Enzyme having peplusol synthase activity

EP4630565A1Pending Publication Date: 2025-10-15THE UNIV OF YORK
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023825081
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-08-01
Filing Date
2023-12-06
Publication Date
2025-10-15

AI Technical Summary

Technical Problem

The complexity of terpenes, particularly triterpenes, makes chemical synthesis challenging, and existing methods lack efficiency in producing triterpene alcohols like peplusol with strong antifungal activities, which are valuable for industrial and biotechnological applications.

Method used

Isolation and characterization of a triterpene synthase from Euphorbia peplus, along with co-expression of a truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase, to enhance the production of peplusol in Nicotiana benthamiana and Saccharomyces cerevisiae, utilizing expression vectors and specific promoter sequences to regulate gene expression.

Benefits of technology

Significantly increases peplusol production, competing with endogenous squalene synthase for farnesyl diphosphate, thereby enhancing triterpene yield and biological activity, and providing a sustainable source for industrial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 1.1
    Figure 1.1
Patent Text Reader

Abstract

The disclosure relates to the isolation and characterisation of a nucleic acid molecule encoding a triterpene synthase polypeptide isolated from Euphorbia peplus; cells, for example plant cells or microbial cells transformed with nucleic acid encoding said polypeptide.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]ENZYME Field of the Disclosure The disclosure relates to the isolation and characterisation of a triterpene synthase (e.g., a peplusol synthase), polypeptide isolated from Euphorbia peplus; cells, for example plant cells or microbial cells, transformed with nucleic acid encoding said polypeptide; expression vectors including nucleic acid encoding said polypeptide and methods to produce a triterpene alcohol, for example peplusol. Background to the Disclosure The Terpenes are a diverse groups of plant natural products. Their complexity does not lend itself to chemical synthesis. Triterpenes are components of surface waxes and specialized membranes and may potentially act as signalling molecules. Complex glycosylated triterpenes (e.g., saponins) provide protection against pathogens and pests. Simple and complex triterpenes have a wide range of applications in the food, health, and industrial biotechnology sectors. The Euphorbiaceae is a large family of flowering plants found all over the world, with some synthesising diterpene compounds of considerable biological activity such as ingenol mebutate (Euphorbia peplus), resiniferatoxin (E. resinifera), prostratin (E. cornigera), jatrophanes and lathyranes (Jatropha sp. and Euphorbia sp.), jatropholones, (Jatropha sp.), rhamnofolanes (Jatropha sp.) and jatrophone (Jatropha sp.). Several triterpenes have been isolated from plants belonging to the family of Euphorbiaceae. For example, linear and cyclic triterpenes such as peplusol, cycloartenol, lanosterol and others (1). Peplusol is a triterpene alcohol with strong antifungal activities (1) that was previously described as being responsible for the physical properties of Euphorbia peplus latex (2). Peplusol, like other triterpenoids is thought to be derived from two farnesyl diphosphate (FPP) molecules in a reaction that is similar to the production of the well documented squalene molecule. Squalene is used in cosmetics and skin care, was originally sourced from shark liver until recently and is now a target for industrial biotechnology to deliver a more sustainable supply. This disclosure relates to a triterpene synthase isolated from E. peplus that produces peplusol when transiently expressed in Nicotiana benthamiana (Figure 1) and Saccharomyces cerevisiae (Figure 2). Therefore, this enzyme has peplusol synthase activity. We have also identified an alternative enzyme with the same activity. In addition, we have found that production of peplusol is significantly increased when a truncated version of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase (tHMGR) which catalyzes the conversion of HMG-CoA to mevalonate, is co-expressed in plants with the discovered E. peplus peplusol synthase (Figure 1). Statements of Invention According to an aspect of the invention there is provided an isolated nucleic acid molecule that encodes a polypeptide with peplusol synthase activity wherein said nucleic acid molecule comprises or consists of a nucleotide sequence selected from the group consisting of: i) a nucleotide sequence as represented by the sequence in SEQ ID NO: 1 or SEQ ID NO: 2; ii) a nucleotide sequence wherein said sequence is degenerate as a result of the genetic code to the nucleotide sequence defined in (i); iii) a nucleic acid molecule the complementary strand of which hybridizes under stringent hybridization conditions to the sequence in SEQ ID NO: 1 or SEQ ID NO: 2 wherein said nucleic acid molecule encodes a polypeptide with peplusol synthase activity; iv) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence as represented in SEQ ID NO: 3; v) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence wherein said amino acid sequence is modified by addition deletion or substitution of at least one amino acid residue as represented in iv) above and which has retained or enhanced peplusol synthase activity. According to an aspect of the invention there is provided an isolated nucleic acid molecule that encodes a polypeptide with peplusol synthase activity wherein said nucleic acid molecule comprises or consists of a nucleotide sequence selected from the group consisting of: i) a nucleotide sequence as represented by the sequence in SEQ ID NO: 6 or SEQ ID NO: 7; ii) a nucleotide sequence wherein said sequence is degenerate as a result of the genetic code to the nucleotide sequence defined in (i); iii) a nucleic acid molecule the complementary strand of which hybridizes under stringent hybridization conditions to the sequence in SEQ ID NO: 6 or SEQ ID NO: 7 wherein said nucleic acid molecule encodes a polypeptide with peplusol synthase activity; iv) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence as represented in SEQ ID NO: 8; v) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence wherein said amino acid sequence is modified by addition deletion or substitution of at least one amino acid residue as represented in iv) above and which has retained or enhanced peplusol synthase activity. Hybridization of a nucleic acid molecule occurs when two complementary nucleic acid molecules undergo an amount of hydrogen bonding to each other. The stringency of hybridization can vary according to the environmental conditions surrounding the nucleic acids, the nature of the hybridization method, and the composition and length of the nucleic acid molecules used. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001); and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993). The Tmis the temperature at which 50% of a given strand of a nucleic acid molecule is hybridized to its complementary strand. The following is an exemplary set of hybridization conditions and is not limiting: Very High Stringency (allows sequences that share at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to hybridize over the disclosed full-length sequence) Hybridization: 5x SSC at 65 ^C for 16 hours Wash twice: 2x SSC at room temperature (RT) for 15 minutes each Wash twice: 0.5x SSC at 65 ^C for 20 minutes each High Stringency (allows sequences that share at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% or 89% identity to hybridize over the disclosed full-length sequence) Hybridization: 5x-6x SSC at 65 ^C-70 ^C for 16-20 hours Wash twice: 2x SSC at RT for 5-20 minutes each Wash twice: 1x SSC at 55 ^C-70 ^C for 30 minutes each Low Stringency (allows sequences that share at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% or 79% identity to hybridize over the disclosed full-length sequence) Hybridization: 6x SSC at RT to 55 ^C for 16-20 hours Wash at least twice: 2x-3x SSC at RT to 55 ^C for 20-30 minutes each. According to a further aspect of the invention there is provided the use of a nucleic acid molecule according to the invention in the manufacture of a peplusol synthase. According to a further aspect of the invention there is provided an isolated polypeptide selected from the group consisting of: i) a polypeptide comprising or consisting of an amino acid sequence as represented in SEQ ID NO: 3; or ii) a modified polypeptide comprising or consisting of a modified amino acid sequence wherein said polypeptide is modified by addition deletion or substitution of at least one amino acid residue of the sequence presented in SEQ ID NO: 3 and which has peplusol synthase activity. According to a further aspect of the invention there is provided an isolated polypeptide selected from the group consisting of: i) a polypeptide comprising or consisting of an amino acid sequence as represented in SEQ ID NO: 8; or ii) a modified polypeptide comprising or consisting of a modified amino acid sequence wherein said polypeptide is modified by addition deletion or substitution of at least one amino acid residue of the sequence presented in SEQ ID NO: 8 and which has peplusol synthase activity. A modified polypeptide as herein disclosed may differ in amino acid sequence by one or more substitutions, additions, deletions, truncations that may be present in any combination. Among preferred variants are those that vary from a reference polypeptide by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid by another amino acid of like characteristics. The following non-limiting list of amino acids are considered conservative replacements (similar): a) alanine, serine, and threonine; b) glutamic acid and aspartic acid; c) asparagine and glutamine d) arginine and lysine; e) isoleucine, leucine, methionine and valine and f) phenylalanine, tyrosine and tryptophan. Most highly preferred are variants that retain or enhance the same biological function and activity as the reference polypeptide from which it varies. In one embodiment, the variant polypeptides have at least 50% identity, even more preferably at least 55% identity, still more preferably at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% identity, and at least 99% identity with most or the full-length amino acid sequence illustrated herein. In an embodiment, the variant polypeptides have at least 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% identity, and at least 99% identity with most or the full-length amino acid sequence illustrated herein. According to a further aspect of the invention there is provided the use of a peplusol synthase polypeptide according to the invention in the manufacture of peplusol. According to a further aspect of the invention there is provided a vector comprising a nucleic acid molecule according to the invention. In a preferred embodiment of the invention said nucleic acid molecule is operably linked to a nucleic acid molecule comprising a promoter sequence. In a preferred embodiment of the invention said nucleic acid sequence comprising a promoter that confers constitutive, regulated or inducible expression on said peplusol synthase. In a preferred embodiment of the invention said promoter is a heterologous promoter for expression is a heterologous host cell. For example, not a Euphorbia peplus cell or plant. Preferably, the nucleic acid molecule in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, (e.g., bacterial, yeast), or plant cell. The vector may be a bi- functional expression vector which functions in multiple hosts. By "promoter" is meant a nucleotide sequence upstream from the transcriptional initiation site and which contains all the regulatory regions required for transcription. Suitable promoters include constitutive, tissue-specific, inducible, developmental or other promoters for expression in plant cells comprised in plants depending on design. Such promoters include viral, fungal, bacterial, animal and plant-derived promoters capable of functioning in plant cells. Constitutive promoters include, for example CaMV 35S promoter (Odell et al. (1985) Nature 313, 9810-812); rice actin (McElroy et al. (1990) Plant Cell 2: 163-171); ubiquitin (Christian et al. (1989) Plant Mol. Biol. 18 (675-689); pEMU (Last et al. (1991) Theor Appl. Genet. 81: 581-588); MAS (Velten et al. (1984) EMBO J. 3. 2723-2730); ALS promoter (U.S. Application Seriel No. 08 / 409,297), and the like. Other constitutive promoters include those in U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680, 5,268,463; and 5,608,142, each of which is incorporated by reference. Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induced gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88: 10421-10425 and McNellis et al. (1998) Plant J. 14(2): 247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet.227: 229-237, and US Patent Nos.5,814,618 and 5,789,156, herein incorporated by reference. Where enhanced expression in particular tissues is desired, tissue-specific promoters can be utilised. Tissue-specific promoters include those described by Yamamoto et al. (1997) Plant J. 12(2): 255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7): 792- 803; Hansen et al. (1997) Mol. Gen. Genet. 254(3): 337-343; Russell et al. (1997) Transgenic Res.6(2): 157-168; Rinehart et al. (1996) Plant Physiol.112(3): 1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2): 525-535; Canevascni et al. (1996) Plant Physiol. 112(2): 513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5): 773-778; Lam (1994) Results Probl. Cell Differ.20: 181-196; Orozco et al. (1993) Plant Mol. Biol. 23(6): 1129-1138; Mutsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90 (20): 9586-9590; and Guevara-Garcia et al (1993) Plant J.4(3): 495-50. "Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter. In a preferred aspect, the promoter is a tissue specific promoter, an inducible promoter or a developmentally regulated promoter. Of interest in the present context are nucleic acid constructs which operate as plant vectors. Specific procedures and vectors previously used with wide success in plants are described by Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148. Suitable vectors may include plant viral-derived vectors. If desired, selectable genetic markers may be included in the construct, such as those that confer selectable phenotypes such as resistance to herbicides (e.g., kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate). According to a further aspect of the invention there is provided a cell transformed or transfected with a nucleic acid molecule or vector according to the invention. In a preferred embodiment of the invention there is provided a cell transformed or transfected with: i) a first nucleic acid molecule encoding a peplusol synthase according to the invention; and ii) a second nucleic acid molecule encoding a 3-hydroxy-3-methylglutaryl coenzyme A reductase and wherein said first and second nucleic acid molecules are co-expressed in said cell. Preferably, said 3-hydroxy-3-methylglutaryl coenzyme A reductase has a truncation of the N-terminal membrane-binding region. The enzyme 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR; EC 1.1.1.34) is known in the art and catalyses the reduction of HMG-CoA to mevalonate. The truncation of the N-terminal membrane-binding region of HMGCR is known to remove feedback control of HMGCR activity (20, 21). The upregulation of the truncated version of HMGCR results in the increased flux through the mevalonate pathway for the production of farnesyl diphosphate (FPP), which is common precursor for all triterpenes, including peplusol. In a preferred embodiment of the invention said second nucleic acid molecule encodes a polypeptide with 3-hydroxy-3-methylglutaryl coenzyme A activity and wherein said nucleic acid molecule comprises or consists of a nucleotide sequence selected from the group consisting of: i) a nucleotide sequence as represented by the sequence in SEQ ID NO: 4 ii) a nucleotide sequence wherein said sequence is degenerate as a result of the genetic code to the nucleotide sequence defined in (i); iii) a nucleic acid molecule the complementary strand of which hybridizes under stringent hybridization conditions to the sequence in SEQ ID NO: 4 wherein said nucleic acid molecule encodes a polypeptide with 3-hydroxy-3-methylglutaryl coenzyme A activity; iv) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence as represented in SEQ ID NO: 5 v) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence wherein said amino acid sequence is modified by addition deletion or substitution of at least one amino acid residue as represented in iv) above and which has retained or enhanced 3-hydroxy-3-methylglutaryl coenzyme A activity. In a preferred embodiment of the invention said cell is a plant cell. In an alternative preferred embodiment of the invention said cell is a microbial cell; preferably a bacterial or fungal cell [e.g., Saccharomyces cerevisiae]. According to a further aspect of the invention there is provided a plant comprising a plant cell according to the invention. According to an aspect of the invention there is provided the use of a cell according to the invention in the production of peplusol. According to an aspect of the invention there is provided a process for the modification of farnesyl diphosphate comprising: i) providing a transgenic plant cell according to the invention; ii) cultivating said plant cell to produce a transgenic plant; and optionally i) harvesting said transgenic plant, or part thereof. Preferably, said modification results in the production of peplusol. According to an aspect of the invention there is provided a method for the production of peplusol comprising: i) providing a microbial cell according to the invention in culture ii) cultivating the microbial cell under conditions that modifies farnesyl diphosphate to produce peplusol; and optionally iii) isolating said peplusol from the microbial cell or cell culture. Preferably, said microbial cell expresses the truncated form of HMGCR. In a preferred method of the invention said transgenic cell is a microbial cell; preferably a bacterial or fungal cell [e.g., Saccharomyces cerevisiae]. If microbial cells are used as organisms in the process according to the invention they are grown or cultured in the manner with which the skilled worker is familiar, depending on the host organism. As a rule, microorganisms are grown in a liquid medium comprising a carbon source, usually in the form of sugars, a nitrogen source, usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as salts of iron, manganese and magnesium and, if appropriate, vitamins, at temperatures of between 0°C and 100°C, preferably between 10°C and 60°C, while gassing in oxygen. The pH of the liquid medium can either be kept constant, regulated during the culturing period, or not. The cultures can be grown batchwise, semi-batchwise or continuously. Nutrients can be provided at the beginning of the fermentation or fed in semi- continuously or continuously. The triterpene produced can be isolated from the organisms as described above by processes known to the skilled worker, for example by extraction, distillation, crystallization, if appropriate precipitation with salt, and / or chromatography. To this end, the organisms can advantageously be disrupted beforehand. In this process, the pH value is advantageously kept between pH 4 and 12, preferably between pH 6 and 9, especially preferably between pH 7 and 8. The culture medium to be used must suitably meet the requirements of the strains in question. Descriptions of culture media for various microorganisms can be found in the textbook "Manual of Methods for General Bacteriology" of the American Society for Bacteriology (Washington D.C., USA, 1981). As described above, these media which can be employed in accordance with the invention usually comprise one or more carbon sources, nitrogen sources, inorganic salts, vitamins and / or trace elements. Preferred carbon sources are sugars, such as mono-, di- or polysaccharides. Examples of carbon sources are glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose. Sugars can also be added to the media via complex compounds such as molasses or other by-products from sugar refining. The addition of mixtures of a variety of carbon sources may also be advantageous. Other possible carbon sources are oils and fats such as, for example, soya oil, sunflower oil, peanut oil and / or coconut fat, fatty acids such as, for example, palmitic acid, stearic acid and / or linoleic acid, alcohols and / or polyalcohols such as, for example, glycerol, methanol and / or ethanol, and / or organic acids such as, for example, acetic acid and / or lactic acid. Nitrogen sources are usually organic or inorganic nitrogen compounds or materials comprising these compounds. Examples of nitrogen sources comprise ammonia in liquid or gaseous form or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or complex nitrogen sources such as cornsteep liquor, soya meal, soya protein, yeast extract, meat extract and others. The nitrogen sources can be used individually or as a mixture. Inorganic salt compounds which may be present in the media comprise the chloride, phosphorus and sulfate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron. Inorganic sulfur-containing compounds such as, for example, sulfates, sulfites, dithionites, tetrathionates, thiosulfates, sulfides, or else organic sulfur compounds such as mercaptans and thiols may be used as sources of sulfur for the production of sulfur- containing fine chemicals, in particular of methionine. Phosphoric acid, potassium dihydrogenphosphate or dipotassium hydrogenphosphate or the corresponding sodium-containing salts may be used as sources of phosphorus. Chelating agents may be added to the medium to keep the metal ions in solution. Particularly suitable chelating agents comprise dihydroxyphenols such as catechol or protocatechuate and organic acids such as citric acid. The fermentation media used according to the invention for culturing microorganisms usually also comprise other growth factors such as vitamins or growth promoters, which include, for example, biotin, riboflavin, thiamine, folic acid, nicotinic acid, panthothenate and pyridoxine. Growth factors and salts are frequently derived from complex media components such as yeast extract, molasses, cornsteep liquor and the like. It is moreover possible to add suitable precursors to the culture medium. The exact composition of the media compounds heavily depends on the particular experiment and is decided upon individually for each specific case. Information on the optimization of media can be found in the textbook "Applied Microbiol. Physiology, A Practical Approach" (Editors P.M. Rhodes, P.F. Stanbury, IRL Press (1997) pp.53-73, ISBN 019 9635773). Growth media can also be obtained from commercial suppliers, for example Standard 1 (Merck) or BHI (brain heart infusion, DIFCO) and the like. All media components are sterilized, either by heat (20 min at 1.5 bar and 121°C) or by filter sterilization. The components may be sterilized either together or, if required, separately. All media components may be present at the start of the cultivation or added continuously or batchwise, as desired. The culture temperature is normally between 15°C and 45°C, preferably at from 25°C to 40°C, and may be kept constant or may be altered during the experiment. The pH of the medium should be in the range from 5 to 8.5, preferably around 7.0. The pH for cultivation can be controlled during cultivation by adding basic compounds such as sodium hydroxide, potassium hydroxide, ammonia and aqueous ammonia or acidic compounds such as phosphoric acid or sulfuric acid. Foaming can be controlled by employing antifoams such as, for example, fatty acid polyglycol esters. To maintain the stability of plasmids it is possible to add to the medium suitable substances having a selective effect, for example antibiotics. Aerobic conditions are maintained by introducing oxygen or oxygen-containing gas mixtures such as, for example, ambient air into the culture. The temperature of the culture is normally 20°C to 45°C and preferably 25°C to 40°C. The culture is continued until formation of the desired product is at a maximum. This aim is normally achieved within 10 to 160 hours. The fermentation broth can then be processed further. The biomass may, according to requirement, be removed completely or partially from the fermentation broth by separation methods such as, for example, centrifugation, filtration, decanting or a combination of these methods or be left completely in said broth. It is advantageous to process the biomass after its separation. However, the fermentation broth can also be thickened or concentrated without separating the cells, using known methods such as, for example, with the aid of a rotary evaporator, thin-film evaporator, falling-film evaporator, by reverse osmosis or by nanofiltration. Finally, this concentrated fermentation broth can be processed to obtain the products present therein. Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of the words, for example “comprising” and “comprises”, means “including but not limited to”, and is not intended to (and does not) exclude other moieties, additives, components, integers or steps. “Consisting essentially” means having the essential integers but including integers which do not materially affect the function of the essential integers. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. Where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise. Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. An embodiment of the invention will now be described by example only and with reference to the following figures: FIGURE 1. Heterologous expression of E. peplus truncated Peplusol Synthase (EpTS) in N. benthamiana. Abbreviations: EV – empty vector, tHMGR – truncated version of A. thaliana 3-Hydroxy- 3-MethylGlutaryl coenzyme A Reductase, nd – not detectable. Error bars – standard error (n=4). FIGURE 2. Heterologous expression of (A) E. peplus truncated Peplusol Synthase (EpTS) and (B) A. thaliana Squalene Synthase (AtSS) in S. cerevisiae. Abbreviations: EV – empty vector, AtSS –A. thaliana squalene synthase, EpTS - E. peplus truncated Peplusol Synthase, nd – not detectable. Error bars – standard error (n=3). Extractions on were done using methanol (MeOH) or ethyl acetate (EtOAc) as described in Materials and Methods section Figure 3A Amino acid sequence of E. peplus truncated Peplusol Synthase (EpTS) with four conserved regions in Eukaryotic and Prokaryotic squalene synthases highlighted in blue, two DXXED motifs as the substrate binding sites highlighted in brown and residues involved in NADPH recognition highlighted in green, according to Liu et al. 2014. (top) and the prediction of transmembrane helices in protein sequences using TMHMM - 2.0 service from the closely related homologues selected from Figure 3B (bottom). Figure 3B. E. peplus truncated Peplusol Synthase (EpTS) nucleotide and amino acid identity to Eukaryotic and Prokaryotic homologous squalene synthases. Functionally characterised squalene synthases marked with asterisk. Figure 3C. E. peplus full length Peplusol Synthase (EpTS2) nucleotide and amino acid identity to Eukaryotic and Prokaryotic homologous squalene synthases. Functionally characterised squalene synthases marked with asterisk. Figure 4A E. peplus truncated Peplusol Synthase (EpTS) nucleotide sequence (SEQ ID NO: 1) and Figure 4B EpTS amino acid sequence (SEQ ID NO: 3).Figure 4C EpTS truncated peplusol synthase nucleotide sequence (SEQ ID NO: 2) codon optimised for expression in Saccharomyces cerevisiae. Figure 5A nucleotide sequence (SEQ ID NO: 4) and Figure 5Bamino acid sequence (SEQ ID NO: 5) of truncated 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase (tHMGCR). Figure 6 Heterologous expression of E. peplus truncated and full length Peplusol Synthases (EpTS and EpTS2 respectively) and A. thaliana Squalene Synthase (AtSS) in N. benthamiana. (A) Raw LC-MS chromatograms showing peplusol extracted ion mass (m / z 427.3933) displayed for N. benthamiana leaves infiltrated with E. peplus truncated and full length Peplusol Synthases (EpTS and EpTS2 respectively) and A. thaliana Squalene Synthase as well as for the E. peplus – purified peplusol standard. Leaf extractions and LC-MS methods described in materials and methods section. (B) LC- and GC-MS based quantification of peplusol and squalene in N. benthamiana plants infiltrated with E. peplus truncated and full length Peplusol Synthases (EpTS and EpTS2 respectively) and A. thaliana Squalene Synthase as described in materials and methods section. Abbreviations: EV – empty vector, AtSS –A. thaliana squalene synthase, EpTS and EpTS2 – E. peplus truncated and full length Peplusol Synthases respectively,, tHMGR – truncated version of A. thaliana 3-Hydroxy-3-MethylGlutaryl coenzyme A Reductase, nd – not detectable. Error bars – standard error (n=4). Figure 7 Heterologous expression of E. peplus truncated and full length Peplusol Synthases (EpTS and EpTS2 respectively) and A. thaliana Squalene Synthase (AtSS) in S. cerevisiae. Abbreviations: EV – empty vector, AtSS –A. thaliana squalene synthase, EpTS and EpTS2 – E. peplus truncated and full length Peplusol Synthases respectively, nd – not detectable. Error bars – standard error (n=3). (A) LC-MS based quantification of peplusol in S. cerevisiae strains overexpressing E. peplus truncated and full length Peplusol Synthases (EpTS and EpTS2 respectively) and A. thaliana Squalene Synthase (AtSS). Extractions performed using either ethyl acetate (EtOAc) on whole cultures and media-supernatants or methanol (MeOH) on cell pellets, as described in materials and methods section. (B) GC-MS based quantification of squalene in S. cerevisiae strains overexpressing E. peplus truncated and full length Peplusol Synthases (EpTS and EpTS2 respectively) and A. thaliana Squalene Synthase (AtSS). Extraction, derivatisation and quantification performed on cell pellets, as described in materials and methods section. Figure 8 nucleotide sequence (SEQ ID NO: 6) and Figure 4B amino acid sequence (SEQ ID NO: 8) of full length peplusol synthase (TPS2); Figure 4C full length peplusol synthase nucleotide sequence (SEQ ID NO: 7) codon optimised for expression in Saccharomyces cerevisiae. MATERIALS AND METHODS 1. Preparation and identification of peplusol. 4.8 ml of latex was harvested from 8-weeks old E. peplus plants, frozen in LN2 and extracted with 10 volumes of 100% ethyl acetate (Rathburn Chemicals, UK) over 5 days. Ethyl acetate was removed by rotary evaporation to yield 0.93 g of a dark yellow oily residue which was taken up in 20 ml of an n-hexane:ethyl acetate mixture (80:20). The extract was then applied to a 40 g Grace Resolve silica column and fractions collected using a 0-100 % ethyl acetate in hexane gradient, followed by isocratic 100% ethyl acetate and 100% methanol. This method yielded 10 mg of peplusol NMR data for peplusol:1H NMR (600 MHz, CDCl3): δ 5.14-5.06 (m, 5H (H-6, H-10, H-2', H-6', H-10')), 4.96 (s, 1H (H-15)), 4.87 (s, 1H (H-15)), 3.59-3.51 (m, 2H (H-1)), 2.28 (ddt, J = 7.2, 5.5, 7.2 Hz, 1H (H-2)), 2.19-2.12 and 2.12-2.01 (m, (H-4, H-5, H-1', H-5', H-9')), 2.02-1.95 (m, 6H (H-8, H-4', H-8')), 1.68 (s, 6H (H-13, H-13')), 1.61 (s, 6H (H-12, H-12')), 1.60 (s, 6H (H-14', H-14 or H-15')), 1.59 (s, 3H (H-14 or H-15'));13C NMR (CDCl3): δ 149.6 (C-3), 136.5, 135.6, 135.0, 131.4, 131.3 (C-7, C-11, C-3', C-7', C-11'), 124.4, 124.3, 124.1, 123.9 (C-6, C-10, C-6', C-10'), 122.2 (C-2'), 111.0 (C-15), 64.0 (C-1), 48.8 (C-2), 39.8, 39.7, 39.7 (C-8, C-4', C-8'), 34.4 (C-4), 29.1 (C-1'), 26.8, 26.7, 26.6 (C-5, C- 9, C-9'), 26.2 (C-5'), 25.7 (C-13, C-13'), 17.7 (C-12, C-12'), 16.2, 16.1, 16.0 (C-14, C-14', C-15'). HRMS (m / z) [M+H]+ calcd. for C30H50O, 427.3940; found, 427.3933. NMR and HRMS data for peplusol are in agreement with previously published12. Euphorbia peplus chromosome-level genome assembly Vegetative propagated individual Euphorbia peplus plants grown in P1 trays filled with F2 compost under 16 h / 8 h light and 250C / 220C day / night regime for 8 weeks. Plant material was kept in dark 3 days before harvesting top leaves above apical branching point of main stems. 11.7 grams of liquid-nitrogen frozen young leaf material was shipped on dry ice to Dovetail Genomics (Scotts Valley, CA, USA) for PacBio de novo genome Assembly, Proximity Ligation Library creation, HiRise Scaffolding and Basic Genome Annotation. 2.1 DNA extraction and HiFi Assembly DNA was extracted using CTAB protocol. In brief, 2g of leaf material was ground in liquid nitrogen and incubated with 20ml of CTAB buffer (2% Hexadecyltrimethylammonium Bromide, 1.4M NaCl, 20mM EDTA, 1% PVP-40, 1% PEG 800 and 100mM Tric, pH 9.5) in 680C with gentle agitation for 15min.20ml of phenol / chloroform mixture was added to extract and mix by gently inverting the tubes several times ensuring phases are fully mixed. Top layer was transferred into new tube after centrifugation at 5200 x g for 10 minutes at room temperature. Phenol / chloroform extraction was repeated and followed by chloroform / isoamyl alcohol extraction as above. DNA precipitated with 0.7%vol isopropanol was captured by spooling it on a glass rod and immediately placed in a tube containing 9.5ml of G2 buffer (800 mM guanidine hydrochloride; 30 mM Tris•Cl, pH 8.0; 30 mM EDTA, pH 8.0; 5% Tween 20; 0.5% Triton X-100), premixed with 19µl of RNAse A (100 mg / µl) and 200µl of Qiagen protease (Cat.No.19155) Samples were mixed by vortexing and incubated at 50˚C for 30-60 min, agitating occasionally. Samples were vortexed for >10sec and loaded on equilibrated Genomic-tip 100 / G column (Qiagen, Cat. No.: 10223) and purified using manufacturers protocol. DNA samples were quantified using Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA). The PacBio SMRTbell library (~20kb) for PacBio Sequel was constructed using SMRTbell Express Template Prep Kit 2.0 (PacBio, Menlo Park, CA, USA) using the manufacturer recommended protocol. The library was bound to polymerase using the Sequel II Binding Kit 2.0 (PacBio) and loaded onto PacBio Sequel II. Sequencing was performed on PacBio Sequel II 8M SMRT cells. 28.2 gigabase-pairs coming from 26,209,297 PacBio CCS reads (82X coverage of estimated2338Mbp E. peplus genome) were used as an input to Hifiasm3v0.15.4-r342 with default parameters. Blast results of the Hifi asm output assembly against the nt database were used as input for blobtools4v1.1.1 and scaffolds identified as possible contamination were removed from the assembly. Finally, purge_dups v1.2.55was used to remove haplotigs and contig overlaps. Primary filtered HiFi assembly consisted of 11 contigs with L90 of 13.5Mbp and covered 286.827Mbp. 2.2 Omni-C Library Preparation and Sequencing. For each Dovetail Omni-C library, chromatin was fixed in place with formaldehyde in the nucleus and then extracted. Fixed chromatin was digested with DNAse I, chromatin ends were repaired and ligated to a biotinylated bridge adapter followed by proximity ligation of adapter containing ends. After proximity ligation, crosslinks were reversed and the DNA purified. Purified DNA was treated to remove biotin that was not internal to ligated fragments. Sequencing libraries were generated using NEB Next Ultra enzymes and Illumina-compatible adapters. Biotin-containing fragments were isolated using streptavidin beads before PCR enrichment of each library. The library was sequenced on an Illumina HiSeq X platform to produce approximately 30x sequence coverage. Then HiRise used MQ>50 reads for scaffolding. 2.3 Scaffolding the Assembly with HiRise The input de novo assembly and Dovetail OmniC library reads were used as input data for HiRise, a software pipeline designed specifically for using proximity ligation data to scaffold genome assemblies6. Dovetail OmniC library sequences were aligned to the draft input assembly using bwa (https: / / github.com / lh3 / bwa). The separations of Dovetail Omni C read pairs mapped within draft scaffolds were analyzed byHiRise to produce a likelihood model for genomic distance between read pairs, and the model was used to identify and break putative misjoins, to score prospective joins, and make joins above a threshold. Final HiRise assembly contained 8 contigs with L90 of 29.9Mbps which correspond to 8 chromosomes of E. peplus7that covered 99.8% of input 286.827Mbps HiFi assembled sequence. Remaining 0.334 Mbp of the sequence was scattered over 149 contigs. 2.4 Ab initio genome annotation AUGUSTUS8was used for ab initio gene prediction, using model training based on coding sequences from Amaranthus hypochondriacus, Beta vulgaris, Spinacia oleracea and Arabidopsis thaliana. RNAseq data coming from E. peplus roots, leaves, main stems, pods and latex cDNA libraries9were mapped onto the 286.827Mbp of HiRise genome assembly described above using Bowtie 210. Hints with locations of potential intron–exon boundaries were generated from the alignment files with the software package BAM2 hints in the MAKER package11. MAKER with AUGUSTUS (intron–exon boundary hints provided from RNA-seq and isoform sequencing) was then used to predict genes in the HiRise genome assembly. Genes were characterized for their putative function by performing a BLAST search of the peptide sequences against the UniProt database. PFAM domains and InterProScan ID were added to the gene models using the scripts provided in the MAKER package. Ab initio gene prediction yielded 22,470 genes covering 36,440,672bp of total coding region and average length of 1,621Kbp. BUSCO (Benchmarking Universal Single-Copy Orthologs) analysis of predicted genes showed 92.5% complete single-copy-, 0.4% complete duplicated, 1.6% fragmented and 5.5% missing BUSCOs. We have used annotated genome sequence to look for the potential candidates involved in peplusol biosynthesis from FPP, which would exhibit synthase, dehydratase or the oxidase activities. Ten such candidate genes are listed in Table 1. 3. Euphorbia peplus candidate gene cloning and transient gene expression in Nicotiana benthamiana. cDNA was synthesised using total RNA from 100ng of E. peplus latex or stems total RNA using Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA) and random hexamer primers (Invitrogen, Carlsbad, CA). The open reading frame for each gene was then amplified and inserted into the pEAQ-HT expression vector via In-Fusion cloning tools (TaKaRa bio Inc. Kusatsu, Japan), according to the manufacturer’s protocol using the primers detailed in Table 1. In each instance, a 5’-AAAA-3’ Kozak sequence was included immediately upstream of the start codon. In the case of EpTS, the sequence annotated as squalene synthase in the genome assembly described in section 2 aboveE. peplus was used to generate a synthetic fragment containing an open reading frame of EpTS (SEQ ID NO: 1) with 5’- (CTGTATATTCTGCCCAAATTCGCG) and 3’- (CCTTTAACTCTGGTTTCATTAAATT) tails facilitating In-Fusion cloning into pEAQ-HT vector (plus 5’-AAAA-3’ Kozak sequence). The synthetic fragment was produced by Integrated DNA Technologies (Leuven, Belgium) and inserted into the pEAQ-HT expression vector via In-Fusion cloning tools as mentioned above. After confirming the presence of the correct inserts by Sanger sequencing, the expression vectors were transformed into Agrobacterium tumefaciens LBA4404 using the freeze-thaw method. For initial experiments to detect the production of novel diterpenoids, Nicotiana benthamiana leaves were infiltrated by vacuum infiltration, using a vacuum pump to apply negative pressure at -0.9 Bar for 1min with equal mixtures of A. tumefaciens cultures at a final OD 600nmof 1.0 in infiltration buffer (10 mM MgCl2, 200 µM acetosynringone and 0.015% Silwet L-77). AvGFP (a visual marker for the gene expression) were present in all of the mixes depicted on Figure 1. Five days after infiltration, all leaf material showing expression of Green Fluorescence Protein (AvGFP) was harvested and flash frozen in liquid nitrogen. Freeze dried leaf material was ground for 30sec with a steel bead at 30 Hz minutes in a Retsch II homogenizer (Qiagen, Hilden, Germany) and extracted overnight with 1ml of Ethyl Acetate containing 15 μg / ml of Phorbol 12-myristate 13-acetate (PMA, LC-laboratories, cat. No. P-1680) and 100 μg / ml of trans-cryophyllene (Sigma, cat.no. 22075) with vigorous shaking, to obtain results presented in figure 1. After centrifugation, 100μL aliquot was taken for GC-MS analysis performed as described before9,12. Remaining ethyl acetate was removed by evaporation in GeneVac personal evaporator (Genevac, Ipswithc, UK). Extract was re-dissolved in acetonitrile: isopropanol (70:30) and 2 μL aliquot was injected on an Acquity UPLC system (Waters, Elstree, UK) fitted with a Accucore C30, 2.1mm x 100mm, partical size 2.6µm column (Thermo Fisher cat. No.27826—102130). Metabolites were eluted at 0.35 mL / min and 40°C using a linear gradient from: 99:1 solvent A: solvent B to 1:99 Solvent A: solvent B over 21min, followed by isocratic 1:99 Solvent A:Solvent B for 3min and isocratic 99:1 Solvent A:Solvent B for 4 min (Solvent A: 10mM Ammonium Formate in Acetonitrile / H20 60:40 + 0.1% Formic Acid, Solvent B: 10mM Ammonium Formate in Acetonitrile / 2-Propanol 10:90 + 0.1% Formic Acid). Pseudomolecular [M+H]+ ions were detected using a Thermo Fisher LTQ-Orbitrap (ThermoFisher, Hemel Hempstead, UK) mass spectrometer fitted with an atmospheric pressure chemical ionization source operating in positive ionization mode under the control of Xcalibur 2.1 software. Data were acquired over the m / z range 50 - 1200 in FTMS centroid mode with resolution set to 7500. Peplusol was identified via LC-MS using plant-purified, NMR-verified standard, and quantified against PMA internal standard as described before. Squalene was identified via GC-MS using commercial standard (Sigma, cat. No. S3626) and quantified against trans-cryophyllene internal standard as described before9Analytical methods for squalene and peplusol extraction, detection and quantification were further optimised to obtain results presented in Figure 6. Plant material ground in a Retsch II homogenizer as above was extracted with 1ml of Ethyl Acetate overnight. After centrifugation, ethyl acetate was removed by evaporation in GeneVac personal evaporator (Genevac, Ipswithc, UK). Extract was re-dissolved in methanol and 2 μL aliquot was injected on an Acquity UPLC system (Waters, Elstree, UK) fitted with a Accucore C30, 2.1mm x 100mm, partical size 2.6µm column (Thermo Fisher cat. No. 27826—102130). Metabolites were eluted at 0.35 mL / min and 40°C using a linear gradient from: 99:1 solvent A: solvent B to 1:99 Solvent A: solvent B over 21min, followed by isocratic 1:99 Solvent A:Solvent B for 3min and isocratic 99:1 Solvent A:Solvent B for 4 min (Solvent A: 10mM Ammonium Formate in methanol / water 60:40 + 0.1 % Formic acid, Solvent B: 10mM Ammonium Formate in methanol / isopropanol 10:90 + 0.1 % Formic acid) with the same mass spectrometer settings as above. Following dilution series of E. peplus-purifed peplusol were run in parallel to create 7- point standard curves: 0, 0.15625, 0.3125, 0.625, 1.25, 2.5 and 5mg / ml. Standard samples were run on LC-MS as above. Standard curves with linear regression R2≥0.998 were used to calculate amount of peplusol in the plant extracts as presented in Figure X. Squalene was extracted using method modified from Reed et al.201713. Plant material ground in a Retsch II homogenizer as above, was extracted in 500µL of saponification solution (ethanol:water:KOH, 9:1:1, v:v:w) for 2 hours in 650C with intermittent agitation. 250µL of water was added to the samples before adding 500 µL of hexane. Samples were vortexed, centrifuged and 350ul of the upper hexane phase was transferred to a glass vial. Hexane was dried in GeneVac personal evaporator (Genevac, Ipswithc, UK). Dried extract was derivatised using a mixture of pyridine (60μL), N-Methyl-N- (trimethylSilyl)TriFluoroAcetamide (MSTFA, 30μL) and TriMethylsilyl Chloride (TMS, 1μL) for 1h at 500C.1 μL of the derivaitsed extract was analysed by GC-MS using Agilent 6890 Gas Chromatograph GC, (Agilent Technologies UK Ltd, Cheadle, UK) linked to a LECO Pegasus IV Time of Flight Mass Spectrometer TOF-MS, (LECO Instruments, Stockport, UK). The GC oven was fitted with a Restek Zebron ZB-5HT Inferno TM 30M, capillary column (30m, 0.25-mmID, 0.1μm film thickness). Helium carrier gas was used at 1ml / min constant flow and transfer line temperature was set to 250°C. The oven temperature was set at 80°C for 5 min and then increased to 270°C at a rate of 12°C min-1follwed by increase to 310°C at a rate of 6°C min-1. Mass spectral data was acquired over the m / z range of 50 to 500 in positive electron ionization mode at -70 eV at acquisition rate of 20 spectra / second and 5min acquisition delay. Squalene was quantified against external standard curve using commercial squalene standard (Sigma, cat. No. S3626), derivatised as above and presented in Figure 6 Table 1 – Primers used for creation of GFP fusion constructs in pEAQ-HT via In- Fusion cloning Gene ID Genome Forward (5'--3') Reverse (5'--3') annotation EpTS2 Squalene CTGTATATTCTGCCCAAATT AATTTAATGAAACCAGAG Synthase CGCGAAAAAATGGAGATTTT TTAAAGGTCAGTAAGTGG GGGAGGGATAG TCATTTTTTTGTG Squalene CTGTATATTCTGCCCAAATT AATTTAATGAAACCAGAG monooxygena CGCGAAAAAATGGCTTCAAA TTAAAGGTCAATCAGAAG EpSOX8 se TACAAGTATTCATG CCTTAACTTTGAAG Squalene CTGTATATTCTGCCCAAATT AATTTAATGAAACCAGAG monooxygena CGCGAAAAAATGAGCTCGC TTAAAGGCTAGTGCGCCT EpSOX9 se TTTCATTCC CAACCG Squalene CTGTATATTCTGCCCAAATT AATTTAATGAAACCAGAG monooxygena CGCGAAAAAATGAAAATGTC TTAAAGGTTAATTTACTTC EpSOX10 se GGATCATTACTTG AACAGGTGGAGC CTGTATATTCTGCCCAAATT AATTTAATGAAACCAGAG EpPhytSy Phytoene CGCGAAAAAATGACGGTAG TTAAAGGTTATGCCTTTCT nth synthase CATTACTATGG CAGTGGAG 3-hydroxyacyl- CTGTATATTCTGCCCAAATT AATTTAATGAAACCAGAG Ep3hydac [acyl-carrier- CGCGAAAAAATGGCAAGCT TTAAAGGCTATCCCATAG ylDehyd protein] CTACTTTCAC CCATCAAAAACTC dehydratase CTGTATATTCTGCCCAAATT AATTTAATGAAACCAGAG EpDHADe Dihydroxy-acid CGCGAAAAAATGCAATCCA TTAAAGGCTACTCATCCG hyd dehydratase CTTTCATTTCTCC TCACGCATC Very-long- chain (3R)-3- hydroxyacyl- CTGTATATTCTGCCCAAATT AATTTAATGAAACCAGAG EpVLCde CoA CGCGAAAAAATGTCCATCAT TTAAAGGTCACATCTTCTT hyd dehydratase 2 GTTGACATTTGC CTCGTGGC CytP450 AATTTAATGAAACCAGAG oxidase CTGTATATTCTGCCCAAATT TTAAAGGCTAGGAAGGAA CYP71D3 (casbene-9- CGCGAAAAAATGGAGTTAG CATATGGAGTAGGAATAA 65 oxidase) AACTTCACCTCCCTTGTTC T CTGTATATTCTGCCCAAATT CGCGAAAAAATGATGGAAT AATTTAATGAAACCAGAG CYP71D6 CytP450 CCCTTTTTTCCTCCACAGAA TTAAAGGTTAACCGATGG 25 oxidase TG GAGGATAATATGGTGTG 4. EpTS gene expression in Saccharomyces cerevisiae The codon-optimised Euphorbia Peplusol Synthase (EpTS), Euphorbia Peplusol Synthase2 (EpTS2) and Arabidopsis thaliana Squalene Synthase (AtSS, Gene Bank Accession P53799.1) were synthesised as gBlock DNA fragments from IDT (Integrated DNA Technologies Inc.) with overhangs allowing direct insertion into a PmeI digested modified pBEVY-L vector, without PCR amplification, via In-Fusion cloning tools (TaKaRa bio Inc. Kusatsu, Japan), according to the manufacturer’s protocol. Codon- optimised EpTS, EpTS2 and AtSS were assembled into a PmeI digested modified pBEVY-L vector (Addgene# 51225) under the Gal10 promoter, plasmid was propagated in Top10 E. coli cells (Invitrogen, USA) and sequence confirmed by Sanger sequencing (Eurofins, Europe). The constructs were transformed by lithium acetate14method into CEN.PK2-1C wild type strain background (MATα ura3-52; trp1-289; leu2-3,112; his3Δ 1; MAL2-8c; SUC2) purchased from EUROSCARF (accession no- 30000B). Three independent S. cerevisiae transformants, confirmed by colony PCR using pBEVY- L specific primers were grown at 30 °C and 210 rpm in Synthetic Complete (SC) selective medium lacking leucine (SC-LEU) in shake flasks for 72h. For the analysis of peplusol content in whole cultures, 6 mL of culture was used for extraction with equal volume of ethyl acetate with Phorbol 12-Myristate 13-Acetate (PMA) internal standard (LC-laboratories, cat. No. P-1680) at 1.6μg / mL, overnight with vigorous shaking at room temperature. The ethyl acetate fraction was transferred to glass tubes and evaporated using a laboratory evaporator (EZ-2 series, Genevac Ltd.) The final pellet was dissolved in 200μL of methanol and used for LC-MS analysis as described before. For the analysis of peplusol in media and cell pellets, 4ml of culture was spun down at 3000g for 5min and 3ml of the media, supernatant was extracted with equal volume of ethyl acetate with PMA internal standard (1.6μg / mL), evaporated, re-suspended in 200μL of methanol and used for LC-MS analysis as described above. Cell pellets were mixed with 0.5ml of methanol with PMA internals standard (25μg / mL) in 2ml Eppendorf tubes, vortexed at 1500rpm at 600C for 10min and spun down for 2min at 20,000g in table-top microcentrifuge. 300μl of the supernatant was run on LC-MS as described above. Peplusol was identified using plant-purified NMR-verified standard run at the same time, and quantified against PMA internal standard as described before9,13. Analytical methods for peplusol detection and quantification were further optimised to obtain results presented in Figure 7. Extraction for whole cultures, media and cell pellets was performed as described above but samples were run on LC-MS using: (A) 10mM Ammonium Formate in methanol / water 60:40 + 0.1 % Formic acid, and (B) 10mM Ammonium Formate in methanol / isopropanol 10:90 + 0.1 % Formic acid as described in section 3. Following dilution series of E. peplus-purifed peplusol were run in parallel to create 7-points standard curves: 0, 0.15625, 0.3125, 0.625, 1.25, 2.5 and 5mg / ml. Standard samples were run on LC-MS as above. Standard curves with linear regression R2≥0.998 were used to calculate amount of peplusol in the yeast extracts as presented in Figure 7. Squalene was extracted from the cell pellets after spinning down 2mL of cultures for 2min at 20,000g in table-top microcentrifuge using protocol modified from Moses et al., 201415. Cell pellets were treated with 0.5ml of saponification solution (25% EtOH, 20% KOH) for 2h at 650C with intermittent agitation.500μL of hexane was added and samples were vortexed at 1500rpm for 10min.350μL of hexane upper phase was transferred into glass vials and dried down in laboratory evaporator (EZ-2 series, Genevac Ltd.). Dried extract was derivatised using a mixture of pyridine (60μL), N-Methyl-N- (trimethylSilyl)TriFluoroAcetamide (MSTFA, 30μL) and TriMethylsilyl Chloride (TMS, 1μL) for 1h at 500C.1 μL of the derivatised extract was analysed by GC-MS using Agilent 6890 Gas Chromatograph GC, (Agilent Technologies UK Ltd, