidine and the N1 and C6-NH2, respectively, of adenosine and between the C2-oxy, N3 and C4-NH2, of cytidine and the C2-NH2, N' — H and C6-oxy, respectively, of guanosine. Thus, for example, guanosine (2-amino-6-oxy-9-β-D-ribofuranosyl-purine) can be modified to form isoguanosine (2-oxy-6-amino-9-p-D-ribofuranosyl-purine). Such modification results in a nucleoside base which will no longer effectively form a standard base pair with cytosine. However, modification of cytosine (1 -β-D-ribofuranosyl-2-oxy-4-amino-pyrimidine) to form isocytosine (1 -β-D- ribofuranosyl-2-amino-4-oxy-pyrimidine-) results in a modified nucleotide which will not effectively base pair with guanosine but will form a base pair with isoguanosine (U.S. Pat. No. 5,681 ,702 to Collins et al.). Isocytosine is available from Sigma Chemical Co. (St. Louis, Mo.); isocytidine can be prepared by the method described by Switzer et al. (1993) Biochemistry 32:10489-10496 and references cited therein; 2'- deoxy-5-methyl-isocytidine can be prepared by the method of Tor et al., 1993, J. Am. Chem. Soc. 115:4461 -4467 and references cited therein; and isoguanine nucleotides can be prepared using the method described by Switzer et al., 1993, supra, and Mantsch et al., 1993, Biochem. 14:5593-5601 , or by the method described in U.S. Pat. No. 5,780,610 to Collins et al. Other nonnatural base pairs can be synthesized by the method described in Piccirilli et al., 1990, Nature 343:33-37, for the synthesis of 2,6- diaminopyrimidine and its complement (1 -methylpyrazolo-[4,3]pyrimidine-5,7-(4H,6H)-dione. Other such modified nucleotide units which form unique base pairs are known, such as those described in Leach et al. (1992) J. Am. Chem. Soc. 114:3675-3683 and Switzer et al., supra.

[0199] Nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation. Nucleobases are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Accordingly, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, U represents uracil.

[0200] In accordance with the compositions and methods disclosed herein, nucleic acids or polynucleotides may be “enriched” in certain nucleosides. As used in this context, the term “enriched” refers to a polynucleotide in which at least 50% of the nucleosides within the polynucleotide are the same. For example, a polynucleotide is said to be “enriched” in uridine if at least 50% (e.g., 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleosides in the polynucleotide are uridine nucleosides. In another example, a polynucleotide is said to be “enriched” in a modified uridine nucleoside (e.g., in 1 -methylpseudouridine) if at least 50% (e.g., 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleosides in the polynucleotide are the modified uridine nucleoside (e.g., 1 -methylpseudouridine).

[0201] As used herein, polynuceotides that are “enriched” for certain nucleoside residues may be separated from one another by way of a spacer. In this context, a “spacer” refers to a polynucleotide that does not code for a polypeptide (i.e. , does not contain a start codon operably linked to a continuous segment of amino acid-encoding codons) and that is not enriched with the same nucleoside as the enriched polynucleotide(s) adjacent to the spacer. In some embodiments, a spacer may be enriched for a different nucleoside as the enriched polynucleotide(s) adjacent to the spacer. Spacers may be, for example, from 5 to 100 nucleosides in length, such as from 10 to 40 nucleosides in length (e.g., 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides in length).

[0202] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can comprise modified amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine), as well as other modifications known in the art.

[0203] The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include encoded polynucleotide products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide can be a monomer or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides. The term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid. In some embodiments, a "peptide" can be less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

[0204] Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxy orientation.

[0205] “Percent (%) sequence complementarity” with respect to a reference polynucleotide sequence is defined as the percentage of nucleic acids in a candidate sequence that are complementary to the nucleic acids in the reference polynucleotide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence complementarity. A given nucleotide is considered to be “complementary” to a reference nucleotide as described herein if the two nucleotides form canonical Watson-Crick base pairs. For the avoidance of doubt, Watson-Crick base pairs in the context of the present disclosure include adenine-thymine, adenine-uracil, and cytosine-guanine base pairs. A proper Watson-Crick base pair is referred to in this context as a “match,” while each unpaired nucleotide, and each incorrectly paired nucleotide, is referred to as a “mismatch.” Alignment for purposes of determining percent nucleic acid sequence complementarity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal complementarity over the full length of the sequences being compared. As an illustration, the percent sequence complementarity of a given nucleic acid sequence, A, to a given nucleic acid sequence, B, (which can alternatively be phrased as a given nucleic acid sequence, A that has a certain percent complementarity to a given nucleic acid sequence, B) is calculated as follows:

[0206] 100 multiplied by (the fraction X / Y) where X is the number of complementary base pairs in an alignment (e.g., as executed by computer software, such as BLAST) in that program’s alignment of A and B, and where Y is the total number of nucleic acids in B. It will be appreciated that where the length of nucleic acid sequence A is not equal to the length of nucleic acid sequence B, the percent sequence complementarity of A to B will not equal the percent sequence complementarity of B to A. As used herein, a query nucleic acid sequence is considered to be “completely complementary” to a reference nucleic acid sequence if the query nucleic acid sequence has 100% sequence complementarity to the reference nucleic acid sequence.

[0207] As used herein, the terms “percent (%) sequence identity,” “percent (%) identity,” and the like, with respect to a reference polynucleotide or polypeptide sequence, is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values may be generated using the sequence comparison computer program BLAST. As an illustration, the percent sequence identity of a given nucleic acid or amino acid sequence, A, to, with, or against a given nucleic acid or amino acid sequence, B, (which can alternatively be phrased as a given nucleic acid or amino acid sequence, A that has a certain percent sequence identity to, with, or against a given nucleic acid or amino acid sequence, B) is calculated as follows:

[0208] 100 multiplied by (the fraction X / Y) where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in that program’s alignment of A and B, and where Y is the total number of nucleic acids in B. It will be appreciated that where the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, the percent sequence identity of A to B will not equal the percent sequence identity of B to A.

[0209] As used herein, the term “operatively linked” in the context of a polynucleotide fragment is intended to mean that the two polynucleotide fragments are joined such that the amino acid sequences encoded by the two polynucleotide fragments remain in-frame.

[0210] As used herein, the term "pharmacokinetic" refers to any one or more properties of a molecule or compound as it relates to the determination of the fate of substances administered to a living organism. Pharmacokinetics is divided into several areas including the extent and rate of absorption, distribution, metabolism and excretion. This is commonly referred to as ADME where: (A) Absorption is the process of a substance entering the blood circulation; (D) Distribution is the dispersion or dissemination of substances throughout the fluids and tissues of the body; (M) Metabolism (or Biotransformation) is the irreversible transformation of parent compounds into daughter metabolites; and (E) Excretion (or Elimination) refers to the elimination of the substances from the body. In rare cases, some drugs irreversibly accumulate in body tissue.

[0211] As used herein, the term “regulatory sequence” includes promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation, e.g., of open reading frames described herein. Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990); incorporated herein by reference.

[0212] As used herein, the phrases "signal sequence," "signal peptide," and "transit peptide" are used interchangeably and refer to a sequence that can direct the transport or localization of a protein to a certain organelle, cell compartment, or extracellular export. The term encompasses both the signal sequence polypeptide and the nucleic acid sequence encoding the signal sequence. Thus, references to a signal sequence in the context of a nucleic acid refer in fact to the nucleic acid sequence encoding the signal sequence polypeptide.

[0213] As used herein, the term "similarity" refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art.

[0214] As used herein, the phrase “specifically binds” refers to a binding reaction which is determinative of the presence of an antigen in a heterogeneous population of proteins and other biological molecules that is recognized, e.g., by a protein or nucleic acid with particularity. A protein or nucleic acid that specifically binds to an antigen will bind to the antigen with a KD of less than 100 nM. For example, a protein or nucleic acid that specifically binds to an antigen will bind to the antigen with a KD of up to 100 nM (e.g., between 1 pM and 100 nM). A protein or nucleic acid that does not exhibit specific binding to a particular antigen or epitope thereof will exhibit a KD of greater than 100 nM (e.g., greater than 500 nm, 1 pM, 100 pM, 500 pM, or 1 mM) for that particular antigen or epitope thereof. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein or carbohydrate. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein or carbohydrate. See, Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1988) and Harlow & Lane, Using Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1999), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.

[0215] As used herein, the terms “subject” and “patient” refer to an organism that receives treatment for a particular disease or condition. Examples of subjects and patients include mammals, such as humans, primates, pigs, goats, rabbits, hamsters, cats, dogs, guinea pigs, members of the bovidae family (such as cattle, bison, buffalo, and yaks, among others), sheep, and horses, among others. A patient that may be treated using the compositions and methods described herein may have an established disease, in which case the patient has been diagnosed as having the disease and has shown symptoms of the disease for a prolonged period of time (e.g., over the course of days, weeks, months, or years). Alternatively, a patient may be symptomatic for a particular disease, but has yet to be diagnosed with the disease by a physician. Other patients that may be treated using the compositions and methods described herein include those that have been diagnosed as having a particular disease, and may or may not be showing symptoms of the disease as of yet. For example, a patient eligible for treatment with the compositions and methods described herein may be described as diagnosed but asymptomatic if the patient has received a diagnosis of a disease, even though the patient may not yet be showing symptoms thereof.

[0216] As used herein, "transfection" refers to the introduction of a polynucleotide (e.g., exogenous nucleic acids) into a cell wherein a polypeptide encoded by the polynucleotide is expressed (e.g., mRNA) or the polypeptide modulates a cellular function (e.g., siRNA, miRNA). As used herein, "expression" of a nucleic acid sequence refers to translation of a polynucleotide (e.g., an mRNA) into a polypeptide or protein and / or post-translational modification of a polypeptide or protein. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures.

[0217] As used herein, the terms “treat” or “treatment” refer to therapeutic treatment, in which the object is to inhibit or slow down (lessen) an undesired physiological change or disorder. Beneficial or desired clinical results of treatment include, without limitation, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Those in need of treatment include those already having the condition or disorder, as well as those prone to have the condition or disorder or those in which the condition or disorder is to be inhibited.

[0218] As used herein, the term "effective amount" of an agent is that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an "effective amount" depends upon the context in which it is being applied. For example, in the context of administering an agent that treats a protein deficiency, an effective amount of an agent is, for example, an amount of mRNA expressing sufficient the desired protein to ameliorate, reduce, eliminate, or prevent the symptoms associated with the corresponding protein deficiency, as compared to the severity of the symptom observed without administration of the agent. The term "effective amount" can be used interchangeably with "effective dose," "therapeutically effective amount," or "therapeutically effective dose."

[0219] As used herein, “methods of administration” can include intravenous, intramuscular, intradermal, subcutaneous, or other methods of delivering a composition to a subject. A method of administration can be selected to target delivery (e.g., to specifically deliver) to a specific region or system of a body.

[0220] As used herein, the term “internal ribosome entry site” or “IRES” refers to a nucleic acid element that is capable of recruiting one or more components of the translation machinery, e.g., a component of the ribosome (e.g., 25S, 28S, 18S, 5.8S, or 5S rRNA), elF4G, or elF3 thereby fostering translation of an open reading frame that is operably linked thereto. IRES elements of the disclosure may be used in conjunction with either a 5’ cap-containing nucleic acid (e.g., a 5’-cap containing mRNA molecule) or a nucleic acid that lacks a 5’ cap (e.g., a circular RNA molecule). Exemplary IRES elements of the disclosure include polypyrimidine tracts, such as one or a plurality of polynucleotide tracts in which at least 70% of the nucleosides therein are pyrimidine-containing nucleosides, such as a uridine, a modified uridine, a cytidine, or a modified cytidine (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be a uridine, a modified uridine, a cytidine, or a modified cytidine).

[0221] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0222] The phrase "pharmaceutically acceptable excipient," as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient. Excipients can include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspension or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

[0223] The present disclosure also includes pharmaceutically acceptable salts of the compounds described herein. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used. Lists of suitable salts are found in Flemington's Pharmaceutical Sciences, 17thed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1 -19 (1977), each of which is incorporated herein by reference in its entirety.

[0224] The term "pharmaceutically acceptable solvate," as used herein, means a compound of the present disclosure wherein molecules of a suitable solvent are incorporated in the crystal lattice. A suitable solvent is physiologically tolerable at the dosage administered. For example, solvates can be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (for example, mono-, di-, and tri-hydrates), A / -methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), A / ,A / '-dimethylformamide (DMF), A / ,A / '-dimethylacetamide (DMAC), 1 ,3-dimethyl-2-imidazolidinone (DMEU), 1 ,3-dimethyl-3, 4,5,6- tetrahydro-2-(1 H)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water is the solvent, the solvate is referred to as a "hydrate."

[0225] As used herein, the term "alkyl", "alkyl group", or "alkylene" means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted. The notation "C1-14alkyl" means an optionally substituted linear or branched, saturated hydrocarbon including 1 -14 carbon atoms. Unless otherwise specified, an alkyl group described herein refers to both unsubstituted and substituted alkyl groups.

[0226] As used herein, the term "alkenyl", "alkenyl group", or "alkenylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted. The notation "C2-14alkenyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon double bond. An alkenyl group may include one, two, three, four, or more carbon-carbon double bonds. For example, C18alkenyl may include one or more double bonds. A C18alkenyl group including two double bonds may be a linoleyl group. Unless otherwise specified, an alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups.

[0227] As used herein, the term "alkynyl", "alkynyl group", or "alkynylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted. The notation "C2-14alkynyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon triple bond. An alkynyl group may include one, two, three, four, or more carbon-carbon triple bonds. For example, C18alkynyl may include one or more carbon-carbon triple bonds. Unless otherwise specified, an alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups.

[0228] As used herein, the term "carbocycle" or "carbocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings of carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings. The notation "C3-6carbocycle" means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon-carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1 ,2 dihydronaphthyl groups. The term "cycloalkyl" as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond. Unless otherwise specified, carbocycles described herein refers to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles.

[0229] As used herein, the term "heterocycle" or "heterocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom. Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen membered rings. Heterocycles may include one or more double or triple bonds and may be non-aromatic or aromatic (e.g., heterocycloalkyl or heteroaryl groups). Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups. The term "heterocycloalkyl" as used herein means a nonaromatic heterocycle and may or may not include any double or triple bond. Unless otherwise specified, heterocycles described herein refers to both unsubstituted and substituted heterocycle groups, i.e., optionally substituted heterocycles.

[0230] As used herein, the term "heteroalkyl", "heteroalkenyl", or "heteroalkynyl", refers respectively to an alkyl, alkenyl, alkynyl group, as defined herein, which further comprises one or more (e.g., 1 , 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) wherein the one or more heteroatoms is inserted between adjacent carbon atoms within the parent carbon chain and / or one or more heteroatoms is inserted between a carbon atom and the parent molecule, i.e., between the point of attachment. Unless otherwise specified, heteroalkyls, heteroalkenyls, or heteroalkynyls described herein refers to both unsubstituted and substituted heteroalkyls, heteroalkenyls, or heteroalkynyls, i.e., optionally substituted heteroalkyls, heteroalkenyls, or heteroalkynyls.

[0231] As used herein, a "biodegradable group" is a group that may facilitate faster metabolism of a lipid in a mammalian entity. A biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group. As used herein, an "aryl group" is an optionally substituted carbocyclic group including one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group including one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted. For example, M and M' can be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole. In the Formulas herein, M and M' can be independently selected from the list of biodegradable groups above. Unless otherwise specified, aryl or heteroaryl groups described herein refers to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups.

[0232] Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified. Optional substituents may be selected from the group consisting of, but are not limited to, a halogen atom (e.g., a chloride, bromide, fluoride, or iodide group), a carboxylic acid (e.g., C(O)OH), an alcohol (e.g., a hydroxyl, OH), an ester (e.g., C(O)OR OC(O)R), an aldehyde (e.g., C(O)H), a carbonyl (e.g., C(O)R, alternatively represented by C=0), an acyl halide (e.g., C(O)X, in which X is a halide selected from bromide, fluoride, chloride, and iodide), a carbonate (e.g., OC(O)OR), an alkoxy (e.g., OR), an acetal (e.g., C(0R)2R"", in which each OR are alkoxy groups that can be the same or different and R"" is an alkyl or alkenyl group), a phosphate (e.g., P(O)43-) , a thiol (e.g., SH), a sulfoxide (e.g., S(O)R), a sulfinic acid (e.g., S(O)OH), a sulfonic acid (e.g., S(O)20H), a thial (e.g., C(S)H), a sulfate (e.g., S(O)42-) , a sulfonyl (e.g., S(O)2 ), an amide (e.g., C(O)NR2, or N(R)C(O)R), an azido (e.g., N3), a nitro (e.g., NO2), a cyano (e.g., CN), an isocyano (e.g., NC), an acyloxy (e.g., OC(O)R), an amino (e.g., NR2, NRH, or NH2), a carbamoyl (e.g., 0C(O)NR2, 0C(O)NRH, or 0C(O)NH2), a sulfonamide (e.g., S(O)2NR2, S(O)2NRH, S(O)2NH2, N(R)S(O)2R, N(H)S(O)2R, N(R)S(O)2H, or N(H)S(O)2H), an alkyl group, an alkenyl group, and a cyclyl (e.g., carbocyclyl or heterocyclyl) group. In any of the preceding, R is an alkyl or alkenyl group, as defined herein. In some embodiments, the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein. For example, a C1-6alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein.

[0233] Compounds of the disclosure that contain nitrogens can be converted to N-oxides by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid (mCPBA) and / or hydrogen peroxides) to afford other compounds of the disclosure. Thus, all shown and claimed nitrogen-containing compounds are considered, when allowed by valency and structure, to include both the compound as shown and its N- oxide derivative (which can be designated as N->0 or N+-O-). Furthermore, in other instances, the nitrogens in the compounds of the disclosure can be converted to N-hydroxy or N-alkoxy compounds. For example, N-hydroxy compounds can be prepared by oxidation of the parent amine by an oxidizing agent such as m CPBA. All shown and claimed nitrogen-containing compounds are also considered, when allowed by valency and structure, to cover both the compound as shown and its N-hydroxy (i.e., N- OH) and N-alkoxy (i.e., N-OR, wherein R is substituted or unsubstituted C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle) derivatives.

[0234] BRIEF DESCRIPTION OF THE DRAWINGS

[0235] FIG. 1 A is a schematic illustrating that linear RNA molecules are prone to degradation at the 5’ and / or 3’ ends by way of exonucleases (top). These types of linear RNA molecules often contain a 5’ cap (bottom) in order to promote ribosome recruitment and, ultimately, translation of an open reading frame.

[0236] FIG. 1B is a schematic showing ways in which RNAs may mitigate or avoid exonuclease degradation. In one example (top), a linear RNA molecule may be bound to a chemical moiety at the 5’ and / or 3’ ends that blocks the access of exonucleases to the RNA molecule. In another example (middle), the RNA may be circularized, such that there are no 5’ or 3’ ends available for binding to (and cleavage by) an exonuclease). One aspect that has hindered the development of these types of molecules is the absence of a 5’ cap, which would typically be attached to the free 5’ end of a linear RNA molecule in order to promote ribosome binding and open reading frame translation. The present disclosure addresses this problem by providing internal ribosome entry (IRES) elements that recruit ribosomes in a cap-independent manner (bottom), allowing for RNAs to simultaneously recruit ribosomes and be modified in ways that remove / modify the cap so as to avoid nucleolytic degradation (e.g., by way of 5’ and / or 3’ blocking moieties or by way of RNA circularization).

[0237] FIG. 2 is a graph comparing the expression of green fluorescent protein (GFP) from three different, linear RNA constructs in HEK293 cells over the course of 60 hours. Each linear RNA contained an open reading frame encoding GFP, and each RNA lacked a 5’ cap structure. The RNA molecules differed in the type of IRES element tested within the 5’ untranslated region (UTR). One construct contained a known coxsackievirus B3 (CVB3) IRES sequence in its 5’ UTR (“GO lin, 5’ CVB3,” top of graph); another construct contained three polynucleotide tracts each containing 9 contiguous unmodified uridine residues, each tract separated from one another by two 13-nucleoside spacers (“GO lin, 5’ v1 .1 ,” lower line of graph); and another construct three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers (“G5 lin , 5’ 3xU9,” middle of graph). A negative control, in which no RNA was provided to the HEK293 cells, was included as well (bottom flatline of graph). FIG. 2 also includes a table comparing the GFP expression level achieved by the “G5 lin, 5’3xU9” construct as compared to the “G0 lin, 5’ CVB3” construct and a construct having the same composition as “G5 lin, 5’3xU9,” but also containing the known 5’ Cap1 structure.

[0238] FIGS. 3A - 3D are graphs comparing the expression of GFP from three different, linear RNA constructs in various cell types (HeLa (FIG. 3A), HEK293 (FIG. 3B), THP1 (FIG. 3C), and Hep3B (FIG. 3D)). Each construct contained an open reading frame encoding GFP, but the constructs differed in the IRES element tested within the 5’ UTR and in the presence / absence of a 5’ cap. One construct contained the known 5’ Cap1 structure (“Cap1 -A100,” circles); another construct contained the CVB3 IRES sequence in its 5’ UTR, without a 5’ cap structure (“CVB3 (GO),” squares); and another construct contained three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers without a 5’cap structure (“3xU9_1 (G5),” diamonds). A negative control, in which no RNA was provided to the HEK293 cells, was included as well (bottom flatline of graph). FIG. 3 also includes a table comparing the GFP expression level achieved by the “3xU9_1 (G5)” and “CVB3 (GO)” construct as compared to the “Cap1 -A100” construct.

[0239] FIG. 4A is a schematic showing an experimental design for the evaluation of erythropoietin (EPO) expression in BALB / c mice injected intravenously with SM86 / DMG nanoparticles containing one of five different EPO-encoding RNA constructs: (i) a linear RNA construct containing an EPO-encoding open reading frame and a 5’ Cap1 structure (“Cap1 -A100,” also referred to as “GO Cap1 ”); (ii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ triphosphate structure (“lin GO CVB3, 5’ PPP”); (iii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ biotin-triazole structure (“lin GO CVB3, 5’ bA”); (iv) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ triphosphate structure (“lin G5 3xU9, 5’ PPP”); and (v) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ biotin-triazole structure (“lin G5 3xU9, 5’ bA”). Mice were injected with the SM86-DMG nanoparticles intravenously and were assessed for serum EPO concentrations after 3 hours, 6 hours, 1 day, and 2 days.

[0240] FIG. 4B is a graph comparing the serum EPO concentrations achieved by each construct.

[0241] FIG. 5 is a graph comparing the secretion of IFN-y-inducible protein 10 (IP10) - an immune response marker - in BALB / c mice injected intravenously with one of five different EPO-encoding RNA constructs in the same experiment as Fig. 4, 6 hours after injection. A vehicle-only arm (“buffer”) was included as a negative control. Mice were injected with the SM86-DMG nanoparticles intravenously and were subsequently assessed for serum IP10 concentrations.

[0242] FIG. 6A is a graph comparing the expression of luciferase in HeLa cells transfected in the presence of lipofectamine 2000 (L2K) with one of three different luciferase-encoding RNA constructs. The constructs tested were: (i) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ triphosphate structure (“G5 lin 5’ PPP_3xU9”); and (ii) a linear RNA construct containing a luciferaseencoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, the tracts separated from one another by spacers of 18-28 nucleosides in length, and a 5’ triphosphate structure (“G5 lin 5’ PPP_6xU9”); and (iii) a linear RNA construct having the same structure as in (ii), except containing a 5’ Cap1 structure in lieu of a 5’ triphosphate structure (“G5 lin 5’ Cap1_v2.0”).

[0243] FIG. 6B is table comparing the luciferase expression of the constructs tested in FIG. 6A in two different cell types: HeLa cells and Hep3B cells.

[0244] FIG. 7A is a graph comparing the expression of luciferase in HeLa cells that were transfected, in accordance with the methodology described in FIG. 6A, with a circular RNA molecule containing a luciferase-encoding open reading frame. Within each RNA molecule, each instance of uridine was replaced with 1 -methylpseudouridine. In addition to encoding luciferase, the RNA molecule was tethered to one of three proteins by way of MS2 tethering sites within the RNA: (i) LACZ (“t-LACZ”), (ii) eukaryotic translation initiation factor 4 G (“t-elF4G”), or (iii) La protein (“t-La”). Tethering was facilitated by fusing MBP-encoding polypeptide to LACZ(t-Lacz), 4 G (“t-elF4G”), or (iii) La protein (“t-La”).

[0245] FIG. 7B is a graph comparing luciferase expression achieved by linearized versions of the constructs tested in FIG. 7A; in FIG. 7B, each construct contained a 5’ triphosphate structure and a 3’ poly(A) tail in lieu of circularization. Notably, the data shown in FIGS. 7A and 7B represent the first instance of successful translation of an RNA without a cap, particularly one in which all uridine nucleosides have been replaced with 1 -methylpseudouridine nucleosides. Taken together, these data demonstrate that IRES elements of the disclosure are capable of effectuating ribosomal recruitment - and successful protein translation - in a manner that is independent of the presence or absence of a 5’ cap. Moreover, these data show that IRES elements of the disclosure can effectuate ribosomal recruitment and successful protein translation in a manner that is not dependent upon the presence or absence of a chemical modification of one of the nucleosides of the nucleic acid molecule, particularly because the interaction that mediates the recruitment of the ribosome (i.e. , the interaction between the MS2 tethering site and the MS2-binding protein) is not affected by the presence or absence of a nucleoside modification (in this instance, 1 -methylpseudouridrine).

[0246] FIG. 8A is a graph comparing the expression of mGreenLantern protein in HeLa cells that were transfected with mGreenLantern-encoding RNA constructs in the presence of L2K. Three different RNA constructs were tested: (i) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, the tracts separated from one another by spacers of 18-28 nucleosides in length, and a 5’ triphosphate structure (“G5 lin 5’ Cap1_v2.0”); (ii) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1 , and a 5’ triphosphate structure (“GO lin 5’ PPP_1xApt17”); and (iii) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1 , with all U residues replaced with N- methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_1xApt17”). FIG. 8B is a graph comparing the expression of luciferase in HeLa cells that were transfected with luciferase-encoding RNA constructs in the presence of L2K. Five different RNA constructs were tested: (i) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, and a 5’ Cap1 structure (“G5 lin 5’ Cap1_v1.1 ”); (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_3xU9”); (iii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_6xU9”); (iv) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1 , with all U residues replaced with N- methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_1xApt17”); and (v) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six repeats of the nucleic acid sequence of SEQ ID NO: 1 , with all U residues replaced with N- methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_6xApt17”).

[0247] FIG. 9A is a graph comparing the expression of luciferase in HeLa cells transfected with one of eight different luciferase-encoding RNA constructs: (i) a linear RNA construct containing a luciferaseencoding open reading frame and a 5’ Cap1 structure (“C1 ”); (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous uridine residues, and a 5’-triphosphate structure (“v1 .1 ”); (iii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’-triphosphate structure (“v2.0 (G5)”); (iv) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous uridine residues, and a 5’-triphosphate structure (“v2.0 (GO)”); (v) a linear RNA construct containing a luciferaseencoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds La protein, with all uridine residues in the polynucleotide tract replaced by 1 -methylpseudouridine residues, and a 5’-triphosphate structure (“1xPDCD4 La (G5)”); (vi) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds La protein, and a 5’-triphosphate structure (“1xPDCD4 La (GO)”); (vii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds elF4G protein, with all uridine residues in the polynucleotide tract replaced by 1 -methylpseudouridine residues, and a 5’-triphosphate structure (“1xAUAU4 (G5)”); and (viii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds elF4G protein, and a 5’-triphosphate structure (“1xAUAU4 (GO)”).

[0248] FIG. 9B provides a table reporting the luciferase expression achieved by certain of the constructs shown in FIG. 9A as a percentage of the luciferase expression achieved by the “Cap1 ” construct.

[0249] FIG. 10A is a graph comparing the expression of fluorescent protein in HeLa cells transfected with one of two different fluorescent-protein-encoding RNA constructs. The constructs tested were: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of GGGAAAUAAGAGAGAAAAGAAGAGuAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 3, “UTR1 ”), and a GFP-encoding open reading frame fused to a degron domain and; and (ii) an RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of GGGAAAUUUUUUUUUGAUAUUAUAAGAGUUUUUUUUUGAUAUUAAGAAAAUUUUUUUUUGAUAUU AGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 4, “UTR2”), and a GFP- encoding open reading frame fused to a degron domain. A negative control (“no RNA”) was included for comparison purposes.

[0250] FIG. 10B is a graph demonstrating the results of an experiment conducted as outlined in FIG. 10A, but in HEK293 cells in lieu of HeLa cells.

[0251] FIG. 10C provides a set of graphs comparing the expression of luciferase in BALB / c mice transfected with one of two different luciferase-encoding RNA constructs: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR1 ” (as in FIGS. 10A and 10B), and a luciferase-encoding open reading frame; and (ii) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR2” (as in FIGS. 10A and 10B), and a luciferase-encoding open reading frame. A negative control (“PBS”) was included for comparison purposes.

[0252] FIG. 10D provides a set of graphs comparing the expression of erythropoietin in BALB / c mice transfected with one of two different erythropoietin-encoding RNA constructs: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR1 ” (as in FIGS. 10A and 10B), and an erythropoietin-encoding open reading frame; and (ii) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR2” (as in FIGS. 10A and 10B), and an erythropoietin-encoding open reading frame. A negative control (“PBS”) was included for comparison purposes.

[0253] FIG. 11 A is a graph comparing the expression of luciferase in Hep3b cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements (e.g., see the x-axis). The sequence of these elements is provided in Table 14 (e.g., see Example 7). The three bars for each element represents, from left to right, luciferase expression measured at 2 hour, 5 hours, and 24 hours post-transfection. Luminescence expression data shows that 5’ hulRES9 (e.g., SEQ ID NO: 173) has the highest luciferase expression. This is an improvement over 5’ 3xU9 (SEQ ID NO: 202).

[0254] FIG. 11 B is a graph comparing the expression of luciferase in HeLa cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements. The sequence of these elements is provided in Table 14 (e.g., see Example 7). The three bars for each element represents, from left to right, luciferase expression measured at 2 hour, 5 hours, and 24 hours post-transfection. Luminescence expression data shows that 5’ 6xU9 (SEQ ID NO: 203) has the highest luciferase expression and 5’ hulRES9 (e.g., SEQ ID NO: 173) has the next highest luciferase expression. This is an improvement over 5’ 3xU9 (SEQ ID NO: 202).

[0255] FIG. 12 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 15 (e.g., see Example 7). The green integrated density of the inlet graph shows that 5’ Shape 1 (SEQ ID NO: 174) and 5’ Shape 3 (SEQ ID NO: 176) show the highest expression, well above 5’ 6xU9 (SEQ ID NO: 203). Further, 5’ Shape 2 (SEQ ID NO: 175) outperforms 5’ Shape 4 (SEQ ID NO: 177) and 5’ 6xU9.

[0256] FIG. 13 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 15 (e.g., see Example 7). The green integrated density of the inlet graph shows that 5’ Shape 2 (SEQ ID NO: 175) outperforms 5’ Shape 4 (SEQ ID NO: 177) and 5’ 6xU9 (SEQ ID NO: 203).

[0257] FIG. 14 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 15 (e.g., see Example 7). The green integrated density of the inlet graph shows that 5’ Shape 5 (SEQ ID NO: 178) and 5’ Shape 8 (SEQ ID NO: 180) perform similarly to 5’ 3xU9 (SEQ ID NO: 202).

[0258] FIG. 15 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 15 (e.g., see Example 7). The green integrated density reveals that 5’ Shape 1 (SEQ ID NO: 174), 5’ Shape 2 (SEQ ID NO: 175), 5’ Shape 3 (SEQ ID NO: 176), and 5’ Shape 4 (SEQ ID NO: 177) outperform 5’ 6xU9 (SEQ ID NO: 203) and 5’ 3xU9 (SEQ ID NO: 202), which outperform 5’ Shape 7 (SEQ ID NO: 179) and 5’ Shape 8 (SEQ ID NO: 180). 5’ Shape 9 (SEQ ID NO: 181 ) performs similar to baseline and uncapped control.

[0259] FIG. 16 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 15 (e.g., see Example 7). The green integrated density of the two inlet graphs shows that 5’ Shape 5 (SEQ ID NO: 178) and 5’ Shape 8 (SEQ ID NO: 180) have similar performance, while 5’ Shape 9 (SEQ ID NO: 181 ) and 5’ Shape 7 (SEQ ID NO: 179) are expressing closer to baseline.

[0260] FIG. 17 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 18 (e.g., see Example 7). The green integrated density of the two inlet graphs shows that 5’ Apt17+5xU9 (SEQ ID NO: 183 or SEQ ID NO: 184) constructs and 5’ 5xU9+CCND1 (SEQ ID NO: 182) constructs have an increased Cmax, suggesting that combining different IRES elements disclosed herein can increase gene expression.

[0261] FIG. 18 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 18 (e.g., see Example 7). The green integrated density data shows that 5’ 1XApt17 substantially outperforms 5’ 1xAUAU4 (SEQ ID NO: 194) and 5’ 1xPDCD4 (SEQ ID NO: 198), with the later having similar temporal expression and Cmax values.

[0262] FIG. 19 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 18 (e.g., see Example 7). The green integrated density data shows that constructs with 5’ Apt17+5xU9 (SEQ ID NO: 183 or SEQ ID NO: 184) and constructs with 5’ 5xU9+CCND1 (SEQ ID NO: 182) have similar expression to constructs with 5’ 6xU9 (SEQ ID NO: 203). This data suggests that combining different IRES elements disclosed herein can increase gene expression.

[0263] FIG. 20 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 18 (e.g., see Example 7). The green integrated density data shows that constructs with elements 5’ 6xPDCD4 (SEQ ID NO: 198) have appreciable expression. Also, constructs with element 5’ 1xApt17 (SEQ ID NO: 193) show expression above background.

[0264] FIG. 21 A is a bar graph comparing the expression of luciferase in THP-1 cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements. The sequence of these elements is provided in Table 18 (e.g., see Example 7). Luminescence expression data shows that 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 205), and 5’ 6xU9_v5 (SEQ ID NO: 205) have the highest luciferase expression.

[0265] FIG. 21 B is the same bar graph as in FIG. 21 A, but without the capped control and the uncapped control (to better show the Y axis values).

[0266] FIG. 22A is a bar graph comparing the expression of luciferase in Hep3b cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements. The sequence of these elements is provided in Table 18 (e.g., see Example 7). The two bars for each element represents, from left to right, luciferase expression measured at 4 and 24 hours post-transfection. Luminescence expression data shows that 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 204), and 5’ 6xU9_v5 (SEQ ID NO: 205) have the highest luciferase expression.

[0267] FIG. 22B is the same bar graph as in FIG. 22A, but without the capped control and the uncapped control (to better show the Y axis values).

[0268] FIG. 23A is a bar graph comparing the expression of luciferase in HeLa cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements. The sequence of these elements is provided in Table 18 (e.g., see Example 7). The two bars for each element represents, from left to right, luciferase expression measured at 4 and 24 hours post-transfection. Luminescence expression data shows that 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 204), 5’ 6xU9_v5 (SEQ ID NO: 205), and 5’ 6xU9_v1 (SEQ ID NO: 187) have the highest luciferase expression.

[0269] FIG. 23B is the same bar graph as in FIG. 23A, but without the capped control and the uncapped control (to better show the Y axis values).

[0270] DETAILED DESCRIPTION

[0271] The present disclosure provides nucleic acid molecules (e.g., RNA molecules, such as linear or circular RNA molecules) that are capable of recruiting and binding to ribosomes without the need for a 5’ cap structure. Nucleic acid molecules often use 5’ cap structures as a means for promoting ribosomal binding and, ultimately, open reading frame translation. The presence of a 5’ cap that is susceptible to decapping and subsequent degradation of the RNA, may preclude the possibility of instead having chemical modifications that extend the molecule’s half-life. The present disclosure addresses this problem by providing means for nucleic acid molecules to recruit and bind ribosome without the need for a 5’ cap structure, thus providing the advantage of simultaneously allowing the nucleic acid molecules to be translatable and to be modified in ways that mitigate nucleolytic degradation.

[0272] Examples of nucleic acid modifications that reduce or avoid nucleolytic degradation, but that also preclude the inclusion of a 5’ cap, include (i) the presence of 5’ chemical moieties that restrict the access of an exonuclease to the nucleic acid molecule, as well as (ii) circularization of a nucleic acid molecule, which removes 5’ and 3’ ends altogether. Both of these types of modifications provide the benefit of reducing or eliminating exonucleolytic cleavage by way of either chemically protecting, or removing, the 5’ and 3’ ends to which an exonuclease would bind. However, because these types of modifications alter or eliminate the 5’ end, they preclude the inclusion of a 5’ cap. The present disclosure features internal ribosome entry sites (IRESs) that can be incorporated into nucleic acids and that promote ribosome recruitment and protein translation in the absence of a 5’ cap.

[0273] Importantly, not only do the presently described IRES elements promote cap-independent translation, thereby permitting half-life-extending modifications such as 573’ blocking and circularization, the present IRES elements are also compatible with chemically modified uridine nucleosides, particularly 1 -methylpseudouridine nucleosides. This is a significant departure from known IRES elements, which are often structure-based and are expected to be incompatible with chemically modified nucleosides. The use of modified uridine residues, particularly 1 -methylpseudouridine, provides the benefit of engendering a nucleic acid molecule that is substantially less immunogenic than a corresponding nucleic acid molecule lacking this modification. Accordingly, IRES elements that are compatible with 1 - methylpseudoridine are particularly advantageous.

[0274] The IRES of the disclosure may recruit translation tractor and / or ribosomes to the nucleic acids described herein in order to promote translation. For example, IRES of the disclosure (e.g., SEQ ID NOs: 173-205) may bind to translation initiation factors, thereby recruiting the molecular machinery needed for initiating translation of the nucleic acid. In another example, IRES of the disclosure (e.g., SEQ ID NOs: 185, 190, and 199-201 ) may bind directly to ribosomal subunits (e.g., eukaryotic 60S or 40S subunits) by, e.g., hybridizing directly to ribosomal RNA (rRNA), such as 25S, 28S, 18S, 5.8S, and / or 5S rRNA.

[0275] Thus, the IRES elements described herein thus provide multiple benefits: not only do the present IRES elements allow the types of half-life-extending nucleic acid modifications that would preclude a 5’ cap group, but they also function with a uridine modification that significantly suppresses immunogenicity of the nucleic acid molecule. Furthermore, by binding to ribosomes or hybridizing directly with ribosomal RNA, IRES’ of the disclosure provide the advantage of fast and efficient protein expression while reducing energy expenditure on the cell.

[0276] The sections that follow describe exemplary IRES elements in further detail, as well as the various types of nucleic acid modifications that can be used in conjunction with the IRES elements of the disclosure.

[0277] 1. Internal Ribosome Entry Sites

[0278] Exemplary nucleic acids of the disclosure are those that contain:

[0279] (i) an internal ribosome entry site (IRES) comprising one or more polynucleotide tracts enriched in uridine or a modified uridine; operably linked to (ii) an open reading frame encoding a polypeptide.

[0280] In some embodiments, the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine (e.g.. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the polynucleotide tracts enriched in uridine or a modified uridine). The IRES may, for example, comprise from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine. In certain embodiments, the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.

[0281] In some embodiments, at least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine (e.g.. 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be uridine or a modified uridine). In some embodiments, at least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

[0282] In exemplary nucleic acids of the disclosure, each polynucleotide tract, independently, is from 5 to 20 nucleosides in length (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length). In some embodiments, each polynucleotide tract, independently, is from 5 to 19 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 18 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 17 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 16 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 10 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 10 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 10 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length.

[0283] In exemplary nucleic acids of the disclosure, each polynucleotide tract, independently, comprises from 5 to 20 contiguous uridine or modified uridine nucleosides (e.g. 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 uridine or modified uridine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 14 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 13 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 12 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 11 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 10 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 14 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 13 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 12 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 11 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 10 contiguous uridine or modified uridine nucleosides.

[0284] In exemplary nucleic acids of the disclosure, each polynucleotide tract comprises at least 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract comprises 9 contiguous uridine or modified uridine nucleosides.

[0285] In exemplary nucleic acids of the disclosure, one or more (or all) of the polynucleotide tracts are enriched in modified uridine. In some embodiments, the modified uridine is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5- methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine is 1 -methylpseudouridine.

[0286] In exemplary nucleic acids of the disclosure, the IRES is located within a noncoding region of the nucleic acid, such as a 5’ untranslated region (UTR) that is operably linked to the open reading frame. In some embodiments, the open reading frame is further operably linked to a 3’ UTR.

[0287] In exemplary nucleic acids of the disclosure, the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides (e.g., 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleosides). In some embodiments, each of the spacers, independently, comprises from 10 to 40 nucleosides (e.g., 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides). In some embodiments, each of the spacers, independently, comprises 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.

[0288] In exemplary nucleic acids of the disclosure, the IRES is represented by the formula: [(N)n - (U')m]p wherein: each N is, independently, any nucleoside residue; each U' is, independently, uridine or a modified uridine; each n is, independently, an integer from 1 to 100 e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14,

[0289] 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100); each m is, independently, an integer from 2 to 15 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, or

[0290] 15); and p is an integer from 2 to 20 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20).

[0291] In exemplary nucleic acids of the disclosure, N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.

[0292] In exemplary nucleic acids of the disclosure, the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5- methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.

[0293] In exemplary nucleic acids of the disclosure, the modified cytidine of N is 5-aza-cytidine, 6-aza- cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5- methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 - methyl-pseudoisocytidine, 4-thio- 1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza- pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio- zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 - methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4- acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O- trimethyl-cytidine, 1 -thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.

[0294] In exemplary nucleic acids of the disclosure, the modified adenosine of N is 2-amino-purine, 2, 6- diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7- deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7- deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6- methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6- isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O- trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thioadenosine, 8-azido-adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19- amino-pentaoxanonadecyl)-adenosine.

[0295] In exemplary nucleic acids of the disclosure, the modified guanosine of N is inosine, 1 -methylinosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl- queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8- aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl- guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2- methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl- guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O- methyl-guanosine, 2'-O-methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.

[0296] In exemplary nucleic acids of the disclosure, the modified uridine of U’ is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5- methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.

[0297] In exemplary nucleic acids of the disclosure, each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 1 1 . In some embodiments, each m is 9. In some embodiments, p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6.

[0298] In exemplary nucleic acids of the disclosure, the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular. In some embodiments, the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.

[0299] In exemplary nucleic acids of the disclosure, the modified uridine of the open reading frame is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine of the open reading frame is 1 -methylpseudouridine.

[0300] In exemplary nucleic acids of the disclosure, the modified cytidine of N is 5-aza-cytidine, 6-aza- cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5- methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 - methyl-pseudoisocytidine, 4-thio- 1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza- pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio- zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 - methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4- acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O- trimethyl-cytidine, 1 -thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.

[0301] In exemplary nucleic acids of the disclosure, the modified adenosine of N is 2-amino-purine, 2, 6- diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7- deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7- deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6- methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6- isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O- trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thioadenosine, 8-azido-adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19- amino-pentaoxanonadecyl)-adenosine.

[0302] In exemplary nucleic acids of the disclosure, the modified guanosine of N is inosine, 1 -methylinosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl- queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8- aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl- guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2- methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl- guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O- methyl-guanosine, 2'-O-methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.

[0303] In exemplary nucleic acids of the disclosure, the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.

[0304] In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES presented in Table 2 (e.g., any one of IRES 1 to IRES 22).

[0305] In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 70% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 91 % sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 92% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 93% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 94% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 96% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 97% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 98% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 99% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with 100% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.

[0306] Table 2. Exemplary IRES sequences

[0307] In exemplary nucleic acids of the disclosure, the nucleic acid does not comprise a 5’ cap.

[0308] In another aspect, the disclosure provides a nucleic acid comprising:

[0309] (i) (a) an IRES comprising one or more polynucleotides that specifically bind a RNA binding protein, a translation initiation factor (for example, eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2, also referred to as Dap5), eukaryotic translation initiation factor 3 (elF3)), or IRES trans-acting factors (ITAfs), such as a polypyrimidine tract-binding protein (PTBP); or (b) a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as La) fused to an RNA-binding protein; operably linked to

[0310] (ii) an open reading frame encoding a polypeptide.

[0311] In exemplary nucleic acids of the disclosure, the one or more polynucleotides specifically bind elF4G. In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ). In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1 ). In some embodiments, each of the one or more polynucleotides has the nucleic acid sequence of SEQ ID NO: 1 . In some embodiments, the nucleic acid does not comprise a 5’ cap.

[0312] In a further aspect, the disclosure provides a polypeptide expression system comprising:

[0313] (i) the nucleic acid of the foregoing aspect (or any of the above embodiments thereof); and

[0314] (ii) a nucleic acid comprising an open reading frame that encodes elF4G, La protein, or a functional variant thereof.

[0315] In some embodiments, the nucleic acid of (i) and the nucleic acid of (ii) are separate molecules.

[0316] In some embodiments, the nucleic acid of (ii) comprises, from 5’ to 3’:

[0317] (i) a 5’ UTR;

[0318] (ii) the open reading frame encoding the elF4G, La protein, or functional variant thereof; and (iii) a 3’ UTR.

[0319] In some embodiments, the nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR.

[0320] In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES presented in Table 3 (e.g., any one of IRES 23 to IRES 33).

[0321] In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 70% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 91% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 92% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 93% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 94% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 96% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 97% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 98% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 99% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with 100% sequence identity to any one of SEQ ID NOs: 191 -201 . Table 3. Exemplary translation initiation elements 2. Chemically Modified Nucleic Acids

[0322] The IRES elements of the disclosure, as well as the open reading frame, UTR, and other elements of the nucleic acid constructs described herein, may have one or more chemical modifications. According to Aduri et al., (Aduri, R. et al., AMBER force field parameters for the naturally occurring modified nucleosides in RNA. Journal of Chemical Theory and Computation. 2006. 3(4):1464-75), there are 107 naturally occurring nucleosides, including 1 -methyladenosine, 2-methylthio-N6-hydroxynorvalyl carbamoyladenosine, 2-methyladenosine, 2-O-ribosylphosphate adenosine, N6-methyl-N6- threonylcarbamoyladenosine, N6-acetyladenosine, N6-glycinylcarbamoyladenosine, N6- isopentenyladenosine, N6-methyladenosine, N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6-hydroxynorvalylcarbamoyladenosine, 1 ,2-0- dimethyladenosine, N6,2-O-dimethyladenosine, 2-O-methyladenosine, N6,N6,O-2-trimethyladenosine, 2- methylthio-N6-(cis-hydroxyisopentenyl) adenosine, 2-methylthio-N6-methyladenosine, 2-methylthio-N6- isopentenyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, 2-thiocytidine, 3-methylcytidine , N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-methylcytidine, 5-hydroxymethylcytidine, lysidine, N4-acetyl-2-O-methylcytidine, 5-formyl-2-O-methylcytidine, 5,2-O-dimethylcytidine, 2-0- methylcytidine, N4,2-O-dimethylcytidine, N4,N4,2-O-trimethylcytidine, 1 -methylguanosine, N2,7- dimethylguanosine, N2-methylguanosine, 2-O-ribosylphosphate guanosine, 7-methylguanosine, under modified hydroxywybutosine, 7-aminomethyl-7-deazaguanosine, 7-cyano-7-deazaguanosine, N2,N2- dimethylguanosine, 4-demethylwyosine, epoxyqueuosine, hydroxywybutosine, isowyosine, N2, 7,2-0- trimethylguanosine, N2,2-O-dimethylguanosine, 1 ,2-O-dimethylguanosine, 2-O-methylguanosine, N2,N2,2-O-trimethylguanosine, N2,N2,7-trimethylguanosine, peroxywybutosine, galactosyl-queuosine, mannosyl-queuosine, queuosine, archaeosine, wybutosine, methylwyosine, wyosine, 2-thiouridine, 3-(3- amino-3-carboxypropyl)uridine, 3-methyluridine, 4-thiouridine, 5-methyl-2-thiouridine, 5- methylaminomethyluridine, 5-carboxymethyluridine, 5-carboxymethylaminomethyluridine, 5- hydroxyuridine, 5-methyluridine, 5-taurinomethyluridine, 5-carbamoylmethyluridine, 5- (carboxyhydroxymethyl)uridine methyl ester, dihydrouridine, 5-methyldihydrouridine, 5- methylaminomethyl-2-thiouridine, 5-(carboxyhydroxymethyl)uridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine, 3,2-O-dimethyluridine, 5-carboxymethylaminomethyl-2-O- methyluridine, 5-carbamoylmethyl-2-O-methyluridine, 5-methoxycarbonylmethyl-2-O-methyluridine, 5- (isopentenylaminomethyl)-2-O-methyluridine, 5,2-O-dimethyluridine, 2-0-methyluridine, 2-thio-2-O- methyluridine, uridine 5-oxyacetic acid, 5-methoxycarbonylmethyluridine, uridine 5-oxyacetic acid methyl ester, 5-methoxyuridine, 5-aminomethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-thiouridine, 5- methylaminomethyl-2-selenouridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-taurinomethyl-2- thiouridine, pseudouridine, 1 -methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 1 -methylpseudouridine, 3-methylpseudouridine, 2-O-methylpseudouridine, inosine, 1 -methylinosine, 1 ,2-O-dimethylinosine, and 2-O-methylinosine. Each of these may be components of nucleic acids of the present invention. a. Nucleosides containing modified sugars

[0323] The alternative nucleosides and nucleotides (e.g., building block molecules), which may be incorporated into a polynucleotide (e.g., RNA or mRNA, as described herein), can be altered on the sugar of the ribonucleic acid. For example, the 2' hydroxyl group (OH) can be modified or replaced with a number of different substituents. Exemplary substitutions at the 2'-position include, but are not limited to, H, halo, optionally substituted C1-6alkyl; optionally substituted C1-6alkoxy; optionally substituted C6-1 0aryloxy; optionally substituted C3-8cycloalkyl; optionally substituted C3-8cycloalkoxy; optionally substituted C6-10aryloxy; optionally substituted C6-1 0aryl- C1-6alkoxy, optionally substituted C1-12(heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), - O(CH2CH2O)nCH2CH2OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20); “locked” nucleic acids (LNA) in which the 2'-hydroxyl is connected by a C1-6alkylene or C1-6heteroalkylene bridge to the 4’-carbon of the same ribose sugar, where exemplary bridges included methylene, propylene, ether, or amino bridges; aminoalkyl, as defined herein; aminoalkoxy, as defined herein; amino as defined herein; and amino acid, as defined herein

[0324] Generally, RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen. Exemplary, non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.g., tricyclo; and “unlocked” forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by glycol units attached to phosphodiester bonds), threose nucleic acid (TNA, where ribose is replace with a-L-threofuranosyl- (3'->2')), and peptide nucleic acid (PNA, where 2-amino-ethyl-glycine linkages replace the ribose and phosphodiester backbone). The sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a polynucleotide molecule can include nucleotides containing, e.g., arabinose, as the sugar. b. Alterations on the nucleobase

[0325] The present disclosure provides for alternative nucleosides and nucleotides. As described herein “nucleoside” is defined as a compound containing a sugar molecule (e.g., a pentose or ribose) or derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). As described herein, “nucleotide” is defined as a nucleoside including a phosphate group.

[0326] Exemplary non-limiting alterations include an amino group, a thiol group, an alkyl group, a halo group, or any described herein. The alternative nucleotides may by synthesized by any useful method, as described herein (e.g., chemically, enzymatically, or recombinantly to include one or more alternative or alternative nucleosides).

[0327] In some embodiments, a nucleic acid of the invention (e.g., an mRNA or an oligonucleotide) includes one or more 2’-OMe nucleotides, 2’-methoxyethyl nucleotides (2’-MOE nucleotides), 2’-F nucleotide, 2’-NH2nucleotide, 2’fluoroarabino nucleotides (FANA nucleotides), locked nucleic acid nucleotides (LNA nucleotides), or 4’-S nucleotides. The alternative nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, and guanosine-cytosine base pairs, but also base pairs formed between nucleotides and / or alternative nucleotides including non-standard or alternative bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures. One example of such non-standard base pairing is the base pairing between the alternative nucleotide inosine and adenine, cytosine, or uracil.

[0328] The alternative nucleosides and nucleotides can include an alternative nucleobase. Examples of nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine, and uracil. Examples of nucleobase found in DNA include, but are not limited to, adenine, guanine, cytosine, and thymine. These nucleobases can be altered or wholly replaced to provide polynucleotide molecules having enhanced properties (e.g., resistance to nucleases and stability), and these properties may manifest through disruption of the binding of a major groove binding partner.

[0329] In some embodiments, the alternative nucleobase is an alternative uracil. Exemplary nucleobases and nucleosides having an alternative uracil include pseudouridine (ip), pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridineor 5-bromo-uridine), 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), uridine 5- oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl- uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2- thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 5- methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5- carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5- carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1 -propynyl-pseudouridine, 5- taurinomethyl-uridine (Tm5U), 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine(Tm5s2U), 1 - taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine (m5U, i.e., having the nucleobase deoxythymine), 1 - methyl-pseudouridine (m1 ψ), 5-methyl-2-thio-uridine (m5s2U), 1 -methyl-4-thio-pseudouridine (m1s4ip), 4- thio-1 -methyl-pseudouridine, 3-methyl-pseudouridine (m3ip), 2-thio-1 -methyl-pseudouridine, 1 -methyl-1 - deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2- methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), 1 -methyl-3-(3-amino-3- carboxypropyl)pseudouridine (acp3ip), 5-(isopentenylaminomethyl)uridine (inm5U), 5- (isopentenylaminomethyl)-2-thio-uridine (inm5s2U), a-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O- dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine (ipm), 2-thio-2'-O-methyl-uridine (s2Um), 5- methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Um), 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, and 5-[3-(1 -E- propenylamino)uridine. In preferred embodiments, the nucleic acid is modified to contain 1 -methylpseudouridine (m1ψ) in lieu of uridine at each instance.

[0330] In some embodiments, the alternative nucleobase is an alternative cytosine. Exemplary nucleobases and nucleosides having an alternative cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), N4-acetyl-cytidine (ac4C), 5-formyl-cytidine (f5C), N4-methyl- cytidine (m4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s2C), 2- thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-th io- 1 -methyl-pseudoisocytidine, 4-th io- 1 -methyl-1 - deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl- zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 -methyl-pseudoisocytidine, lysidine (k2C), a-thio-cytidine, 2'-O- methyl-cytidine (Cm), 5,2'-O-dimethyl-cytidine (m5Cm), N4-acetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O- dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (f5Cm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1 - thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, and 2’-OH-ara-cytidine.

[0331] In some embodiments, the alternative nucleobase is an alternative adenine. Exemplary nucleobases and nucleosides having an alternative adenine include 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6- methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7- deaza-8-aza-2-amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyladenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A), 2-methylthio-N6-methyl- adenosine (ms2m6A), N6-isopentenyl-adenosine (i6A), 2-methylthio-N6-isopentenyl-adenosine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenosine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms2io6A), N6-glycinylcarbamoyl-adenosine (g6A), N6-threonylcarbamoyl-adenosine (t6A), N6-methyl-N6- threonylcarbamoyl-adenosine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenosine (ms2g6A), N6,N6- dimethyl-adenosine (m62A), N6-hydroxynorvalylcarbamoyl-adenosine (hn6A), 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine (ms2hn6A), N6-acetyl-adenosine (ac6A), 7-methyl-adenine, 2- methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine (Am), N6,2'-O- dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1 ,2'-O-dimethyl-adenosine (m1Am), 2'-O-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido- adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, and N6-(19-amino- pentaoxanonadecyl)-adenosine.

[0332] In some embodiments, the alternative nucleobase is an alternative guanine. Exemplary nucleobases and nucleosides having an alternative guanine include inosine (I), 1 -methyl-inosine (m1l), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (02yW), hydroxywybutosine (OhyW), undermodified hydroxywybutosine (OhyW*), 7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQi), archaeosine (G+), 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio- 7-deaza-8-aza-guanosine, 7-methyl-guanosine (m7G), 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6- methoxy-guanosine, 1 -methyl-guanosine (m1G), N2-methyl-guanosine (m2G), N2,N2-dimethyl-guanosine (m22G), N2,7-dimethyl-guanosine (m27G), N2, N2,7-dimethyl-guanosine (m2’2’7G), 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio- guanosine, a-thio-guanosine, 2'-O-methyl-guanosine (Gm), N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1 -methyl-2'-O-methyl-guanosine (m1Gm), N2,7- dimethyl-2'-O-methyl-guanosine (m2’7Gm), 2'-O-methyl-inosine (Im), 1 ,2'-O-dimethyl-inosine (m1lm), 2'-O- ribosylguanosine (phosphate) (Gr(p)) , 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, and 2’-F-guanosine.

[0333] The nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine, or pyrimidine analog. For example, the nucleobase can each be independently selected from adenine, cytosine, guanine, uracil, or hypoxanthine. In some embodiments, the nucleobase can also include, for example, naturally-occurring and synthetic derivatives of a base, including pyrazolo[3,4- d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl, and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7- methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1 ,5-a]1 ,3,5 triazinones, 9-deazapurines, imidazo[4,5-d]pyrazines, thiazolo[4,5-d]pyrimidines, pyrazin-2-ones, 1 ,2,4- triazine, pyridazine; and 1 ,3,5 triazine. When the nucleotides are depicted using the shorthand A, G, C, T or U, each letter refers to the representative base and / or derivatives thereof (e.g., A includes adenine or adenine analogs (e.g., 7-deaza adenine)).

[0334] In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5- methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-trifluoromethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uracil, uracil, 5-hydroxymethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-bromo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-iodo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-methoxy- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-ethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5- phenyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-ethnyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uracil, uracil, N4-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-fluoro-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, N4-acetyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, pseudoisocytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-formyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uracil, uracil, 5-aminoallyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-carboxy-cytosine, and cytosine as the only uracils and cytosines.

[0335] In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-trifluoromethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-hydroxymethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-bromo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-iodo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouracil, uracil, 5-methoxy-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-ethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-phenyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-ethnyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, N4-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouracil, uracil, 5-fluoro-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, N4-acetyl- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, pseudoisocytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl- pseudouracil, uracil, 5-formyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-aminoallyl- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-carboxy-cytosine, and cytosine as the only uracils and cytosines.

[0336] In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5- methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-trifluoromethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uridine, uridine, 5-hydroxymethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynuc...

Claims

CLAIMS1 . A nucleic acid comprising:(i) an internal ribosome entry site (IRES) comprising one or more polynucleotide tracts enriched in uridine or a modified uridine; operably linked to(ii) an open reading frame encoding a polypeptide.

2. The nucleic acid of claim 1 , wherein the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine.

3. The nucleic acid of claim 2, wherein the IRES comprises from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine.

4. The nucleic acid of claim 3, wherein the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.

5. The nucleic acid of claim 4, wherein the IRES comprises 3 of the polynucleotide tracts enriched in uridine or a modified uridine.

6. The nucleic acid of claim 4, wherein the IRES comprises 4 of the polynucleotide tracts enriched in uridine or a modified uridine.

7. The nucleic acid of claim 4, wherein the IRES comprises 5 of the polynucleotide tracts enriched in uridine or a modified uridine.

8. The nucleic acid of claim 4, wherein the IRES comprises 6 of the polynucleotide tracts enriched in uridine or a modified uridine.

9. The nucleic acid of any one of claims 1 -8, wherein at least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

10. The nucleic acid of claim 9, wherein at least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.11 . The nucleic acid of claim 10, wherein at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

12. The nucleic acid of claim 11 , wherein at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

13. The nucleic acid of claim 12, wherein at least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

14. The nucleic acid of claim 13, wherein at least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

15. The nucleic acid of claim 14, wherein all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine, preferably wherein all of the nucleosides in each of the polynucleotide tracts is a modified uridine.

16. The nucleic acid of any one of claims 1 -15, wherein each polynucleotide tract, independently, is from 5 to 20 nucleosides in length.

17. The nucleic acid of claim 16, wherein each polynucleotide tract, independently, is from 6 to 15 nucleosides in length.

18. The nucleic acid of claim 17, wherein each polynucleotide tract, independently, is from 7 to 11 nucleosides in length.

19. The nucleic acid of claim 18, wherein each polynucleotide tract is 9 nucleosides in length.

20. The nucleic acid of any one of claims 1 -19, wherein each polynucleotide tract, independently, comprises from 5 to 20 contiguous uridine or modified uridine nucleosides.21 . The nucleic acid of claim 20, wherein each polynucleotide tract, independently, comprises from 6 to 15 contiguous uridine or modified uridine nucleosides.

22. The nucleic acid of claim 21 , wherein each polynucleotide tract, independently, comprises from 7 to 11 contiguous uridine or modified uridine nucleosides.

23. The nucleic acid of any one of claims 1 -22, wherein each polynucleotide tract comprises at least 9 contiguous uridine or modified uridine nucleosides.

24. The nucleic acid of claim 23, wherein each polynucleotide tract comprises 9 contiguous uridine or modified uridine nucleosides.

25. The nucleic acid of any one of claims 1 -24, wherein each polynucleotide tract is enriched in the modified uridine.

26. The nucleic acid of any one of claims 1 -25, wherein the modified uridine is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.

