Methods for detecting alicyclobacillus contaminants

Abstract

The present embodiments relate to mixtures, systems, kits, and methods useful to detect strains of Alicyclobacillus which express novel genetic variants of the vdcC gene. Alicyclobacillus strains which express these variants produce guaiacol which causes spoilage in fruit juice products. The methods and mixtures may be used to predict the spoilage potential of fruit juice products that are contaminated with Alicyclobacillus.

Description

METHODS FOR DETECTING ALICYCLOBACILLUS CONTAMINANTSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 477,057 filed on December 23, 2022, which is herein incorporated by reference in its entirety. SEQUENCE LISTING

[0002] This application contains a Sequence Listing which has been submitted in electronic format and is hereby incorporated by reference in its entirety. The Sequence Listing is provided as a file entitled 02138 WO-Sequence Listing. xml created on December 18, 2023, which is 1 1,000 bytes in size.FIELD OF THE INVENTION

[0003] The present embodiments relate to mixtures, systems, kits, and methods for detecting novel gene variants in Alicyclobacillus species which contaminate food and beverage products. The presence of the gene variants in contaminating Alicyclobacillus may be used to predict spoilage potential of food and beverage products.BACKGROUND OF THE INVENTION

[0004] The Alicyclobacillus genus includes several species of acidophilic, thermophilic, and spore-forming aerobic and facultatively anaerobic motile gram-positive rod-shaped bacteria that can grow within the pH range of 0.5 to 6.5 and the temperature range of 4 °C to 70 °C, and can survive adverse environments, such as thermal pasteurization, by forming endospores. A major source of spoilage and lost revenue in the food and beverage industry is the contamination of approximately 30% of raw materials used in the production of fruit juices by members of the Alicyclobacillus genus. Examples include the species A. acidoterrestris, A. terrestris, A. pomorum A. acidocaldarius, and A. acidiphilus. Viable Alicyclobacillus spores are also heat resistant and the elevated temperatures experienced during thermal pasteurization can stimulate spore germination, leading to potential spoilage, unsellable product, and products that must be recalled. However, not all Alicyclobacillus organisms cause spoilage. Furthermore, current assays do not differentiate between Alicyclobacillus that cause spoilage and those that do not. A need exists in the art for a sensitive and conclusive detection assay that can detectAlicyclobacillus strains that are associated with beverage spoilage as opposed to merely detecting all Alicyclobacillus strains. The present embodiments address this need.SUMMARY OF THE INVENTION

[0005] The present disclosure relates to mixtures, methods, systems, and kits suitable for detecting novel gene variants in Alicyclobacillus species which contaminate food and beverage products. The presence of the gene variants in contaminating Alicyclobacillus may be used to predict spoilage potential of food and beverage products.

[0006] Tests to identify the presence of Alicyclobacillus organisms are available. These are known in the art as ACB tests. However, as shown herein, a positive ACB test alone does not necessarily imply spoilage; rather, spoilage occurs due to production of guaiacol by a vanillic acid decarboxylase gene product which is expressed by some, but not all, Alicyclobacillus strains. The gene variants disclosed herein produce guaiacol and their identification indicates spoilage potential in a test sample.

[0007] The invention described herein suitably may include mixtures which may be used to detect the disclosed gene variants. For example, a mixture disclosed herein may contain a pair of primers which bind to one of three disclosed variants of the vanillic acid decarboxylase (ycdC) gene in Alicyclobacillus strains. The three disclosed gene variants have the sequence of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3. Each of the pair of primers binds to a target nucleic acid molecule which has the sequence of one of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, a complement thereof, or a fragment thereof. The mixture may include deoxynucleotide triphostphate nucleotides, a DNA polymerase, a buffer, and a test sample that is suspected to have at least one of the three gene variants.

[0008] In an example, the test sample may be a food, food suspension, food solution, or beverage. It may be raw fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drinks, fruit flavored tea, wine, or fruit flavored water.

[0009] The primer pairs in the mixture may be SEQ ID NO: 4 and SEQ ID NO:5, SEQ ID NO: 6 and SEQ ID NO: 7, or SEQ ID NO: 8 and SEQ ID NO: 5. Additionally, the primer pairs may be complements of one or more of these sequences.

[0010] In some embodiments, the mixture may include a probe that binds to one of the target nucleic acid molecules, or its complement, or a fragment thereof. The probe may bindto SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or complements thereof, or fragments thereof. The probe may have the sequence of SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11. Specifically, a probe having SEQ ID NO: 9 may be in a mixture with primer pair of SEQ ID NO: 4 and SEQ ID NO: 5 which bind to the target nucleic acid molecule of SEQ ID NO: 1 or its complement. A probe having SEQ ID NO: 10 may be in a mixture with primer pair of SEQ ID NO: 6 and SEQ ID NO: 7 which bind to the target nucleic acid molecule of SEQ ID NO: 2 or its complement. A probe having SEQ ID NO: 11 may be in a mixture with primer pair of SEQ ID NO: 8 and SEQ ID NO: 5 which bind to the target nucleic acid molecule of SEQ ID NO: 3 or its complement. These probes and primer pairs in the disclosed mixture may also be the complement of the sequences disclosed herein.

[0011] The disclosure includes methods of detecting an organism, for example, a species of Alicyclobacillus, which is suspected of having one of the three target nucleic acid molecules (gene variants) described herein. For example, the method may include the step of reacting a test sample as described herein with a first and a second primer which binds to the target nucleic acid molecule under conditions that are sufficient to produce a detectable amplicon. The first and second primer may be one of the primer pairs disclosed herein or complements thereof. The detectable amplicon may be one of the target nucleic acid molecules disclosed herein or a fragment thereof. The method may also include the step of detecting the presence or absence of the detectable amplicon. In an example, the detectable amplicon is produced by one or more of polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR). In an example, the amplicon may be detected by one or more techniques which include direct detection of a measurement of a physical property of the amplicon, detecting UV absorption at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye, and detecting the dye; complexing the amplicon with a detectable label, and detecting the presence of the label; detecting a detectable signal from a reporter molecule which produces a total detectable signal proportional to the number of copies of the amplicon in the sample; and detecting a detectable signal from two or more reporter molecules which produce a total detectable signal proportional to the number of copies of the amplicon in the sample.

[0012] The method may also include the step of reacting the test sample with a probe as described herein. The probe may be labeled with a detectable label.

[0013] In one embodiment, the primer pairs and probes used in the disclosed method include a probe having SEQ ID NO: 9 and the primer pair of SEQ ID NO: 4 and SEQ ID NO: 5 to detect the target nucleic acid molecule of SEQ ID NO: 1. In a nonlimiting example, this embodiment may be used to detect the target nucleic acid molecule in a diastatic strain of Alicyclobacillus acidoterrestris.

[0014] In another embodiment, the primer pairs and probes used in the disclosed method include a probe having SEQ ID NO: 10 and the primer pair of SEQ ID NO: 6 and SEQ ID NO: 7 to detect the target nucleic acid molecule of SEQ ID NO: 2. In a nonlimiting example, this embodiment may be used to detect the target nucleic acid molecule in a diastatic strain of Alicyclobacillus herbarius.

[0015] In yet another embodiment, the primer pairs and probes used in the disclosed method include a probe having SEQ ID NO: 11 and the primer pair of SEQ ID NO: 8 and SEQ ID NO: 5 to detect the target nucleic acid molecule of SEQ ID NO: 3. In a nonlimiting example, this embodiment may be used to detect the target nucleic acid molecule in a diastatic strain of Alicyclobacillus dauci.

[0016] These methods may be used to detect a contaminant that includes one of the target nucleic acids disclosed herein, its complement, or a fragment thereof. The methods disclosed herein may also be used to detect the spoilage potential in a test sample as disclosed herein.

[0017] In some embodiments, the method includes the step of reacting the test sample with more than one of the primer pairs disclosed herein. In such examples, the methods may be used to detect more than one contaminant in a test sample, each contaminant including one of the three target nucleic acid molecules disclosed herein.

[0018] In addition to more than one primer pair, the methods may include the step of reacting the test sample with more than one of the probes disclosed herein. Such mixtures may be used to detect more than one contaminant in a test sample, each contaminant including one of the three target nucleic acid molecules disclosed herein.

[0019] The disclosure also includes systems for detecting the disclosed target nucleic acid molecules or organisms or contaminants that contain one or more of the target nucleic acid molecules. In an example, the system may include one of the mixtures disclosed herein and an instrument that is configured to perform an amplification assay on the mixture. In someembodiments, the system may include a sample vessel. In some embodiments, the system may include one or more PCR reaction mixtures, for example, one of the mixtures disclosed herein. Each of the PCR reaction mixtures may be housed in one of the sample vessels. In some embodiments, the system further includes one or more sample temperature controlling devices. The temperature controlling devices may be used to bring the sample to the temperatures needed to perform the amplification assay.

[0020] The disclosure also includes kits. The kits may include reagents that may be used to create the mixtures disclosed herein and to perform the methods disclosed herein. In an example, the kit may include a first primer and a second primer, forming a primer pair. The first primer may be substantially homologous to one of the target nucleic acid molecules disclosed herein and the second primer may be substantially complementary to the target nucleic acid molecule to which the first primer is substantially homologous. The kit may additionally include deoxynucleotide triphosphate nucleotides and a buffer. In some emboiments, the kit may further include a DNA polymerase.

[0021] In some embodiments, the kit includes the primer pairs disclosed herein. In an example, the first primer has a sequence which is substantially homologous to a sequence of SEQ ID NO: 4 and the second primer has a sequence which is substantially homologous to a sequence of SEQ ID NO: 5. In another yet example, the kit additionally includes a probe which has a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 9.

[0022] In another example, the kit includes a primer pair that has a first primer that has a sequence which is substantially homologous to a sequence of SEQ ID NO: 6 and a second primer that has a sequence which is substantially homologous to a sequence of SEQ ID NO: 7. In yet another example, the kit additionally includes a probe which has a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 10.

[0023] In another example, the kit includes a primer pair that has a first primer that has a sequence which is substantially homologous to a sequence of SEQ ID NO: 8 and a second primer that has a sequence which is substantially homologous to a sequence of SEQ ID NO: 5. In yet another example, the kit additionally includes a probe which has a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 11.

[0024] In some embodiments, the probe in the kits disclosed herein may be covalently bound to a detectable label. In another example, the probe in the kit disclosed herein may also include a quencher positioned to quench a signal from the detectable label.

[0025] What is described is:

[0026] Al. A mixture, comprising: a first primer which specifically binds to a target nucleic acid molecule comprising a sequence of any one of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof; a second primer which specifically binds to a complement of the target nucleic acid molecule; deoxynucleotide triphosphate nucleotides; a DNA polymerase; a buffer; and a test sample that is suspected of having a nucleic acid that is substantially homologous with the target nucleic acid molecule.

[0027] A2. The mixture of clause Al, wherein the first primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 4; and the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5.

[0028] A3. The mixture of clause Al, wherein the first primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 6; and the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 7.

[0029] A4. The mixture of clause Al, wherein the first primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 8; andthe second primer comprises a sequence which is substantially homologous to the sequence of SEQ ID NO: 5.

[0030] A5. The mixture of any one of clauses A1-A4, additionally comprising a probe, wherein the probe comprises a sequence which is substantially homologous to the target nucleic acid molecule, or fragment thereof, or complement thereof.

[0031] A6. The mixture of clause A5, further comprising a detectable label, wherein the probe is covalently bound to a detectable label.

[0032] A7. The mixture of clause A5, wherein the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 9, or the complement thereof and the target nucleic acid molecule sequence comprises SEQ ID NO: 1, a complement thererof, or a fragment thereof.

[0033] A8. The mixture of clause A5, wherein the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 10, or the complement thereof and the target nucleic acid molecule sequence comprises SEQ ID NO: 2, a complement thererof, or a fragment thereof.

[0034] A9. The mixture of clause A5, wherein the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 11, or the complement thereof and the target nucleic acid molecule sequence comprises SEQ ID NO: 3, a complement thererof, or a fragment thereof.

[0035] A10. The mixture of clause Al, wherein the test sample comprises a food, food suspension, food solution, or beverage.

[0036] Al 1. The mixture of clause A 10, wherein the test sample comprises one or more of the following list: raw fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drinks, fruit flavored tea, wine, and fruit flavored water.

[0037] Bl . A method of detecting an organism comprising a target nucleic acid molecule, the target nucleic acid molecule comprising a sequence which is substantially homologous to one of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof in a test sample, the method comprising:reacting the test sample with a first primer comprising a sequence that specifically binds to the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; and a second primer comprising a sequence that specifically binds to a complement of the target nucleic acid molecule that the first primer binds to under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; and detecting a presence or absence of the detectable amplicon.

[0038] B2. The method of clause Bl, wherein the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule to which the first primer binds.

[0039] B3. The method of any one of the clauses Bl or B2, wherein the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 4, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5; the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 6, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 7; or the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 8, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5.

[0040] B4. The method of clause B2, wherein the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 4, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5 and the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 9; the first primer comprises a sequence which is substantially homologous asequence of SEQ ID NO: 6, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 7 and the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 10; or the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 8, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5 and the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 11.

[0041] B5. The method of clause Bl, wherein the detectable amplicon is produced by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0042] Cl. A method of detecting a diastatic strain of Alicyclobacillus acidoterrestris, the method comprising: reacting a test sample with: a first primer comprising a sequence that specifically binds to a target nucleic acid comprising a sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof; and a second primer that specifically binds to a complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising a sequence of SEQ ID NO: 1, or a fragment thereof, or complement thereof; and detecting a presence or an absence of the amplicon.

