Filamentous fungal strains comprising enhanced protein productivity phenotypes and methods thereof

EP4615861A1Pending Publication Date: 2025-09-17DANISCO US INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023801271
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-11-11
Filing Date
2023-10-13
Publication Date
2025-09-17

AI Technical Summary

Technical Problem

Current methods for protein production in filamentous fungi are limited by low volumetric efficiencies and high operating costs due to temperature constraints and inefficient carbon source utilization in submerged cultures.

Method used

Genetically modified filamentous fungal strains deficient in the SPT5 protein, which exhibit enhanced protein productivity phenotypes, including increased volumetric productivity and carbon conversion efficiency, are developed. These strains can operate at elevated temperatures, reducing cooling needs and production costs.

Benefits of technology

The modified strains show significant increases in total protein productivity and carbon conversion efficiency, allowing for more efficient and cost-effective protein production at higher temperatures, thereby overcoming the limitations of traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 000061
    Figure 000061
  • Figure 000062
    Figure 000062
  • Figure IMGF000011_0001
    Figure IMGF000011_0001
Patent Text Reader

Abstract

The present disclosure is generally related to genetically modified filamentous fungal strains (cells) and their use in the production of proteins of interest. Certain embodiments provide, inter alia, methods and compositions for the design and construction of genetically modified filamentous fungal cells (strains), recombinant (modified) filamentous fungal cells (strains) comprising enhanced protein productivity phenotypes, including, but not limited to, improved volumetric efficiencies, higher specific productivities, improved yield on carbon sources, increased bioreactor operating temperatures (e.g., mitigating / reducing bioreactor cooling needs and reducing operating costs) and the like, methods and compositions for cultivating / fermenting filamentous fungal strains at increased temperature ranges for the production of proteins of interest and the like.
Need to check novelty before this filing date? Find Prior Art

Description

FILAMENTOUS FUNGAL STRAINS COMPRISING ENHANCED PROTEIN PRODUCTIVITY PHENOTYPES AND METHODS THEREOF TECHNICAL FIELD

[0001] The present disclosure is generally related to the fields of biology, molecular biology, filamentous fungi, yeast, fermentation, genetics, industrial protein production and the like. More particularly, the present strains and methods of the disclosure relate to genetic modifications in filamentous fungi that give rise to variant (modified) strains having altered phenotypes, wherein such modified strains are particularly well-suited for growth in submerged cultures (e.g., large-scale production of proteins for industrial / commercial applications). CROSS REFERENCE TO RELATED APPLICATIONS

[0002] This application claims benefit to U.S. Provisional Patent Application No. 63 / 383,320, filed November 11, 2022, which is incorporated herein by referenced in its entirety. REFERENCE TO A SEQUENCE LISTING

[0003] The contents of the electronic submission of the text file Sequence Listing, named “NB41704-WO- PCT_SequenceListing.xml” was created on October 04, 2023 and is 32 KB in size, which is hereby incorporated by reference in its entirety. BACKGROUND

[0004] Filamentous fungi (e.g., Aspergillus sp., Penicillium sp., Talaromyces sp., Fusarium sp., Myceliophthora sp., Neurospora sp., Candida sp., Trichoderma sp., and the like) are capable of expressing native and heterologous proteins to high levels, making them well-suited for the large-scale production of proteins (e.g., enzymes, antibodies, peptides, etc.) and / or metabolites for industrial and / or commercial applications such as pharmaceutical applications, animal health applications, food applications, beverage applications, laundry and textile applications, and the like. Filamentous fungi are typically grown in mycelial submerged cultures in bioreactors, which bioreactors are adapted to introduce and distribute oxygen and nutrients into the culture medium (i.e., culture broth). For example, the filamentous fungus Trichoderma reesei (T. reesei; an anamorph of the fungus Hypocrea jecorina) is known to be an efficient producer of cellulase enzymes.

[0005] As such, filamentous fungi have been utilized for their ability to produce proteins (e.g., enzymes), which proteins are valuable in the production of commodities such as cellulosic (derived) ethanol, textile processing, grain processing, detergents, fibers / pulp / paper, food additives, feed additives and the like. For example, recombinant gene expression in such fungal host strains is a common method for the productionof proteins (i.e., for industrial and commercial purposes) and as such, protein productivity improvements of a fungal host strain are an important economic factor of protein production costs. Thus, as appreciated by one of skill in the art, such novel compositions and methods for enhancing protein production in filamentous fungal strains are of significant commercial interest. SUMMARY

[0006] As set forth and described herein, the present disclosure is generally related to genetically modified filamentous fungal strains (cells) and their use in the production of proteins of interest. In certain embodiments, the disclosure provides, inter alia, methods and compositions for the design and construction of genetically modified filamentous fungal cells (strains), recombinant (modified) filamentous fungal cells (strains) comprising enhanced protein productivity phenotypes, including, but not limited to, improved volumetric efficiencies, higher specific productivities, improved yield on carbon sources, increased bioreactor operating temperatures (e.g., mitigating / reducing bioreactor cooling needs and reducing operating costs) and the like, methods and compositions for cultivating / fermenting filamentous fungal strains at increased temperature ranges for the production of proteins of interest and the like.

[0007] Certain embodiments of the disclosure are related to variant / mutant / recombinant (modified) strains of filamentous fungus derived or obtained from parental or control strains comprising genes encoding native SPT5 proteins. More particularly, certain aspects are related to variant filamentous fungal cells derived or obtained from parental filamentous fungal cells comprising a gene encoding a native SPT5 protein, wherein the variant cells comprise a genetic modification rendering the cells deficient in the production of the native SPT5 protein. In certain other aspects, such variant cells comprise enhanced protein productivity phenotypes relative to the control or parental cells when cultivated under the same conditions. In related aspects, the SPT5 gene comprises at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 1. In certain other aspects, the SPT5 gene encodes a native SPT5 protein comprising at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO: 2.

[0008] In one or more other embodiments or aspects of the disclosure, the native SPT5 protein comprises at least one domain selected from the group consisting of a SPT5 N-terminal domain (NTD) comprising at least 80% identity to SEQ ID NO: 5, a NusG superfamily (NGN) domain comprising at least 80% identity to SEQ ID NO: 6 and a SPT5 C-terminal domain (CTD) comprising at least 80% identity to SEQ ID NO: 7. In certain other embodiments, an enhanced protein productivity phenotype is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency and increased specific productivity. In relatedembodiments, variant cells of the disclosure comprise an enhanced protein productivity phenotype relative to the parental cells when cultivated under the same conditions at temperature between about 25°C to 29°C.

[0009] In one or more other embodiments or aspects, cells of the disclosure comprise an introduced expression cassette encoding a heterologous protein of interest (POI). In one or more other embodiments or aspects, cells of the disclosure express / produce one or more lignocellulosic degrading enzymes. In certain embodiments, one or more lignocellulosic degrading enzymes expressed / produced are expressed from endogenous genes encoding the one or more lignocellulosic degrading enzymes. In other embodiments, the one or more lignocellulosic degrading enzymes are expressed from an introduced (heterologous) expression cassette.

[0010] Certain other one or more embodiments or aspects of the disclosure provide, inter alia, methods for producing increased amounts of lignocellulosic degrading enzymes in a modified filamentous fungal cell. In certain embodiments, such methods comprise obtaining parental filamentous fungal cells having a SPT5 gene encoding a native SPT5 protein. In one or more related embodiments or aspects, one or more parental filamentous fungal cells having a SPT5 gene encoding a native SPT5 protein are genetically modified, wherein the genetic modification renders the modified cells obtained therefrom deficient in the production of the native SPT5 protein. In certain other one or more related embodiments or aspects, such methods comprise fermenting / cultivating the modified cells under suitable conditions for the production of lignocellulosic degrading enzymes, wherein the modified cells produce an increased amount of the lignocellulosic degrading enzymes relative to the parental cells when fermented / cultivated under the same conditions, at a temperature between about 25C° to 29°C.

[0011] Certain other one or more embodiments or aspects of the disclosure provide, inter alia, methods for producing increased amounts of heterologous proteins of interest in a modified filamentous fungal cell. In certain embodiments, such methods comprise obtaining parental filamentous fungal cells having a SPT5 gene encoding a native SPT5 protein and producing one or more heterologous proteins of interest. In certain other embodiments, such methods comprise obtaining a parental filamentous fungal cells having a SPT5 gene encoding a native SPT5 protein and introducing into the parental cells one or more expression cassettes encoding one or more (heterologous) proteins of interest. In one or more other embodiments or aspects, parental filamentous fungal cells having a SPT5 gene encoding a native SPT5 protein are genetically modified, wherein the genetic modification renders the modified cells obtained therefrom deficient in the production of the native SPT5 protein. In certain other one or more related embodiments or aspects, such methods comprise fermenting / cultivating the modified cells under suitable conditions for the production of the one or more heterologous proteins of interest, wherein the modified cells produce an increased amount of the one or more heterologous proteins of interest relative to the parental cells when fermented / cultivated under the same conditions, at a temperature between about 25C° to 29°C.

[0012] In certain embodiments of the methods and / or compositions of the disclosure, modified filamentous fungal cells deficient in the expression / production of the native SPT5 protein comprise an enhanced protein productivity phenotype, particularly when fermented at an elevated fermentation temperatures, wherein the enhanced protein productivity phenotype comprises an increased total protein productivity, an increased volumetric productivity, an increased carbon conversion efficiency and an increased specific productivity. For example, in certain embodiments, a modified filamentous fungal cell deficient in the expression / production of the native SPT5 protein comprises an increased total protein productivity phenotype when fermented at an elevated temperature. In certain related embodiments, a modified filamentous fungal cell deficient in the expression / production of the native SPT5 protein comprises an increased total protein productivity of at least 1% increase relative to a parental or control cell when fermented under same conditions at an elevated fermentation temperature. In certain aspects, an elevated fermentation temperature is at least about 28.05°C , 28.1°C, 28.2°C, 28.3°C, 28.4°C, 28.5°C, 28.6°C, 28.7°C, 28.8°C, 28.9°C, 29°C, 29.1°C, 29.2°C, 29.3°C, 29.4°C, 29.5°C, 29.6°C, 29.7°C, 29.8°C, 29.9°C or 30°C. BRIEF DESCRIPTION OF THE BIOLOGICAL SEQUENCES

[0013] SEQ ID NO: 1 is a Trichoderma reesei polynucleotide (DNA) sequence encoding a native SPT5 protein of SEQ ID NO: 2.

[0014] SEQ ID NO: 2 is the amino acid sequence of the native (full-length) SPT5 protein encoded SEQ ID NO: 1.

[0015] SEQ ID NO: 3 is an open reading frame (ORF) sequence encoding the native (full-length) SPT5 protein of SEQ ID NO: 2.

[0016] SEQ ID NO: 4 is the amino acid sequence of a C-terminally truncated SPT5 variant protein.

[0017] SEQ ID NO: 5 is an amino acid sequence of the SPT5 N-terminal domain (NTD).

[0018] SEQ ID NO: 6 is an amino acid sequence of the NusG superfamily (NGN) domain.

[0019] SEQ ID NO: 7 is an amino acid sequence of the SPT5 C-terminal domain (CTD).

[0020] SEQ ID NO: 8 is an artificial RNA target site (TS) sequence named “CLsgRNA58”.

[0021] SEQ ID NO: 9 is an artificial DNA sequence named “AL950”.

[0022] SEQ ID NO: 10 is an artificial DNA sequence named “AL952”.

[0023] SEQ ID NO: 11 is an artificial DNA sequence named “CL2350”.

[0024] SEQ ID NO: 12 is an artificial DNA sequence named “CL2351”.

[0025] SEQ ID NO: 13 is a T. reesei DNA sequence encoding the native GEF1 protein comprising SEQ ID NO: 14.

[0026] SEQ ID NO: 14 is the amino acid sequence of the native (full-length) GEF1 protein encoded by SEQ ID NO: 13.

[0027] SEQ ID NO: 15 is an artificial RNA target site (TS) sequence named “GEF1REST”.

[0028] SEQ ID NO: 16 is an artificial DNA sequence named “CLN2514”.

[0029] SEQ ID NO: 17 is an artificial DNA sequence named “CLN2517”. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 presents the amino acid sequences of the native SPT5 protein (SEQ ID NO: 2; FIG.1A) and the C-terminally truncated mutant SPT5 protein (SEQ ID NO: 4; FIG. 1B). As shown in FIG. 1, the native (full-length) SPT5 protein comprises 1,057 amino acid residues (FIG.1A), whereas the C-terminally truncated mutant protein comprises 929 amino acid residues (FIG. 1B), wherein the last 128 C-terminal amino acid residues of the native SPT5 protein (FIG. 1A, underlined residues) are deleted in the mutant SPT5 protein (FIG.1B).

[0031] Figure 2 presents the amino acid sequence of the native Trichoderma sp. SPT5 protein (FIG. 2A; SEQ ID NO: 2) showing the SPT5 N-terminal domain (NTD; SEQ ID NO: 5) in grey shaded residues, the SPT5 NusG (NGN) domain (SEQ ID NO: 6) in underlined residues and the STP5 C-terminal domain (CTD; SEQ ID NO: 7) in bold residues. As shown in FIG. 1A, the variant SPT5 protein (SEQ ID NO: 4) C- terminal truncation (SEQ ID NO: 4) occurs near the C-terminus of the SPT5 domain, as indicated with the double underlined serine (S) residue. Likewise, the amino acid sequences of the native Trichoderma SPT5 protein’s N-terminal domain (NTD; SEQ ID NO: 5), NusG (NGN) domain (SEQ ID NO: 6) and C-terminal domain (CTD; SEQ ID NO: 7) are presented in FIG.2B for clarity. DETAILED DESCRIPTION

[0032] As set forth and described herein, the present disclosure is generally related to genetically modified filamentous fungal strains (cells) and their use in the production of proteins of interest. More particularly, the present strains and methods of the disclosure relate to genetic modifications in filamentous fungi that give rise to variant strains having altered phenotypes, wherein such variant strains are particularly well- suited for growth in submerged cultures (e.g., large-scale production of proteins for industrial / commercial applications). As described and exemplified hereinafter, certain embodiments of the disclosure provide, inter alia, methods and compositions for the design and construction of genetically modified filamentous fungal cells (strains), modified filamentous fungal cells comprising enhanced protein productivity phenotypes (including, but not limited to, improved volumetric efficiencies, higher specific productivities, improved yield on carbon sources, reduced bioreactor (fermentor) operating costs, methods and compositions for cultivating / fermenting filamentous fungal strains at increased temperature ranges for the production of proteins of interest and the like.I. DEFINITIONS

[0033] Prior to describing the present strains and methods in detail, the following terms are defined for clarity. Terms not defined should be accorded their ordinary meanings as used in the relevant art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present compositions and methods apply.

[0034] All publications and patents cited in this specification are herein incorporated by reference.

[0035] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the present compositions and methods. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the present compositions and methods, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the present compositions and methods.

[0036] Certain ranges are presented herein with numerical values being preceded by the term “about”. The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating un-recited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. For example, in connection with a numerical value, the term “about” refers to a range of -10% to+10% of the numerical value, unless the term is otherwise specifically defined in context. In another example, the phrase a “pH value of about 6” refers to pH values of from 5.4 to 6.6, unless the pH value is specifically defined otherwise.

[0037] The headings provided herein are not limitations of the various aspects or embodiments of the present compositions and methods which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

[0038] In accordance with this Detailed Description, the following abbreviations and definitions apply. Note that the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “an enzyme” includes a plurality of such enzymes, and reference to “the dosage” includes reference to one or more dosages and equivalents thereof known to those skilled in the art, and so forth.

[0039] It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely”, “only”,“excluding”, “not including” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[0040] It is further noted that the term “comprising”, as used herein, means “including, but not limited to”, the component(s) after the term “comprising”. The component(s) after the term “comprising” are required or mandatory, but the composition comprising the component(s) may further include other non-mandatory or optional component(s).

[0041] It is also noted that the term “consisting of,” as used herein, means “including and limited to”, the component(s) after the term "consisting of”. The component(s) after the term “consisting of” are therefore required or mandatory, and no other component(s) are present in the composition.

[0042] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present compositions and methods described herein. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.

[0043] As used herein, the terms “wild-type” and “native” are used interchangeably and refer to genes, proteins, fungal cells or strains as found in nature.

[0044] As used herein, the terms “recombinant” or “non-natural” refer to an organism, microorganism, cell, nucleic acid molecule, or vector that has at least one engineered genetic alteration, or has been modified by the introduction of a heterologous nucleic acid molecule, or refer to a cell (e.g., a microbial cell) that has been altered such that the expression of a heterologous or endogenous nucleic acid molecule or gene can be controlled. Recombinant also refers to a cell that is derived from a non-natural cell or is progeny of a non-natural cell having one or more such modifications. Genetic alterations include, for example, modifications introducing expressible nucleic acid molecules encoding proteins, or other nucleic acid molecule additions, deletions, substitutions or other functional alteration of a cell’s genetic material. For example, recombinant cells may express genes or other nucleic acid molecules that are not found in identical or homologous form within a native (wild-type) cell, or may provide an altered expression pattern of endogenous genes, such as being over-expressed, under-expressed, minimally expressed, or not expressed at all.

[0045] “Recombination”, “recombining” or generating a “recombined” nucleic acid is generally the assembly of two or more nucleic acid fragments wherein the assembly gives rise to a chimeric gene.

[0046] As used herein, the term “gene” is synonymous with the term “allele” in referring to a nucleic acid that encodes and directs the expression of a protein or RNA. Vegetative forms of filamentous fungi are generally haploid, therefore a single copy of a specified gene (i.e., a single allele) is sufficient to confer a specified phenotype.

[0047] As used herein, the term “gene” means the segment of DNA involved in producing a polypeptide (protein) chain, that may or may not include regions preceding and following the coding region (e.g., 5′ untranslated (5′ UTR) or “leader” sequences, 3′ UTR or “trailer” sequences, promoter sequences, terminator sequences and the like) as well as intervening sequences (introns) between individual coding segments (exons). For example, a gene (DNA) sequence of interest (GOI) may encode a regulatory protein, a structural protein, commercially important industrial proteins or peptides, such as enzymes (e.g., proteases, mannanases, xylanases, amylases, glucoamylases, cellulases, oxidases, phytases, lipases) and the like. The gene of interest may be a naturally occurring gene, a mutated (modified) gene or a synthetic gene.

[0048] As used herein, the term “promoter” refers to a nucleic acid sequence that functions to direct transcription of a downstream gene, or an open reading frame (ORF) thereof. The promoter will generally be appropriate to the host cell (e.g., a filamentous fungal cell) in which the target gene is being expressed. The promoter together with other transcriptional and translational regulatory nucleic acid sequences (also termed “control sequences”) is necessary to express a given gene. In general, the transcriptional and translational regulatory sequences include, but are not limited to, promoter and terminator sequences including a core promoter and enhancer or activator or repressor sequences, transcriptional and translational start and stop sequences. In certain embodiments, the promoter is an inducible promoter, or a constitutive promoter. In certain embodiments, the inducible promoter is an inducible cellulase gene promoter.

[0049] As used herein, the term “promoter activity” is the ability of a nucleic acid to direct transcription of a downstream (3′) polynucleotide in a host cell. To test promoter activity, the (promoter) nucleic acid may be operably linked to a downstream polynucleotide to produce a recombinant nucleic acid. The recombinant nucleic acid may be introduced into a cell, and transcription of the polynucleotide may be evaluated. In certain cases, the polynucleotide may encode a protein, and transcription of the polynucleotide can be evaluated by assessing production of the protein in the cell.

[0050] As used herein, the term “operably linked” refers to a functional linkage between two or more nucleic acid sequences. Thus, a nucleic acid sequence is operably linked when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter sequence or a terminator sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation; a nucleic acid sequence encoding a secretory leader (i.e., a signal peptide) is operably linked to a nucleic acid sequence (e.g., an ORF) encoding a polypeptide if it is expressed as a pre-protein that participates in the secretion of the polypeptide. Generally, “operably linked” means that the DNA (nucleic acid) sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking two or more nucleic acid sequences (i.e., operably linking) is accomplished using any of the methods to one of skill in the art.

[0051] As used herein, a “functional gene” is a gene capable of being used by cellular components to produce an active gene product, typically a protein. In contrast, a “non-functional gene” cannot be used by cellular components to produce an active gene product (i.e., a functional protein), or has a reduced ability to be used by cellular components to produce an active gene product (i.e., a functional protein).

[0052] As used herein, a “functional protein” is a protein that possesses a function or activity, such as an enzymatic function / activity, a binding function / activity (e.g., DNA binding), a surface-active property, and the like, and which has not been mutagenized, truncated, or otherwise modified to abolish or reduce that function / activity.

[0001] As used herein, the term “gene” is synonymous with the term “allele” in referring to a nucleic acid that encodes and directs the expression of a protein or RNA. Vegetative forms of filamentous fungi are generally haploid, therefore a single copy of a specified gene (i.e., a single allele) is sufficient to confer a specified phenotype.

[0002] As used herein, the terms “wild-type” and “native” are used interchangeably and refer to genes, proteins, fungal cells or strains as found in nature.

[0053] As used herein, the phrases “modified filamentous fungal cell(s)”, “mutant filamentous fungal cell(s)”, “variant filamentous fungal cell(s)”, “recombinant fungal cell(s)”, “modified filamentous fungal strain(s)”, and the like may be used interchangeably and refer to filamentous fungal cells that are derived (obtained) from a control or parental filamentous fungal cell belonging to the Pezizomycotina subphylum. For example, a “modified” filamentous fungal cell may be derived (obtained) from a control or parental filamentous fungal cell, wherein the modified cell comprises at least one genetic modification which is not found in the control or parental cell.

[0054] As used herein, the term “Ascomycete fungal cell” refers to any organism in the Division Ascomycota in the Kingdom Fungi. Examples of Ascomycetes fungal cells include, but are not limited to, filamentous fungi in the subphylum Pezizomycotina, such as Trichoderma sp., Aspergillus sp., Myceliophthora sp. and Penicillium sp.

[0055] As used herein, the term “filamentous fungus” refers to all filamentous forms of the subdivision Eumycota and Oomycota. For example, filamentous fungi include, without limitation, Acremonium, Aspergillus, Emericella, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Scytalidium, Thielavia, Tolypocladium, or Trichoderma species. In some embodiments, the filamentous fungus may be an Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae.

[0056] In some embodiments, the filamentous fungus is a Fusarium sp. such as Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum,Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, and the like. In other embodiments, the filamentous fungus is Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Scytalidium thermophilum, Thielavia terrestris and the like. In certain other embodiments, a filamentous fungus is a Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, Trichoderma viride and the like.

[0057] As used herein, exemplary parental Trichoderma reesei strains include, but are not limited to, T. reesei strain QM6a (ATCC Deposit No. 13631), T. reesei strain RL-P37 (NRRL Deposit No. 15709) and T. reesei strain RUT-C30 (ATCC Deposit No.56765); exemplary parental Aspergillus niger strains include, but are not limited to, A. niger strain designated as ATCC Deposit No.1015; exemplary parental Aspergillus oryzae strains include, but are not limited to A. oryzae strain RIB40 (ATCC Deposit No. 42149); and exemplary parental Myceliophthora thermophila strains include, but are not limited to, M. thermophila strain designated as ATCC Deposit No.42464.

[0058] For example, Trichoderma strains RUT-C30 and RL-P37 are mutagenized (cellulase overproducing) derivatives of Trichoderma natural isolate QM6a (Sheir-Neiss and Montenecourt, 1984), with strain NG14 being the last common ancestor. In certain aspects, suitable Trichoderma strains may be derived / obtained from T. reesei strains comprising a deletion of the T. reesei pyr2 gene (∆pyr2), as generally described by Sheir-Neiss and Montenecourt (1984) and PCT Publication No. WO2011 / 153449 (specifically incorporated herein by reference in its entirety).

[0059] In certain other aspects, exemplary Trichoderma strains are presented and described in TABLE 1. TABLE 1 STRAIN DESCRIPTIONS Strain Name Strain Description Phenotype T4 T i h d T4 h l ll l i

[0060] As used herein, a T. reesei parental strain named “T4” is a cellulase overproducing strain derived from T. reesei strain RL-P37, as generally described in PCT Publication No. WO2021 / 092356 (specifically incorporated herein by reference in its entirety).

[0061] As used herein, a T. reesei parental (control) strain named “T4-GEF1” was serially propagated under selective conditions to identify and isolate mutant strains thereof capable of high temperature protein production, without adversely affecting specific productivity (Qp). For example, PCT Publication No. WO2021 / 092356, generally describes the serial propagation of the Trichoderma “T4” strain under selective conditions to identity and isolate mutant T4 strains thereof capable of high temperature (HT) protein production as compared to the parent (control) T4 strain. As described in this publication, a mutant strain capable of HT protein production relative to the parent T4 strain was identified, wherein the mutated gene encoded a truncated protein named “GEF1” and the strain was named T4-GEF1.

[0062] As used herein, a mutant Trichoderma strain named “T4-26rc” (derived from control strain T4- GEF1) was identified under selective temperatures and isolated, wherein T4-26rc mutant has a similar specific productivity (Qp) when cultivated at 29°C relative to the Qp of the control T4-GEF1 strain cultivated at 28°C.

[0063] As used herein, a variant Trichoderma strain named “SPT5 t-BBW51” was derived from the T4-GEF1 control strain, and comprises a single nucleotide polymorphism (SNP; G ^A) in the SPT5 coding sequence (CDS), resulting in (W930*) a C-terminal truncation of the SPT5 protein.

[0064] As used herein, a T. reesei parental strain named “t-BAL50” comprises an introduced single copy of a cellulase expression cassette integrated into the genome, wherein the cellulase cassette encodes a cellobiohydrolase 1 (Cbh1) protein, a cellobiohydrolase 2 (Cbh2), an endoglucanase 1 (Eg1) protein and an endoglucanase 2 (Eg2) protein.

[0065] As used herein, a mutant Trichoderma strain named “t-BDA85” was derived from the t-BAL50 strain, comprises a SNP (G to A) in the SPT5 gene coding sequence (CDS), resulting in a C-terminal truncation (W930*) of amino acid positions 930 through 1,057 of native SPT5 protein, as shown in FIG.1B (SEQ ID NO: 4).

[0066] As used herein, a mutant Trichoderma strain named “t-BDA88” was derived from the t-BAL50 strain and comprises a pyr2 selection marker gene inserted at nucleotide position 3,183 of the SPT5 gene CDS, thereby disrupting the SPT5 CDS resulting in a truncated SPT5 protein.

[0067] As used herein, a mutant Trichoderma strain named “t-BEX65” was derived from the t-BDA85 strain by reverting the disrupted GEF1 gene to the restored wildtype GEF1 gene (WT GEF1REST).

[0068] As used herein, the terms “polypeptide” and “protein” (and / or their respective plural forms) are used interchangeably to refer to polymers of any length comprising amino acid residues linked by peptide bonds. The conventional one-letter or three-letter codes for amino acid residues are used herein. The polymer can be linear or branched, it can comprise modified amino acids, and it can be interrupted by non- amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation,or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art.

[0069] As used herein, the term “derivative polypeptide / protein” refers to a protein which is derived or derivable from a protein by addition of one or more amino acids to either or both the N- and C-terminal end(s), substitution of one or more amino acids at one or a number of different sites in the amino acid sequence, deletion of one or more amino acids at either or both ends of the protein or at one or more sites in the amino acid sequence, and / or insertion of one or more amino acids at one or more sites in the amino acid sequence. The preparation of a protein derivative can be achieved by modifying a DNA sequence which encodes for the native protein, transformation of that DNA sequence into a suitable host, and expression of the modified DNA sequence to form the derivative protein.

[0070] Related (and derivative) proteins include “variant proteins”. Variant proteins differ from a reference / parental protein (e.g., a wild-type protein) by substitutions, deletions, and / or insertions at a small number of amino acid residues. The number of differing amino acid residues between the variant and parental protein can be one or more, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more amino acid residues. Variant proteins can share at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99%, or more, amino acid sequence identity with a reference protein. A variant protein can also differ from a reference protein in selected motifs, domains, epitopes, conserved regions, and the like.

[0071] As used herein, the term “analogous sequence” refers to a sequence within a protein that provides similar function, tertiary structure, and / or conserved residues as the protein of interest (i.e., typically the original protein of interest). For example, in epitope regions that contain an α-helix or a β-sheet structure, the replacement amino acids in the analogous sequence preferably maintain the same specific structure. The term also refers to nucleotide sequences, as well as amino acid sequences. In some embodiments, analogous sequences are developed such that the replacement of amino acids result in a variant enzyme showing a similar or improved function. In some embodiments, the tertiary structure and / or conserved residues of the amino acids in the protein of interest are located at or near the segment or fragment of interest. Thus, where the segment or fragment of interest contains, for example, an α-helix or a β-sheet structure, the replacement amino acids preferably maintain that specific structure.

[0072] As used herein, the term “homologous protein” refers to a protein that has similar activity and / or structure to a reference protein. It is not intended that homologues necessarily be evolutionarily related. Thus, it is intended that the term encompass the same, similar, or corresponding protein(s) (i.e., in terms ofstructure and function) obtained from different organisms. In some embodiments, it is desirable to identify a homologue that has a quaternary, tertiary and / or primary structure similar to the reference protein.

[0073] The degree of homology between sequences can be determined using any suitable method known in the art (see, e.g., Smith and Waterman, 1981; Needleman and Wunsch, 1970; Pearson and Lipman, 1988; programs such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI); and Devereux et al., 1984). For purposes of the present disclosure, the degree of identity between two amino acid sequences is determined using the Needleman- Wunsch algorithm (Needleman and Wunsch, 1970) as implemented in the Needle program of the EMBOSS package (Rice et al., 2000), preferably version 3.0.0 or later. The optional parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.

[0074] The output of Needle labeled “longest identity” (obtained using the nobrief option) is used as the percent identity and is calculated as follows: (Identical Residues x 100) / (Length of Alignment - Total Number of Gaps in Alignment)

[0075] As used herein, the phrases “substantially similar” and “substantially identical”, in the context of at least two nucleic acids or polypeptides, typically means that a polynucleotide or polypeptide comprises a sequence that has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or even at least about 99% identity, or more, compared to the reference (i.e., wild-type) sequence. Sequence identity can be determined using known programs such as BLAST, ALIGN, and CLUSTAL using standard parameters. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. Also, databases can be searched using FASTA. One indication that two polypeptides are substantially identical is that the first polypeptide is immunologically cross-reactive with the second polypeptide. Typically, polypeptides that differ by conservative amino acid substitutions are immunologically cross-reactive. Thus, a polypeptide is substantially identical to a second polypeptide, for example, where the two peptides differ only by a conservative substitution. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions (e.g., within a range of medium to high stringency).

[0076] In certain embodiments, filamentous fungus cells for manipulation, construction and use as described herein are generally from the subphylum Pezizomycotina, particularly fungi that have a vegetative hyphae state and comprise a SPT5 gene or a homologue thereof.

[0077] As used herein, a “gene or polynucleotide encoding a native SPT5 protein” comprises sequence homology to SEQ ID NO: 1. In certain embodiments, a gene or polynucleotide encoding a native SPT5 protein comprises at least about 50%, 60%, 70%, 80%, 90% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3. In certain aspects, a gene or polynucleotide encoding a native SPT5 protein comprises at least about 50%, 60%, 70%, 80%, 90% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3, and encodes one or more protein domains selected from the group consisting of a SPT5 N-terminal domain (SPT5 NTD), a NusG superfamily N-terminal domain (NGN) and a SPT5 C-terminal domain (SPT5 CTD). In certain other embodiments, a gene or polynucleotide encoding a native SPT5 protein hybridizes with a nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3, under medium to stringent hybridization conditions.

[0078] As used herein, an “open reading frame (ORF) nucleic acid sequence encoding a native SPT5 protein” comprises sequence homology to the ORF sequence of SEQ ID NO: 3. In certain other embodiments, an ORF nucleic acid sequence (encoding a native SPT5 protein) encodes an SPT5 comprising at least about 50%, 60%, 70%, 80%, 90% to 100% sequence identity to the native SPT5 protein of SEQ ID NO: 2. In certain other embodiments, an ORF encoding a native SPT5 protein hybridizes with a nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 under medium to stringent hybridization conditions.

[0079] As used herein, the phrases “lignocellulosic degrading enzymes”, “cellulase enzymes”, and “cellulases” are used interchangeably, and include glycoside hydrolase (GH) enzymes such as cellobiohydrolases, xylanases, endoglucanases, and β-glucosidases, that hydrolyze glycosidic bonds of cellulose (hemi-cellulose) to produce sugars (e.g., glucose., xylose, arabinose, etc.).

[0080] As used herein, “endoglucanase” proteins may be abbreviated as “EG”, “cellobiohydrolase” proteins may be abbreviated “CBH”, “β-glucosidase” proteins may be abbreviated “BG” and “xylanase” proteins may be abbreviated “XYL”. Thus, as used herein, a gene (or ORF) encoding a EG protein may be abbreviated “eg”, a gene (or ORF) encoding a CBH protein may be abbreviated “cbh”, a gene (or ORF) encoding a BG protein may be abbreviated “bg”, and a gene (or ORF) encoding a XYL protein may be abbreviated “xyl”. In certain embodiments, cellobiohydrolases include enzymes classified under Enzyme Commission No. (EC 3.2.1.91), endoglucanases include enzymes classified under EC 3.2.1.4, endo-β-1,4- xylanases include enzymes classified under EC 3.2.1.8, β-xylosidases include enzymes classified under EC 3.2.1.37, and β-glucosidases include enzymes classified under EC 3.2.1.21.

[0081] As used herein, a “cellulase gene promoter” includes, but is not limited to, a cellobiohydrolase (cbh) gene promoter sequence, an endoglucanase (eg) gene promoter sequence, a β-glucosidase (bg) gene promoter sequence, a xylanase (xyl) gene promoter sequence, and the like.

[0082] As used herein, “nucleic acid” refers to a nucleotide or polynucleotide sequence, and fragments or portions thereof, as well as to DNA, cDNA, and RNA of genomic or synthetic origin, which may be double- stranded or single-stranded, whether representing the sense or antisense strand.

[0083] As used herein, the term “expression” refers to the transcription and stable accumulation of sense (mRNA) or anti-sense RNA, derived from a nucleic acid molecule of the disclosure. Expression may also refer to translation of mRNA into a polypeptide. Thus, the term “expression” includes any step involved in the production of the polypeptide including, but not limited to transcription, post-transcriptional modification, translation, post-translational modification, secretion and the like.

[0084] As used herein, the combined term “expresses / produces”, as used in phrases such as a “variant strain of filamentous fungus cells expresses / produces an ‘increased’ amount of a protein of interest (POI)” (i.e., relative to the parental / control cell), the term “expresses / produces” is meant to include any steps involved in the expression and production of a protein in filamentous fungus strains of the disclosure.

[0085] In certain embodiments, a gene, polynucleotide, or nucleic acid sequence encoding a native SPT5 protein comprising “sequence homology” refers to DNA or RNA (nucleic acid) sequences that have de minimus sequence variations from the corresponding nucleic acid sequences (to which comparison is made) and retain substantially the same biological functions as the corresponding nucleic acid sequences (to which comparison is made). For example, in certain embodiments, a nucleic acid sequence comprising substantial sequence homology to a gene, polynucleotide, or nucleic acid encoding a native SPT5 protein is assessed by identifying the encoded gene product (native SPT5 protein), as described herein.

[0086] In certain other embodiments, a gene, polynucleotide, or nucleic acid sequence comprising sequence homology to a gene, polynucleotide, or nucleic acid encoding a native SPT5 protein is determined / identified using nucleic acid hybridization methods. For example, in certain embodiments, a DNA / RNA sequence comprising substantial sequence homology to a gene encoding a native SPT5 protein (e.g., SEQ ID NO: 2) is identified by the ability of such DNA / RNA sequence to hybridize with a specified nucleic acid sequence of the disclosure, under stringent conditions.

[0087] As used herein, “hybridizes under stringent conditions” is intended to describe conditions for hybridization and washing under which nucleotide sequences that are significantly identical or homologous to each other remain hybridized to each other. Such stringent conditions are well known to those skilled in the art (see, e.g., Ausubel et al., 1995; Sambrook et al., 1989). For example, in certain embodiments, a non-limiting example of stringent hybridization conditions includes hybridization in 4X sodium chlorine / sodium citrate (SSC), at about 65-70°C (or hybridization in 4×SSC plus 50% formamide at about 42-50°C), followed by one or more washes in 1×SSC, at about 65-70°C. Likewise, a non-limiting example of highly stringent hybridization conditions includes hybridization in 1×SSC, at about 65-70°C (orhybridization in 4×SSC plus 50% formamide at about 42-50°C), followed by one or more washes in 0.3×SSC, at about 65-70°C.

[0088] Certain embodiments of the disclosure are related to modified strains of filamentous fungus cells comprising a genetic modification of a gene encoding a native SPT5 protein. Thus, certain aspects are related to variant / mutant / recombinant (genetically modified) strains of filamentous fungus derived or obtained from parental (or control) strains comprising genes encoding native SPT5 proteins. More particularly, certain aspects are related to variant filamentous fungal cells derived or obtained from parental or control filamentous fungal cells comprising a gene encoding a native SPT5 protein, wherein the variant cells comprise a genetic modification rendering the cells deficient in the expression / production of the native SPT5 protein. In certain other aspects, such variant cells comprise enhanced protein productivity phenotypes relative to the parental or control cells when cultivated under the same conditions. In related aspects, the SPT5 gene comprises at least about 50%, 60%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 1. In certain other aspects, the SPT5 gene encodes a native SPT5 protein comprising at least about 50%, 60%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO: 2.

[0089] In one or more other embodiments or aspects of the disclosure, the native SPT5 protein comprises at least one domain selected from the group consisting of a SPT5 N-terminal domain (NTD) comprising at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 5, a NusG superfamily (NGN) domain comprising at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 6 and a SPT5 C-terminal domain (CTD) comprising at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 7. In certain other embodiments, an enhanced protein productivity phenotype is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency and increased specific productivity. In related embodiments, variant cells of the disclosure comprise an enhanced protein productivity phenotype relative to the parental or control cells when cultivated under the same conditions at temperature between about 25°C to 29°C.

[0090] In other certain embodiments, variant cells of the disclosure comprise an enhanced protein productivity phenotype relative to the parental or control cells when cultivated under the same conditions at temperature between about 25°C, 26°C, 27°C , 28°C or 29°C. In other embodiments, variant cells of thedisclosure comprise an enhanced protein productivity phenotype relative to the parental or control cells when cultivated under the same conditions at temperature between about 25.0°C, 25.1°C, 25.2°C , 25.3°C, 25.4°C, 25.5°C, 25.6°C, 25.7°C, 25.8°C, 25.9°C, 26.0°C, 26.1°C, 26.2°C, 26.3°C, 26.4°C, 26.5°C, 26.6°C, 26.7°C, 26.8°C, 26.9°C, 27.0°C, 27.1°C, 27.2°C, 27.3°C, 27.4°C, 27.5°C, 27.6°C, 27.7°C, 27.8°C, 27.9°C, 28.0°C, 28.1°C, 28.2°C, 28.3°C, 28.4°C, 28.5°C, 28.6°C, 28.7°C, 28.8°C, 28.9°C or 29.0°C.

[0091] In one or more other embodiments or aspects, cells of the disclosure comprise an introduced expression cassette encoding a heterologous protein of interest (POI). In one or more other embodiments or aspects, cells of the disclosure express / produce one or more lignocellulosic degrading enzymes. In certain embodiments, one or more lignocellulosic degrading enzymes produced are expressed from endogenous genes encoding the one or more lignocellulosic degrading enzymes. In other embodiments, the one or more lignocellulosic degrading enzymes produced are expressed from an introduced (heterologous) expression cassette encoding the one or more lignocellulosic degrading enzymes.

[0092] As used herein, the terms “modification” and “genetic modification” are used interchangeably and include, but are not limited to: (a) the introduction, substitution, or removal of one or more nucleotides in a gene, or the introduction, substitution, or removal of one or more nucleotides in a regulatory element required for the transcription or translation of the gene, (b) gene disruption, (c) gene conversion, (d) gene deletion, (e) the down-regulation of a gene (e.g., antisense RNA, siRNA, miRNA, and the like), (f) specific mutagenesis (including, but not limited to, CRISPR / Cas9 based mutagenesis) and / or (g) random mutagenesis of any one or more the genes disclosed herein.

[0093] As used herein, a variant strain of filamentous fungus comprising a genetic modification includes, but is not limited to a genetic modification of a gene encoding a native SPT5 protein disclosed herein. Thus, as described in further detail below, various molecular biological methods are well known and available to one skilled in the art for generating / constructing such variant strains of filamentous fungus cells.

[0094] As used herein, “the introduction, substitution, or removal of one or more nucleotides in a gene encoding a protein”, such genetic modifications include the gene’s coding sequence (i.e., exons) and non- coding intervening (introns) sequences.

[0095] As used herein, “disruption of a gene”, “gene disruption”, “inactivation of a gene” and “gene inactivation” are used interchangeably and refer broadly to any genetic modification that substantially disrupts / inactivates a target gene. Exemplary methods of gene disruptions include, but are not limited to, the complete or partial deletion of any portion of a gene, including a polypeptide coding sequence (CDS), a promoter, an enhancer, or another regulatory element, or mutagenesis of the same, where mutagenesis encompasses substitutions, insertions, deletions, inversions, and any combinations and variations thereof which disrupt / inactivate the target gene(s) and substantially reduce or prevent the expression / production ofthe functional gene product. In certain embodiments of the disclosure, such gene disruptions prevent a host cell from expressing / producing the encoded lov gene product.

[0096] In certain embodiments, a gene, polynucleotide, or nucleic acid sequence encoding a native SPT5 protein is genetically modified using an established gene editing technique, such as CRISPR / Cas9 gene editing, zinc-finger nuclease (ZFN) gene editing, transcription activator-like effector nuclease editing (TALEN), homing (mega) nuclease editing, and the like.

[0097] In other embodiments, a variant strain of filamentous fungus is constructed (i.e., genetically modified) by the process of gene conversion.

[0098] In other embodiments, a protein of interest (e.g., an endogenous POI or a heterologous POI) expressed / produced by the fungal cells of the disclosure is detected, measured, assayed and the like, by protein quantification methods, gene transcription methods, mRNA translation methods and the like, including, but not limited to protein migration / mobility (SDS-PAGE), mass spectrometry, HPLC, size exclusion, ultracentrifugation sedimentation velocity analysis, transcriptomics, proteomics, fluorescent tags, epitope tags, fluorescent protein (GFP, RFP, etc.) chimeras / hybrids and the like.

[0099] As used herein, functionally and / or structurally similar proteins are considered to be “related proteins”. Such related proteins can be derived from organisms of different genera and / or species, or even different classes of organisms (e.g., bacteria and fungi). Related proteins also encompass homologues and / or orthologues determined by primary sequence analysis, determined by secondary or tertiary structure analysis, or determined by immunological cross-reactivity.

[0100] The term “promoter” as used herein refers to a nucleic acid sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3' (downstream) to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleic acid segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity.

[0101] As defined herein, the term “introducing”, as used in phrases such as “introducing into a fungal cell” at least one polynucleotide open reading frame (ORF), or a gene thereof, or a vector thereof, includes methods known in the art for introducing polynucleotides into a cell, including, but not limited to protoplast fusion, natural or artificial transformation (e.g., calcium chloride, electroporation), transduction, transfection, and the like.

[0102] As used herein, “transformed” or “transformation” mean a cell has been transformed by use of recombinant DNA techniques. Transformation typically occurs by insertion of one or more nucleotide sequences (e.g., a polynucleotide, an ORF or gene) into a cell. The inserted nucleotide sequence may be a heterologous nucleotide sequence (i.e., a sequence that is not naturally occurring in the cell that is to be transformed).

[0103] As used herein, “transformation” refers to introducing an exogenous DNA into a host cell so that the DNA is maintained as a chromosomal integrant or a self-replicating extra-chromosomal vector. As used herein, “transforming DNA”, “transforming sequence”, and “DNA construct” refer to DNA that is used to introduce sequences into a host cell. The DNA may be generated in vitro by PCR or any other suitable techniques. In some embodiments, the transforming DNA comprises an incoming sequence, while in other embodiments it further comprises an incoming sequence flanked by homology boxes. In yet a further embodiment, the transforming DNA comprises other non-homologous sequences, added to the ends (i.e., stuffer sequences or flanks). The ends can be closed such that the transforming DNA forms a closed circle, such as, for example, insertion into a vector.

[0104] As used herein “an incoming sequence” refers to a DNA sequence that is introduced into the fungal cell chromosome. In some embodiments, the incoming sequence is part of a DNA construct. In other embodiments, the incoming sequence encodes one or more proteins of interest. In some embodiments, the incoming sequence comprises a sequence that may or may not already be present in the genome of the cell to be transformed (i.e., it may be either a homologous or heterologous sequence). In some embodiments, the incoming sequence encodes one or more proteins of interest, a gene, and / or a mutated or modified gene. In alternative embodiments, the incoming sequence encodes a functional wild-type gene or operon, a functional mutant gene or operon, or a nonfunctional gene or operon. In some embodiments, an incoming sequence is a non-functional sequence inserted into a gene to disrupt function of the gene. In another embodiment, the incoming sequence includes a selective marker. In a further embodiment the incoming sequence includes two homology boxes.

[0105] As used herein, “homology box” refers to a nucleic acid sequence, which is homologous to a sequence in the fungal cell chromosome. More specifically, a homology box is an upstream or downstream region having between about 80 and 100% sequence identity, between about 90 and 100% sequence identity, or between about 95 and 100% sequence identity with the immediate flanking coding region of a gene or part of a gene to be deleted, disrupted, inactivated, down-regulated and the like, according to the invention. These sequences direct where in the fungal cell chromosome a DNA construct is integrated and directs what part of the fungal cell chromosome is replaced by the incoming sequence. While not meant to limit the present disclosure, a homology box may include about between 1 base pair (bp) to 200 kilobases (kb). Preferably, a homology box includes about between 1 bp and 10.0 kb; between 1 bp and 5.0 kb;between 1 bp and 2.5 kb; between 1 bp and 1.0 kb, and between 0.25 kb and 2.5 kb. A homology box may also include about 10.0 kb, 5.0 kb, 2.5 kb, 2.0 kb, 1.5 kb, 1.0 kb, 0.5 kb, 0.25 kb and 0.1 kb. In some embodiments, the 5' and 3' ends of a selective marker are flanked by a homology box wherein the homology box comprises nucleic acid sequences immediately flanking the coding region of the gene.

[0106] As used herein, the term “selectable marker-encoding nucleotide sequence” refers to a nucleotide sequence which is capable of expression in the host cells and where expression of the selectable marker confers to cells containing the expressed gene the ability to grow in the presence of a corresponding selective agent or lack of an essential nutrient.

[0107] As used herein, the terms “selectable marker” and “selective marker” refer to a nucleic acid (e.g., a gene) capable of expression in host cell which allows for ease of selection of those hosts containing the vector. Examples of such selectable markers include, but are not limited to, antimicrobials. Thus, the term “selectable marker” refers to genes that provide an indication that a host cell has taken up an incoming DNA of interest or some other reaction has occurred. Typically, selectable markers are genes that confer antimicrobial resistance or a metabolic advantage on the host cell to allow cells containing the exogenous DNA to be distinguished from cells that have not received any exogenous sequence during the transformation.

[0108] As defined herein, a host cell “genome”, a fungal cell “genome”, or a filamentous fungus cell “genome” includes chromosomal and extrachromosomal genes.

[0109] As used herein, the terms “plasmid”, “vector” and “cassette” refer to extrachromosomal elements, often carrying genes which are typically not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- stranded or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell.

[0110] As used herein, the term “vector” refers to any nucleic acid that can be replicated (propagated) in cells and can carry new genes or DNA segments (e.g., an “incoming sequence”) into cells. Thus, the term refers to a nucleic acid construct designed for transfer between different host cells. Vectors include viruses, bacteriophage, pro-viruses, plasmids, phagemids, transposons, and artificial chromosomes such as YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), PLACs (plant artificial chromosomes), and the like, that are “episomes” (i.e., replicate autonomously) or can integrate into the chromosome of a host cell.

[0111] A used herein, a “transformation cassette” refers to a specific vector comprising a gene (or ORF thereof), and having elements in addition to the gene that facilitate transformation of a particular host cell.

[0112] As used herein, “expression vector” refers to a vector that has the ability to incorporate and express heterologous DNA in a cell. Many prokaryotic and eukaryotic expression vectors are commercially available and know to one skilled in the art. Selection of appropriate expression vectors is within the knowledge of one skilled in the art.

[0113] As used herein, the terms “expression cassette” and “expression vector” refer to a nucleic acid construct generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a target cell (i.e., these are vectors or vector elements, as described above). The recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter. In some embodiments, DNA constructs also include a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a target cell. In certain embodiments, a DNA construct of the disclosure comprises a selective marker and an inactivating chromosomal or gene or DNA segment as defined herein.

[0114] As used herein, a “targeting vector” is a vector that includes polynucleotide sequences that are homologous to a region in the chromosome of a host cell into which the targeting vector is transformed and that can drive homologous recombination at that region. For example, targeting vectors find use in introducing genetic modifications into the chromosome of a host cell through homologous recombination. In some embodiments, a targeting vector comprises other non-homologous sequences, e.g., added to the ends (i.e., stuffer sequences or flanking sequences). The ends can be closed such that the targeting vector forms a closed circle, such as, for example, insertion into a vector.

[0115] As defined herein, the phrases “enhanced protein productivity phenotype” and “increased protein productivity phenotype”, may be used interchangeably.

[0116] As used herein, a variant cell (or strain) comprising an “enhanced protein productivity phenotype” includes, but is not limited to, a variant cell comprising an enhanced / increased volumetric productivity, a variant cell comprising an enhanced / increased carbon conversion efficiency, a variant cell comprising an enhanced / increased protein yield, a variant cell comprising an enhanced / increased specific protein productivity and the like. For example, in certain embodiments, a variant cell or strain comprising an enhanced protein productivity phenotype expresses / produces at least 0.1% or more total protein (g) per g of fed sugars (relative to parental strain), wherein fed sugars can be expressed in terms of mass of sugar added to the fermentor during production phase (i.e., following feed- start).

[0117] As used herein, when describing an “enhanced / increased protein productivity phenotype” in an unmodified (parental or control) cell vis-à-vis the modified (variant) cell, it will be understood that the “parental” and “variant” cells are grown / cultivated / fermented under the same conditions (e.g., the same conditions such as media, temperature, pH and the like).

[0118] Similarly, when describing the “expression / production” of a protein of interest (POI) in an unmodified (parental or control) cell vis-à-vis the “expression / production” of the same POI in a modified (variant) cell, it will be understood that the “parental” and “variant” cells are grown / cultivated / fermented under essentially the same conditions (e.g., the same conditions such as media, temperature, pH and the like).

[0119] As used herein, “aerobic fermentation” refers to growth in the presence of oxygen.

[0120] As used herein, the terms “broth”, “cell broth”, “fermentation broth” and / or “culture broth” are used interchangeably, and refer collectively to (i) the fermentation (culture) medium and (ii) the cells, in a liquid (submerged) culture.

[0121] As used herein, the term “cell mass” refers to the cell component (including intact and lysed cells) present in a liquid (submerged) culture. Cell mass can be expressed in dry cell weight (DCW) or wet cell weight (WCW).

[0122] As used herein, the phrase “elevated fermentation (cultivation) temperatures” is a fermentation temperature greater than 28°C. In certain embodiments, an elevated fermentation temperature is at least about 28.05°C , 28.1°C, 28.2°C, 28.3°C, 28.4°C, 28.5°C, 28.6°C, 28.7°C, 28.8°C, 28.9°C, 29°C, 29.1°C, 29.2°C, 29.3°C, 29.4°C, 29.5°C, 29.6°C, 29.7°C, 29.8°C, 29.9°C or 30°C. In certain embodiments, an elevated fermentation temperature is at least about 28.5°C to about 29°C. In other certain embodiments, an elevated fermentation temperature is at least about 29°C to 30°C. II. FUNGAL STRAINS COMPRISING ENHANCED PROTEIN PRODUCTIVITY PHENOTYPES AT ELEVATED CULTIVATION TEMPERATURES

[0123] As generally described and set forth below in the Examples section, in certain embodiments Applicant has serially propagated a Trichoderma reesei whole cellulase strain named T4-GEF1 under selective conditions to identify and isolate mutant strains thereof capable of high temperature protein production without adversely affecting specific productivity (Qp) (Example 1). For example, a mutant T. reesei strain named T4-26rc was identified and isolated under such selective conditions (Example 2), wherein the mutant T4-26rc strain has a similar Qpwhen cultivated at 29°C, relative to the control T4-GEF1 strain cultivated at 28°C (TABLE 2).

[0124] As detailed in Example 2, Applicant sequenced the HT T. reesei T4-26rc mutant strain described / isolated in Example 1 to identify any mutated alleles which may contribute to the enhanced protein productivity observed at 31°C growth / cultivation conditions. More specifically, the mutant alleleidentified herein resides at scaffold position 2: 1043183-1043184 in the wild-type T. reesei QM6a (v2.0 genome sequence assembly, available at the Joint Genomes Institute (JGI) website; genome.jgi.doe.gov), wherein the mutated allele comprises a SNP (G ^A) encoding a truncated SPT5 protein (e.g., see FIG. 1 and FIG. 2). In particular, the mutant T4-26rc T. reesei strain has a similar Qpwhen grown / cultivated at 29°C as compared (relative) to the parental (control) T. reesei T4-GEF1 strain grown / cultivated at 28°C.

[0125] As set forth in Example 3, inactivation of the wild-type SPT5 gene (JGI; T. reesei v2.0 scaffold 2: 1043183-1043184) encoding the native (functional) SPT5 protein (SEQ ID NO: 2; PID: 4136) was performed in a T. reesei strain named SPT5t-BBW51 by introducing the SNP (G to A) in the SPT5 gene CDS, resulting in a C-terminal truncation (W930*) of amino acid positions 930 through 1,057 of native SPT5 protein. As presented in Example 3 (TABLE 2), the fermentor performance of the SPT5 t-BBW51 transformant was compared to the parental (control) T4-GEF1 strain and mutant T4-26rc strain described in Examples 1-2. In particular, as shown in TABLE 2, the total protein yield of the T4, T4-GEF1, T4-26rc and SPT5t-BBW51 strains are shown as percentages (%) relative to the control T4 strain cultivated at 25°C. For example, the percent (%) total protein yield of T4, T4-GEF1, and SPT5 t-BB51 at 28°C compared to the % control of T4 at 25°C, are 68%, 107%, and 112% respectively. In another example, the percent (%) total protein yield of T4-GEF1,T4-26rc, and SPT5 t-BB51 at 29°C, compared to the % control of T4 at 25°C, are 73%, 100 %, and 112% respectively.

[0126] Example 4 generally describes the inactivation / disruption of the wild-type SPT5 gene by introducing a single nucleotide polymorphism (SNP) into a T. reesei parental (control) strain (t-BAL50) comprising a heterologous cellulase expression cassette, wherein the modified T. reesei strain derived therefrom was named t-BDA88, as shown in TABLE 3. A second transformant named t-BDA85, comprising a SNP (G>A) at nucleotide position 3,183 in the coding sequence of the SPT5 gene was also evaluated via fermentor performance, as shown in TABLE 3. More particularly, as presented in TABLE 3, the fermentor performance of the t-BDA85 and t-BDA88 transformants were compared to the parental t- BAL50 (control) strain, wherein the total protein yield of t-BDA85 and t-BDA88 strains are shown in as percentages (%) relative to the t-BAL50 parental (control) strain cultivated at 25°C.

[0127] Example 5 of the disclosure further evaluates the influence of SPT5 in the absence of the GEF1 gene disruption (∆GEF1). In this example, restoration of the wild-type GEF1 gene (GEF1Rest) encoding the native GEF1 protein was performed in T. reesei strain t-BDA85 using a Cas9-based method, wherein a transformant named t-BEX65 comprised the restored WT GEF1 (GEF1Rest) gene . As shown in TABLE 4, the fermentor performance of t-BEX65 strain at protein production temperatures 25°C, 28°C, and 29°C was evaluated, wherein the total protein yield of t-BEX65 is shown as percentages (%) relative to t-BEX65 at 25°C.

[0128] Thus, as set forth and described hereinafter, in certain embodiments, a gene encoding a native SPT5 protein comprises sequence homology to SEQ ID NO: 1. In certain embodiments, a gene encoding a native SPT5 protein comprises at least about 50% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3. In certain embodiments, a gene encoding a native SPT5 protein comprises at least about 50%, 51%, 52%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3.

[0129] In certain aspects, a gene encoding a native SPT5 protein comprises at least about 50% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3, and encodes one or more protein domains selected from the group consisting of a SPT5 N-terminal domain (SPT5 NTD), a NusG superfamily N-terminal domain (NGN) and a SPT5 C-terminal domain (SPT5 CTD). In certain other embodiments, a gene or polynucleotide encoding a native SPT5 protein hybridizes with a nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3, under medium to stringent hybridization conditions.

[0130] In certain other embodiments or aspects of the disclosure, a gene CDS (open reading frame; ORF) nucleic acid sequence encoding a native SPT5 protein comprises sequence homology to the ORF sequence of SEQ ID NO: 3. In certain other embodiments, an ORF nucleic acid sequence (encoding a native SPT5 protein) encodes an SPT5 comprising at least about 50% to 100% sequence identity to the native SPT5 protein of SEQ ID NO: 2. In certain other embodiments, an ORF nucleic acid sequence (encoding a native SPT5 protein) encodes an SPT5 comprising at least about 50%, 51%, 52%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% to 100% sequence identity to the native SPT5 protein of SEQ ID NO: 2. In certain other embodiments, an ORF encoding a native SPT5 protein hybridizes with a nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 under medium to stringent hybridization conditions.

[0131] In certain embodiments, the position of an amino acid residue in a given amino acid sequence is numbered herein using the amino acid residue numbering (positions) of the native Trichoderma sp. SPT5 protein of SEQ ID NO: 2. For example, FIG. 1A presents the amino acid sequence of the native SPT5 protein (SEQ ID NO: 2), wherein a given amino acid sequence described herein can be aligned with the SPT5 protein amino acid sequence (SEQ ID NO: 2), using alignment algorithms described herein (and / or alignment algorithms known by one skilled in the art,) and an amino acid residue in the given amino acid sequence that aligns (preferably, optimally aligns) with an amino acid residue in the native sequence can be conveniently numbered by reference to the corresponding amino acid residue in the SPT5 sequence.

[0132] Likewise, to establish sequence homology or sequence identity to the primary (1°) sequence of the SPT5 protein (SEQ ID NO: 2), one skilled in the art may readily compare the primary sequence of SEQ ID NO: 2 with one or more candidate SPT5 protein homologue / orthologue sequences using sequence alignment algorithms, software and methods thereof know to one skilled in the art. Thus, after aligning the conserved residues, allowing for necessary insertions and deletions in order to maintain alignment (i.e., avoiding the elimination of conserved residues through arbitrary deletion and insertion), the residues equivalent to particular amino acids in the primary sequence of a candidate filamentous fungus SPT5 protein are defined. Alignment of conserved residues preferably should conserve 100% of such residues. However, alignment of greater than 98%, 95%, 90%, 85%, 80%, 75% 70%, 50% or at least 45% of conserved residues is also adequate to define equivalent residues.

[0133] Thus, in certain aspects, a gene encoding a native SPT5 protein comprises at least about 50% to 100% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3, and encodes one or more protein domains selected from the group consisting of a SPT5 N-terminal domain (SPT5 NTD), a NusG superfamily N- terminal domain (NGN) and a SPT5 C-terminal domain (SPT5 CTD). For example, as presented in FIG. 2A, the native Trichoderma SPT5 protein (SEQ ID NO: 2) comprises 1,057 amino acid (residue) positions, wherein the SPT5 protein comprises a SPT5 N-terminal domain (SPT5 NTD) at amino acid positions 147- 217 of SEQ ID NO: 2, a NusG superfamily N-terminal domain (NGN) at amino acid positions 224-313 of SEQ ID NO: 2 and a SPT5 C-terminal domain (SPT5 CTD) at amino acid positions 856-934 of SEQ ID NO: 2.

[0134] Thus, in certain other aspects, a native SPT5 protein of the disclosure comprises a SPT5 NTD comprising at least about 80% identity to SEQ ID NO: 5 (e.g., see FIG. 2B, SEQ ID NO: 5). In other embodiments, a SPT5 protein comprises a NGN domain comprising at least about 80% identity to SEQ ID NO:6 (e.g., see FIG. 2B, SEQ ID NO: 6). In another embodiment SPT5 protein comprises a SPT5 CTD comprising at least about 80% identity to SEQ ID NO: 7 (e.g., see FIG.2B, SEQ ID NO: 7).

[0135] In one or more other embodiments or aspects, the disclosure provides recombinant fungal cells comprising genetic modifications rendering the fungal cells deficient in the expression of a native SPT5 protein. In certain embodiments or aspects, the skilled artisan may refer to one or more Figures (Drawings) presented herein, and / or one or more nucleic acid (DNA) sequences described herein and / or one or more protein (amino acid) sequences of the disclosure. In certain other embodiments or aspects, the skilled artisan may refer to FIG. 1 and / or FIG. 2 of the disclosure, particularly as related such native and variant SPT5 protein (amino acid) sequences described herein. In certain other embodiments or aspects, a wild- type (WT) T. reesei SPT5 gene encoding a native SPT5 protein comprises substantial sequence identity to the native SPT5 protein of SEQ ID NO: 2. In other embodiments or aspects, a WT SPT5 gene comprises substantial sequence identity to the WT SPT5 gene of SEQ ID NO: 1. In certain other embodiments oraspects, a WT SPT5 gene comprises a genetic modification in a portion of the SPT5 gene CDS, including, but not limited to, a portion of the SPT5 gene CDS encoding one or more native SPT5 protein domains selected from a SPT5 NTD, a SPT5 NGN superfamily domain, a SPT5 CTD, or a portion of SPT5 gene CDS intervening one or more the native SPT5 protein domains (i.e., SPT5 NTD, SPT5 NGN, SPT5 CTD) or a portion of an upstream (5ʹ) SPT5 gene regulatory sequence, and / or a portion an downstream (3ʹ) SPT5 gene regulatory sequence and the like. As presented and described below in the Examples, such genetically modified filamentous fungal cells rendered deficient in the expression / production of the native SPT5 protein are particularly useful for the enhanced production of proteins of interest at elevated fermentation temperatures.

[0136] Based on the foregoing, the following sections further describe, inter alia, molecular biology techniques, process and the like for constructing / rendering filamentous fungal cells deficient in the expression / production of a native (functional) SPT5 protein, molecular biology techniques, process and the like for constructing recombinant (modified) filamentous fungal cells expressing / producing one or more lignocellulosic degrading enzymes, molecular biology techniques, process and the like for constructing recombinant (modified) filamentous fungal cells expressing / producing one or more heterologous proteins of interest, heterologous and / or endogenous proteins of interest suitable for expression / production in filamentous fungal cells of the disclosure, compositions, methods, techniques and the like for growing / fermenting / cultivating filamentous fungal cells for the production / expression / secretion of one or more heterologous and / or endogenous proteins of interest, methods, techniques and the like for detecting, assaying, quantifying, and the like one or more proteins . heterologous and / or endogenous proteins of interest III. MOLECULAR BIOLOGY

[0137] As generally set forth above, certain embodiments of the disclosure are related to modified filamentous fungal cells comprising enhanced protein productivity phenotypes. In certain embodiments, modified (variant) filamentous fungal cells comprise enhanced protein productivity phenotypes at elevated fermentation (cultivation) temperatures. In certain other embodiments or aspects of the disclosure, modified filamentous fungal cells comprise genetic modifications rendering the fungal cells deficient in the production of a native SPT5 protein. Thus, certain embodiments are related to molecular biology, genetic modifications, polynucleotides, genes, ORFs, gene coding (CDS) sequences, vectors, expression cassettes, and the like. In certain other embodiments, the disclosure is related to recombinant nucleic acids (polynucleotides, expression cassettes, etc.) comprising a gene or gene CDS or ORF encoding one or more proteins of interest. In certain embodiments, a polynucleotide of the disclosure comprises one or more selectable markers. Selectable markers for use in filamentous fungi include, but are not limited to, alsl,amdS, hygR, pyr2, pyr4, pyrG, sucA, a bleomycin resistance marker, a blasticidin resistance marker, a pyrithiamine resistance marker, a chlorimuron ethyl resistance marker, a neomycin resistance marker, an adenine pathway gene, a tryptophan pathway gene, a thymidine kinase marker, and the like. In particular embodiments, the selectable marker is pyr2, which compositions and methods of use are generally set forth in PCT Publication No. WO2011 / 153449.

[0138] In other embodiments or aspects of the disclosure, filamentous fungal cells comprise genetic modifications rendering the fungal cells deficient in the production of a native SPT5 protein. In certain embodiments or aspects, and further discussed below, such genetic modifications include, but are not limited to, the introduction, substitution, or removal of one or more nucleotides in the SPT5 gene or SPT5 gene CDS thereof, or the introduction, substitution, or removal of one or more nucleotides in a regulatory element required for the transcription or translation of the SPT5 gene (or SPT5 gene CDS thereof), SPT5 gene disruptions, SPT5 gene conversions, SPT5 gene deletions, SPT5 genes down-regulation, specific SPT5 mutagenesis and / or random SPT5 mutagenesis of a gene encoding a SPT5 protein.

[0139] Standard techniques for transformation of filamentous fungi and culturing the fungi (which are well known to one skilled in the art) are used to transform a fungal host cell of the disclosure. Thus, the introduction of a DNA construct or vector into a fungal host cell includes techniques such as transformation, electroporation, nuclear microinjection, transduction, transfection (e.g., lipofection mediated and DEAE- Dextrin mediated transfection), incubation with calcium phosphate DNA precipitate, high velocity bombardment with DNA-coated micro-projectiles, gene gun or biolistic transformation, protoplast fusion and the like. General transformation techniques are known in the art. The expression of heterologous proteins in Trichoderma is described, for example, in U.S. Patent No.6,022,725; U.S. Patent No.6,268,328. Reference is also made to Cao et al. (2000) for transformation of Aspergillus strains.

[0140] Generally, transformation of Trichoderma sp. uses protoplasts or cells that have been subjected to a permeability treatment, typically at a density of 105 to 107 / mL, particularly 2×106 / mL. A volume of 100 μL of these protoplasts or cells in an appropriate solution (e.g., 1.2 M sorbitol and 50 mM CaCl2) is mixed with the desired DNA. Generally, a high concentration of polyethylene glycol (PEG) is added to the uptake solution. Additives, such as dimethyl sulfoxide, heparin, spermidine, potassium chloride and the like, may also be added to the uptake solution to facilitate transformation. Similar procedures are available for other fungal host cells (e.g., see U.S. Patent No. 6,022,725 and U.S. Patent No. 6,268,328, both of which are incorporated by reference.

[0141] Thus, the methods and compositions of instant disclosure generally rely on routine techniques in the field of recombinant genetics. For example, in certain embodiments, a heterologous gene or ORF encoding a protein of interest is introduced into a filamentous fungal (host) cell. In certain embodiments, the heterologous gene or ORF is typically cloned into an intermediate vector, before being transformed intoa filamentous fungal (host) cells for replication and / or expression. These intermediate vectors can be prokaryotic vectors, such as, e.g., plasmids, or shuttle vectors. In certain embodiments, the expression of the heterologous gene or ORF is under the control of its native promoter. In other embodiments, the expression of the heterologous gene or ORF is placed under the control of a heterologous promoter, which can be a heterologous constitutive promoter or a heterologous inducible promoter.

[0142] Those skilled in the art are aware that a natural (native) promoter can be modified by replacement, substitution, addition, or elimination of one or more nucleotides, without changing its function. The practice of the invention encompasses but is not constrained by such alterations to the promoter.

[0143] The expression vector typically contains a transcription unit or “expression cassette” that contains all the additional elements required for the expression of the heterologous sequence. For example, a typical expression cassette contains a 5′ promoter operably linked to a heterologous nucleic acid sequence encoding a protein of interest and may further comprise sequence signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination sequences. Additional elements of the cassette may include enhancers and, if genomic DNA is used as the structural gene, introns with functional splice donor and acceptor sites.

[0144] In addition to a promoter sequence, the expression cassette may also contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes. Although any fungal terminator is likely to be functional in the present invention, preferred terminators include: the terminator from Trichoderma cbhI gene, the terminator from Aspergillus nidulans trpC gene and the Aspergillus awamori or Aspergillus niger glucoamylase genes.

[0145] The particular expression vector used to transport the genetic information into the cell is not particularly critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells may be used. Standard bacterial expression vectors include bacteriophages λ and M13, as well as plasmids such as pBR322 based plasmids, pSKF, pET23D, and fusion expression systems such as MBP, GST, and LacZ. Epitope tags can also be added to recombinant proteins to provide convenient methods of isolation, e.g., c-myc.

[0146] The elements that can be included in expression vectors may also be a replicon, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, or unique restriction sites in nonessential regions of the plasmid to allow insertion of heterologous sequences. The particular antibiotic resistance gene chosen is not dispositive either, as any of the many resistance genes known in the art may be suitable. The prokaryotic sequences are preferably chosen such that they do not interfere with the replication or integration of the DNA in the fungal host.

[0147] The methods of transformation of the present invention may result in the stable integration of all or part of the transformation vector into the genome of the filamentous fungus. However, transformation resulting in the maintenance of a self-replicating extra-chromosomal transformation vector is also contemplated. Many standard transfection methods can be used to produce Trichoderma reesei cell lines that express large quantities of the heterologous protein, and as such, any of the known procedures for introducing foreign nucleotide sequences into fungal host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, biolistics, liposomes, microinjection, plasma vectors, viral vectors and any of the other known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell. Also of use is the Agrobacterium-mediated transfection method such as the one described in U.S. Patent No.6,255,115.

[0148] After the expression vector is introduced into the cells, the transformed cells are cultured under conditions favoring expression of gene. Large batches of transformed cells can be cultured as described herein. Finally, the protein product is recovered from the culture using standard techniques. Thus, the disclosure herein provides for the expression and enhanced production of desired proteins of interest, particularly at elevated fermentation (cultivation) temperatures described herein.

[0149] In certain other embodiments, the disclosure is related genetically modified filamentous fungal strains (cells) comprising enhanced protein productivity phenotypes. In particular embodiments, a modified fungal strain of the disclosure comprised an enhanced protein productivity phenotype at elevated fermentation temperatures. For example, in certain embodiments, a variant strain of filamentous fungus comprises genetic modification of a gene encoding a SPT5 protein, wherein the genetic modification includes, but is not limited to: (a) the introduction, substitution, or removal of one or more nucleotides in the SPT5 gene (or ORF thereof), or the introduction, substitution, or removal of one or more nucleotides in a regulatory element required for the transcription or translation of the SPT5 gene (or ORF thereof), (b) a gene disruption, (c) a gene conversion, (d) a gene deletion, (e) a gene down-regulation, (f) specific mutagenesis and / or (g) random mutagenesis of a gene encoding a SPT5 protein (e.g., SEQ ID NO: 2).

[0150] Thus, in certain embodiments, a variant strain of filamentous fungus comprising a genetic modification is constructed by gene deletion to eliminate the expression / production of the SPT5 protein (i.e., rendering the cell deficient in the expression of the native SPT5 protein).

[0151] In other embodiments, a variant strain of filamentous fungus comprising a genetic modification is constructed by partial gene deletion or gene disruption to eliminate the expression / production of the native SPT5 protein. For example, as set forth below in the Examples, inactivation of the wild-type SPT5 gene in a parental filamentous fungal strain resulted in a mutant strain comprising an enhanced protein productivity phenotype relative to the parental cell when cultivated at 29 °C.

[0152] Thus, in certain embodiments, a modified filamentous fungal strain comprises a partial deletion of the SPT5 gene, wherein a partial deletion includes the partial deletion of any portion of the SPT5 gene’s coding sequence, wherein such variant strain comprises an enhanced protein productivity phenotype. Thus, in certain other embodiments, such variant strains do not express / produce the SPT5 protein, or such variant strains express / produce a reduced amount of the SPT5 protein relative to the parental strain.

[0153] Thus, as generally set forth herein and described above, one skilled in the art may readily perform one or more genetic modifications rendering filamentous fungal cells deficient in the expression of the native SPT5 protein by reference to one or more nucleic acid sequences and / or protein sequence disclosed herein. For example, gene deletion techniques enable the partial or complete removal of the gene, thereby completely eliminating or reducing expression / production of the encoded protein (e.g., SPT5). In such methods, the deletion of the gene may be accomplished by homologous recombination using an integration plasmid / vector that has been constructed to contiguously contain the 5′ and 3′ regions flanking the gene. The contiguous 5′ and 3′ regions may be introduced into a filamentous fungal cell, for example, on an integrative plasmid / vector in association with a selectable marker to allow the plasmid to become integrated in the cell.

[0154] In other embodiments, a variant strain of filamentous fungus comprises genetic modification which disrupts or inactivates the gene encoding the protein (e.g., SPT5). Exemplary methods of gene disruption / inactivation include disrupting any portion of the gene, including the gene coding sequence (CDS), promoter, enhancer, or another regulatory element, which disruption includes substitutions, insertions, deletions, inversions, and combinations thereof and variations thereof. A non-limiting example of a gene disruption technique includes inserting (integrating) into one or more of the genes of the disclosure an integrative plasmid containing a nucleic acid fragment homologous to the (e.g., SPT5) gene, which will create a duplication of the region of homology and incorporate (insert) vector DNA between the duplicated regions. In certain other non-limiting examples, a gene disruption technique includes inserting into a gene (e.g., a gene encoding a SPT5 protein) an integrative plasmid containing a nucleic acid fragment homologous to the (e.g., SPT5) gene, which will create a duplication of the region of homology and incorporate (insert) vector DNA between the duplicated regions, wherein the vector DNA inserted separates, e.g., the promoter of the SPT5 gene from the SPT5 protein coding region, or interrupts (disrupts) the coding, or non-coding, sequence of the SPT5 gene, resulting in an enhanced protein productivity phenotype. Thus, a disrupting construct may be a selectable marker gene (e.g., pyr2) accompanied by 5′ and 3′ regions homologous to the SPT5 gene. The selectable marker enables identification of transformants containing the disrupted gene. Thus, in certain embodiments, gene disruption includes modification of control elements of the gene, such as the promoter, ribosomal binding site (RBS), untranslated regions (UTRs), codon changes, and the like .

[0155] In other embodiments, a variant strain of filamentous fungus is constructed (i.e., genetically modified) by introducing, substituting, or removing one or more nucleotides in the gene, or a regulatory element required for the transcription or translation thereof. For example, nucleotides may be inserted or removed so as to result in the introduction of a pre-mature stop codon, the removal of the start codon, or a frame-shift of the open reading frame (ORF). Such a modification may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art.

[0156] In another embodiment, a variant strain of filamentous fungus is constructed by the process of gene conversion. For example, in the gene conversion method, a nucleic acid sequence corresponding to the target gene is mutagenized in vitro to produce a defective nucleic acid sequence, which is then transformed into the parental cell to produce a variant cell comprising a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous gene. It may be desirable that the defective gene or gene fragment also encodes a marker which may be used for selection of transformants containing the defective gene. For example, the defective gene may be introduced on a non- replicating or temperature- sensitive plasmid in association with a selectable marker. Selection for integration of the plasmid is affected by selection for the marker under conditions not permitting plasmid replication. Selection for a second recombination event leading to gene replacement is affected by examination of colonies for loss of the selectable marker and acquisition of the mutated gene.

[0157] In other embodiments, a variant strain of filamentous fungus is constructed by established anti- sense (gene-silencing) techniques, using a nucleotide sequence complementary to the nucleic acid sequence of the SPT5 gene. More specifically, expression of a SPT5 gene by a filamentous fungus strain may be reduced (down-regulated) or eliminated by introducing a nucleotide sequence complementary to the nucleic acid sequence of the SPT5 gene, which is transcribed in the cell and is capable of hybridizing to the mRNA produced in the cell. Under conditions allowing the complementary anti-sense nucleotide sequence to hybridize to the mRNA, the amount of protein translated is thus reduced or eliminated (i.e., rendering the modified cell deficient in the expression of the native SPT5 protein). Such anti-sense methods include, but are not limited to RNA interference (RNAi), small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides, and the like, all of which are well known to the skilled artisan.

[0158] In other embodiments, a variant strain of filamentous fungus is constructed by random or specific mutagenesis using methods well known in the art, including, but not limited to, chemical mutagenesis and transposition. Modification of the gene may be performed by subjecting the parental cell to mutagenesis and screening for mutant cells in which expression of the SPT5 gene has been reduced or eliminated. The mutagenesis, which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, use of a suitable oligonucleotide, or subjecting the DNA sequence to PCR generated mutagenesis. Furthermore, the mutagenesis may be performed by use of any combinationof these mutagenizing methods. Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N- nitrosoguanidine (MNNG), N-methyl-N'-nitrosoguanidine (NTG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues. When such agents are used, the mutagenesis is typically performed by incubating the parental cell to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions and selecting for mutant cells exhibiting reduced or no expression of the gene.

[0159] In certain other embodiments, a variant strain of filamentous fungus is constructed by means of site-specific gene editing techniques. For example, in certain embodiments, a variant strain of filamentous fungus is constructed (i.e., genetically modified) by use of transcriptional activator like endonucleases (TALENs), zinc-finger endonucleases (ZFNs), homing (mega) endonuclease and the like. More particularly, the portion of the gene to be modified (e.g., a coding region, a non-coding region, a leader sequence, a pro-peptide sequence, a signal sequence, a transcription terminator, a transcriptional activator, or other regulatory elements required for expression of the coding region) is subjected genetic modification by means of ZFN gene editing, TALEN gene editing, homing (mega) endonuclease and the like, which modification methods are well known and available to one skilled in the art.

[0160] In certain other embodiments, a variant strain of filamentous fungus is constructed by means of CRISPR / Cas9 editing (e.g., see Examples herewith). More specifically, compositions and methods for fungal genome modification by CRISPR / Cas9 systems are described and well known in the art (e.g., see, PCT Publication Nos: WO2016 / 100571, WO2016 / 100568, WO2016 / 100272, WO2016 / 100562 and the like). Thus, a gene encoding a SPT5 protein can be disrupted, deleted, mutated, or otherwise genetically modified by means of nucleic acid guided endonucleases, that find their target DNA by binding either a guide RNA (e.g., Cas9) or a guide DNA (e.g., NgAgo), which recruits the endonuclease to the target sequence on the DNA, wherein the endonuclease can generate a single or double stranded break in the DNA. This targeted DNA break becomes a substrate for DNA repair and can recombine with a provided editing template to disrupt or delete the gene. For example, the gene encoding the nucleic acid guided endonuclease (e.g., a Cas9 from S. pyogenes, or a codon optimized gene encoding the Cas9 nuclease) is operably linked to a promoter active in the filamentous fungal cell and a terminator active in filamentous fungal cell, thereby creating a filamentous fungal Cas9 expression cassette. Likewise, one or more target sites unique to the gene of interest are readily identified by a person skilled in the art.

[0161] For example, to build a DNA construct encoding a gRNA-directed to a target site within the gene of interest, the variable targeting domain (VT) will comprise nucleotides of the target site which are 5′ of the (PAM) proto-spacer adjacent motif (TGG), which nucleotides are fused to DNA encoding the Cas9 endonuclease recognition domain for S. pyogenes Cas9 (CER). The combination of the DNA encoding aVT domain and the DNA encoding the CER domain thereby generate a DNA encoding a gRNA. Thus, a filamentous fungal expression cassette for the gRNA is created by operably linking the DNA encoding the gRNA to a promoter active in filamentous fungal cells and a terminator active in filamentous fungal cells.

[0162] In certain embodiments, the DNA break induced by the endonuclease is repaired / replaced with an incoming sequence. For example, to precisely repair the DNA break generated by the Cas9 expression cassette and the gRNA expression cassette described above, a nucleotide editing template is provided, such that the DNA repair machinery of the cell can utilize the editing template. For example, about 500bp 5′ of targeted gene can be fused to about 500bp 3′ of the targeted gene to generate an editing template, which template is used by the filamentous fungal host’s machinery to repair the DNA break generated by the RGEN (RNA-guided endonuclease).

[0163] The Cas9 expression cassette, the gRNA expression cassette and the editing template can be co- delivered to filamentous fungal cells using many different methods (e.g., protoplast fusion, electroporation, natural competence, or induced competence). The transformed cells are screened by PCR, by amplifying the target locus with a forward and reverse primer. These primers can amplify the wild-type locus or the modified locus that has been edited by the RGEN. These fragments are then sequenced using a sequencing primer to identify edited colonies.

[0164] Another way in which a gene encoding a SPT5 protein of the disclosure can be genetically modified is by altering the expression level of the gene of interest. For example, nuclease-defective variants of such nucleotide-guided endonucleases (e.g., Cas9 D10A, N863A or Cas9 D10A, H840A) can be used to modulate gene expression levels by enhancing or antagonizing transcription of the target gene. These Cas9 variants are inactive for all nuclease domains present in the protein sequence, but retain the RNA-guided DNA binding activity (i.e., these Cas9 variants are unable to cleave either strand of DNA when bound to the cognate target site). Thus, the nuclease-defective proteins (i.e., Cas9 variants) can be expressed as a filamentous fungus expression cassette and when combined with a filamentous fungus gRNA expression cassette, such that the Cas9 variant protein is directed to a specific target sequence within the cell. The binding of the Cas9 (variant) protein to specific gene target sites can block the binding or movement of transcription machinery on the DNA of the cell, thereby decreasing the amount of a gene product produced. Thus, any of the genes disclosed herein can be targeted for reduced gene expression using this method. Gene silencing can be monitored in cells containing the nuclease-defective Cas9 expression cassette and the gRNA expression cassette(s) by using methods such as RNAseq.

[0165] Thus, in certain one or more embodiments, recombinant (modified) filamentous fungal cells of the disclosure comprise genetic modifications rendering the cells deficient in the expression of the native SPT5 protein, wherein the modified cells are at least about 5% to 100% deficient in the expression of the native SPT5 protein. In certain embodiments, modified filamentous fungal cells of the disclosure are therefore atleast about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% to 100% deficient in the expression of the native SPT5 protein. IV. PROTEINS OF INTEREST

[0166] As briefly stated in the preceding sections, the present strains and methods find use in the production of commercially important proteins in submerged cultures of filamentous fungi. A protein of interest (POI) of the instant disclosure can be any endogenous or heterologous protein, and it may be a variant of such a POI. The protein can contain one or more disulfide bridges or is a protein whose functional form is a monomer or a multimer, i.e., the protein has a quaternary structure and is composed of a plurality of identical (homologous) or non-identical (heterologous) subunits, wherein the POI or a variant POI thereof is preferably one with properties of interest.

[0167] In certain embodiments, a variant strain of filamentous fungus exhibits an increased protein titer relative to the (unmodified) parental strain, wherein protein titer is defined as the amount of protein per volume (g / L). For example, titers can be measured by methods known in the art (e.g., ELISA, HPLC, Bradford assay, LC / MS and the like). Thus, in certain embodiments, a variant strain of filamentous fungus comprises a protein titer increase of at least about 0.1 %, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more as compared to the unmodified (parental) cell.

[0168] In certain embodiments, a variant strain of filamentous fungus exhibits an increased volumetric productivity relative to the (unmodified) parental strain, wherein volumetric productivity is defined as the amount of protein produced (g) during the fermentation per nominal volume (L) of the bioreactor per total fermentation time (h). For example, volumetric productivities can be measured by methods know in the art (e.g., ELISA, HPLC, Bradford assay, LC / MS and the like). Thus, in certain embodiments, a variant strain of filamentous fungus comprises a volumetric productivity increase of at least about 0.1 %, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more as compared to the unmodified (parental) cell.

[0169] In certain other embodiments, a variant strain of filamentous fungus exhibits an increased total protein yield, wherein total protein yield is defined as the amount of protein produced (g) per gram of carbohydrate fed, relative to the (unmodified) parental strain. Thus, as used herein, total protein yield (g / g) may be calculated using the following equation: “Yf = Tp / Tc”

[0170] wherein “Yf” is total protein yield (g / g), “Tp” is the total protein produced during the fermentation (g) and “Tc” is the total carbohydrate (g) fed during the fermentation (bioreactor) run. In certain embodiments, the increase in total protein yield of the modified strain (i.e., relative to the parental strain)is an increase of at least about 0.1 %, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more as compared to the unmodified (parental) cell.

[0171] Total protein yield may also be described as carbon conversion efficiency / carbon yield, for example, as in the percentage (%) of carbon fed that is incorporated into total protein. Thus, in certain embodiments, a variant strain of filamentous fungus comprises an increased carbon conversion efficiency (e.g., an increase in the percentage (%) of carbon fed that is incorporated into total protein), relative to the (unmodified) parental strain. In certain embodiments, the increase in carbon conversion efficiency of the modified strain (i.e., relative to the parental strain) is an increase of at least about 0.1 %, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more as compared to the unmodified (parental) cell.

[0172] In certain embodiments, a variant strain of filamentous fungus exhibits an increased specific productivity (Qp) of a POI relative the (unmodified) parental strain. For example, the detection of specific productivity (Qp) is a suitable method for evaluating rate of protein production. The specific productivity (Qp) can be determined using the following equation: “Qp = gP / gDCW•hr”

[0173] wherein, “gP” is grams of protein produced in the tank; “gDCW” is grams of dry cell weight (DCW) in the tank and “hr” is fermentation time in hours from the time of inoculation, which includes the time of production as well as growth time. Thus, in certain embodiments, a variant strain of filamentous fungus comprises a specific productivity (Qp) increase of at least about 0.1 %, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more as compared to the unmodified (parental) cell.

[0174] In certain embodiments, a POI or a variant POI thereof is selected from the group consisting of acetyl esterases, aminopeptidases, amylases, arabinases, arabinofuranosidases, carbonic anhydrases, carboxypeptidases, catalases, cellulases, chitinases, chymosins, cutinases, deoxyribonucleases, epimerases, esterases, α-galactosidases, β-galactosidases, α-glucanases, glucan lyases, endo-β-glucanases, glucoamylases, glucose oxidases, α-glucosidases, β-glucosidases, glucuronidases, glycosyl hydrolases, hemicellulases, hexose oxidases, hydrolases, invertases, isomerases, laccases, ligases, lipases, lyases, mannanases, mannosidases, oxidases, oxidoreductases, pectate lyases, pectin acetyl esterases, pectin depolymerases, pectin methyl esterases, pectinolytic enzymes, perhydrolases, polyol oxidases, peroxidases, phenoloxidases, phytases, polygalacturonases, proteases, peptidases, rhamno-galacturonases, ribonucleases, transferases, transport proteins, transglutaminases, xylanases, hexose oxidases, and combinations thereof.

[0175] In certain embodiments, a POI or a variant POI thereof is selected from an Enzyme Commission (EC) Number selected from the group consisting of EC 1, EC 2, EC 3, EC 4, EC 5 or EC 6.

[0176] For example, in certain embodiments a POI is an oxidoreductase enzyme, including, but not limited to, an EC1 (oxidoreductase) enzyme selected from EC 1.10.3.2 (e.g., a laccase), EC 1.10.3.3 (e.g., L- ascorbate oxidase), EC 1.1.1.1 (e.g., alcohol dehydrogenase), EC 1.11.1.10 (e.g., chloride peroxidase), EC 1.11.1.17 (e.g., peroxidase), EC 1.1.1.27 (e.g., L-lactate dehydrogenase), EC 1.1.1.47 (e.g., glucose 1- dehydrogenase), EC 1.1.3.X (e.g., glucose oxidase), EC 1.1.3.10 (e.g., pyranose oxidase), EC 1.13.11.X (e.g., dioxygenase), EC 1.13.11.12 (e.g., lineolate 13S-lipozygenase), EC 1.1.3.13 (e.g., alcohol oxidase), EC 1.14.14.1 (e.g., monooxygenase), EC 1.14.18.1 (e.g., monophenol monooxigenase), EC 1.15.1.1 (e.g., superoxide dismutase), EC 1.1.5.9 (formerly EC 1.1.99.10, e.g., glucose dehydrogenase), EC 1.1.99.18 (e.g., cellobiose dehydrogenase), EC 1.1.99.29 (e.g., pyranose dehydrogenase), EC 1.2.1.X (e.g., fatty acid reductase), EC 1.2.1.10 (e.g., acetaldehyde dehydrogenase), EC 1.5.3.X (e.g., fructosyl amine reductase), EC 1.8.1.X (e.g., disulfide reductase) and EC 1.8.3.2 (e.g., thiol oxidase).

[0177] In certain embodiments a POI is a transferase enzyme, including, but not limited to, an EC 2 (transferase) enzyme selected from EC 2.3.2.13 (e.g., transglutaminase), EC 2.4.1.X (e.g., hexosyltransferase), EC 2.4.1.40 (e.g., alternasucrase), EC 2.4.1.18 (e.g., 1,4 alpha-glucan branching enzyme), EC 2.4.1.19 (e.g., cyclomaltodextrin glucanotransferase), EC 2.4.1.2 (e.g., dextrin dextranase), EC 2.4.1.20 (e.g., cellobiose phosphorylase), EC 2.4.1.25 (e.g., 4-alpha-glucanotransferase), EC 2.4.1.333 (e.g., 1,2-beta-oligoglucan phosphor transferase), EC 2.4.1.4 (e.g., amylosucrase), EC 2.4.1.5 (e.g., dextransucrase), EC 2.4.1.69 (e.g., galactoside 2-alpha-L-fucosyl transferase), EC 2.4.1.9 (e.g., inulosucrase), EC 2.7.1.17 (e.g., xylulokinase), EC 2.7.7.89 (formerly EC 3.1.4.15, e.g., [glutamine synthetase]-adenylyl-L-tyrosine phosphorylase), EC 2.7.9.4 (e.g., alpha glucan kinase) and EC 2.7.9.5 (e.g., phosphoglucan kinase).

[0178] In other embodiments a POI is a hydrolase enzyme, including, but not limited to, an EC 3 (hydrolase) enzyme selected from EC 3.1.X.X (e.g., an esterase), EC 3.1.1.1 (e.g., pectinase), EC 3.1.1.14 (e.g., chlorophyllase), EC 3.1.1.20 (e.g., tannase), EC 3.1.1.23 (e.g., glycerol-ester acylhydrolase), EC

[0179] 3.1.1.26 (e.g., galactolipase), EC 3.1.1.32 (e.g., phospholipase A1), EC 3.1.1.4 (e.g., phospholipase A2), EC 3.1.1.6 (e.g., acetylesterase), EC 3.1.1.72 (e.g., acetylxylan esterase), EC 3.1.1.73 (e.g., feruloyl esterase), EC 3.1.1.74 (e.g., cutinase), EC 3.1.1.86 (e.g., rhamnogalacturonan acetylesterase), EC 3.1.1.87 (e.g., fumosin B1 esterase), EC 3.1.26.5 (e.g., ribonuclease P), EC 3.1.3.X (e.g., phosphoric monoester hydrolase), EC 3.1.30.1 (e.g., Aspergillus nuclease S1), EC 3.1.30.2 (e.g., Serratia marcescens nuclease), EC 3.1.3.1 (e.g., alkaline phosphatase), EC 3.1.3.2 (e.g., acid phosphatase), EC 3.1.3.8 (e.g., 3-phytase), EC 3.1.4.1 (e.g., phosphodiesterase I), EC 3.1.4.11 (e.g., phosphoinositide phospholipase C), EC 3.1.4.3 (e.g., phospholipase C), EC 3.1.4.4 (e.g., phospholipase D), EC 3.1.6.1 (e.g., arylsufatase), EC 3.1.8.2 (e.g.,diisopropyl-fluorophosphatase), EC 3.2.1.10 (e.g., oligo-1,6-glucosidase), EC 3.2.1.101 (e.g., mannan endo-1,6-alpha-mannosidase), EC 3.2.1.11 (e.g., alpha-1,6-glucan-6-glucanohydrolase), EC 3.2.1.131 (e.g., xylan alpha-1,2-glucuronosidase), EC 3.2.1.132 (e.g., chitosan N-acetylglucosaminohydrolase), EC

[0180] 3.2.1.139 (e.g., alpha-glucuronidase), EC 3.2.1.14 (e.g., chitinase), EC 3.2.1.151 (e.g., xyloglucan- specific endo-beta-1,4-glucanase), EC 3.2.1.155 (e.g., xyloglucan-specific exo-beta-1,4-glucanase), EC 3.2.1.164 (e.g., galactan endo-1,6-beta-galactosidase), EC 3.2.1.17 (e.g., lysozyme), EC 3.2.1.171 (e.g., rhamnogalacturonan hydrolase), EC 3.2.1.174 (e.g., rhamnogalacturonan rhamnohydrolase), EC 3.2.1.2 (e.g., beta-amylase), EC 3.2.1.20 (e.g., alpha-glucosidase), EC 3.2.1.22 (e.g., alpha-galactosidase), EC

[0181] 3.2.1.25 (e.g., beta-mannosidase), EC 3.2.1.26 (e.g., beta-fructofuranosidase), EC 3.2.1.37 (e.g., xylan 1,4-beta-xylosidase), EC 3.2.1.39 (e.g., glucan endo-1,3-beta-D-glucosidase), EC 3.2.1.40 (e.g., alpha-L-rhamnosidase), EC 3.2.1.51 (e.g., alpha-L-fucosidase), EC 3.2.1.52 (e.g., beta-N- Acetylhexosaminidase), EC 3.2.1.55 (e.g., alpha-N-arabinofuranosidase), EC 3.2.1.58 (e.g., glucan 1,3-beta-glucosidase), EC 3.2.1.59 (e.g., glucan endo-1,3-alpha-glucosidase), EC 3.2.1.67 (e.g., galacturan 1,4-alpha- galacturonidase), EC 3.2.1.68 (e.g., isoamylase), EC 3.2.1.7 (e.g., 1-beta-D-fructan fructanohydrolase), EC 3.2.1.74 (e.g., glucan 1,4-β-glucosidase), EC 3.2.1.75 (e.g., glucan endo-1,6-beta- glucosidase), EC 3.2.1.77 (e.g., mannan 1,2-(1,3)-alpha-mannosidase), EC 3.2.1.80 (e.g., fructan beta- fructosidase), EC 3.2.1.82 (e.g., exo-poly-alpha-galacturonosidase), EC 3.2.1.83 (e.g., kappa- carrageenase), EC 3.2.1.89 (e.g., arabinogalactan endo-1,4-beta-galactosidase), EC 3.2.1.91 (e.g., cellulose 1,4-beta-cellobiosidase), EC 3.2.1.96 (e.g., mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase), EC 3.2.1.99 (e.g., arabinan endo-1,5-alpha-L-arabinanase), EC 3.4.X.X (e.g., peptidase), EC 3.4.11.X (e.g., aminopeptidase), EC 3.4.11.1 (e.g., leucyl aminopeptidase), EC 3.4.11.18 (e.g., methionyl aminopeptidase), EC 3.4.13.9 (e.g., Xaa-Pro dipeptidase), EC 3.4.14.5 (e.g., dipeptidyl-peptidase IV), EC 3.4.16.X (e.g., serine-type carboxypeptidase), EC 3.4.16.5 (e.g., carboxypeptidase C), EC 3.4.19.3 (e.g., pyroglutamyl-peptidase I), EC 3.4.21.X (e.g., serine endopeptidase), EC 3.4.21.1 (e.g., chymotrypsin), EC 3.4.21.19 (e.g., glutamyl endopeptidase), EC 3.4.21.26 (e.g., prolyl oligopeptidase), EC 3.4.21.4 (e.g., trypsin), EC 3.4.21.5 (e.g., thrombin), EC 3.4.21.63 (e.g., oryzin), EC 3.4.21.65 (e.g., thermomycolin), EC 3.4.21.80 (e.g., streptogrisin A), EC 3.4.22.X (e.g., cysteine endopeptidase), EC 3.4.22.14 (e.g., actinidain), EC 3.4.22.2 (e.g., papain), EC 3.4.22.3 (e.g., ficain), EC 3.4.22.32 (e.g., stem bromelain), EC 3.4.22.33 (e.g., fruit bromelain), EC 3.4.22.6 (e.g., chymopapain), EC 3.4.23.1 (e.g., pepsin A), EC 3.4.23.2 (e.g., pepsin B), EC 3.4.23.22 (e.g., endothiapepsin), EC 3.4.23.23 (e.g., mucorpepsin), EC 3.4.23.3 (e.g., gastricsin), EC 3.4.24.X (e.g., metalloendopeptidase), EC 3.4.24.39 (e.g., deuterolysin), EC 3.4.24.40 (e.g., serralysin), EC 3.5.1.1 (e.g., asparaginase), EC 3.5.1.11 (e.g., penicillin amidase), EC 3.5.1.14 (e.g., N-acyl-aliphatic-L-amino acid amidohydrolase), EC 3.5.1.2 (e.g., L-glutamine amidohydrolase), EC 3.5.1.28 (e.g., N-acetylmuramoyl-L- alanine amidase), EC 3.5.1.4 (e.g., amidase), EC 3.5.1.44 (e.g.,protein-L-glutamine amidohydrolase), EC 3.5.1.5 (e.g., urease), EC 3.5.1.52 (e.g., peptide-N(4)-(N-acetyl- beta-glucosaminyl)asparagine amidase), EC 3.5.1.81 (e.g., N-Acyl-D-amino-acid deacylase), EC 3.5.4.6 (e.g., AMP deaminase) and EC 3.5.5.1 (e.g., nitrilase).

[0182] In other embodiments a POI is a lyase enzyme, including, but not limited to, an EC 4 (lyase) enzyme selected from EC 4.1.2.10 (e.g., mandelonitrile lyase), EC 4.1.3.3 (e.g., N-acetylneuraminate lyase), EC 4.2.1.1 (e.g., carbonate dehydratase), EC 4.2.2.- (e.g., rhamnogalacturonan lyase), EC 4.2.2.10 (e.g., pectin lyase), EC 4.2.2.22 (e.g., pectate trisaccharide-lyase), EC 4.2.2.23 (e.g., rhamnogalacturonan endolyase) and EC 4.2.2.3 (e.g., mannuronate-specific alginate lyase).

[0183] In certain other embodiments a POI is an isomerase enzyme, including, but not limited to, an EC 5 (isomerase) enzyme selected from EC 5.1.3.3 (e.g., aldose 1-epimerase), EC 5.1.3.30 (e.g., D-psicose 3- epimerase), EC 5.4.99.11 (e.g., isomaltulose synthase) and EC 5.4.99.15 (e.g., (1→4)-α-D-glucan 1-α-D- glucosylmutase).

[0184] In yet other embodiments, a POI is a ligase enzyme, including, but not limited to, an EC 6 (ligase) enzyme selected from EC 6.2.1.12 (e.g., 4-coumarate:coenzyme A ligase) and EC 6.3.2.28 (e.g., L-amino- acid alpha-ligase). V. FERMENTATION

[0185] In certain embodiments, the disclosure provides methods for producing a protein of interest comprising growing / cultivating / fermenting a filamentous fungal cell, wherein the fungal cell secrets the protein of interest. In general, fermentation methods well known in the art are used to ferment the fungal cells. In some embodiments, the fungal cells are grown under batch or continuous fermentation conditions. A classical batch fermentation is a closed system, where the composition of the medium is set at the beginning of the fermentation and is not altered during the fermentation. At the beginning of the fermentation, the medium is inoculated with the desired organism(s). In this method, fermentation is permitted to occur without the addition of any components to the system. Typically, a batch fermentation qualifies as a “batch” with respect to the addition of the carbon source, and attempts are often made to control factors such as pH and oxygen concentration. The metabolite and biomass compositions of the batch system change constantly up to the time the fermentation is stopped. Within batch cultures, cells progress through a static lag phase to a high growth log phase and finally to a stationary phase, where growth rate is diminished or halted. If untreated, cells in the stationary phase eventually die. In general, cells in log phase are responsible for the bulk of production of product.

[0186] A suitable variation on the standard batch system is the “fed-batch fermentation” system. In this variation of a typical batch system, the substrate is added in increments as the fermentation progresses. Fed- batch systems are useful when catabolite repression likely inhibits the metabolism of the cells and where itis desirable to have limited amounts of substrate in the medium. Measurement of the actual substrate concentration in fed-batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors, such as pH, dissolved oxygen and the partial pressure of waste gases, such as CO2. Batch and fed-batch fermentations are common and well known in the art.

[0187] Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor, and an equal amount of conditioned medium is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density, where cells are primarily in log phase growth. Continuous fermentation allows for the modulation of one or more factors that affect cell growth and / or product concentration. For example, in one embodiment, a limiting nutrient, such as the carbon source or nitrogen source, is maintained at a fixed rate and all other parameters are allowed to moderate. In other systems, a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions. Thus, cell loss due to medium being drawn off should be balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes, as well as techniques for maximizing the rate of product formation, are well known in the art of industrial microbiology.

[0188] Certain embodiments of the instant disclosure are related to fermentation procedures for culturing fungi. Fermentation procedures for production of cellulase enzymes are known in the art. For example, cellulase enzymes can be produced either by solid or submerged culture, including batch, fed-batch and continuous-flow processes. Culturing is generally accomplished in a growth medium comprising an aqueous mineral salts medium, organic growth factors, a carbon and energy source material, molecular oxygen, and, of course, a starting inoculum of the filamentous fungal host to be employed.

[0189] In addition to the carbon and energy source, oxygen, assimilable nitrogen, and an inoculum of the microorganism, it is necessary to supply suitable amounts in proper proportions of mineral nutrients to assure proper microorganism growth, maximize the assimilation of the carbon and energy source by the cells in the microbial conversion process, and achieve maximum cellular yields with maximum cell density in the fermentation media.

[0190] The composition of the aqueous mineral medium can vary over a wide range, depending in part on the microorganism and substrate employed, as is known in the art. The mineral media should include, in addition to nitrogen, suitable amounts of phosphorus, magnesium, calcium, potassium, sulfur, and sodium, in suitable soluble assimilable ionic and combined forms, and also present preferably should be certain trace elements such as copper, manganese, molybdenum, zinc, iron, boron, and iodine, and others, again in suitable soluble assimilable form, all as known in the art.

[0191] The fermentation reaction is an aerobic process in which the molecular oxygen needed is supplied by a molecular oxygen-containing gas such as air, oxygen-enriched air, or even substantially pure molecular oxygen, provided to maintain the contents of the fermentation vessel with a suitable oxygen partial pressure effective in assisting the microorganism species to grow in a thriving fashion.

[0192] The microorganisms also require a source of assimilable nitrogen. The source of assimilable nitrogen can be any nitrogen-containing compound or compounds capable of releasing nitrogen in a form suitable for metabolic utilization by the microorganism. While a variety of organic nitrogen source compounds, such as protein hydrolysates, can be employed, usually cheap nitrogen-containing compounds such as ammonia, ammonium hydroxide, urea, and various ammonium salts such as ammonium phosphate, ammonium sulfate, ammonium pyrophosphate, ammonium chloride, or various other ammonium compounds can be utilized. Ammonia gas itself is convenient for large scale operations, and can be employed by bubbling through the aqueous ferment (fermentation medium) in suitable amounts. At the same time, such ammonia can also be employed to assist in pH control.

[0193] The pH range in the aqueous microbial ferment (fermentation admixture) should be in the exemplary range of about 2.0 to 8.0. With filamentous fungi, the pH normally is within the range of about 2.5 to 8.0; with Trichoderma reesei, the pH normally is within the range of about 3.0 to 7.0. Preferences for pH range of microorganisms are dependent on the media employed to some extent, as well as the particular microorganism, and thus change somewhat with change in media as can be readily determined by those skilled in the art.

[0194] Preferably, the fermentation is conducted in such a manner that the carbon-containing substrate can be controlled as a limiting factor, thereby providing good conversion of the carbon-containing substrate to cells and avoiding contamination of the cells with a substantial amount of unconverted substrate. The latter is not a problem with water-soluble substrates, since any remaining traces are readily washed off. It may be a problem, however, in the case of non-water-soluble substrates, and require added product-treatment steps such as suitable washing steps.

[0195] As described above, the time to reach this level is not critical and may vary with the particular microorganism and fermentation process being conducted. However, it is well known in the art how to determine the carbon source concentration in the fermentation medium and whether or not the desired level of carbon source has been achieved.

[0196] The fermentation can be conducted as a batch or continuous operation, fed batch operation is much to be preferred for ease of control, production of uniform quantities of products, and most economical uses of all equipment.

[0197] If desired, part or all of the carbon and energy source material and / or part of the assimilable nitrogen source such as ammonia can be added to the aqueous mineral medium prior to feeding the aqueous mineral medium to the fermenter.

[0198] Each of the streams introduced into the reactor preferably is controlled at a predetermined rate, or in response to a need determinable by monitoring such as concentration of the carbon and energy substrate, pH, dissolved oxygen, oxygen or carbon dioxide in the off-gases from the fermenter, cell density measurable by dry cell weights, light transmittancy, or the like. The feed rates of the various materials can be varied so as to obtain as rapid a cell growth rate as possible, consistent with efficient utilization of the carbon and energy source, to obtain as high a yield of microorganism cells relative to substrate charge as possible.

[0199] In either a batch, or the preferred fed batch operation, all equipment, reactor, or fermentation means, vessel or container, piping, attendant circulating or cooling devices, and the like, are initially sterilized, usually by employing steam such as at about 121°C for at least about 15 minutes. The sterilized reactor then is inoculated with a culture of the selected microorganism in the presence of all the required nutrients, including oxygen, and the carbon-containing substrate. The type of fermenter employed is not critical.

[0200] The collection and purification of proteins from the fermentation broth can also be done by procedures known to one of skill in the art. The fermentation broth will generally contain cellular debris, including cells, various suspended solids and other biomass contaminants, as well as the desired cellulase enzyme product, which are preferably removed from the fermentation broth by means known in the art.

[0201] Suitable processes for such removal include conventional solid-liquid separation techniques such as, e.g., centrifugation, filtration, dialysis, microfiltration, rotary vacuum filtration, or other known processes, to produce a cell-free filtrate. It may be preferable to further concentrate the fermentation broth or the cell-free filtrate prior to crystallization using techniques such as ultrafiltration, evaporation or precipitation.

[0202] Precipitating the proteinaceous components of the supernatant or filtrate may be accomplished by means of a salt, e.g., ammonium sulfate, followed by purification by a variety of chromatographic procedures, e.g., ion exchange chromatography, affinity chromatography or similar art recognized procedures. VI. EXEMPLARY EMBODIMENTS

[0203] Non-limiting embodiments of the disclosure include, but are not limited to:

[0204] 1. A recombinant (modified) filamentous fungal cell derived from a parental filamentous fungal cell comprising a gene encoding a native SPT5 protein, wherein the recombinant cell comprises a genetic modification rendering the cell deficient in the expression / production of the native SPT5 protein.

[0205] 2. The recombinant cell of embodiment 1, wherein the parental cell expresses one or more endogenous proteins of interest and / or expresses one or more heterologous proteins of interest.

[0206] 3. The recombinant cell of embodiment 1, comprising an enhanced protein productivity phenotype relative to the parental cell when cultivated under the same conditions at temperature between about 25°C to 29°C.

[0207] 4. The recombinant cell of embodiment 1, wherein the gene encoding the native SPT5 protein comprises at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 1.

[0208] 5. The recombinant cell of embodiment 1, wherein the native SPT5 protein comprises at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO: 2.

[0209] 6. The recombinant cell of embodiment 1, wherein the native SPT5 protein comprises at least one domain selected from the group consisting of a SPT5 N-terminal domain (NTD) comprising at least 80% identity to SEQ ID NO: 5, a NusG superfamily (NGN) domain comprising at least 80% identity to SEQ ID NO: 6 and a SPT5 C-terminal domain (CTD) comprising at least 80% identity to SEQ ID NO: 7.

[0210] 7. The recombinant cell of embodiment 3, wherein the enhanced protein productivity phenotype is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency and increased specific productivity.

[0211] 8. The recombinant cell of embodiment 3, comprising an enhanced protein productivity phenotype relative to the parental cell when fermented under the same conditions at 26°C.

[0212] 9. The recombinant cell of embodiment 3, comprising an enhanced protein productivity phenotype relative to the parental cell when fermented under the same conditions at 27°C.

[0213] 10. The recombinant cell of embodiment 3, comprising an enhanced protein productivity phenotype relative to the parental cell when fermented under the same conditions at 28°C.

[0214] 11. The recombinant cell of embodiment 3, comprising an enhanced protein productivity phenotype relative to the parental cell when fermented under the same conditions at 29°C.

[0215] 12. The recombinant cell of embodiment 1, wherein the recombinant and parental cells comprise one or more introduced expression cassettes encoding one or more heterologous proteins of interest.

[0216] 13. The recombinant cell of embodiment 12, wherein the one or more expression cassettes encode a heterologous protein selected from the group consisting of an enzyme, a peptide, an antibody, a receptor, a growth factor, and a hormone.

[0217] 14. The recombinant cell of embodiment 13, wherein the enzyme is selected from the group consisting of an oxidoreductase, a transferase, a hydrolase, a lyase, an isomerase and a ligase.

[0218] 15. The recombinant cell of embodiment 2, expressing one or more lignocellulosic degrading enzymes.

[0219] 16. The recombinant cell of embodiment 12, comprising one or more introduced expression cassettes encoding one or more lignocellulosic degrading enzymes.

[0220] 17. The recombinant cell of embodiment 15 or embodiment 16, wherein the one or more lignocellulosic degrading enzymes are selected from the group consisting of a cellobiohydrolase, a xylanase, an endoglucanase, and a β-glucosidase.

[0221] 18. The recombinant cell of embodiment 1, further comprising a genetic modification rendering the cell deficient in the production of a native GEF1 protein.

[0222] 19. The recombinant cell of embodiment 1, wherein the genetic modification rendering the cell deficient in the expression / production of the native SPT5 protein comprises the complete or partial deletion of the wild-type SPT5 gene coding sequence (CDS) and / or the complete or partial deletion of the upstream (5ʹ) wild-type SPT5 gene promoter.

[0223] 20. The recombinant cell of embodiment 19, wherein the partial deletion of the wild-type (WT) SPT5 gene CDS comprises a deletion of at least nine (9) to about one hundred (100) contiguous nucleotides of the WT SPT5 gene CDS and / or a deletion of at least nine (9) contiguous nucleotides of the upstream WT SPT5 gene promoter.

[0224] 21. The recombinant cell of embodiment 20, wherein the partial deletion of the WT SPT5 gene CDS comprises a deletion of at least nine (9) contiguous nucleotides encoding a SPT5 N-terminal domain (NTD) comprising identity to the native SPT5 NTD of SEQ ID NO: 5, a deletion of at least 9 contiguous nucleotides encoding a SPT5 NusG domain (NGN) comprising identity to the native SPT5 NGN of SEQ ID NO: 6, a deletion of at least 9 contiguous nucleotides encoding a SPT5 C-terminal domain (CTD) comprising identity to the native SPT5 NTD of SEQ ID NO: 7, a deletion of at least 9 contiguous nucleotides preceding or following the nucleotides encoding the native SPT5 NTD of SEQ ID NO: 5, a deletion of at least 9 contiguous nucleotides preceding or following the nucleotides encoding the native SPT5 NGN of SEQ ID NO: 6, and / or a deletion of at least 9 contiguous nucleotides preceding or following the nucleotides encoding the native SPT5 CTD of SEQ ID NO: 7.

[0225] 22. The recombinant cell of embodiment 1, wherein the genetic modification rendering the cell deficient in the expression / production of the native SPT5 protein comprises a disruption of the wild- type (WT) SPT5 gene coding sequence (CDS) and / or a disruption of the upstream (5ʹ) WT SPT5 gene promoter.

[0226] 23. The recombinant cell of embodiment 22, wherein the disruption of the WT SPT5 gene CDS comprises the disruption of a SPT5 N-terminal domain (NTD) comprising identity to the native SPT5 NTD of SEQ ID NO: 5, the disruption of a SPT5 NusG domain (NGN) comprising identity to the native SPT5NGN of SEQ ID NO: 6, the disruption of a SPT5 C-terminal domain (CTD) comprising identity to the native SPT5 NTD of SEQ ID NO: 7, a disruption of a nucleotide position preceding or following the nucleotides encoding the native SPT5 NTD, a disruption of a nucleotide position preceding or following the nucleotides encoding the native NGN of SEQ ID NO: 6, and / or a disruption of a nucleotide position preceding or following the nucleotides encoding the native SPT5 CTD of SEQ ID NO: 7.

[0227] 24. The recombinant cell of embodiment 1, wherein the genetic modification rendering the cell deficient in the expression / production of the native SPT5 protein comprises an anti-sense (gene-silencing) nucleotide sequence complementary to nucleic acid sequence encoding the native of the wild-type SPT5 gene coding sequence (CDS).

[0228] 25. A mutant Trichoderma reesei cell comprising a variant SPT5 gene having a guanine (G) to adenine (A) single nucleotide polymorphism (SNP) mutation in the SPT5 gene coding sequence (CDS) at nucleotide position 2,790 of SEQ ID NO: 3.

[0229] 26. The mutant cell of embodiment 25, wherein the variant SPT5 gene encodes a truncated SPT5 protein comprising at least about 90 to 100% identity to SEQ ID NO: 4.

[0230] 27. The mutant cell of embodiment 25, expressing one or more endogenous proteins of interest and / or expressing one or more heterologous proteins of interest.

[0231] 28. The mutant cell of embodiment 25, comprising an enhanced protein productivity phenotype relative to a control T. reesei cell comprising a wild-type SPT5 gene CDS and expressing the same one or more endogenous proteins of interest and / or expressing the same one or more heterologous proteins of interest, wherein the mutant and control cells are fermented under the same conditions at temperature between about 25°C to 29°C.

[0232] 29. An isolated variant SPT5 gene comprising at least 90% to 100% identity to SEQ ID NO: 3 and comprising a G to A SNP mutation at nucleotide position 2,790 of SEQ ID NO: 3.

[0233] 30. An isolated polynucleotide encoding a variant SPT5 protein comprising at least 90% to 100% sequence identity to the C-terminally truncated SPT5 protein of SEQ ID NO: 4.

[0234] 31. A method for producing increased amounts of lignocellulosic degrading enzymes in a modified filamentous fungal cell comprising (a) obtaining a parental filamentous fungal cell having a gene encoding a native SPT5 protein, genetically modifying the parental cell to obtain a modified filamentous fungal cell deficient in the expression / production of the native SPT5 protein, and (b) fermenting the modified cell under suitable conditions for the production of lignocellulosic degrading enzymes, wherein the modified cell produces an increased amount of the lignocellulosic degrading enzymes relative to the parental cell when fermented under the same conditions at a temperature between about 25C° to 29°C.

[0235] 32. A method for producing an increased amount of a heterologous protein of interest (POI) in a modified filamentous fungal cell comprising (a) obtaining a parental filamentous fungal cell having a geneencoding a native SPT5 protein, genetically modifying the parental cell to obtain a modified filamentous fungal cell deficient in the expression / production of the native SPT5 protein, wherein an expression cassette encoding the POI is introduced into the parental cell before, during, or after rendering the cell deficient in the production of the native SPT5 protein, and (b) fermenting the modified cell under suitable conditions for the production of the heterologous POI, wherein the modified cell produces an increased amount of the POI relative to the parental cell when fermented under the same conditions at a temperature between about 25C° to 29°C.

[0236] 33. The method of embodiment 31 or embodiment 32, wherein the gene encoding the native SPT5 protein comprises at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleic acid sequence of SEQ ID NO: 1.

[0237] 34. The method of embodiment 31 or embodiment 32, wherein the native SPT5 protein comprises at least about 50%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO: 2.

[0238] 35. The method of embodiment 31 or embodiment 32, wherein the native SPT5 protein comprises at least one domain selected from the group consisting of a SPT5 N-terminal domain (NTD) comprising at least 80% identity to SEQ ID NO: 5, a NusG superfamily (NGN) domain comprising at least 80% identity to SEQ ID NO: 6 and a SPT5 C-terminal domain (CTD) comprising at least 80% identity to SEQ ID NO: 7.

[0239] 36. The method of embodiment 31 or embodiment 32, wherein the cells are fermented at 26°C.

[0240] 37. The method embodiment 31 or embodiment 32, wherein the cells are fermented at 27°C.

[0241] 38. The method of embodiment 31 or embodiment 32, wherein the cells are fermented at 28°C.

[0242] 39. The method of embodiment 31 or embodiment 32, wherein the cells are fermented at 29°C.

[0243] 40. The method of embodiment 31, wherein one or more lignocellulosic degrading enzymes are selected from the group consisting of a cellobiohydrolase, a xylanase, an endoglucanase and a β- glucosidase.

[0244] 41. The method of embodiment 32, wherein the expression cassette encodes a heterologous protein selected from the group consisting of an enzyme, a peptide, an antibody, a receptor, a growth factor, and a hormone.

[0245] 42. The method of embodiment 41, wherein the enzyme is selected from the group consisting of an oxidoreductase, a transferase, a hydrolase, a lyase, an isomerase and a ligase.

[0246] 43. The method of embodiment 31 or embodiment 32, further comprising a genetic modification rendering the cell deficient in the production of a native GEF1 protein.

[0247] 44. The method of embodiment 31 or embodiment 32, wherein the genetic modification rendering the cell deficient in the expression / production of the native SPT5 protein comprises the complete or partialdeletion of the wild-type SPT5 gene coding sequence (CDS) and / or the complete or partial deletion of the upstream (5ʹ) wild-type SPT5 gene promoter.

[0248] 45. The method of embodiment 44, wherein the partial deletion of the wild-type (WT) SPT5 gene CDS comprises a deletion of at least nine (9) to about one hundred (100) contiguous nucleotides of the WT SPT5 gene CDS and / or a deletion of at least nine (9) contiguous nucleotides of the upstream WT SPT5 gene promoter.

[0249] 46. The method of embodiment 45, wherein the partial deletion of the WT SPT5 gene CDS comprises a deletion of at least nine (9) contiguous nucleotides encoding a SPT5 N-terminal domain (NTD) comprising identity to the native SPT5 NTD of SEQ ID NO: 5, a deletion of at least 9 contiguous nucleotides encoding a SPT5 NusG domain (NGN) comprising identity to the native SPT5 NGN of SEQ ID NO: 6, a deletion of at least 9 contiguous nucleotides encoding a SPT5 C-terminal domain (CTD) comprising identity to the native SPT5 NTD of SEQ ID NO: 7, a deletion of at least 9 contiguous nucleotides preceding or following the nucleotides encoding the native SPT5 NTD of SEQ ID NO: 5, a deletion of at least 9 contiguous nucleotides preceding or following the nucleotides encoding the native SPT5 NGN of SEQ ID NO: 6, and / or a deletion of at least 9 contiguous nucleotides preceding or following the nucleotides encoding the native SPT5 CTD of SEQ ID NO: 7.

[0250] 47. The method of embodiment 31 or embodiment 32, wherein the genetic modification rendering the cell deficient in the expression / production of the native SPT5 protein comprises a disruption of the wild- type (WT) SPT5 gene coding sequence (CDS) and / or a disruption of the upstream (5ʹ) WT SPT5 gene promoter.

[0251] 48. The method of embodiment 47, wherein the disruption of the WT SPT5 gene CDS comprises the disruption of a SPT5 N-terminal domain (NTD) comprising identity to the native SPT5 NTD of SEQ ID NO: 5, the disruption of a SPT5 NusG domain (NGN) comprising identity to the native SPT5 NGN of SEQ ID NO: 6, the disruption of a SPT5 C-terminal domain (CTD) comprising identity to the native SPT5 NTD of SEQ ID NO: 7, a disruption of a nucleotide position preceding or following the nucleotides encoding the native SPT5 NTD, a disruption of a nucleotide position preceding or following the nucleotides encoding the native NGN of SEQ ID NO: 6, and / or a disruption of a nucleotide position preceding or following the nucleotides encoding the native SPT5 CTD of SEQ ID NO: 7

[0252] 49. The method of embodiment 31 or embodiment 32, wherein the genetic modification rendering the cell deficient in the expression / production of the native SPT5 protein comprises an anti-sense (gene- silencing) nucleotide sequence complementary to nucleic acid sequence encoding the native of the wild- type SPT5 gene coding sequence (CDS).

[0253] 50. The method of embodiment 31 or embodiment 32, wherein the modified cell comprises an enhanced protein productivity phenotype selected from increased protein productivity, increased totalprotein productivity, increased volumetric productivity, increased carbon conversion efficiency and increased specific productivity, as compared to the parental cell when fermented under the same conditions.

[0254] 51. The fungal cell of embodiment 1, wherein the cell is selected from the group consisting of an Acremonium sp. cell, an Aspergillus sp. cell, an Emericella sp. cell, a Fusarium sp. cell, a Humicola sp. cell, a Mucor sp. cell, a Myceliophthora sp. cell, a Neurospora sp. cell, a Penicillium sp. cell, a Scytalidium sp. cell, a Thielavia sp. cell, a Tolypocladium sp. cell, and a Trichoderma sp. cell.

[0255] 52. The method of embodiment 31 or embodiment 32, wherein the fungal cell is selected from the group consisting of an Acremonium sp. cell, an Aspergillus sp. cell, an Emericella sp. cell, a Fusarium sp. cell, a Humicola sp. cell, a Mucor sp. cell, a Myceliophthora sp. cell, a Neurospora sp. cell, a Penicillium sp. cell, a Scytalidium sp. cell, a Thielavia sp. cell, a Tolypocladium sp. cell, and a Trichoderma sp. cell. EXAMPLES

[0256] Certain aspects of the present disclosure may be further understood in light of the following examples, which should not be construed as limiting. Modifications to materials and methods will be apparent to those skilled in the art. Standard recombinant DNA and molecular cloning techniques used herein are well known in the art (Ausubel et al., 1987; Sambrook et al., 1989). EXAMPLE 1 IDENTIFYING MUTANT TRICHODERMA STRAINS COMPRISING ENHANCED PROTEIN PRODUCTIVITY PHENOTYPES AT ELEVATED CULTIVATION TEMPERATURE

[0257] As generally set forth above, PCT Publication No. WO2021 / 092356 describes inter alia, the serial propagation of a cellulase overproducing Trichoderma T4 strain under selective conditions to identity and isolate mutant T4 strains thereof capable of high temperature (HT) protein production as compared to the parental (control) T4 strain. In particular, the WO2021 / 092356 publication identified a mutant T4 strain (named “T4-GEF1”) capable of HT protein production without adversely affecting specific productivity (Qp) as compared / relative to the control T4 strain, wherein the mutant T4 strain comprised a mutated “GEF1 gene” encoded a truncated “GEF1 protein” relative to the T4 parent (control) strain.

[0258] As discussed above in Section I, TABLE 1, certain exemplary Trichoderma strains comprising a deletion of the GEF1 gene (∆GEF1, e.g., derived from control strain T4-GEF1) are described herein, which strains were serially propagated under selective conditions to isolate mutant strains capable of HT protein production, without adversely affecting specific productivity Qp. More specifically, in the instant example a mutant T. reesei strain named “T4-26rc” was identified and isolated, which mutant T4-26rc strain has a similar Qp when cultivated at 29°C as compared to the parental (control) T. reesei T4-GEF1 strain cultivated at 28°C.

[0259] For example, the T4-GEF1 control strain was sporulated on BIRD agar and 1x107spores / mL were collected from the agar plate, suspended in water and treated with 0.15 mg / mL of 1-methyl-3-nitro-1- nitrosoguanidine (Sigma 112, 994-1) for two (2) hours at room temperature until only 1% of the spores remained viable. The spores were inoculated into an evolution media containing 0.5% of either microcrystalline cellulose (EMCOCEL, JRS Pharma, Rosenburg, Germany), carboxymethylcellulose (CMC; Sigma-Aldrich C5678, St. Louis, MO), or acid swollen cellulose (e.g., for preparation see, Wood, 1971) as the sole carbon source. Also, per liter ammonium sulfate (4g), sodium phosphate monobasic (4.5g), magnesium sulfate heptahydrate (1g), calcium chloride dihydrate (1g) and 2.5 ml of a 400X trace element solution.

[0260] More particularly, in a first method, about one (1) million chemically mutated spores were inoculated into a two-hundred fifty (250) ml dented bottom flask containing the evolution medium described above with Avicel® as the sole carbon source. The flask was incubated at 180 rpm, 31°C for five (5) days. At this time, a 10% volume / volume transfer was made to a second identical flask which was incubated in the same manner. The serial transfer continued for eleven (10) passages (P) as follows: P1 = seven (7) days, P2 = seven (7) days, P3 = five (5) days, P4 = five (5) days, P5 = five (5) days, P6 = four (4) days, P7 = four (4) days, P8 = four (4) days, P9 = three (3) days, and P10 = two (2) days. The P10 broth from the P10 shake flasks was centrifuged at 4,000 rpm for ten (10) minutes. The supernatant was discarded, and the cells were suspended in water and plated onto BIRD medium.

[0261] Individual colony forming units were evaluated for total protein BCA (Product # 23228, Thermo Scientific, Rockford, IL) after incubation in a slow-release lactose micro titer plate (srMTP; e.g., see PCT Publication No. WO2014 / 047520) for four (4) days, 31°C, 200 rpm, and 80% humidity. Thus, mutant strains producing an equivalent amount of total protein at 31°C relative to the amount of total protein produced by the parental strain at 28°C, were further evaluated for high temperature protein production in fermentors.

[0262] In a second method, mutated spores of the T. reesei T4-GEF1 parental (control) strain were encapsulated in water and oil emulsion droplets using methods described in Bachmann et al. (2013). The droplets contained evolution medium with either 0.5% microcrystalline cellulose (EMCOCEL, JRS Pharma, Rosenburg, Germany), carboxymethylcellulose (Sigma-Aldrich C5678, St. Louis, MO), or acid swollen cellulose (Wood, 1988) as the sole carbon source. Also, per liter ammonium sulfate (4g), sodium phosphate monobasic (4.5g), magnesium sulfate heptahydrate (1g), calcium chloride dihydrate (1g), and 2.5 ml of a 400X trace element solution. The droplets were incubated at 31°C in a tube for three (3) days at which time the emulsion was disrupted using methods described in Bachmann et al. (2013). The cells were recovered, sporulated on agar plates, re-encapsulated and incubated at 31°C for three (3) days. This process was repeated 10 times. After the final transfer, the cells were suspended in water and plated ontoBIRD medium. Individual colony forming units were evaluated for total BCA protein (Product # 23228, Thermo Scientific, Rockford, IL) after incubation in a srMTP lactose plate (PCT Publication No. WO2014 / 047520) for four (4) days, 31°C, 200 rpm, and 80% humidity. Mutant strains producing an equivalent amount of total protein at 31°C relative to the amount of total protein produced by the parental strain at 28°C, were further evaluated for high temperature protein production in fermentors.

[0263] In a third method, evolution combined with large particle flow cytometry was used to isolate high temperature mutants. Mutated T4-GEF1 evolved as described above through ten transfers. The evolved culture was used to inoculate 250 mL flasks containing 50 mL citrate minimal medium. The inoculum flask was incubated at 28°-34°C, 180-200 rpm, for 48 hours and subsequently used to inoculate a DASGIP fermenter run under high productivity fermentation conditions including pH 4.8, 31°C, 0.04 specific feed rate (g gh) of glucose sophorose. At 169 hours, a 10 mL broth sample was harvested, and cells were encapsulated in 300 um alginate particles by electro-extrusion and grown overnight at 31°C, 150-200 rpm, in Tr seed media with 0.01%-0.5% sophorose or lactose. Particles were stained with 4 ul / mL Resorufin cellobioside (CAS 1000404-48-7) for 10-30 minutes at 31°C followed by sorting on a large particle cell sorter COPAS (Union Biometrica, Holliston, Massachusetts, USA). The brightest 0.2-0.5% particles (561 nm excitation and 610 / 20 nm emission) were sorted into a 96-well MTP containing Bird-E agar. The plates were incubated at 31°C for 5-10 days to isolate sporulated mutants. These mutants were evaluated in srMTP and fermentors for improved productivity at 25°-31°C.

[0264] As described below in Example 2, a mutant T. reesei T4-GEF1 strain named “T4-26rc” was identified as a high temperature (HT) mutant strain capable of optimal protein production when grown / cultivated at 29°C compared to (vis-à-vis) the optimal protein production of the parental (control) T4-GEF1 strain when grown / cultivated at 28°C. EXAMPLE 2 CHARACTERISTICS OF THE MUTANT TRICHODERMA STRAIN T4-26rc COMPRISING A MUTATED SPT5 GENE

[0265] Applicant sequenced the high temperature (HT) T. reesei T4-26rc mutant strain described / isolated in Example 1 to identify any mutated alleles which may contribute to the enhanced protein productivity observed at 31°C cultivation conditions. More specifically, the mutant allele identified herein resides at scaffold position 2: 1043183-1043184 in the wild-type T. reesei QM6a (v2.0 genome sequence assembly, available at the Joint Genomes Institute (JGI) website; genome.jgi.doe.gov), wherein the mutated allele comprises a SNP (G to A) in the gene coding sequence, thereby encoding a truncated SPT5 protein as shown in FIG.1.EXAMPLE 3 INACTIVATION OF THE SPT5 GENE IN A TRICHODERMA STRAIN BY INSERTION OF PYR2 GENE

[0266] In the present example, inactivation of the wild-type SPT5 gene (JGI; T. reesei v2.0 scaffold 2: 1043183-1043184) encoding the native SPT5 protein (SEQ ID NO: 2; PID: 4136) was performed in a Trichoderma strain using a Cas9-based method. More particularly, purified Cas9 protein and modified EZ tracrRNA were purchased from Synthego Corporation (Redwood City, CA) and the modified crRNA was synthesized by Synthego with the following sequence at the 5′ end (CLsgRNA58; SEQ ID NO: 8) that is specific to a target site (TS) CLsgRNA58 within the T. reesei SPT5 gene. CLsgRNA58: CGUCGGCGCCGAAACACCCC (SEQ ID NO:8)

[0267] For example, the Cas9 target site (TS) in the SPT5 gene, determined by the above CLsgRNA58 RNA sequence (SEQ ID NO: 8) is at nucleotide positions 3,209 through 3,228 in the coding sequence (CDS), which is close to the mutation at nucleotide position 3,183 observed in the T4-26rc mutant identified / described in Examples 1-2. Thus, the tracrRNA and crRNA were annealed to form guide RNA (gRNA) and then combined with Cas9-2NLS to form a ribonucleoprotein complex (Cas9:RNP) according to the manufacturer’s directions. Before use, the Cas9:RNP’s were mixed with Lipofectamine CRISPR- MAX, purchased from ThermoFisher Scientific, Inc. (Waltham, MA).

[0268] A linear DNA fragment containing the T. reesei pyr2 gene with native promoter and terminator sequences and flanked by 492 bp of T. reesei repeat (SEQ ID NO: 18) was amplified by PCR using primers AL950 (SEQ ID NO: 9) and AL952 (SEQ ID NO: 10). The resulting PCR product was purified using a Qiagen QIAquick PCR purification kit. AL950: CCTAACTAACGTCTGACATCG (SEQ ID NO: 9) AL952: CGTACCATTTGACTGATACGATG (SEQ ID NO: 10)

[0269] Protoplasts of the T. reesei parental strain T4-GEF1 were transformed with the pyr2 PCR product plus the Cas9:RNP. Transformants were selected for uridine auxotrophy. Screening transformants for the desired insertion of pyr2 into the SPT5 gene was conducted by PCR using forward and reverse primer pairs CL2350 (SEQ ID NO:11) and CL2351 (SEQ ID NO: 12), which amplify across the SPT5. CL2350: AGTCGCTGGTTGTGCTGGAC (SEQ ID NO: 11) CL2351: TAGCGTAGATCCATAGTCCACC (SEQ ID NO: 12)

[0270] The SNP (G to A) was introduced into the SPT5 gene coding sequence (CDS) of the transformant named “SPT5 t-BBW51”, which was determined by Sanger sequencing using the primers CL2350 and CL2351.

[0271] As presented in TABLE 2, the fermentor performance of the disrupted SPT5 gene transformant SPT5 t-BBW51 was compared to the T4 parent, T4-GEF1 control and T4-26rc mutant strains described in Examples 1-2. In particular, as shown in TABLE 2, the total protein yield of T4, T4-GEF1, T4-26rc and SPT5t-BBW51 strains are shown as percentages (%) relative to the parental T4 strain cultivated at 25°C. For example, as presented below in TABLE 2, the total protein yield of the T4 (parent) strain cultivated at 28°C is about 32% reduced as compared to the T4 (parent) strain cultivated at 25°C. Likewise, the total protein yield of the T4-GEF1 (∆GEF1) strain cultivated at 28°C is about 7% increased as compared to the T4 (parent) strain cultivated at 25°C, and about 39% increased as compared to the T4 (parent) strain cultivated at 28°C. TABLE 2 FINAL TOTAL PROTEIN YIELD (g / g) AS PERCENT OF CONTROL (T4 at 25°C) Strain Name Temperature (°C) Total protein yield (% of T425°C) T4 (Parent) 25 100

[0272] In addition, as shown above in TABLE 2, the total protein yield of the mutant T4-26rc (mutant SPT5) strain cultivated at 29°C is approximately equivalent to total protein yield of the T4 (parent) strain cultivated at 25°C, wherein the total protein yield of the mutant T4-26rc (mutant SPT5) strain cultivated at 29°C is about 32% increased as compared to the T4 (parent) strain cultivated at 28°C. Likewise, the total protein yield of the mutant T4-26rc (mutant SPT5) strain cultivated at 29°C (TABLE 2) has a higher protein yield as compared to the T4-GEF1 (∆GEF1) strain cultivated at 29°C. As shown above (TABLE 2), the total protein yield of the SPT5 t-BBW51 disrupted strain (∆SPT5) is about 12% increased as compared to the T4 (parent) strain cultivated at 25°C, and about 44% increased as compared as compared to the T4 (parent) strain cultivated at 28°C.EXAMPLE 4 INACTIVATION OF THE SPT5 GENE BY INTRODUCING SNP INTO A TRICHODERMA STRAIN COMPRISING A HETEROLOGOUS CELLULASE EXPRESSION CASSETTE

[0273] Inactivation of the SPT5 gene (JGI; T. reesei v2.0 scaffold 2: 1043183-1043184) encoding the SPT5 protein (SEQ ID NO: 2) was performed in a T. reesei strain using a Cas9-based method. More particularly, purified Cas9 protein and Modified EZ tracrRNA were purchased from Synthego Corporation (Redwood City, CA) and the modified crRNA was synthesized by Synthego with the following sequence at the 5′ end (CLsgRNA58; SEQ ID NO: 8) that is specific to a target site (TS; CLsgRNA58) within the T. reesei SPT5 gene. CLsgRNA58: CGUCGGCGCCGAAACACCCC (SEQ ID NO: 8)

[0274] The Cas9 target site (TS) in the SPT5 gene, determined by the above RNA sequence (SEQ ID NO: 8) is at nucleotide positions 3,209-3,228 in the coding sequence, which is close to the mutation at nucleotide position 3,183 observed in the mutant strain (Example 2). The tracrRNA and crRNA were annealed to form guide RNA (gRNA) and then combined with Cas9-2NLS to form a ribonucleoprotein complex (Cas9:RNP) according to the manufacturer’s directions. Before use, the Cas9:RNP’s were mixed with Lipofectamine CRISPR-MAX, purchased from ThermoFisher Scientific, Inc. (Waltham, MA).

[0275] A linear DNA fragment containing the T. reesei SPT5 gene with desired SNP (G to A) at nucleotide position 3,183 in the coding sequence was amplified by PCR using primers CL2350 and CL2351. The resulting PCR product was purified using a Qiagen QIAquick PCR purification kit.

[0276] Protoplasts of the T. reesei parental strain t-BAL50 were transformed with the SPT5 and pyr2 PCR product plus the Cas9:RNP. Transformants were selected for uridine auxotrophy. Screening transformants for the desired SNP (G to A) at nucleotide position 3,183 in the CDS of the SPT5 gene was conducted by PCR using forward and reverse primer pairs CL2350 and CL2351, which primers amplify across the SPT5. CL2350: AGTCGCTGGTTGTGCTGGAC (SEQ ID NO: 11) CL2351: TAGCGTAGATCCATAGTCCACC (SEQ ID NO: 12)

[0277] Insertion of pyr2 fragment 278 bp resulted in truncation of SPT5 in transformant named “t- BDA88”, which was determined by Sanger sequencing using the CL2350 and CL2351 primers, verifying disruption of the SPT5 CDS.

[0278] In another transformant named t-BDA85, SNP (G to A) at nucleotide position 3,183 in the CDS of the SPT5 gene was identified by sequencing PCR product using forward and reverse primer pairs CL2350 and CL2351, which primers amplify across the SPT5, verifying SPT5 truncation.As presented below in TABLE 3, the fermentor performance of the t-BDA85 and t-BDA88 transformants were compared to the parental (control) t-BAL50 strain. In particular, the total protein yield of t-BDA85 and t-BDA88 strains are shown in TABLE 3 as percentages (%), relative to the t-BAL50 control strain cultivated at 25°C.

[0279] For example, as presented below in TABLE 3, the total protein yield of the t-BAL50 control strain cultivated at 28°C is about 12% reduced as compared to the BAL50 control strain cultivated at 25°C. Likewise, the total protein yield of the t-BDA85 strain, containing the SPT5 truncation, cultivated at 29°C is about 2% increased as compared to the t-BAL50 control strain cultivated at 25°C, and about 14% increased as compared to the t-BAL50 (parent) strain cultivated at 28°C.

[0280] Additionally, at 29°C total protein yield of t-BDA88, containing the SPT5 disruption, is reduced by 4% compared to the BAL50 control cultivated at 25°C. Likewise, at 29°C total protein yield of t-BDA88 is increased 8% compared to t-BAL50 cultivated at 28°C. Additionally, at 29°C total protein yield of t- BDA88, containing the SPT5 deletion, is reduced by 6% compared to total protein yield at 29°C of t- BDA85 ,containing the SPT5 truncation. TABLE 3 FERMENTOR PERFORMANCE Strain Name Temperature (°C) Total protein yield (% of t-BAL50 Control)EXAMPLE 5 EVALUATING SPT5 MUTATIONS IN TRICHODERMA STRAINS HAVING A WILD-TYPE GEF1 GENE

[0281] In the instant example, Applicant restored the wild-type GEF1 gene (GEF1Rest; encoding the native GEF1 protein to further evaluate the mutant SPT5 phenotypes of the disclosure in the absence of any GEF1 mutant allele contributions. More particularly, restoration of the wild-type GEF1 gene (GEF1Rest) was performed in the t-BDA85 strain described above in Example 4, wherein purified Cas9 protein and Modified EZ tracrRNA were purchased from Synthego Corporation (Redwood City, CA) and the modified crRNA was synthesized by Synthego with the following sequence at the 5′ end (GEF1Rest; SEQ ID NO: 15) that is specific to a target site (GEF1Rest) within the T. reesei GEF1 gene. GEF1Rest: AAGAAUCAAGGGCACCGCAG (SEQ ID NO: 15)

[0282] The Cas9 target site (TS) in the GEF1 gene, determined by the above RNA sequence (SEQ ID NO: 15) is at nucleotide positions 3,668-3,687 in the coding sequence. The tracrRNA and crRNA were annealed to form guide RNA (gRNA) and then combined with Cas9-2NLS to form a ribonucleoprotein complex (Cas9:RNP) according to the manufacturer’s directions. Before use, the Cas9:RNP’s were mixed with Lipofectamine CRISPR-MAX, purchased from ThermoFisher Scientific, Inc. (Waltham, MA).

[0283] A linear DNA fragment containing the T. reesei GEF1 wild type gene was amplified by PCR using primers CLN2516 and CLN2515 from P37 genomic DNA. The resulting PCR product was purified using a Qiagen QIAquick PCR purification kit.

[0284] Protoplasts of the T. reesei parental strain tBDA-85 were transformed with the GEF1 PCR product plus the Cas9:RNP. Transformants were selected for resistant to sorbitol. Screening transformants for the desired wildtype GEF1 gene was conducted by PCR using forward and reverse primer pairs CLN2514 and CLN2517, which primers amplify across the GEF1 and verified by sequencing. CLN2514: CAGATCATAGTGCCGACGAG (SEQ ID NO: 16) CLN2517: AGTTCCGCCTTGCAGCTTG (SEQ ID NO: 17)

[0285] Restoration of the wildtype GEF1 gene in the transformant t-BEX65 was determined by Sanger sequencing using the CLN2514 and CLN2517 primers, verifying the GEF1 wildtype sequence.

[0286] As presented below in TABLE 4, the fermentor performance of the t-BEX65 strain at protein production temperatures of 25°C, 28°C, and 29°C was evaluated,wherein the total protein yield of t-BEX65 strain is shown as percentages (%) relative to t-BEX65 strain cultivated at 25°C. More particularly, as indicated in TABLE 4, the t-BEX65 strain comprising the mutation SPT5 SNP (G ^ A) and restored GEF1 gene has 8% reduced total protein yield at 28°C compared to the total protein yield at 25°C. Likewise, as shown in Table 4, t-BEX65 at 29°C has an increase of 4% total protein yield compared to 25°C and an increase of 12% total protein yield compared to 28°C. TABLE 4 FERMENTOR PERFORMANCE OF T-BEX65 Temperature °C Productivity* Productiy g p g %) of T-BEX65 at 25°CREFERENCES PCT Publication No. WO2011 / 153449 PCT Publication No. WO2014 / 047520 PCT Publication No. WO2016 / 100272 PCT Publication No. WO2016 / 100562 PCT Publication No. WO2016 / 100568 PCT Publication No. WO2016 / 100571 PCT Publication No. WO2021 / 092356 U.S. Patent No.6,022,725 U.S. Patent No.6,255,115 U.S. Patent No.6,268,328 Ausubel et al., “Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987, 1989 and 2003). Cao et al., “Penicillopepsin‐JT2, a recombinant enzyme from Penicillium janthinellum and the contribution of a hydrogen bond in subsite S3 to kcat”, Protein Science (9):991-1001, 2000. Devereux et al., Nucleic Acids Res.12:387-395, 1984. Needleman and Wunsch, “A general method applicable to the search for similarities in the amino acid sequence of two proteins”, J. Mol. Biol.48: 443-453, 1970. Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2ndEdition, Cold Spring Harbor Laboratory Press, Cold Spring, New York, 1989. Sambrook et al., Molecular Cloning, A Laboratory Manual, 4thEdition, Cold Spring Harbor Laboratory Press, Cold Spring, New York, 2012. Sheir-Neiss and Montenecourt, "Characterization of the secreted cellulases of Trichoderma reesei wild type and mutants during controlled fermentations", Applied Microbiology and Biotechnology, 20(1):46-53, 1984. Smith and Waterman, Adv. Appl. Math.2:482, 1981.Wood, “The cellulase of Fusarium solani. Purification and specificity of the β-(1→4)-glucanase and the β- d-glucosidase components”, Biochem. J., 121:353-362, 1971.

Claims

CLAIMS 1. A recombinant filamentous fungal cell derived from a parental filamentous fungal cell comprising a gene encoding a native SPT5 protein, wherein the recombinant cell comprises a genetic modification rendering the cell deficient in the expression of the native SPT5 protein.

2. The recombinant cell of claim 1, wherein the parental cell expresses one or more endogenous proteins of interest and / or expresses one or more heterologous proteins of interest.

3. The recombinant cell of claim 1, comprising an enhanced protein productivity phenotype relative to the parental cell when cultivated under the same conditions at temperature between about 25°C to 29°C.

4. The recombinant cell of claim 1, wherein the gene encoding the native SPT5 protein comprises at least 90% identity to SEQ ID NO:

1.

5. The recombinant cell of claim 1, wherein the native SPT5 protein comprises at least 90% identity to SEQ ID NO:

2.

6. The recombinant cell of claim 1, wherein the native SPT5 protein comprises at least one domain selected from the group consisting of a SPT5 N-terminal domain (NTD) comprising at least 95% identity to SEQ ID NO: 5, a NusG superfamily (NGN) domain comprising at least 95% identity to SEQ ID NO: 6 and a SPT5 C-terminal domain (CTD) comprising at least 95% identity to SEQ ID NO:

7.

7. The recombinant cell of claim 3, wherein the enhanced protein productivity phenotype is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity.

8. A mutant Trichoderma reesei cell comprising a mutated SPT5 gene having a guanine (G) to adenine (A) single nucleotide polymorphism (SNP) mutation in the SPT5 gene coding sequence (CDS) at nucleotide position 2,790 of SEQ ID NO:

3.

9. The mutant cell of claim 8, wherein the gene encoding the native SPT5 protein comprises at least 90% identity to SEQ ID NO:

1.

10. The mutant cell of claim 8, wherein the native SPT5 protein comprises at least 90% identity to SEQ ID NO: 2.

11. An isolated SPT5 gene variant comprising at least 90% identity to SEQ ID NO: 3 and comprising a guanine (G) to adenine (A) single nucleotide polymorphism (SNP) mutation at nucleotide position 2,790 of SEQ ID NO:

3.

12. A method for producing increased amounts of lignocellulosic degrading enzymes in a modified filamentous fungal cell comprising: (a) obtaining a parental filamentous fungal cell having a gene encoding a native SPT5 protein, genetically modifying the parental cell to obtain a modified filamentous fungal cell deficient in the expression of the native SPT5 protein, and (b) fermenting the modified cell under suitable conditions for the production of lignocellulosic degrading enzymes, wherein the modified cell produces an increased amount of the lignocellulosic degrading enzymes relative to the parental cell when fermented under the same conditions at a temperature between about 25C° to 29°C.

14. The method of claim 12, wherein the gene encoding the native SPT5 protein comprises at least 90% identity to the polynucleotide of SEQ ID NO:

1.

15. The method of claim 12, wherein the lignocellulosic degrading enzymes are selected from the group consisting of a cellobiohydrolase, a xylanase, an endoglucanase, and a β-glucosidase.

16. The method of claim 12, wherein the genetic modification rendering the cell deficient in the expression of the native SPT5 protein comprises a complete deletion of the wild-type (WT) SPT5 gene coding sequence (CDS), a partial deletion of WT SPT5 gene CDS, the complete or partial deletion of the upstream WT SPT5 gene promoter, a disruption of the WT SPT5 gene CDS, a disruption of the upstream WT SPT5 gene promoter, or an anti-sense nucleic acid sequence complementary to a portion of the WT SPT5 CDS and / or the upstream WT SPT5 gene promoter.

17. A method for producing an increased amount of a heterologous protein of interest (POI) in a modified filamentous fungal cell comprising: (a) obtaining a parental filamentous fungal cell having a gene encoding a native SPT5 protein, genetically modifying the parental cell to obtain a modified filamentous fungal cell deficient in the expression of the native SPT5 protein, wherein an expression cassette encoding the POI is introduced into the parental cell before, during, or after rendering the cell deficient in the production of the native SPT5 protein, and (b) fermenting the modified cell under suitable conditions for the production of the heterologous POI,wherein the modified cell produces an increased amount of the POI relative to the parental cell when fermented under the same conditions at a temperature between about 25C° to 29°C.

18. The method of claim 17, wherein the gene encoding the native SPT5 protein comprises at least 90% identity to the polynucleotide of SEQ ID NO:

1.

19. The method of claim 17, wherein the expression cassette encodes a heterologous POI selected from the group consisting of an enzyme, a peptide, an antibody, a receptor, a growth factor and a hormone.

20. The method of claim 17, wherein the genetic modification rendering the cell deficient in the expression of the native SPT5 protein comprises a complete deletion of the wild-type (WT) SPT5 gene coding sequence (CDS), a partial deletion of WT SPT5 gene CDS, the complete or partial deletion of the upstream WT SPT5 gene promoter, a disruption of the WT SPT5 gene CDS, a disruption of the upstream WT SPT5 gene promoter, or an anti-sense nucleic acid sequence complementary to a portion of the WT SPT5 CDS and / or the upstream WT SPT5 gene promoter.