27. The nucleic acid of claim 26, wherein the modified uridine is 1 -methylpseudouridine.

28. The nucleic acid of any one of claims 1 -27, wherein the IRES is located within a noncoding region of the nucleic acid (e.g., a 5’ untranslated region (UTR)) that is operably linked to the open reading frame.

29. The nucleic acid of claim 28, wherein the open reading frame is further operably linked to a 3’ UTR.

30. The nucleic acid of any one of claims 1 -29, wherein the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides.31 . The nucleic acid of claim 30, wherein each of the spacers, independently, comprises from 10 to 40 nucleosides.

32. The nucleic acid of claim 31 , wherein each of the spacers, independently, comprises 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.

33. The nucleic acid of any one of claims 1 -32, wherein the IRES is represented by the formula:[(N)n - ( U')m]p wherein:each A / is, independently, any nucleoside residue; each U' is, independently, uridine or a modified uridine; each n is, independently, an integer from 1 to 100; each m is, independently, an integer from 2 to 15; and p is an integer from 2 to 20.

34. The nucleic acid of claim 33, wherein each N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.

35. The nucleic acid of claim 34, wherein each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.

36. The nucleic acid of claim 34 or 35, wherein the modified uridine of N is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.

37. The nucleic acid of claim 36, wherein the modified uridine of N is 1 -methylpseudouridine.

38. The nucleic acid of any one of claims 34, 36, and 37, wherein the modified cytidine of N is 5- aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4- thio-pseudoisocytidine, 4-thio-1 -methyl-pseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 - methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, 4-methoxy-1 -methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl- cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 -thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara- cytidine.

39. The nucleic acid of any one of claims 34 and 36-38, wherein the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8- azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2- amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2- methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2- methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O- trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thioadenosine, 8-azido-adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19- amino-pentaoxanonadecyl)-adenosine.

40. The nucleic acid of any one of claims 34 and 36-39, wherein the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl- queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8- aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl- guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O-methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O- ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.41 . The nucleic acid of any one of claims 33-40, wherein the modified uridine of U’ is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.

42. The nucleic acid of claim 41 , wherein the modified uridine of U’ is 1 -methylpseudouridine.

43. The nucleic acid of any one of claims 33-42, wherein each n is, independently, an integer from 10 to 40.

44. The nucleic acid of claim 43, wherein each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38.

45. The nucleic acid of any one of claims 33-43, wherein each m is, independently, an integer from 2 to 15.

46. The nucleic acid of claim 45, wherein each m is, independently, an integer from 7 to 1 1 .

47. The nucleic acid of claim 46, wherein each m is 9.

48. The nucleic acid of any one of claims 33-47, wherein p is an integer from 2 to 10.

49. The nucleic acid of claim 48, wherein p is an integer from 3 to 6, optionally wherein p is 3 or6.

50. The nucleic acid of any one of claims 1 -49, wherein the nucleic acid is RNA.51 . The nucleic acid of any one of claims 1 -50, wherein the nucleic acid is linear.

52. The nucleic acid of any one of claims 1 -50, wherein the nucleic acid is circular.

53. The nucleic acid of any one of claims 1 -52, wherein the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.

54. The nucleic acid of claim 53, wherein the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.

55. The nucleic acid of claim 53 or 54, wherein the modified uridine of the open reading frame is1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio- 5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine,2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.

56. The nucleic acid of claim 55, wherein the modified uridine of the open reading frame is 1 - methylpseudouridine.

57. The nucleic acid of any one of claims 53, 55, and 56, wherein the modified cytidine of N is 5- aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl- pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methyl-pseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 - methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, 4-methoxy-1 -methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl- cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 -thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara- cytidine.

58. The nucleic acid of any one of claims 53 and 55-57, wherein the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8- azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2- amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2- methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2- methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O- trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thioadenosine, 8-azido-adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19- amino-pentaoxanonadecyl)-adenosine.

59. The nucleic acid of any one of claims 53 and 55-58, wherein the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl- queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8- aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl- guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O-methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O- ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.

60. The nucleic acid of any one of claims 1 -59, wherein the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membranebound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.61 . The nucleic acid of any one of claims 1 -60, wherein the nucleic acid does not comprise a 5’ cap.

62. The nucleic acid of any one of claims 1 -51 and 53-60, wherein the nucleic acid comprises a 5’ cap.

63. The nucleic acid of any one of claims 1 -62, wherein the nucleic acid comprises a nucleotide sequence with at least 75% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.

64. The nucleic acid of claim 63, wherein the nucleic acid comprises a nucleotide sequence with at least 80% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.

65. The nucleic acid of claim 64, wherein the nucleic acid comprises a nucleotide sequence with at least 85% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.

66. The nucleic acid of claim 65, wherein the nucleic acid comprises a nucleotide sequence with at least 90% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.

67. The nucleic acid of claim 66, wherein the nucleic acid comprises a nucleotide sequence with at least 95% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.

68. The nucleic acid of claim 67, wherein the nucleic acid comprises the nucleotide sequence of any one of SEQ ID NOs: 173-190 and 202-205.

69. A nucleic acid comprising:(i) an IRES comprising one or more polynucleotides that specifically bind a translation initiation factor (e.g., eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2), eukaryotic translation initiation factor 3 (elF3), La protein, or an IRES trans-acting factors (ITAf)), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein; operably linked to(ii) an open reading frame encoding a polypeptide.

70. The nucleic acid of claim 69, wherein the one or more polynucleotides specifically bind elF4G.71 . The nucleic acid of claim 70, wherein each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 -methylpseudouridine.

72. The nucleic acid of claim 71 , wherein each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 -methylpseudouridine.

73. The nucleic acid of claim 69, wherein the IRES comprises one or more polynucleotides that specifically bind to a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein, optionally wherein the RNA-binding protein is MS2-binding protein and the one or more polynucleotides comprise one or more MS2 RNA hairpins.

74. The nucleic acid of any one of claims 69-73, wherein the nucleic acid does not comprise a 5’ cap.

75. The nucleic acid of any one of claims 69-73, wherein the nucleic acid comprises a 5’ cap.

76. The nucleic acid of any one of claims 69-75, wherein the nucleic acid comprises a nucleotide sequence with at least 75% percent sequence identity to any one of SEQ ID NO: 191 -201 .

77. The nucleic acid of claim 76, wherein the nucleic acid comprises a nucleotide sequence with at least 80% percent sequence identity to any one of SEQ ID NOs: 191 -201 .

78. The nucleic acid of claim 77, wherein the nucleic acid comprises a nucleotide sequence with at least 85% percent sequence identity to any one of SEQ ID NOs: 191 -201 .

79. The nucleic acid of claim 78, wherein the nucleic acid comprises a nucleotide sequence with at least 90% percent sequence identity to any one of SEQ ID NOs: 191 -201 .

80. The nucleic acid of claim 79, wherein the nucleic acid comprises a nucleotide sequence with at least 95% percent sequence identity to any one of SEQ ID NOs: 191 -201 .81 . The nucleic acid of claim 80, wherein the nucleic acid comprises the nucleotide sequence of any one of SEQ ID NOs: 191 -201 .

82. A nucleic acid comprising:(i) an IRES comprising a nucleotide sequence having complementarity sufficient to hybridize to a region within a ribosomal RNA (rRNA), operably linked to(ii) an open reading frame encoding a polypeptide.

83. The nucleic acid of claim 82, wherein the IRES does not specifically bind to ribosomal protein.

84. The nucleic acid of claim 82 or 83, wherein the nucleotide sequence of the IRES has at least 70% complementarity to the region within the rRNA, optionally wherein the IRES has at least 71 %, 72%, 73%, 74%, 85%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the region within the rRNA.

85. The nucleic acid of claim 84, wherein the nucleotide sequence of the IRES has at least 70% complementarity to at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA.

86. The nucleic acid of claim 82 or 83, wherein the nucleotide sequence of the IRES has at least 75% complementarity to at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA, optionally wherein the nucleic acid sequences has at least 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA.

87. The nucleic acid of any one of claims 82-86, wherein the nucleotide sequence of the IRES comprises at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.

88. The nucleic acid of claim 87, wherein the nucleotide sequence of the IRES comprises from 10 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.

89. The nucleic acid of any claim 88, wherein the nucleotide sequence of the IRES comprises from 12 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.

90. The nucleic acid of claim 89, wherein the nucleotide sequence of the IRES comprises from 15 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.91 . The nucleic acid of claim 90, wherein the nucleotide sequence of the IRES comprises from 18 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.

92. The nucleic acid of claim 91 , wherein the nucleotide sequence of the IRES comprises from 20 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.

93. The nucleic acid of claim 92, wherein the nucleotide sequence of the IRES comprises from 25 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.

94. The nucleic acid of any one of claims 82-93, wherein the nucleotide sequence of the IRES comprises 9 or fewer nucleotide mismatches relative to the region of the rRNA, optionally wherein the antisense strand comprises 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or only 1 mismatch relative to the region of the rRNA.

95. The nucleic acid of any one of claims 82-94, wherein the IRES comprises one or more polynucleotide tracts enriched in uridine or a modified uridine96. The nucleic acid of claim 95, wherein the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine.

97. The nucleic acid of claim 96, wherein the IRES comprises from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine.

98. The nucleic acid of claim 97, wherein the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.

99. The nucleic acid of claim 98, wherein the IRES comprises 3 of the polynucleotide tracts enriched in uridine or a modified uridine.

100. The nucleic acid of claim 98, wherein the IRES comprises 4 of the polynucleotide tracts enriched in uridine or a modified uridine.101 . The nucleic acid of claim 98, wherein the IRES comprises 5 of the polynucleotide tracts enriched in uridine or a modified uridine.

102. The nucleic acid of claim 98, wherein the IRES comprises 6 of the polynucleotide tracts enriched in uridine or a modified uridine.

103. The nucleic acid of any one of claims 95-102, wherein at least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

104. The nucleic acid of claim 103, wherein at least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

105. The nucleic acid of claim 104, wherein at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

106. The nucleic acid of claim 105, wherein at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

107. The nucleic acid of claim 106, wherein at least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

108. The nucleic acid of claim 107, wherein at least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.

109. The nucleic acid of claim 108, wherein all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine, preferably wherein all of the nucleosides in each of the polynucleotide tracts is a modified uridine.

110. The nucleic acid of any one of claims 95-109, wherein each polynucleotide tract, independently, is from 5 to 20 nucleosides in length.

111. The nucleic acid of claim 110, wherein each polynucleotide tract, independently, is from 6 to 15 nucleosides in length.

112. The nucleic acid of claim 111 , wherein each polynucleotide tract, independently, is from 7 to 11 nucleosides in length.

113. The nucleic acid of claim 112, wherein each polynucleotide tract is 9 nucleosides in length.

114. The nucleic acid of any one of claims 95-113, wherein each polynucleotide tract, independently, comprises from 5 to 20 contiguous uridine or modified uridine nucleosides.1 15. The nucleic acid of claim 1 14, wherein each polynucleotide tract, independently, comprises from 6 to 15 contiguous uridine or modified uridine nucleosides.1 16. The nucleic acid of claim 1 15, wherein each polynucleotide tract, independently, comprises from 7 to 1 1 contiguous uridine or modified uridine nucleosides.1 17. The nucleic acid of any one of claims 95-1 16, wherein each polynucleotide tract comprises at least 9 contiguous uridine or modified uridine nucleosides.1 18. The nucleic acid of claim 1 17, wherein each polynucleotide tract comprises 9 contiguous uridine or modified uridine nucleosides.1 19. The nucleic acid of any one of claims 95-1 18, wherein each polynucleotide tract is enriched in the modified uridine.

120. The nucleic acid of any one of claims 95-1 19, wherein the modified uridine is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.121 . The nucleic acid of claim 120, wherein the modified uridine is 1 -methylpseudouridine.

122. The nucleic acid of any one of claims 95-121 , wherein the IRES is located within a noncoding region of the nucleic acid (e.g., a 5’ UTR) that is operably linked to the open reading frame.

123. The nucleic acid of claim 122, wherein the open reading frame is further operably linked to a 3’ UTR.

124. The nucleic acid of any one of claims 95-123, wherein the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides.

125. The nucleic acid of claim 124, wherein each of the spacers, independently, comprises from 10 to 40 nucleosides.

126. The nucleic acid of claim 125, wherein each of the spacers, independently, comprises 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.

127. The nucleic acid of any one of claims 95-126, wherein the IRES comprises a segment having the formula:[(N)n - ( U')m]p wherein: each N is, independently, any nucleoside residue; each U' is, independently, uridine or a modified uridine; each n is, independently, an integer from 1 to 100; each m is, independently, an integer from 2 to 15; and p is an integer from 2 to 20.

128. The nucleic acid of claim 127, wherein each N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.

129. The nucleic acid of claim 128, wherein each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.

130. The nucleic acid of claim 128 or 129, wherein the modified uridine of N is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminornethyl)uridine, 5- (isopentenylaminornethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-rnethoxycarbonylmethyl-2'-O-rnethyl-uridine, 5- carbarnoylmethyl-2'-O-rnethyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylarninomethyl)-2'-O-rnethyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.131 . The nucleic acid of claim 130, wherein the modified uridine of N is 1 -methylpseudouridine.

132. The nucleic acid of any one of claims 128, 130, and 131 , wherein the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl- pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4- thio-pseudoisocytidine, 4-thio-1 -methyl-pseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 - methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, 4-methoxy-1 -methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl- cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 -thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara- cytidine.

133. The nucleic acid of any one of claims 128 and 130-132, wherein the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8- azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2- amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2- methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2- methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thioadenosine, 8-azido-adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19- amino-pentaoxanonadecyl)-adenosine.

134. The nucleic acid of any one of claims 128 and 130-133, wherein the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl- queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8- aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine,1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl- guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O-methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O- ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.

135. The nucleic acid of any one of claims 127-134, wherein the modified uridine of U’ is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine,2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.

136. The nucleic acid of claim 135, wherein the modified uridine of U’ is 1 -methylpseudouridine.

137. The nucleic acid of any one of claims 127-136, wherein each n is, independently, an integer from 10 to 40.

138. The nucleic acid of claim 137, wherein each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38.

139. The nucleic acid of any one of claims 127-137, wherein each m is, independently, an integer from 2 to 15.

140. The nucleic acid of claim 139, wherein each m is, independently, an integer from 7 to 1 1 .141 . The nucleic acid of claim 140, wherein each m is 9.

142. The nucleic acid of any one of claims 127-141 , wherein p is an integer from 2 to 10.

143. The nucleic acid of claim 142, wherein p is an integer from 3 to 6, optionally wherein p is 3 or6.

144. The nucleic acid of any one of claims 95-143, wherein the nucleic acid is RNA.

145. The nucleic acid of any one of claims 95-144, wherein the nucleic acid is linear.

146. The nucleic acid of any one of claims 95-144, wherein the nucleic acid is circular.

147. The nucleic acid of any one of claims 95-146, wherein the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.

148. The nucleic acid of claim 147, wherein the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.

149. The nucleic acid of claim 147 or 148, wherein the modified uridine of the open reading frame is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2- thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy- uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminornethyl)uridine, 5- (isopentenylaminornethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-rnethoxycarbonylmethyl-2'-O-rnethyl-uridine, 5- carbarnoylmethyl-2'-O-rnethyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylarninomethyl)-2'-O-rnethyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.

150. The nucleic acid of claim 149, wherein the modified uridine of the open reading frame is 1 - methylpseudouridine.151 . The nucleic acid of any one of claims 147, 149, and 150, wherein the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl- pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4- thio-pseudoisocytidine, 4-thio-1 -methyl-pseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 - methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, 4-methoxy-1 -methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl- cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 -thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara- cytidine.

152. The nucleic acid of any one of claims 147 and 149-151 , wherein the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8- azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2- amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2- methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2- methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O- trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido-adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19- amino-pentaoxanonadecyl)-adenosine.

153. The nucleic acid of any one of claims 147 and 149-152, wherein the modified guanosine of A / is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl- queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8- aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl- guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O-methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O- ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.

154. The nucleic acid of any one of claims 95-153, wherein the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membranebound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.

155. The nucleic acid of any one of claims 95-154, wherein the nucleic acid does not comprise a 5’ cap.

156. The nucleic acid of any one of claims 95-145 and 147-154, wherein the nucleic acid comprises a 5’ cap.

157. The nucleic acid of any one of claims 82-156, wherein the nucleotide sequence of the IRES comprises at least 75% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190.

158. The nucleic acid of claim 157, wherein the nucleotide sequence of the IRES comprises at least 80% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190.

159. The nucleic acid of claim 158, wherein the nucleotide sequence of the IRES comprises at least 85% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190.

160. The nucleic acid of claim 159, wherein the nucleotide sequence of the IRES has at least 90% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190.161 . The nucleic acid of claim 160, wherein the nucleotide sequence of the IRES has a at least 95% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190, optionally wherein the nucleotide sequence of the IRES has at least 96%, 97%, 98%, or 99% sequence identity SEQ ID NO: 185 or SEQ ID NO: 190.

162. The nucleic acid of claim 161 , wherein the nucleotide sequence of the IRES is SEQ ID NO: 185 or SEQ ID NO: 190.

163. The nucleic acid of any one of claims 82-162, wherein the IRES comprises one or more polynucleotides that specifically bind a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an TAf), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein.

164. The nucleic acid of claim 163, wherein the one or more polynucleotides specifically bind elF4G.

165. The nucleic acid of claim 164, wherein each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 -methylpseudouridine.

166. The nucleic acid of claim 165, wherein each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 -methylpseudouridine.

167. The nucleic acid of claim 163, wherein the IRES comprises one or more polynucleotides that specifically bind to a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein, optionally wherein the RNA-binding protein is MS2-binding protein and the one or more polynucleotides comprise one or more MS2 RNA hairpins.

168. The nucleic acid of any one of claims 163-167, wherein the nucleic acid does not comprise a 5’ cap.

169. The nucleic acid of any one of claims 163-167, wherein the nucleic acid comprises a 5’ cap.

170. The nucleic acid of any one of claims 163-169, wherein the nucleic acid comprises a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NO: 191 -201 .171 . The nucleic acid of claim 170, wherein the nucleic acid comprises a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NO: 191 -201 .

172. The nucleic acid of claim 171 , wherein the nucleic acid comprises a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NO: 191 -201 .

173. The nucleic acid of claim 172, wherein the nucleic acid comprises a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NO: 191 -201 .

174. The nucleic acid of claim 173, wherein the nucleic acid comprises a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NO: 191 -201 .

175. The nucleic acid of claim 174, wherein the nucleic acid comprises the nucleotide sequence of any one of SEQ ID NO: 191 -201 .

176. The nucleic acid of any one of claims 82-175, wherein the rRNA is from a 60S or 40S ribosomal subunit, optionally wherein the rRNA is selected from the group consisting of a 25S, 28S, 18S, 5.8S, and 5S rRNA.

177. A polypeptide expression system comprising :(i) the nucleic acid of any one of claims 1 -176; and(ii) a nucleic acid comprising an open reading frame that encodes a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf).

178. The polypeptide expression system of claim 177, wherein the nucleic acid of (i) and the nucleic acid of (ii) are separate molecules.

179. The polypeptide expression system of claim 177 or 178, wherein the nucleic acid of (ii) comprises, from 5’ to 3’:(i) a 5’ UTR;(ii) the open reading frame encoding the elF4G, La protein, or functional variant thereof; and(iii) a 3’ UTR.

180. The polypeptide expression system of claim 179, wherein the nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR.181 . A host cell comprising the nucleic acid of any one of claims 1 -176 or the polypeptide expression system of any one of claims 70-73.

182. The host cell of claim 181 , wherein the host cell is a eukaryotic cell.

183. The host cell of claim 182, wherein the eukaryotic cell is a mammalian cell.

184. The host cell of claim 183, wherein the mammalian cell is a human cell.

185. A method of expressing a polypeptide in a subject, the method comprising administering to the subject the nucleic acid of any one of claims 1 -176 or the polypeptide expression system of any one of claims 177-180.

186. A method of expressing a polypeptide in a cell or population of cells, the method comprising providing to the cell or population of cells the nucleic acid of any one of claims 1 -176 or the polypeptide expression system of any one of claims 177-180.

187. A method of treating a disease or condition associated with a deficiency in an endogenous polypeptide, the method comprising administering to the subject the nucleic acid of any one of claims 1 - 176 or the polypeptide expression system of any one of claims 177-180, wherein the polypeptide encoded by the nucleic acid or polypeptide expression system corresponds to the polypeptide whose deficiency is associated with the disease or condition.

Images