[0043] C2. The method of clause Cl, wherein the first primer is substantially homologous to a sequence of SEQ ID NO: 4, or the complement thereof, and the second primer is substantially homologous to a sequence of SEQ ID NO: 5, or the complement thereof.

[0044] C3. The method of any one of clauses C1-C2, wherein the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule or complement thereof.

[0045] C4. The method of clause C3, wherein the probe is labeled with a detectable label.

[0046] C5. The method of clause C3, wherein the probe is substantially homologous to a sequence of SEQ ID NO: 9, or a complement thereof.

[0047] DI. A method of detecting a diastatic strain of Alicyclobacillus herbarius, the method comprising: reacting a test sample with: a first primer comprising a sequence that specifically binds to a target nucleic acid comprising a sequence of SEQ ID NO: 2, or a fragment thereof, or a complement thereof; and a second primer that specifically binds to a complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising a sequence of SEQ ID NO: 2, or a fragment thereof, or complement thereof; and detecting a presence or an absence of the amplicon.

[0048] D2. The method of clause DI, wherein the first primer is substantially homologous to a sequence of SEQ ID NO: 6, or the complement thereof, and the second primer is substantially homologous to a sequence of SEQ ID NO: 7, or the complement thereof.

[0049] D3. The method of any one of clauses D1-D2, wherein the method further comprises reacting the test sample with a probe that specifically binds to the target nucleic acid molecule or complement thereof.

[0050] D4. The method of clause D3, wherein the probe is labeled with a detectable label.

[0051] D5. The method of clause D3, the probe is substantially homologous to a sequence of SEQ ID NO: 10, or a complement thereof.

[0052] El. A method of detecting a diastatic strain of Alicyclobacillus dauci the method comprising: reacting a test sample with:a first primer comprising a sequence that specifically binds to a target nucleic acid comprising a sequence of SEQ ID NO: 3, or a fragment thereof, or a complement thereof; and a second primer that specifically binds to a complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising a sequence of SEQ ID NO: 3, or a fragment thereof, or complement thereof; and detecting a presence or an absence of the amplicon.

[0053] E2. The method of clause El, wherein the first primer is substantially homologous to a sequence of SEQ ID NO: 8, or the complement thereof, and the second primer is substantially homologous to a sequence of SEQ ID NO: 5, or the complement thereof.

[0054] E3. The method of any one of clauses E1-E2, wherein the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule or complement thereof.

[0055] E4. The method of clause E3, wherein the probe is labeled with a detectable label.

[0056] E5. The method of clause E3, wherein the probe is substantially homologous to a sequence of SEQ ID NO: 11, or a complement thereof.

[0057] Fl. A method of detecting a contaminant comprising a target nucleic acid molecule having a sequence that is substantially homologous to a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof, or a variant thereof in a test sample, the method comprising: reacting the test sample with: a first primer comprising a sequence that specifically binds to the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; and a second primer comprising a sequence that specifically binds to a complement of the target nucleic acid molecule that the first primer binds to underconditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof, or a complement thereof; and detecting a presence or an absence of the amplicon, wherein the presence of the detectable amplicon indicates a presence of a contaminant in the test sample.

[0058] F2. The method of clause Fl, wherein the detectable amplicon is produced by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0059] F3. The method of clause Fl, wherein the method of detecting the detectable amplicon comprises one or more from the group consisting of: direct detection of a measurement of a physical property of the amplicon, detecting UV absorption at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye, and detecting the dye; complexing the amplicon with a detectable label, and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample; and detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample.

[0060] Gl. A method of detecting the spoilage potential in a test sample comprising: providing a test sample comprising a food, food suspension, food solution, or beverage, the method comprising: reacting the test sample with: a first primer comprising a sequence that specifically binds to a target nucleic acid molecule, wherein the target nucleic acid molecule comprises a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or a complement thereof; and a second primer comprising a sequence that specifically binds to the complement of the target nucleic acid molecule that the first primer binds tounder conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or a complement thereof; and detecting a presence or an absence of the detectable amplicon, wherein the presence of the detectable amplicon indicates positive spoilage potential of the test sample.

[0061] The method of clause Gl, wherein the test sample comprises raw fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drinks, fruit flavored tea, wine, or fruit flavored water.

[0062] The method of clause Gl, wherein the detectable amplicon is produced by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0063] The method of clause Gl, wherein the method of detecting the detectable amplicon comprises one or more from the group consisting of: direct detection of a measurement of a physical property of the amplicon, detecting UV absorption at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye, and detecting the dye; complexing the amplicon with a detectable label, and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample; and detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample.

[0064] Hl. A method of detecting at least one contaminant in a test sample, each contaminant comprising one of three target nucleic acid molecules, each of the three target nucleic acid molecules having a sequence that is substantially homologous to one of a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof, or a variant thereof, the method comprising: reacting the test sample with a first primer, a second primer, a third primer, a fourth primer, and a fifth primer, wherein,the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 4, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5; the third primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 6, the fourth primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 7; the fifth primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 8, under conditions sufficient to produce three detectable amplicons, the three detectable amplicons comprising the three target nucleic acid molecules, or fragments thereof, or complements thereof; and detecting a presence or an absence of each of the three amplicons, wherein the presence of any one of the three amplicons indicates a presence of a contaminant in the test sample.

[0065] H2. The method of clause Hl, further comprising reacting the test sample with: a first probe comprising a sequence that is substantially homologous to a sequence of SEQ ID NO: 9; a second probe comprising a sequence which is substantially homologous to a sequence of SEQ ID NO: 10; and a third probe comprising a sequence which is substantially homologous to a sequaence of SEQ ID NO: 11.

[0066] II. A system comprising: a mixture of any one of clauses A1-A4; and an instrument configured to perform an amplification assay on the mixture.

[0067] 12. The system of clause II, further comprising at least one sample vessel.

[0068] 13. The system of clause 12, further comprising at least one PCR reaction mixture, wherein each of the PCR reaction mixtures is housed in one of the at least one sample vessel.

[0069] 14. The system of clause II, further comprising at least one sample temperature controlling device.

[0070] 15. The system of clause II, wherein the mixture additionally comprises a probe comprising a sequence which is substantially homologous to the target nucleic acid molecule, or fragments thereof, or complements thereof.

[0071] JI . A kit comprising: a first primer that comprises a sequence that is substantially homologous to a target nucleic acid molecule, the target nucleic acid molecule comprising a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3; a second primer that comprises a sequence that is substantially complementary to the target nucleic acid molecule to which the first primer is substantially homologous; deoxynucleotide triphosphate nucleotides; and a buffer.

[0072] J2. The kit of clause JI, further comprising a DNA polymerase.

[0073] J3. The kit of clause JI, wherein the first primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 4; and the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5.

[0074] J4. The kit of clause J3, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 9.

[0075] J5. The kit of clause JI, wherein the first primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 6; and the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 7.

[0076] J6. The kit of clause J5, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 10.

[0077] J7. The kit of clause JI, wherein the first primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 8; and the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5

[0078] J8. The kit of clause J7, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 11.

[0079] J9. The kit of any one of clauses J4, J6, or J8 wherein wherein the probe is covalently bound to a detectable label.

[0080] J10. The kit of clause J9, wherein the probe also includes a quencher positioned to quench a signal from the detectable label.BRIEF DESCRIPTION OF THE DRAWINGS

[0081] For the purpose of illustrating the embodiments, an exemplary embodiment is shown in the drawing. It should be understood, however, that the embodiment is not limited to the precise arrangement and instrumentalitiy of the embodiment shown in the drawing.

[0082] FIG. 1 depicts ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, each with annotations of primer and probe binding sites.

[0083] FIG. 2 illustrates a block diagram of an exemplary embodiment of a thermal cycling system in accordance with aspects of the disclosure.DETAILED DESCRIPTION OF THE INVENTION

[0084] The present disclosure provides for mixtures, systems, kits, and methods of use for the detection of variations in the genetic sequence of the vanillic acid decarboxylase (ydcC) gene in the species, Alicyclobacillus, which causes spoilage in contaminated food and beverage products. The present disclosure additionally provides for mixtures and methods of use for theprediction of the spoilage potential of food and beverage products contaminated with Alicyclobacillus organisms which express the disclosed vdcC gene variants. Those Alicyclobacillus which express one of the variants disclosed herein produce guaiacol and are thereby responsible for food and beverage spoilage. In contrast, Alicyclobacillus organisms which do not express one of the variants, while they represent a contamination, may not produce guaiacol and may not result in spoilage.

[0085] Various mixtures and methods are described in the embodiments herein. The embodiments can be combined with one another. It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. All references cited herein are incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the subject matter is entitled to antedate such disclosure by virtue of prior invention. The use of examples anywhere in the specification, including examples of any terms discussed herein, is illustrative only, and in no way limits the scope and meaning of the disclosure or any exemplified term. Likewise, the disclosure is not limited to its preferred embodiments.

[0086] The Alicyclobacillus genus includes several species of spore-forming bacteria that can survive adverse environments. A major source of spoilage and lost revenue in the fruit juice and wine industry is the contamination of approximately 30% of raw materials used in the production of fruit juices by members of the Alicyclobacillus genus. The strains of Alicyclobacillus which cause spoilage are specifically those which can produce guaiacol. It is essential to detect and control for viable spores of these guaiacol -producing Alicyclobacillus strains in raw materials to control contamination in finished juice products. More specifically, detecting variants in the Alicyclobacillus genome as disclosed herein provides a determination of whether the Alicyclobacillus organisms present in the raw materials will produce guaiacol and, consequently, lead to spoilage.

[0087] Guaiacol is produced by the enzyme vanillic acid decarboxylase which is encoded by the vdcC gene found in some strains of Alicyclobacillus. VdcC gene expression was identified to be predictive of juice or wine spoilage ox Alicyclobacillus species, including Alicyclobacillus acidoterrestris, Alicyclobacillus her bar ms. and Alicyclobacillus dauci.

[0088] Tests to identify the presence of Alicyclobacillus organisms are available. These are known in the art as ACB tests. However, as shown herein, a positive ACB test alone doesnot necessarily imply spoilage; rather, spoilage occurs due to production of guaiacol by a vanillic acid decarboxylase gene product which is expressed by some, but not all Alicyclobacillus strains.

[0089] The genetic variability in the vdcC gene within different species of Alicyclobacillus is shown in the following examples. The three gene sequences, presented herein as SEQ ID NOs: 1, 2, and 3, were identified in different Alicyclobacillus species.

[0090] The genomic region for the vdcC gene variant found in Alicyclobacillus acidoterrestris was identified to comprise the sequence of SEQ ID NO: 1:GAGACGGACTACATGGTCGGCGTCAACACCTGCGTGCCCATGTATCAGCAA CTCAAGGACGCGTTCCCGAACGAAATCGTGGCCGTCAATGCCATGTACACG CATGGCCTCGTCGCCATTATCTCGACCAAGAAACGGTACGGTGGGTTTGC (SEQ ID NO: 1).

[0091] The genomic region for the vdcC gene variant found in Alicyclobacillus herbarius was identified to comprise the sequence of SEQ ID NO: 2:GAGGTCGACTACATGATTGGGTTGAACACGTCGGTTCCACTCTATCACCAGT TGAAGCAGGCCTATCCGGATGAAATCGTCGCGGTGAACGCGATGTATACGC ATGGGCTGGTGGCGATTATTTCGACAAAGACTCGTTATGGGGGCTTTGC (SEQ ID NO: 2).

[0092] The genomic region for the vdcC gene variant found in Alicyclobacillus dauci was identified to comprise the sequence of SEQ ID NO: 3:GAGACTGACTACATGGTGGGTGTGAATACATGTGTGCCGATCTACCAGCAGCTGA AGGAAGCTTTTCCGAACGAGATCGTGGCTGTGAATGCAATGTACACGCACGGACT GGTGGCCATCGTCTCGACGAAGAAGCGGTACGGCGGCTTTGC (SEQ ID NO: 3).

[0093] That the disclosure may be more readily understood, select terms are defined.

[0094] Unless defined otherwise, all technical and scientific terms have the same meaning as is commonly understood by one of ordinary skill in the art to which the embodiments disclosed belongs. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner in describing the mixtures and methods of the disclosure and how to use them. Moreover, it will be appreciated that the same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein, nor is any special significance to be placed upon whether a term is elaborated or discussed herein.

[0095] Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0096] The articles “a,” “an,” and “the” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “a sample” means one sample or more than one sample.

[0097] As used herein, the adverbs “about” or “approximately” means that the numerical value is approximate and small variations would not significantly affect the practice of the disclosed embodiments. Where a numerical limitation is used, unless indicated otherwise by the context, “about” means the numerical value can vary by ±5% and remain within the scope of the disclosed embodiments. Thus, about 100 means 95 to 105.

[0098] As used herein, the term “detecting” or “detection” is used in the broadest sense to include qualitative and / or quantitative measurements of an analyte.

[0099] As used herein, the terms “analyte” refers to a substance being measured in an analytical procedure. Non-limiting examples of analytes include: RNA, DNA, nucleic acid molecules encoded by a cell, synthetic nucleic acid molecules, and amplification products (e.g., amplicons).

[0100] An “amplicon,” as described herein, is an amplification product. An amplicon may be produced by amplifying a nucleic acid sequence from a test sample. An amplicon may include, but is not limited to, a PCR product.

[0101] A “PCR product,” as described herein, refers to any product produced as a result of a PCR reaction.

[0102] As used herein, the term “sample” means any material that may contain a particular item (e.g., analyte) or that is suspected of containing a particular item. Illustratively, the sample may be a fluid medium or liquid. In some embodiments, samples may be used which are high in dissolved solids without further processing. In some embodiments, samples containing high solids (n on-dissolved) may be analyzed by processing the samples using a fdter or used in conjunction with additional manual steps. In some embodiments, samples are non-filtered. In some embodiments, samples are filtered. In some embodiments, samples are purified. In some embodiments, samples are non-purified. Samples may be a liquid, asuspension, extracted or dissolved sample, or a supercritical fluid. Examples of samples include, but are not limited to, food swabs, food extracts, food suspensions, food cultures, amplification reactions, PCR reactions, and the like. The sample may also be derived from another sample. For example, a PCR reaction may be performed on a nucleic acid mixture that has been extracted, isolated, and / or purified from another sample (e.g., juice). The PCR reaction would be a sample derived from another sample.

[0103] As used herein, the term “beverage” means a liquid for drinking. As used herein, the term “food” refers to any raw, cooked, or processed edible substance, ice, beverage, or ingredient used or intended for use in whole or in part for human consumption. Non-limiting examples of food include raw fruit, cooked fruit, wine, and canned fruit. The term food includes food suspensions and food cultures.

[0104] The terms “food suspension” and “food solution” are used interchangeably throughout this application to refer to raw, cooked, or processed food that is in a solution, or that has been placed or suspended in a solution. Non-limiting examples of food suspensions include fruit juices, blended juice products, carbonated fruit drinks, tea, wine, and flavored water. A food suspension may be mixed, vortexed or blended. A food suspension may also be filtered or unfiltered. As used herein, a “food culture” is a food sample that is cultured under conditions to enrich the sample. This process can also be referred to as “enrichment.”

[0105] As used herein, the term “juice” refers to juice at any stage in the process of manufacturing juice prior to packaging into any container that can hold juice.

[0106] As used herein, the term “juice product” includes any food or beverage that is produced during the production of juice.

[0107] The term “spoilage,” as used herein, refers to the process through which a food becomes unsuitable for ingestion. Spoilage in a juice product can include changes in taste, flavor, aroma, viscosity, body, aroma, odor, and appearance in a way that is undesirable, or the presence of a tainting ingredient, for example, guaiacol.

[0108] The term “spoilers” refers to any microorganisms that can cause spoilage in food or beverage. A juice spoiler is any microorganism that that can change the flavor, aroma,or appearance of juice, or otherwise cause juice spoilage, in a manner deemed undesirable by the manufacturer. Non-limiting examples of juice spoilers include members of the Alicyclobacillus genus, including the species A. acidoterrestris, A. terrestris, A. pomorum, A. acidocaldarius, A. suci, A. dauci, A. herbarious and A. acidiphilus.

[0109] As used herein, the terms “nucleic acid”, “nucleic acid molecule”, and “nucleotide” are intended to be consistent with their use in the art and to include naturally occurring species or functional analogs thereof. Nucleic acids comprise one or more nucleotides and can include oligonucleotides and polynucleotides. As used herein, “polynucleotide”, “nucleic acid molecule”, and “nucleic acid”, may be used interchangeably, and may refer to a polymeric form of nucleotides of any length. As used herein, “oligonucleotide” denotes a single-stranded multimer of nucleotides of from about 2 to 200 nucleotides, and illustratively, from about 15 to about 40 nucleotides in length, about 150 nucleotides in length, about 152 nucleotides in length, about 16 to about 25 nucleotides in length, about 18 to about 22 nucleotides in length, about 26 to about 34 nucleotides in length, or about 28 to about 32 nucleotides in length, such as 18, 19, 20, 21, or 22 nucleotides, including for a primer, and, for example, 28, 29, 30, 31, or 32 nucleotides, for example, for a probe. Oligonucleotides may be synthetic or may be made enzymatically. An example nucleic acid molecule is DNA, which may include a deoxyribonucleotide or modified deoxyribonucleotide. As used herein, the term “nucleotide” also is intended to encompass any nucleotide analogue which is a type of nucleotide that includes a modified nucleobase, sugar and / or phosphate moiety compared to naturally occurring nucleotides.

[0110] As used herein, “target nucleic acid” or grammatical equivalent thereof can refer to nucleic acid molecules or sequences that it is desired to identify, detect, hybridize to, sequence, analyze and / or further manipulate.

[0111] As used herein, the term “primer” is defined as an isolated, at least partially single-stranded, and often entirely single-stranded, polynucleotide, such as an oligonucleotide, having a single strand with a free 3' hydroxyl (-OH) group. A primer may also have a modification at the 5' terminus to allow a coupling reaction or to couple the primer to another moiety, such as a detectable moiety, a detectable tag and the like. A primer may also contain auxiliary portions, for example, a region non-complementary to the target nucleic acid that maybe used as a tag for the hybridized complex or for the amplicon produced by an amplification reaction.

[0112] As used herein, the term “probe” is defined as a detectable, illustratively partially single-stranded and often entirely single-stranded, polynucleotide, for example, an oligonucleotide, capable of specifically hybridizing to a target nucleic acid to provide detection of the target nucleic acid.

[0113] As used herein, “specifically hybridizes” means that a probe, primer, or oligonucleotide recognizes and physically interacts (that is, base-pairs) with a substantially complementary nucleic acid (for example, a sample nucleic acid) under high stringency conditions, and does not substantially base pair with other nucleic acids. By “high stringency conditions” is meant conditions configured to allow for identification of target nucleic acid sequences. Such conditions typically occur at about Tm minus 5°C (5° below the Tm of the probe). Functionally, high stringency conditions are used to identify nucleic acid sequences having at least 80% sequence identity. In some embodiments, this may mean at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity.

[0114] As used herein, a “substantially complementary” nucleic acid means that the nucleic acid specifically hybridizes to the designated sequence. As used herein, “substantially homologous” means that the nucleic acid specifically hybridizes to the complement of the designated sequence.

[0115] As used herein, “conditions sufficient to produce a detectable amplicon” include conditions (for example any of temperature, pH, salt conditions, buffer reagents, polymerization reagents, extension reagents, ligation reagents) that support specific amplification of the target region to which the nucleic acid molecule functioning as a primer has specifically hybridized. Such conditions may support, for example, temperature-cycling amplification reactions including polymerase chain reaction (PCR), isothermal amplification reactions such as NASBA, TMA, and the like, ligase chain reactions (LCR) or other nucleic acid amplification methods.

[0116] As used herein, the term “concurrently” refers to the detection of multiple analytes simultaneously or nearly simultaneously. As used herein, “A method of concurrently detecting a plurality of analytes with a single signal,” or variations thereof, may refer to a method that uses a single assay (e.g., single well, single dot, single location on an array) or a single use of a device to detect the plurality of analytes with a single signal. Concurrently, may also mean detection of multiple analytes in separate devices at the same or nearly the same time.

[0117] As used herein, the term “single signal” means detection of a signal based upon a single moiety or method. For example, if the single signal is the color red, then the plurality of analytes indicated by only upon the presence of the color red. That is, the color red, in this non-limiting example, indicates that the plurality analytes are present in the sample. In contrast, if one analyte is indicated by the color red and a second analyte is indicated by the color yellow, the use of two colors (z.e., signals) is not the detection of a plurality of analytes with a single signal. The signal is not limited to colorimetric detection, examples are provided herein of signals that can be used. This is in contrast to the detection of the presence of multiple analytes using distinct signals in the same reaction to detect the presence of multiple analytes in a sample or requiring the performing of separate reactions and methods to detect multiple analytes. That is, the embodiments described herein provide, in part, methods of detecting multiple analytes concurrently with a single signal, such that the detection of a single signal indicates the presence of the multiple analytes in a sample or that the absence of the single signal indicates the absence of the multiple analytes in the sample.

[0118] As used herein, the term “heterologous” in reference to the interaction unit means a group, molecule or moiety that is not native to the analyte. For example, an amplification product can comprise just nucleic acid molecules or nucleotide bases. The amplification product, however, may be conjugated to or attached to a heterologous tag, including, but not limited to, hapten, biotin, digoxigenin, and a fluorescent molecule (e.g., fluorescein or rhodamine). Examples of heterologous interaction units include, but are not limited to, hapten, biotin, nucleic acid molecules, peptide fragments (e.g., His-tags, GST- tags), enzymes, streptavidin, avidin, and fluorescent molecules. This list is non-limiting and any interaction unit can be used. Analytes may be labeled with molecules includingdigoxigenin, rhodamine, fluorescein, DNP, BRDU, and then be detected by capture reagents that are specific for a given molecule.

[0119] As used herein, the term “different analytes” means the analytes are not the same. The different analytes, however, may be referred to with the same name, but have different physical and / or functional features. For example, different organisms may contain different variants of a gene and its protein product. These variations may have the same function and, therefore, have been given the same name. For example, there are multiple species in the genus Alicyclobacillus which may may include variations of the vdcC gene and have varying spoilage potentials. The present methods may be used, for example, to detect a plurality of analytes comprising different vdcC gene variants from a plurality of species of Alicyclobacillus with a high spoilage potential.

[0120] In some embodiments, one or more primers are provided, that specifically hybridize to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or fragments thereof, or complements thereof.

[0121] In some embodiments, the primer is substantially homologous to the sequence of SEQ ID NO: 4:GAGACGGACTACATGGTCGG (SEQ ID NO: 4), or the complement thereof.

[0122] In some embodiments, the primer is substantially homologous to the sequence of SEQ ID NO: 5:GCAAAGCCGCCGTACCG (SEQ ID NO: 5), or the complement thereof.

[0123] In some embodiments, the primer is substantially homologous to the sequence of SEQ ID NO: 6:GAGGTCGACTACATGATTGG (SEQ ID NO: 6), or the complement thereof.

[0124] In some embodiments, the primer is substantially homologous to the sequence of SEQ ID NO: 7:GCAAAGCCCCCATAACG (SEQ ID NO: 7), or the complement thereof.

[0125] In some embodiments, the primer is substantially homologous to the sequence of SEQ ID NO: 8:GAGACTGACTACATGGTGGG (SEQ ID NO: 8), or the complement thereof.

[0126] In some embodiments, one or more probes are provided, that specifically hybridize to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or fragments thereof, or complements thereof.

[0127] In some embodiments, the probe has a sequence that is substantially homologous to the sequence of SEQ ID NO: 9:ATGCGTATACATCGCGTTCACCGCGACGATT (SEQ ID NO: 9), or the complement thereof, or a fragment thereof. The probe of SEQ ID NO: 9 binds to SEQ ID NO: 1.

[0128] In some embodiments, the probe has a sequence that is substantially homologous to the sequence of SEQ ID NO: 10:GTGCGTGTACATTGCATTCACAGCCACGATC (SEQ ID NO: 10), or the complement thereof, or a fragment thereof. The probe of SEQ ID NO: 10 binds to SEQ ID NO: 2.

[0129] In some embodiments, the probe has a sequence that is substantially homologous to the sequence of SEQ ID NO: 11 :ATGCGTGTACATGGCATTGACGGCCACGATT (SEQ ID NO: 11), or the complement thereof, or a fragment thereof. The probe of SEQ ID NO: 11 binds to SEQ ID NO: 3.

[0130] In some embodiments, the primer specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 1, or a fragment thereof, or a complement thereof, wherein the primer is substantially homologous to the sequence of SEQID NO: 4, the complement of SEQ ID NO: 4, SEQ ID NO: 5, or the complement of SEQ ID NO: 5.

[0131] In some embodiments the probe specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 1, or a fragment thereof, or a complement thereof where the probe is substantially homologous to SEQ ID NO: 9 or the complement thereof.

[0132] In some embodiments, the primer specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 2, or a fragment thereof, or a complement thereof, wherein the primer is substantially homologous to the sequence of SEQ ID NO: 6, the complement of SEQ ID NO: 6, SEQ ID NO: 7, or the complement of SEQ ID NO: 7.

[0133] In some embodiments the probe specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 2, or a fragment thereof, or a complement thereof where the probe is substantially homologous to SEQ ID NO: 10 or the complement thereof.

[0134] In some embodiments, the primer specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 3, or a fragment thereof, or a complement thereof, wherein the primer is substantially homologous to the sequence of SEQ ID NO: 8, the complement of SEQ ID NO: 8, SEQ ID NO: 5, or the complement of SEQ ID NO: 5.

[0135] In some embodiments the probe specifically binds to a target nucleic acid molecule that is substantially homologous to SEQ ID NO: 3, or a fragment thereof, or a complement thereof where the probe is substantially homologous to SEQ ID NO: 11 or the complement thereof.

[0136] In some embodiments, the probe is covalently bound to a detectable label. In some embodiments, the detectable label is selected from the following list: 1,5 IAEDANS; 1,8- ANS; 2'-chloro-7'phenyl-l,4-dichloro-6-carboxyfluorescein (VIC); 3(4)-carboxyfluorescein dipivalate NHS ester; 3(4)-carboxyfluorescein dipivalate hydroxyhexyl carboxamide; 3(4)- carboxyfluorescein dipivalate hydroxyhexyl carboxamide phosphoramidite; 3(4)-carboxyfluorescein dipivaloyl -N-succinimidyl ester; 4-Methylumbelliferone; 5-carboxy-2,7- dichlorofluorescein; 5-Carboxyfluorescein (5-FAM); 5-Carboxynapthofluorescein; 5- carboxyfluorescein dipivalate; 5-Carboxytetramethylrhodamine (5-TAMRA); 5-FAM (5- Carb oxy fluorescein); 5-HAT (Hydroxy Tryptamine); 5-Hydroxy Tryptamine (HAT); 5-ROX (carboxy-X-rhodamine); 5-TAMRA (5-Carboxytetramethyirhodamine); 6-Carboxyfluorescein (6-FAM); 6-carboxyfluorescein dipivalate; 6-carboxynapthofluorescein; 6-Carboxyrhodamine 6G; 6-CR 6G; 6-JOE; 7-Amino-4-methylcoumarin; 7- Aminoactinomycin D (7-AAD); 7- Hydroxy-4-methylcoumarin; 9-Amino-6-chloro-2-methoxyacridine; ABQ; ABY; Acid Fuchsin; ACMA (9-Amino-6-chloro-2-methoxyacridine); Acridine Orange; Acridine Red; Acridine Yellow; Acriflavin; Acriflavin Feulgen SITSA; Alexa Fluor 350; Alexa Fluor 405; Alexa Fluor 430; Alexa Fluor 488; Alexa Fluor 500; Alexa Fluor 514; Alexa Fluor 532; Alexa Fluor 546; Alexa Fluor 555; Alexa Fluor 568; Alexa Fluor 594; Alexa Fluor 610; Alexa Fluor 633; Alexa Fluor 635; Alizarin Complexon; Alizarin Red; AMC; AMCA-S; AMCA (Aminomethylcoumarin); AMCA-X; Aminoactinomycin D; Aminocoumarin; Aminomethylcoumarin (AMCA); Anilin Blue; Anthrocyl stearate; APTRA-BTC; APTS; Astrazon Brilliant Red 4G; Astrazon Orange R; Astrazon Red 6B; Astrazon Yellow 7 GLL; Atabrine; ATTO 390; ATTO 425; ATTO 465; ATTO 488; ATTO 495; ATTO 520; ATTO 532; ATTO 550; ATTO 565; ATTO 590; ATM 594; ATTO 610; ATTO 61 IX; ATTO 620; ATTO 633; ATTO 635; ATTO 647; ATTO 647N; ATTO 655; ATTO 680; ATTO 700; ATTO 725; ATTO 740; ATTO-TAG CBQCA; ATTO-TAG FQ; Auramine; Aurophosphine G; Aurophosphine; BAO 9 (Bisaminophenyloxadiazole); BCECF (high pH); BCECF (low pH); Berberine Sulphate; Bimane; Bisbenzamide; Bisbenzimide (Hoechst); bis-BTC; Blancophor FFG; Blancophor SV; BOBO-1; BOBO-3; Bodipy 492 / 515; Bodipy 493 / 503; Bodipy 500 / 510; Bodipy 505 / 515; Bodipy 530 / 550; Bodipy 542 / 563; Bodipy 558 / 568; Bodipy 564 / 570; Bodipy 576 / 589; Bodipy 581 / 591; Bodipy 630 / 650-X; Bodipy 650 / 665-X; Bodipy 665 / 676; Bodipy Fl; Bodipy FL ATP; Bodipy Fl-Ceramide; Bodipy R6G; Bodipy TMR; Bodipy TMR-X conjugate; Bodipy TMR-X; SE; Bodipy TR; Bodipy TR ATP; Bodipy TR-X SE; BO-PRO- 1; BO-PRO-3; Brilliant Sulphoflavin FF; BTC; BTC-5N; Calcein; Calcein Blue; Calcium Crimson; CAL Fluor Gold 540; CAL Fluor Orange 560; CAL Fluor Red590; CAL Fluor Red 610; CAL Fluor 635; Calcium Green; Calcium Green- 1 Ca2+ Dye; Calcium Green-2 Ca2+; Calcium Green-5N Ca2+; Calcium Green-C18 Ca2+; Calcium Orange; Calcofluor White; carboxyfluorescein diacetate;carboxyfluorescein diacetate succinimidyl ester; carboxyfluorescein dipivalate succinimide ester; carboxyfluorescein succinimidyl ester (CFSE); Carboxy-X-rhodamine (5-ROX); Cascade Blue; Cascade Yellow; Catecholamine; CCF2 (GeneBlazer); CFDA; Chromomycin A; Chromomycin A; CL-NERF; CMFDA; Coumarin Phalloidin; CPM Methylcoumarin; CTC; CTC Formazan; Cy2; Cy3.1 8; Cy3.5; Cy3; Cy5.1 8; cyclic AMP Fluorosensor (FiCRhR); Dabcyl; Dansyl; Dansyl Amine; Dansyl Cadaverine; Dansyl Chloride; Dansyl DHPE; Dansyl fluoride; DAPI; Dapoxyl; Dapoxyl 2; Dapoxyl 3' DCFDA; DCFH (Dichlorodihydrofluorescein Diacetate); DDAO; DHR (Dihydorhodamine 123); Di-4-ANEPPS; Di-8-ANEPPS (non-ratio); Di A (4-Di-16-ASP); Dichlorodihydrofluorescein Diacetate (DCFH); DiD — Lipophilic Tracer; DiD (DiIC18(5)); DIDS; Dihydorhodamine 123 (DHR); Dil (DiIC18(3)); Dinitrophenol; DiO (DiOC18(3)); DiR; DiR (DiIC18(7)); dipivaloyl-3(4)-(N-(6’-hydroxyhexul))-carboxamide; DM-NERF (high pH); DNP; Dopamine; DTAF; DY-630-NHS; DY-635-NHS; DyLight 405; DyLight 488; DyLight 549; DyLight 633; DyLight 649; DyLight 680; DyLight 800; ELF 97; Eosin; Erythrosin; Erythrosin ITC; Ethidium Bromide; Ethidium homodimer- 1 (EthD-1); Euchrysin; EukoLight; Europium (III) chloride; Fast Blue; FDA; Feulgen (Pararosaniline); FIF (Formaldehyd Induced Fluorescence); FITC; Flazo Orange; Fluo-3; Fluo-4; Fluorescein (FITC); Fluorescein amidite (FAM); Fluorescein Diacetate; fluorescein diacetate 6-isothiocyanate; fluorescein dipivaloyl amidite; fluorescein phosphoramidite; Fluoro-Emerald; Fluoro-Gold (Hydroxystilbamidine); Fluor-Ruby; FluorX; FM 1-43; FM 4-46; Fura Red (high pH); Fura Red / Fluo-3; Fura-2; Fura-2 / BCECF; Genacryl Brilliant Red B; Genacryl Brilliant Yellow 10GF; Genacryl Pink 3G; Genacryl Yellow SGF; GeneBlazer (CCF2); Gloxalic Acid; Granular blue; Haematoporphyrin; HEX; Hoechst 33258; Hoechst 33342; Hoechst 34580; HPTS; Hydroxycoumarin; Hydroxystilbamidine (FluoroGold); Hydroxytryptamine; Indo-1; high calcium; Indo-1; low calcium; Indodicarbocyanine (DiD); Indotricarbocyanine (DiR); Intrawhite Cf; JC-1; JOE; JO-JO-1; JO-PRO-1; JUN; LaserPro; Laurodan; LDS 751 (DNA); LDS 751 (RNA); Leucophor PAF; Leucophor SF; Leucophor WS; Lissamine Rhodamine; Lissamine Rhodamine B; Calcein / Ethidium homodimer; LOLO-1; LO-PRO-1; Lucifer Yellow; Lyso Tracker Blue; Lyso Tracker Blue-White; Lyso Tracker Green; Lyso Tracker Red; Lyso Tracker Yellow; Ly soSensor Blue; Ly soSensor Green; Ly soSensor Yellow / Blue; Mag Green; Magdala Red (Phloxin B); Mag-Fura Red; Mag-Fura-2; Mag-Fura-5; Mag-Indo-1; Magnesium Green; Magnesium Orange; Malachite Green; Marina Blue; Maxiion Brilliant Flavin 10 GFF; MaxiionBrilliant Flavin 8 GFF; Merocyanin; Meth oxy coumarin; Mitotracker Green FM; Mitotracker Orange; Mitotracker Red; Mitramycin; Monobromobimane; Monobromobimane (mBBr-GSH); Monochlorobimane; MPS (Methyl Green Pyronine Stilbene); NBD; NBD Amine; Nile Red; Nitrobenzoxadidole; Noradrenaline; Nuclear Fast Red; Nuclear Yellow; Nylosan Brilliant lavin EBG; Oregon Green; Oregon Green 488-X; Oregon Green; Oregon Green 488; Oregon Green 500; Oregon Green 514; Pacific Blue; Pararosaniline (Feulgen); PBFI; Phloxin B (Magdala Red); Phorwite AR; Phorwite BKL; Phorwite Rev; Phorwite RPA; Phosphine 3R; PKH26 (Sigma); PKH67; PMIA; Pontochrome Blue Black; POPO-1; POPO-3; PO-PRO-1; PO-PRO-3; Primuline; Procion Yellow; Propidium lodid (PI); PyMPO; Pyrene; Pyronine; Pyronine B; Pyrozal Brilliant Flavin 7GF; QSY 7; Quinacrine Mustard; Resorufin; RH 414; Rhod-2; Rhodamine; Rhodamine 110; Rhodamine 123; Rhodamine 5 GLD; Rhodamine 6G; Rhodamine B; Rhodamine B 200; Rhodamine B extra; Rhodamine BB; Rhodamine BG; Rhodamine Green; Rhodamine Phallicidine; Rhodamine Phalloidine; Rhodamine Red; Rhodamine WT; Rose Bengal; S65A; S65C; S65L; S65T; SBFI; Serotonin; Sevron Brilliant Red 2B; Sevron Brilliant Red 4G; Sevron Brilliant Red B; Sevron Orange; Sevron Yellow L; SITS; SITS (Primuline); SITS (Stilbene Isothiosulphonic Acid); SNAFL calcein; SNAFL-1; SNAFL-2; SNARF calcein; SNARF1; Sodium Green; SpectrumAqua; SpectrumGreen; SpectrumOrange; Spectrum Red; SPQ (6-methoxy-N-(3-sulfopropyl)quinolinium); Stilbene; Sulphorhodamine B can C; Sulphorhodamine Extra; SUN; SYBR Green; SYTO 11; SYTO 12; SYTO 13; SYTO 14; SYTO 15; SYTO 16; SYTO 17; SYTO 18; SYTO 20; SYTO 21; SYTO 22; SYTO 23; SYTO 24; SYTO 25; SYTO 40; SYTO 41; SYTO 42; SYTO 43; SYTO 44; SYTO 45; SYTO 59; SYTO 60; SYTO 61; SYTO 62; SYTO 63; SYTO 64; SYTO 80; SYTO 81; SYTO 82; SYTO 83; SYTO 84; SYTO 85; SYTOX Blue; SYTOX Green; SYTOX Orange; TAMARA; Tetracycline; tetrachlorofluorescein (TET); Tetramethylrhodamine (TAMRA); Texas Red; Texas Red-X conjugate; Thiadicarbocyanine (DiSC3); Thiazine Red R; Thiazole Orange; Thioflavin 5; Thioflavin S; Thioflavin TCN; Thiolyte; Thiozole Orange; Tinopol CBS (Calcofluor White); TMR; TO-PRO-1; TO-PRO-3; TO-PRO-5; TOTO-1; TOTO-3; TRITC (tetramethylrodamine isothiocyanate); True Blue; TruRed; Ultralite; Uranine B; Uvitex SFC; WW 781; X-Rhodamine; XRITC; Xylene Orange; Y66F; Y66H; Y66W; Yamika Yellow; YO-PRO-1; YO-PRO-3; YOYO-1; or YOYO-3, and any combination thereof.

[0137] In some embodiments, the probe additionally comprises a quencher of a detectable label, wherein the quencher of a detectable label is covalently bound to the isolated nucleic acid molecule. In some embodiments, the probe comprises a quencher selected from the group consisting of: BBQ-650, BHQ-1, BHQ-2, BHQ-3, Black Hole Quencher (BHQ), Dabcyl, Eclipse, IBFQ, Iowa Black, TAMARA, TAMRA, ZEN, or ZEN Iowa Black, and any combination thereof.

[0138] In some embodiments, the quenching of the detectable label ceases following hydrolysis of a covalent bond within the probe, wherein: the first hydrolysis product comprises the detectable label and the second hydrolysis product comprises the quencher of the detectable label; the detectable label and the quencher become uncoupled; or the hydrolysis prevents the quencher molecule from quenching the detectable signal.

[0139] In some embodiments, a mixture is provided, wherein the mixture comprises a target nucleic acid molecule and a probe as described herein, wherein: the target nucleic acid molecule is substantially homologous to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof; and the primers and, optionally, the probe specifically bind to the target nucleic acid molecule. In some embodiments the mixture comprises one or more primers as described herein. In some embodiments the mixture comprises one or more probes as described herein. In some embodiments the mixture comprises one or more primers and one or more probes as described herein.

[0140] In some embodiments, the mixture additionally comprises a detectable label as described herein. In some embodiments, the detectable label is covalently bound to the probe. In some embodiments, the mixture additionally comprises a quencher of a detectable label as described herein. In some embodiments, the quencher of a detectable label is covalently bound to the probe.

[0141] In some embodiments, the mixture comprises a target nucleic acid molecule which is substantially homologous to SEQ ID NO: 1 or a fragment thereof, a first primer which is substantially homologous to SEQ ID NO: 4, and second primer which is substantially homologous to SEQ ID NO: 5. In some embodiments, the mixture further comprises a probe which is substantially homologous to SEQ ID NO: 9.

[0142] In some embodiments, the mixture comprises a target nucleic acid molecule which is substantially homologous to SEQ ID NO: 2 or a fragment thereof, a first primer which is substantially homologous to SEC ID NO: 5, and second primer which is substantially homologous to SEQ ID NO: 6. In some embodiments, the mixture further comprises a probe which is substantially homologous to SEQ ID NO: 10.

[0143] In some embodiments, the mixture comprises a target nucleic acid molecule which is substantially homologous to SEQ ID NO: 3 or a fragment thereof, a first primer which is substantially homologous to SEC ID NO: 8, and second primer which is substantially homologous to SEQ ID NO: 5. In some embodiments, the mixture further comprises a probe which is substantially homologousto SEQ ID NO: 11.

[0144] In some embodiments, the mixture is an amplification reaction mixture. In such embodiments, the mixture comprises: primers as described herein; deoxynucleoside triphosphate nucleotides; a polymerase; and a buffer, wherein the target nucleic acid may be added. In some embodiments, the mixture further comprises a test sample as described herein.

[0145] In some embodiments, the deoxynucleoside triphosphate nucleotides (dNTPs) comprise a mixture of dATP, dCTP, dGTP, and dTTP. In some embodiments, the dNTPs additionally comprise deoxyuridine triphosphate (dUTP) in conjunction with an uracil DNA glycosylase (UDG) pre-treatment, as a strategy to prevent carryover PCR contamination. In some embodiments, the dNTPs comprise a mixture of dATP, dCTP, dGTP, and dUTP. In some embodiments, the dUTP is modified. In some embodiments, the dUTP is aminoallyl-dUTP, fluorescein- 12-dUTP, 5-bromo-dUTP, or biotin- 11 -dUTP. Other natural or non-natural dNTPs may be used.

[0146] In some embodiments, the polymerase originates from Thermus aquaticus (Taq), Pyrococcus furiosus (Pfu polymerase), Thermococcus litoralis (Wind or Tli polymerase or Vent polymerase) or Thermus thermophilus (Tth polymerase). In some embodiments, the polymerase is specifically modified for uracil incorporation. In some embodiments, the polymerase is specifically modified for incorporating modified dNTPs.

[0147] In some embodiments, the buffer includes Tris-HCl and magnesium chloride (MgCb). In some embodiments, the buffer includes Tris-HCl, ammonium sulfate ((NHfbSC ), and magnesium chloride (MgCb).

[0148] In some embodiments, the mixture additionally comprises a second target nucleic acid molecule as described herein. In some embodiments the mixture additionally comprises primers as described herein, which hybridize to the second target nucleic acid molecule or the complement thereof. In some embodiments, the second nucleic acid is selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3

[0149] In some embodiments, the mixture comprises a second and a third target nucleic acid molecule as described herein. In some embodiments the mixture additionally comprises primers as described herein, which hybridize to the second and third target nucleic acid molecule or the complements thereof or fragments thereof. In some embodiments, the second and third target nucleic acids are selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.

[0150] In some embodiments, the mixture further comprises a test sample. In some embodiments, the test sample comprises a food, food suspension, food solution, or a beverage. In some embodiments, the test sample comprises raw fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drinks, fruit flavored tea, wine, or fruit flavored water.

[0151] In some embodiments, the test sample comprises a solid suspension. In some embodiments, the test sample comprises AU cyclobacillus cells. In some embodiments, the test sample comprises Alicyclobacillus cells that have been separated from a solid suspension. In some embodiments, the test sample comprises genomic DNA from Alicyclobacillus cells. In some embodiments, the test sample comprises digested genomic DNA from Alicyclobacillus cells. In some embodiments, the Alicyclobacillus species is Alicyclobacillus acidoterrestris. In some embodiments, the Alicyclobacillus species is Alicyclobacillus herbarius. In some embodiments, the Alicyclobacillus species is Alicyclobacillus dauci.

[0152] In some embodiments, the mixture further comprises a detectable amplicon, wherein the amplicon is detectable by direct detection or by indirect detection. In someembodiments, the detectable amplicon comprises a sequence substantially homologous to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or fragments thereof, or complements thereof In some embodiments, the detectable amplicon is a PCR product.

[0153] In some embodiments, a container comprising a mixture, as described herein, is provided. In some embodiments, the container is a tube, plate, reaction vessel, and the like.Methods of Use

[0154] Without wishing to be bound by theory, an amplicon may be produced by amplifying a target nucleic acid molecule through many means, and the amplicon can be detected through many means. Non-limiting examples of DNA amplification reactions include polymerase chain reaction (PCR), isothermal amplification, ligase chain reaction (LCR), and rolling circle replication (RCR). Non-limiting examples of PCR reactions include emulsion PCR, real time PCR (RT-PCR), TaqMan® real-time PCR, multiplex PCR, long-range PCR, single-cell PCR, fast-cycling PCR, methylation-specific PCR (MSP), hot start PCR, high- fidelity PCR, rapid amplified polymorphic DNA analysis (RAPD), rapid amplification of cDNA ends (RACE), in situ PCR, differential display PCR, and bridge PCR (bPCR) amplification. Non-limiting examples of isothermal reactions include isothermal amplification is LOOP-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), thermophilic helicase-dependent amplification (tHDA), rolling-circle amplification (RCA), multiple displacement amplification (MDA), recombinase polymerase amplification (RPA), nucleic acid sequence-based amplification (NASBA), self-sustained sequence reaction (3 SR), strand displacement amplification (SDA), transcription-mediated amplification (TMA), and bridge amplification. An exemplary method of LAMP is described in US Patent Application 20130171643. In some embodiments, an internal control can be added during the DNA amplification reactions.

[0155] An amplicon may be detected following amplification, e.g., with a DNA gel, a lateral flow detection device, or a vertical flow detection device. Alternatively, the predictive region, or a fragment thereof, or a complement thereof, may be amplified and the resulting amplicon can be detected in real-time. In one aspect, positive amplification of DNA may be monitored in real-time using dsDNA binding dyes, for example, SYBR Green or EvaGreenK.

[0156] Real-time monitoring may also be accomplished through the addition of particular oligonucleotide hybridization probes, for example, molecular beacons or TaqMan® probes, to a mixture including primers and the target nucleic acid molecule(s). The oligonucleotide probes themselves may include two distinct oligonucleotide strands. A first oligonucleotide strand may include a quencher and a second oligonucleotide strand may include a fluorophore. A fluorescent signal results when the two strands are displaced from one another during the amplification reaction. Alternatively, a single oligonucleotide strand may comprise both the detectable label and the quencher. In some embodiments, the quenching of the detectable label ceases following hydrolysis of a covalent bond within the reporter nucleic acid molecule, wherein: the first hydrolysis product comprises the detectable label and the second hydrolysis product comprises the quencher of the detectable label; the detectable label and the quencher become uncoupled; or the hydrolysis prevents the quencher molecule from quenching the detectable signal. By monitoring the emitted fluorescence, the amplification reaction may be detected. Multiplex detection methods may also be used. Other probe configurations may be used, as are known in the art.

[0157] In some embodiments, a method of detecting a target nucleic acid molecule which is substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or fragments thereof, or complements thereof, is provided.

[0158] In some embodiments, the methods described herein comprise detecting an analyte in a test sample. In some embodiments, the test sample comprises a food, food suspension, food solution, or a beverage. In some embodiments, the test sample comprises raw fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drinks, fruit flavored tea, wine, or fruit flavored water. In some embodiments, the test sample comprises a suspension of Alicyclobacillus cells. In some embodiments, the test sample comprises a suspension of Alicyclobacillus cells in a container that is capable of being centrifuged. In some embodiments, the test sample comprises Alicyclobacillus cells that have been separated from a suspension of Alicyclobacillus cells. In some embodiments, the test sample comprises a pellet of Alicyclobacillus cells that has been separated from a suspension of Alicyclobacillus cells via centrifugation, wherein the supernatant has been decanted from the pellet. In some embodiments, the test sample comprises Alicyclobacillus cells and a lysisbuffer. In some embodiments, the test sample comprises Alicyclobacillus cells, wherein the cell walls have been lysed. In some embodiments, the test sample comprises genomic DNA from lysed Alicyclobacillus cells. In some embodiments, the test sample comprises genomic DNA from lysed Alicyclobacillus cells. In some embodiments, the sample is derived from another sample. For example, a PCR reaction may be performed on a nucleic acid mixture that has been extracted, isolated, and / or purified from another sample (e.g., wine). In this instance the PCR reaction is a sample derived from another sample.

[0159] In some embodiments, the detection of the analyte in the test sample is used to detect an organism comprising a nucleic acid molecule having a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or complements thereof, or fragments thereof. In some embodiments, the organism is wild Alicyclobacillus. In some embodiments, the detection of the analyte in the test sample is used to detect a contaminant comprising a nucleic acid molecule having a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or complements thereof, or fragments thereof, or a variant thereof. In some embodiments, the contaminant is an organism, wherein the organism is a species of the Alicyclobacillus genus. In some embodiments, the contaminant is derived from a species of the Alicyclobacillus genus. In some embodiments, the detection of the analyte in the test sample is used to determine spoilage potential in a test sample. In some embodiments, positive spoilage potential indicates the presence of a contaminant, wherein the contaminant is an organism, and the organism is a species of the Alicyclobacillus genus. In some embodiments, positive spoilage potential indicates the presence of a contaminant derived from a species of the Alicyclobacillus genus which produces guaiacol.

[0160] In some embodiments, the species of the Alicyclobacillus genus is Alicyclobacillus acidoterrestris. In some embodiments, the species of the Alicyclobacillus genus is Alicyclobacillus herbarius. In some embodiments, the species of the Alicyclobacillus genus is Alicyclobacillus dauci.

[0161] In some embodiments, the analyte is a nucleic acid molecule. In some embodiments, the analyte is a nucleic acid molecule that has been amplified. In some embodiments, the analyte is a nucleic acid molecule that is amplified via an amplification method (e.g., PCR or RT-PCR) and then detected according to the methods described herein.In some embodiments, the analyte is an amplification product. In some embodiments, the analyte is a PCR product. In some embodiments, the analyte is an amplicon. In some embodiments, the amplicon is produced through PCR. In some embodiments, the amplicon is produced through RT-PCR. In some embodiments, the amplicon is produced through linear amplification. In some embodiments, the amplicon is a single stranded or a double-stranded nucleic acid molecule. In some embodiments, the amplicon is detected directly. In some embodiments, the amplicon is detected indirectly.

[0162] In some embodiments, the detection of the analyte in the test sample is used to detect an organism comprising a nucleic acid molecule having a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or fragments, thereof, or a variant thereof. In some embodiments, the organism is Alicyclobacillus. For example, if one of skill in the art is determining whether a juicery product sample is contaminated with Alicyclobacillus which produces guaiacol, nucleic acid sequences that are specific for Alicyclobacillus which produces guaiacol may be amplified (e.g. by PCR) and then detected according to the methods described herein, wherein the detection of the amplification products (i.e. amplicons) indicates that the juicery product sample contains the nucleic acid sequences that are specific for Alicyclobacillus species which produce guaiacol. This example is non-limiting and may be applied to detecting other nucleic acid sequence or other types of analytes present in a sample. The analyte may be what is in the initial sample or an analyte that is derived from the initial sample by, for example, using PCR.

[0163] In some embodiments, the amplicon is detected through hybridization methods in whole or in part as described herein. In some embodiments, a detectable label is covalently bound to the amplicon, and the detectable label is detected. In some embodiments, a detectable label is not covalently bound to the amplicon, and the detectable label is detected. In some embodiments, the detectable label is a dye. In some embodiments, the amplicon is detected indirectly using dyes in the reaction mix.

[0164] In some embodiments, the amplicon is detected after the amplification reaction. In some embodiments, one or more amplicon is detected in real-time, for example, using real-time PCR In some embodiments, the amplicon is detected during the amplification reaction, and in other embodiments, one or more amplicon is then detected following theamplification reaction. In some embodiments, the amplicon is detected using a DNA gel. In some embodiments, the amplicon is detected using a lateral flow or a a vertical flow detection device. In some embodiments, two or more amplicons are detected using a single signal. In some embodiments, the amplification is detected in real time with dyes. In some embodiments, the dyes are SYBR Green or EvaGreen. In some embodiments, the amplification is detected in real time using one or more oligonucleotide probes. In some embodiments, the one or more oligonucleotide probes includes a quenching probe and a fluorescent probe. In some embodiments, a fluorescent signal results when the oligonucleotide probes interact with the amplicon. In some embodiments, the oligonucleotide probes are molecular beacons. In some embodiments, the oligonucleotide probes are TaqMan® probes.

[0165] In some embodiments, two or more amplicons may be produced and detected from the same sample. In some embodiments, three amplicons may be produced and detected from the same sample. In some embodiments, the amplification is detected using a multiplex assay. In some embodiments, the multiplex detection method targets total Alicyclobacillus. In some embodiments, the multiplex detection method targets Alicyclobacillus acidoterrestris, Alicyclobacillus herbarius, or Alicyclobacillus dauci. In some embodiments, the multiplex detection assay has an internal amplification control (IAC).

[0166] In some embodiments, a second or subsequent analyte is additionally detected. In some embodiments, the second or subsequent analyte comprises a marker for a species of Alicyclobacillus. In some embodiments, the marker is an amplicon. In some embodiments, the marker is unlabeled. In some embodiments, the marker is labeled. In some embodiments, the second or subsequent analyte comprises a marker for a species of Alicyclobacillus. In some embodiments, the second or subsequent analyte comprises a marker for Alicyclobacillus acidoterrestris, Alicyclobacillus herbarius, or Alicyclobacillus dauci.

[0167] Buffers may also be included in the present invention. Without wishing to be bound by theory, examples of buffers include, but are not limited to, PCR buffers. PCR buffers are suitable for nucleotide amplification and are known in the art. Without wishing to be bound by theory, examples of buffers include, but are not limited to, lysis buffers. Examples of lysis buffers include: 2% Tween (v / v) and 0.1% Triton(v / v); 2% Tween(v / v) and 0.1% SDS(w / v); 2% Tween(v / v) and 0.1% BSA(w / v); 2% Tween(v / v) and 1% BSA(w / v), 0. 1% SDS(w / v), 1%BSA(w / v), or any combination thereof. The lysis buffers may also be, for example, 5% Tween / PBS; 2% Tween / PBS + 0.1% SDS; 2% Tween / PBS + 1% BSA. Other examples of lysis buffers include, but are not limited to, 5% Tween-80(v / v); 5% Triton X-100(v / v); 5% NP40(v / v); 2% Tween-80(v / v); 2% Triton X-100(v / v); 2% NP40(v / v); 1% Tween-80(v / v); 1% Triton X-100(v / v); and 1% NP40(v / v). The detergents and other components of the buffers may be made with any suitable buffer suitable for proteins, and includes, but is not limited to, water and phosphate buffered saline. The lysis buffers may be used to prepare the samples prior to sequence, analyte, amplicon, or organism detection as described herein. In some embodiments, a lysis buffer is not used.

[0168] In some embodiments, the method of detecting an organism comprising a target nucleic acid molecule which is substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or fragments thereof, or complements thereof, in a test sample, comprises reacting the test sample with a first primer and a second primer. In some embodiments, the first and second primers comprise a sequence which is substantially homologous to the sequence of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8, or the complements thereof. Primer pairs may include the primers of SEQ ID NO: 4 and SEQ ID NO: 5, primers of SEQ ID NO: 6 and SEQ ID NO: 7, and primers of SEQ ID NO: 8 and SEQ ID NO: 5.

[0169] In some embodiments, the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule that the first primer binds to, or to the complementary strand. In some embodiments, the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 9, SEQ ID NO: 10, or SEQ ID NO: 11, or the complements thereof. In some embodiments, the probe is labeled with a detectable label.

[0170] In some embodiments, the method comprises reacting a mixture as described herein with a test sample. In some embodiments, the method comprises producing and detecting a detectable amplicon, wherein the detectable amplicon comprises a a sequence which is substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or fragments thereof, or complements thereof. In some embodiments, the detectableamplicon is produced by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0171] In some embodiments, the method comprises the step of detecting of the detectable amplicon using one or more techniques independently selected from the group consisting of: direct detection of a measurement of a physical property of the amplicon, for example a measurement of UV absorption at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye, and detecting the dye; complexing the amplicon with a detectable label, and detecting the presence of the label; detecting a detectable signal from a labeled probe or primer, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample; or detecting a detectable signal from two or more labeled probes or primers, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample.

[0172] In some embodiments, the method comprises detecting a detectable label as described herein, wherein: the detectable label is covalently bound to the probe; the probe is covalently bound to a quencher molecule that quenches the detectable label; the detectable label is coupled to the quencher; and the coupling between the detectable label and the quencher results in quenching of the detectable label.

[0173] In some embodiments, the method comprises contacting the reaction mixture with a lateral flow or vertical flow detection device to detect the amplicon.

[0174] In some embodiments, the method comprises detection of the target nucleic acid molecule comprising a sequence which is substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, and / or SEQ ID NO: 3, or fragments thereof, or complements thereof wherein the detection thereof indicates positive spoilage potential. In some embodiments, positive spoilage potential indicates the presence of a contaminating Alicyclobacillus strain which comprises a nucleic acid molecule having a sequence which is substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO:2, and / or SEQ ID NO: 3, or fragments thereof, or complements thereof.

[0175] In some embodiments, a method of detecting a contaminant comprising a target nucleic acid molecule which is substantially homologous to the sequence of SEQ IDNO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or fragments thereof, or complements thereof, or variants thereof, in a test sample, is provided. In some embodiments, the method comprises detecting the target nucleic acid as described herein.

[0176] In some embodiments, the method of detecting the contaminant comprising a nucleic acid molecule having a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or fragments thereof, or complements thereof, or variants thereof, in a test sample, comprises producing and detecting a detectable amplicon, wherein the detectable amplicon is produced by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

[0177] In some embodiments, the method of detecting the contaminant comprises producing and detecting a detectable amplicon, wherein the detecting of the detectable amplicon comprises one or more techniques from the group of techniques consisting of: direct detection of a measurement of a physical property of the amplicon, for example a measurement of UV absorption at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye, and detecting the dye; complexing the amplicon with a detectable label, and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample; or detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample.

[0178] In some embodiments, a method of determining spoilage potential in a test sample comprising a target nucleic acid molecule having a sequence which is substantially homologous to the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or fragments thereof, or complements thereof, is provided. In some embodiments, the method of determining spoilage potential in the test sample comprises detecting one or more of the target nucleic acid sequences as described herein.

[0179] In some embodiments, positive spoilage potential indicates the presence of a contaminating Alicyclobacillus strain which produces guaiacol.

[0180] In one embodiment, a sample is assayed both for Alicyclobacillus spp. and guaiacol production. In one embodiment, a sample is assayed for at least both (1) presence of a gene that is present in all strains of Alicyclobacillus and (2) presence of a vanillic aciddecarboxylase (vdcC) gene that is present in species that produce guaiacol (for example, a vdcC gene comprising SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3), wherein detection of the presence of both gene targets indicates a positive result for the presence of a contaminating bacterial strain of Alicyclobacillus capable of causing spoilage of the sample. In another embodiment, one, two, or three variant regions of the vdcC gene is detected in an assay.

[0181] In one embodiment, a method is performed comprising assaying for (for example, by amplification and detection) at least both (1) presence of a gene that is present in all strains of Alicyclobacillus and (2) presence of a vanillic acid decarboxylase (vdcC) gene that is present in species that produce guaiacol, wherein detection of the presence of both gene targets indicates a positive result for the presence of a contaminating bacterial strain of Alicyclobacillus capable of causing spoilage of the sample. In one embodiment, a method is performed wherein an amplification reaction using a primer set for one or more (such as one, two, three or more) vdcC gene variant is performed and the amplification product detected, for example, with a probe for each target. In one embodiment, a method is performed wherein an amplification reaction using a primer set for 16s ribosomal RNA gene of Alicyclobacillus and a primer set for one or more (such as one, two, three or more) vdcC gene variant is performed and the amplification product detected, such as with a probe for each target.Kits

[0182] In some embodiments, kits are provided for usage with the methods described herein. The kit may include a detection device, a sample collector, a buffer container, an instruction manual, a positive control, a negative control, or any combination thereof. With respect to the kit, a positive control is a sample that is known to contain the analyte(s) that can be detected with the device present in the kit. In contrast the negative control, does not contain an analyte that can be detected by the kit.

[0183] In one embodiment, a kit may include DNA oligonucleotide primers and probes used in a PCR assay for detection of spoilage bacteria in beverage as described herein. In one specific embodiment, a kit may comprise a reagent that targets one or more (such as one, two, three or more) vdcC gene variant region(s) which variant region(s) is implicated in guaiacol production. In one specific embodiment, a kit may comprise reagents for two or more PCR reactions: (1) targets the Alicyclobacillus 16s ribosomal RNA gene which detects allAlicyclobacillus species; and (2) targets one or more (such as one, two, three or more) vdcC gene variant region(s) which variant region(s) is implicated in guaiacol production. In one embodiment, the kit comprises reagents to amplify and detect one, two, or three variants of vdcC and detects Alicyclobacillus across species that produce guaiacol and cause spoilage of beverages / juices. In one specific embodiment, a kit may comprise reagents to perform a multiplex PCR reaction that targets one or more vdcC gene variant(s) which is implicated in guaiacol production. In one specific embodiment, a kit may comprise reagents to perform a multiplex PCR reaction that targets: (1) the Alicyclobacillus 16s ribosomal RNA gene which detects all Alicyclobacillus species and (2) one or more vdcC gene variant(s) which is implicated in guaiacol production, thus detecting multiple strains of Alicyclobacillus across species that produce guaiacol and cause spoilage of beverages / juices. A kit may include primers for one or more (such as one, two, three or more) vdcC gene variant in a single reaction vessel. A kit may include primers and probes for both 16s ribosomal RNA gene and one or more (such as one, two, three or more) vdcC gene variant in a single reaction vessel.EXAMPLES

[0184] Various aspects of the present disclosure are illustrated with reference to the following non-limiting examples.Example 1:Detection of Alicyclobacillus spp. and Identification of Guaiacol Production Using the GENE-UP® PRO ACB, IFU Method No. 12, and Cosmo BioassaysGENE-UP® PRO ACB Method

[0185] YSG broth (99 mL) was added to a 7 oz. enrichment bag with a mesh divider. Inoculum of a target organisms of approximately 105CFU total (in 1 ml) was added to all samples except negative controls. The sample bags were incubated for 24 h at 45°C then, 50 mL of the enriched sample was transferred into a 50 mL falcon tube and centrifuged at 500 ref for 10 min. The supernatant (25 mL) then was transferred to a new 50 mL falcon tube and centrifuged at 4,000 ref for 10 min. The supernatant was decanted, leaving the pellet behind. Samples were then analyzed by the GENE-UP® ACB PRO PCR system (which includes detection ability of novel vdcC targets as described herein), with the following steps.

[0186] The PCR kit’s ACB buffer (500%»L) was added to the pellet and vortexed. Lysis was performed by transferring 20 »L of this pellet / buffer mixture into lysis tubes (Biomerieux, Marcy-l’Etoile, France). The lysis tubes were vortexed on an OHAUS Digital Mixer at 2,500 rpm for 5 min. Then, 5 »1 of the lysate was transferred into an ACB mastermix tube. These tubes were moved into the GENE-UP® loading platform, and the ACB protocol was performed. The output from the GENE-UP® software is binary (present / absent), but additional quantitative data is provided to users. The results from the Cy5 channel were used to determine presence / absence of guaiacol producers. Each culture was also plated following IFU protocols for the determination of guaiacol production using the Cosmo Bio guaiacol detection kit, as follows:Cosmo Bioassay:

[0187] Guaiacol production was determined using the Cosmo Bio Guaiacol Detection Kit according to the manufacturer’s instructions (Cosmo Bio Co., Ltd., Tokyo, Japan). Briefly, a loopful of a plated colony was added to each YSG-vanillin tube and incubated for 3 h at 45 °C. The three reagents included in the kit were added to each tube and then compared to a negative control to assess if a color change occurred. Alicyclobacillus cultures used were grown on BAT plates from the IFU confirmation plates. If the samples did not have growth on the confirmation plates, cultures grown on YSG plates were used.Results vdcC Predictive Target PCR Phenotypic Assay (CosmoStrain ID Detection Bio 3hr Protocol)DSM 446 (Type A. acidocaldarius 0 / 3 0 / 3FSL-W 10-0007 A. acidocaldarius 0 / 3 0 / 3FSL-W 10-0009 A. acidocaldarius 0 / 3 0 / 3FSL-W 10-0013 A. acidocaldarius 0 / 3 0 / 3FSL-W10-0034 A. acidocaldarius 0 / 3 0 / 3FSL-W10-0057 A.fi'uctus 0 / 3 0 / 3FSL-W10-0059 A.fi’uctus 0 / 3 0 / 3(Type)DSM 3922 A. acidoterrestris / 3 3 / 3(Type)FSL-W10-0022 A. acidoterrestris / 3 3 / 3FSL-W10-0025 A. acidoterrestris 3 / 3 UFSL-W10-0047 A. acidoterrestris / 3 / 3FSL-W10-0058 A. acidoterrestris 3 / 3 3 / 3FSL-W10-0014 A. mali 0 / 3 0 / 3FSL-W10-0018 A. mali 0 / 3 0 / 3(Type)FSL-W10-0037 A. mali 0 / 3 0 / 3FSL-W10-0041 A. mali 0 / 3 0 / 3FSL-W10-0048 A. suci / 3 / 3FSL-W10-0049 A. suci / 3 3 / 3(Type)FSL-W10-0050 A. suci 3 / 3 3 / 3FSL-W10-0051 A. suci 3 / 3 3 / 3FSL-W10-0062 A. suci 3 / 3 3 / 3FSL-W 10-0043 A. acidiphilus 0 / 3 0 / 3FSL-W 10-0021 A. hesperidum 0 / 3 0 / 3DSM 28700 A. dauci 3 / 3 1 / 3DSM 13609 A. herbarius 3 / 3 3 / 3DSM 17979 A. kakagewensis 0 / 3 0 / 3Table 1: Spoilage ability determination study testing multiple Alicyclobacillus strains representing ten different species inoculated at a 1 C CFU / ml level (each in triplicate) and assessed using the GENE-UP® PRO ACB assay, and Cosmo Bioassay.Example 2:

[0188] Primer pairs were designed to amplify SEQ ID NO: 1 from Alicyclobacillus acidoierreslris, SEQ ID NO: 2 from Alicyclobacillus herbarius, and SEQ ID NO: 3 from Alicyclobacillus dauci. The primer pair for SEQ ID NO: 1 from Alicyclobacillus acidoterrestris comprised a first primer with the sequence of SEQ ID NO: 4, and a second primer with the sequence of SEQ ID NO : 5. The primer pair for SEQ ID NO : 2 from Alicyclobacillus herbarius comprised a first primer with the sequence of SEQ ID NO: 6, and a second primer with the sequence of SEQ ID NO: 7. The primer pair for SEQ ID NO: 3 from Alicyclobacillus dauci comprised a first primer with the sequence of SEQ ID NO: 8, and a second primer with the sequence of SEQ ID NO: 5.

[0189] Probes were designed to detect SEQ ID NO: 1 from Alicyclobacillus acidoterrestris, SEQ ID NO: 2 from Alicyclobacillus herbarius, and SEQ ID NO: 3 from Alicyclobacillus dauci. The probe for SEQ ID NO: 1 from Alicyclobacillus acidoterrestriscomprised a nucleic acid molecule with the sequence of SEQ ID NO: 9. The probe for SEQ ID NO: 2 from Alicyclobacillus herbarius comprised a nucleic acid molecule with the sequence of SEQ ID NO: 10. The probe against SEQ ID NO: 3 from Alicyclobacillus dauci comprised a nucleic acid molecule with the sequence of SEQ ID NO: 11.

[0190] The method of sample preparation varies depending on the sample type.

[0191] The sample may be an Alicyclobacillus colony or an Alicyclobacillus culture. A sample may be a food, food suspension, food solution, or beverage. The sample may be raw fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drinks, fruit flavored tea, wine, or fruit flavored water. The sample may be an enriched sample.

[0192] Illustratively, samples are transferred to a container, for example, a tube or a 96 well plate, for lysis, then lysis buffer is added to the sample and the samples are mixed into the buffer by pipetting. The samples may be mixed further with a vortex mixer at 2500 rpm for 5 minutes. The lysed samples are then allowed to settle. The supernatant containing the target DNA is present in solution at the top of the tubes or wells. The target nucleic acid molecule can then be amplified, for example by PCR. The target DNA is then transferred to a container containing PCR reagents. After addition of the sample, a single tube or well may, for example, contain: 10 ng template DNA (200 pg / pL); 0.1-0.5 pM primer with the sequence of SEQ ID NO: 4; 0.1-0.5 pM primer with the sequence of SEQ ID NO: 5, deoxynucleoside triphosphate nucleotides (200 pM each of dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / pL Taq); 0.1-0.5 pM probe with the sequence of SEQ ID NO: 9; and a PCR buffer. Alternatively, for the detection of multiple analytes, the tube or well can, for example, contain: 10 ng template DNA (200 pg / pL); 0.1-0.5 pM primer with the sequence of SEQ ID NO: 4; 0.2-1.0 pM primer with the sequence of SEQ ID NO: 5; 0.1-0.5 pM primer with the sequence of SEQ ID NO: 6; 0.1-0.5 pM primer with the sequence of SEQ ID NO: 7; 0.1-0.5 pM primer with the sequence of SEQ ID NO: 8; deoxynucleoside triphosphate nucleotides (200 pM each of dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / pL Taq); 0.1-0.5 pM probe with sequence of SEQ ID NO: 9; 0.1-0.5 pM probe with sequence of SEQ ID NO: 10; 0.1-0.5 pM probe with sequence of SEQ ID NO: 11; and a PCR buffer. Alternatively, for a multiplex reaction, the tube may additionally contain primers and probes designed against another bacterial genus, forexample, Escherichia coh. A helper oligonucleotide or a second probe may also be added. Alternatively, a dye, for example SYBR Green, may be used in place of probes.

[0193] DNA amplification is achieved using PCR. A multiplex protocol may be used. An example protocol is: 35-40 repeats of 94 °C x 1 minute, 58.1 °C x 2 minutes, and 72 °C x 3 minutes; then hold at 4 °C. Once the run is complete, the results are analyzed. Color compensation is applied to eliminate signal crosstalk. The Ct / Cp values are calculated using methods known in the art.

[0194] Amplification curves have a characteristic shape having an initial lag phase, an exponential amplification phase, and a final plateau phase. The final plateau phase, which represents a decrease in reaction efficiency as reagents are consumed, may not be reached in reactions containing low levels of target organisms. Amplification curves that deviate from the characteristic shape should be interpreted with caution. For each amplification reaction, the cycle at which fluorescence signal rises above background fluorescence is determined and is called the “threshold cycle” (Ct) or “crossing point” (Cp), depending on the instrument. The Ct / Cp will occur at an earlier cycle for samples containing high levels of target organisms and will be delayed for reactions containing low levels of target organisms. Real time PCR may be used to detect a single amplicon; for example, the amplicon having the sequence of SEQ ID NO: 1 may be detected in the FAM channel. Multiple amplicons can be detected in different channels in a multiplex fashion. For example, the amplicon having the sequence of SEQ ID NO: 1 may be detected in the FAM channel, the amplicon having the sequence of SEQ ID NO:2 may be detected in the ROX channel, and the amplicon having the sequence of SEQ ID NO:3 may be detected in the Cy5 channel. The HEX channel may serve as an internal amplification control (IAC) to indicate a successful PCR reaction and should be detected at a Ct / Cp value between -26-30 cycles.

[0195] The presence of an amplification curve indicates the presence of an amplicon in a sample. The presence of the amplicon having the sequence of SEQ ID NO: 1 indicates a sample that is positive for Alicyclobacillus acidoterrestris . The presence of the amplicon having the sequence of SEQ ID NO: 2 indicates a sample that is positive ox Alicyclobacillus herbarius. The presence of the amplicon having the sequence of SEQ ID NO: 3 indicates a sample that is positive for Alicyclobacillus dauci. However, it is important to note that regardless of the species of Alicyclobacillus present in the sample, the presence of an ampliconhaving the sequence of SEQ ID NO: 1, 2, or 3 indicates the presence of an organism capable of causing spoilage by producing guaiacol. High Ct / Cp values (e.g., > 38) may indicate false positives. Negative and positive controls may be used to verify assay functionality. Samples may also be rerun with higher concentrations of starting template DNA. Presumptive positive samples can be confirmed by microbiological plating and colony PCR.Results

[0196] A fruit juice sample was enriched, the enriched sample lysed, and a portion of the lysate added to a PCR tube. PCR reagents were added, and a multiplex PCR was performed with the following primers:Forward : GAGACGGACTACATGGTCGG ( SEQ ID NO : 4 ) ,Reverse : GCAAAGCCGCCGTACCG ( SEQ ID NO : 5 ) ,Forward : GAGACTGACTACATGGTGGG ( SEQ ID NO : 8 ) ,Forward : GAGGTCGACTACATGATTGG ( SEQ ID NO : 6 ) , and Reverse : GCAAAGCCCCCATAACG ( SEQ ID NO : 7 ) .

[0197] Amplification products were detected with the following fluorophore- labeled probes:Probe 1 : ATGCGTATACATCGCGTTCACCGCGACGATT ( SEQ ID NO : 9 ) ,Probe 2 : GTGCGTGTACATTGCATTCACAGCCACGATC ( SEQ ID NO : 10 ) , and Probe 3 : ATGCGTGTACATGGCATTGACGGCCACGATT ( SEQ ID NO : 11 ) .Example 3: Methods of detection using a gene target that is predictive of spoilage, and a vertical flow detection device.

[0198] It is possible to detect the predictive regions (SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3), or fragments thereof, using multiple detection methods.

[0199] The method of sample preparation varies depending on the sample type.

[0200] The sample can be an Alicyclobacillus colony or an AU cyclobacillus culture. A sample may be food, food suspension, food solution, or beverage. The sample may be raw fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drinks, fruit flavored tea, wine, or fruit flavored water. Samples are transferred to a container, for example, a tube or a 96 well plate, for lysis, then lysis buffer is added to the sample and thesamples are mixed into the buffer by pipetting. The samples may be mixed further with a vortex mixer at 2500 rpm for 5 minutes. The lysed samples are then allowed to settle. The supernatant containing the target DNA is present in solution at the top of the tubes or wells. The target nucleic acid molecule may then be amplified, for example, by PCR. The target DNA is then transferred to a container containing PCR reagents. After addition of the sample, a single tube or well may, for example, contain: 10 ng template DNA (200 pg / pL); 0.1-0.5 pM primer with the sequence of SEQ ID NO: 4; 0.1-0.5 pM primer with the sequence of SEQ ID NO: 5, deoxynucleoside triphosphate nucleotides (200 pM each of dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / pL Taq); 0.1-0.5 pM probe with sequence of SEQ ID NO: 9; and a PCR buffer. Alternatively, for the detection of multiple analytes, the tube or well may, for example, contain: 10 ng template DNA (200 pg / pL); 0.1-0.5 pM primer with the sequence of SEQ ID NO: 4; 0.2- 1.0 pM primer with the sequence of SEQ ID NO: 5; 0.1-0.5 pM primer with the sequence of SEQ ID NO: 6; 0.1-0.5 pM primer with the sequence of SEQ ID NO: 7; 0.1-0.5 pM primer with the sequence of SEQ ID NO: 8; deoxynucleoside triphosphate nucleotides (200 pM each of dATP, dCTP, dGTP, and dTTP); DNA polymerase (0.05 units / pL Taq); 0.1-0.5 pM probe with sequence of SEQ ID NO: 9; 0.1-0.5 pM probe with sequence of SEQ ID NO: 10; 0.1-0.5 pM probe with sequence of SEQ ID NO: 11; and a PCR buffer. A helper oligonucleotide or a second probe may also be added.

[0201] In this example, DNA amplification is achieved using PCR. A multiplex protocol may be used. An example protocol is: 35-40 repeats of 94 °C x 1 minute, 58.1 °C x 2 minutes, and 72 °C x 3 minutes; then hold at 4 °C.

[0202] The target may be detected, for example, with a vertical flow device. The sample (e.g., 200 pL) is transferred directly to the window of the vertical flow detection device with a pipette. A separate vertical flow detection device is be used for each PCR tube sample. The vertical flow detection device is allowed to develop for 2 minutes ± 15 seconds.Systems

[0203] In some embodiments, systems are provided for usage with the methods described herein. The system may include a kit or a mixture, as described above, along with an instrument to run the assay. In at least one embodiment, the system as shown in FIG. 2 may include at least one PCR reaction mixture housed in sample vessel 714. In certain embodiments,the sample vessel 714 may include a PCR reaction mixture configured to permit and / or effect amplification of a template nucleic acid. Certain illustrative embodiments may also include at least one sample block or chamber 716 configured to receive the at least one sample vessel 714. The sample vessel 714 may include any plurality of sample vessels in individual, strip, plate, or other format, and, illustratively, may be provided as or received by a sample block or chamber 716.

[0204] One or more embodiments may also include at least one sample temperature controlling device 718 and / or 720 configured to manipulate and / or regulate the temperature of the sample(s). Such a sample temperature controlling device may be configured to raise, lower, and / or maintain the temperature of the sample(s). In one example, sample controlling device 718 is a heating system and sample controlling device 720 is a cooling system. Illustrative sample temperature controlling devices include (but are not limited to) heating and / or cooling blocks, elements, exchangers, coils, radiators, refrigerators, filaments, Peltier devices, forced air blowers, handlers, vents, distributors, compressors, condensers, water baths, ice baths, flames and / or other combustion or combustible forms of heat, hot packs, cold packs, dry ice, dry ice baths, liquid nitrogen, microwave- and / or other wave-emitting devices, means for cooling, means for heating, means for otherwise manipulating the temperature of a sample, and / or any other suitable device configured to raise, lower, and / or maintain the temperature of the sample(s).

[0205] The illustrative PCR system 700 also includes an optical system 710 configured to detect an amount of fluorescence emitted by the sample 714 (or a portion or reagent thereof). Such an optical system 710 may include one or more fluorescent channels, as are known in the art, and may simultaneously or individually detect fluorescence from a plurality of samples.

[0206] At least one embodiment of the PCR system may further include a CPU 706 programmed or configured to operate, control, execute, or otherwise advance the heating system 718 and cooling system 720 to thermal cycle the PCR reaction mixture, illustratively while optical system 710 collects fluorescent signal. CPU 706 may then generate an amplification curve, a melting curve, or any combination, which may or may not be printed, displayed on a screen of the user terminal 704, or otherwise outputted. Optionally, a positive, negative, or other call may be outputted based on the amplification and / or melting curve for example on the screenof the user terminal 704. Optionally, only the calls are outputted, illustratively, one call for each target tested.

[0207] The CPU 706 may include a program memory, a microcontroller or a microprocessor (MP), a random-access memory (RAM), and an input / output (I / O) circuit, all of which are interconnected via an address / data bus. The program memory may include an operating system such as Microsoft Windows®, OS X®, Linux®, Unix®, etc. In some embodiments, the CPU 706 may also include, or otherwise be communicatively connected to, a database or other data storage mechanism (e g., one or more hard disk drives, optical storage drives, solid state storage devices, etc.). The database may include data such as melting curves, annealing temperatures, denaturation temperatures, and other data necessary to generate and analyze melting curves. The CPU 706 may include multiple microprocessors, multiple RAMS, and multiple program memories as well as a number of different types of I / O circuits. The CPU 706 may implement the RAM(s) and the program memories as semiconductor memories, magnetically readable memories, and / or optically readable memories, for example.

[0208] The microprocessors may be adapted and configured to execute any one or more of a plurality of software applications and / or any one or more of a plurality of software routines residing in the program memory, in addition to other software applications. One of the plurality of routines may include a thermocycling routine which may include providing control signals to the heating system 718 and the cooling system 720 to heat and cool the sample 714 respectively, in accordance with the two-step PCR protocol. Another of the plurality of routines may include a fluorescence routine which may include providing control signals to the optical system 710 to emit a fluorescence signal and detect the amount of fluorescence scattered by the sample 714. Yet another of the plurality of routines may include a sample calling routine which may include obtaining fluorescence data (temperature, fluorescence pairs) from the optical system 710 during the in-cycle temperature adjusting segment for each of N cycles, generating a composite melting curve by combining the fluorescent data from each of the N cycles during the respective in-cycle temperature adjusting segments, analyzing the composite melting curve to make a positive or negative call, and displaying the composite melting curve, individual melting curve, and / or an indication of the call on the user terminal 704.

[0209] In some embodiments, the CPU 706 may communicate with the user terminal 704, the heating system 718, the cooling system 720, the optical system 710, and the sampleblock 716 over a communication network 722-732 via wired or wireless signals and, in some instances, may communicate over the communication network via an intervening wireless or wired device, which may be a wireless router, a wireless repeater, a base transceiver station of a mobile telephony provider, etc. The communication network may be a wireless communication network such as a fourth- or third-generation cellular network (4G or 3G, respectively), a Wi-Fi network (802.11 standards), a WiMAX network, a wide area network (WAN), a local area network (LAN), the Internet, etc. Furthermore, the communication network may be a proprietary network, a secure public Internet, a virtual private network and / or some other type of network, such as dedicated access lines, plain ordinary telephone lines, satellite links, combinations of these, etc. Where the communication network comprises the Internet, data communication may take place over the communication network via an Internet communication protocol. Still further, the communication network may be a wired network where data communication may take place via Ethernet or a Universal Serial Bus (USB) connection.

[0210] In some embodiments, the CPU 706 may be included within the user terminal 704. In other embodiments, the CPU 706 may communicate with the user terminal 704 via a wired or wireless connection (e.g., as a remote server) to display individual melting curves, composite melting curves, calls, etc. on the user terminal 704. The user terminal 704 may include a user interface, a communication unit, and a user-input device such as a “soft” keyboard that is displayed on the user interface of the user terminal 704, an external hardware keyboard communicating via a wired or a wireless connection (e.g., a Bluetooth keyboard), an external mouse, or any other suitable user-input device in addition to the CPU 706 or another CPU similar to the CPU 706.

[0211] Although the present disclosure has been described in considerable detail with reference to certain preferred embodiments thereof, other versions are possible. Therefore, the spirit and scope of the appended claims should not be limited to the description and the preferred versions contained within this specification. The embodiments arc now described with reference to the following examples. These examples are provided for the purpose of illustration only and the embodiments should in no way be construed as being limited to these examples, but rather should be construed to encompass any and all variations which become evident as a result of the teaching provided herein. Those of skill in the art will readilyrecognize a variety of non-critical parameters that could be changed or modified to yield essentially similar results.

Claims

What is claimed is:

1. A mixture, comprising: a first primer which specifically binds to a target nucleic acid molecule comprising a sequence of any one of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof; a second primer which specifically binds to a complement of the target nucleic acid molecule; deoxynucleotide triphosphate nucleotides; a DNA polymerase; a buffer; and a test sample that is suspected of having a nucleic acid that is substantially homologous with the target nucleic acid molecule.

2. The mixture of claim 1, wherein the first primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 4; and the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5.

3. The mixture of claim 1, wherein the first primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 6; and the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 7.

4. The mixture of claim 1, wherein the first primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 8; and the second primer comprises a sequence which is substantially homologous to the sequence of SEQ ID NO: 5.

5. The mixture of any one of claims 1-4, additionally comprising a probe, wherein the probe comprises a sequence which is substantially homologous to the target nucleic acid molecule, or fragment thereof, or complement thereof.

6. The mixture of claim 5, further comprising a detectable label, wherein the probe is covalently bound to a detectable label.

7. The mixture of claim 5, wherein the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 9, or the complement thereof and the target nucleic acid molecule sequence comprises SEQ ID NO: 1, a complement thererof, or a fragment thereof.

8. The mixture of claim 5, wherein the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 10, or the complement thereof and the target nucleic acid molecule sequence comprises SEQ ID NO: 2, a complement thererof, or a fragment thereof.

9. The mixture of claim 5, wherein the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 11, or the complement thereof and the target nucleic acid molecule sequence comprises SEQ ID NO: 3, a complement thererof, or a fragment thereof.

10. The mixture of claim 1, wherein the test sample comprises a food, food suspension, food solution, or beverage.

11. The mixture of claim 10, wherein the test sample comprises one or more of the following list: raw fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drinks, fruit flavored tea, wine, and fruit flavored water.

12. A method of detecting an organism comprising a target nucleic acid molecule, the target nucleic acid molecule comprising a sequence which is substantially homologous to one of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof in a test sample, the method comprising: reacting the test sample with a first primer comprising a sequence that specifically binds to the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; anda second primer comprising a sequence that specifically binds to a complement of the target nucleic acid molecule that the first primer binds to under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; and detecting a presence or absence of the detectable amplicon.

13. The method of claim 12, wherein the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule to which the first primer binds.

14. The method of any one of the claims 12 or 13 wherein the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 4, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5; the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 6, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 7; or the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 8, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5.

15. The method of claim 13, wherein the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 4, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5 and the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 9; the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 6, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 7 and the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 10; or the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 8, the second primer comprises a sequence which issubstantially homologous to a sequence of SEQ ID NO: 5 and the probe comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 11.

16. The method of claim 12, wherein the detectable amplicon is produced by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

17. A method of detecting a diastatic strain of Alicyclobacilhis acidoterrestris, the method comprising: reacting a test sample with: a first primer comprising a sequence that specifically binds to a target nucleic acid comprising a sequence of SEQ ID NO: 1, or a fragment thereof, or a complement thereof; and a second primer that specifically binds to a complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising a sequence of SEQ ID NO: 1, or a fragment thereof, or complement thereof; and detecting a presence or an absence of the amplicon.

18. The method of claim 17, wherein the first primer is substantially homologous to a sequence of SEQ ID NO: 4, or the complement thereof, and the second primer is substantially homologous to a sequence of SEQ ID NO: 5, or the complement thereof.

19. The method of any one of claims 17-18, wherein the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule or complement thereof.

20. The method of claim 19, wherein the probe is labeled with a detectable label.

21. The method of claim 19, wherein the probe is substantially homologous to a sequence of SEQ ID NO: 9, or a complement thereof.

22. A method of detecting a diastatic strain of Alicyclobacillus herbarius, the method comprising: reacting a test sample with:a first primer comprising a sequence that specifically binds to a target nucleic acid comprising a sequence of SEQ ID NO: 2, or a fragment thereof, or a complement thereof; and a second primer that specifically binds to a complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising a sequence of SEQ ID NO: 2, or a fragment thereof, or complement thereof; and detecting a presence or an absence of the amplicon.

23. The method of claim 22, wherein the first primer is substantially homologous to a sequence of SEQ ID NO: 6, or the complement thereof, and the second primer is substantially homologous to a sequence of SEQ ID NO: 7, or the complement thereof.

24. The method of any one of claims 22-23, wherein the method further comprises reacting the test sample with a probe that specifically binds to the target nucleic acid molecule or complement thereof.

25. The method of claim 24, wherein the probe is labeled with a detectable label.

26. The method of claim 24, the probe is substantially homologous to a sequence of SEQ ID NO: 10, or a complement thereof.

27. A method of detecting a diastatic strain of Alicyclobacillus dciuci. the method comprising: reacting a test sample with: a first primer comprising a sequence that specifically binds to a target nucleic acid comprising a sequence of SEQ ID NO: 3, or a fragment thereof, or a complement thereof; and a second primer that specifically binds to a complement of the target nucleic acid molecule to which the first primer binds, under conditions sufficient to produce a detectable amplicon comprising a sequence of SEQ ID NO: 3, or a fragment thereof, or complement thereof; anddetecting a presence or an absence of the amplicon.

28. The method of claim 27, wherein the first primer is substantially homologous to a sequence of SEQ ID NO: 8, or the complement thereof, and the second primer is substantially homologous to a sequence of SEQ ID NO: 5, or the complement thereof29. The method of any one of claims 27-28, wherein the method further comprises reacting the sample with a probe that specifically binds to the target nucleic acid molecule or complement thereof.

30. The method of claim 29, wherein the probe is labeled with a detectable label.

31. The method of claim 29, wherein the probe is substantially homologous to a sequence of SEQ ID NO: 11, or a complement thereof.

32. A method of detecting a contaminant comprising a target nucleic acid molecule having a sequence that is substantially homologous to a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof, or a variant thereof in a test sample, the method comprising: reacting the test sample with: a first primer comprising a sequence that specifically binds to the target nucleic acid molecule under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof; and a second primer comprising a sequence that specifically binds to a complement of the target nucleic acid molecule that the first primer binds to under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule or a fragment thereof, or a complement thereof; and detecting a presence or an absence of the amplicon, wherein the presence of the detectable amplicon indicates a presence of a contaminant in the test sample.

33. The method of claim 32, wherein the detectable amplicon is produced by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

34. The method of claim 32, wherein the method of detecting the detectable amplicon comprises one or more from the group consisting of: direct detection of a measurement of a physical property of the amplicon, detecting UV absorption at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye, and detecting the dye; complexing the amplicon with a detectable label, and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample; and detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample.

35. A method of detecting the spoilage potential in a test sample comprising: providing a test sample comprising a food, food suspension, food solution, or beverage, the method comprising: reacting the test sample with: a first primer comprising a sequence that specifically binds to a target nucleic acid molecule, wherein the target nucleic acid molecule comprises a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof, under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or a complement thereof; and a second primer comprising a sequence that specifically binds to the complement of the target nucleic acid molecule that the first primer binds to under conditions sufficient to produce a detectable amplicon comprising the target nucleic acid molecule, or a fragment thereof, or a complement thereof; and detecting a presence or an absence of the detectable amplicon, wherein the presence of the detectable amplicon indicates positive spoilage potential of the test sample.

36. The method of claim 35, wherein the test sample comprises raw fruit, cooked fruit, canned fruit, fruit juice, fruit juice product, blended fruit juice, carbonated fruit drinks, fruit flavored tea, wine, or fruit flavored water.

37. The method of claim 35, wherein the detectable amplicon is produced by polymerase chain reaction (PCR), isothermal amplification, or ligase chain reaction (LCR).

38. The method of claim 35, wherein the method of detecting the detectable amplicon comprises one or more from the group consisting of: direct detection of a measurement of a physical property of the amplicon, detecting UV absorption at 260 nm; isolating the amplicon; sequencing the amplicon; staining the amplicon with a dye, and detecting the dye; complexing the amplicon with a detectable label, and detecting the presence of the label; detecting a detectable signal from a reporter molecule, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample; and detecting a detectable signal from two or more reporter molecules, wherein the total detectable signal is proportional to the number of copies of the amplicon in the sample.

39. A method of detecting at least one contaminant in a test sample, each contaminant comprising one of three target nucleic acid molecules, each of the three target nucleic acid molecules having a sequence that is substantially homologous to one of a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, or a fragment thereof, or a complement thereof, or a variant thereof, the method comprising: reacting the test sample with a first primer, a second primer, a third primer, a fourth primer, and a fifth primer, wherein, the first primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 4, the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5; the third primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 6,the fourth primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 7; the fifth primer comprises a sequence which is substantially homologous a sequence of SEQ ID NO: 8, under conditions sufficient to produce three detectable amplicons, the three detectable amplicons comprising the three target nucleic acid molecules, or fragments thereof, or complements thereof; and detecting a presence or an absence of each of the three amplicons, wherein the presence of any one of the three amplicons indicates a presence of a contaminant in the test sample.

40. The method of claim 39, further comprising reacting the test sample with: a first probe comprising a sequence that is substantially homologous to a sequence of SEQ ID NO: 9; a second probe comprising a sequence which is substantially homologous to a sequence of SEQ ID NO: 10; and a third probe comprising a sequence which is substantially homologous to a sequaence of SEQ ID NO: 11.

41. A system comprising: a mixture of any one of claims 1-4; and an instrument configured to perform an amplification assay on the mixture.

42. The system of claim 41, further comprising at least one sample vessel.

43. The system of claim 42, further comprising at least one PCR reaction mixture, wherein each of the PCR reaction mixtures is housed in one of the at least one sample vessel.

44. The system of claim 41, further comprising at least one sample temperature controlling device.

45. The system of claim 41, wherein the mixture additionally comprises a probe comprising a sequence which is substantially homologous to the target nucleic acid molecule, or fragments thereof, or complements thereof.

46. A kit comprising: a first primer that comprises a sequence that is substantially homologous to a target nucleic acid molecule, the target nucleic acid molecule comprising a sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3; a second primer that comprises a sequence that is substantially complementary to the target nucleic acid molecule to which the first primer is substantially homologous; deoxynucleotide triphosphate nucleotides; and a buffer.

47. The kit of claim 46, further comprising a DNA polymerase.

48. The kit of claim 46, wherein the first primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 4; and the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 5.

49. The kit of claim 48, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO:9.

50. The kit of claim 46, wherein the first primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 6; and the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 7.

51. The kit of claim 50, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO:10.

52. The kit of claim 46, wherein the first primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO: 8; and the second primer comprises a sequence which is substantially homologous to a sequence of SEQ ID NO:

553. The kit of claim 52, further comprising a probe, wherein the probe comprises a sequence that is substantially homologous to or substantially complementary to a sequence of SEQ ID NO: 11.

54. The kit of any one of claims 49, 51, or 53, wherein wherein the probe is covalently bound to a detectable label.

55. The kit of claim 54, wherein the probe also includes a quencher positioned to quench a signal from the detectable label.

Images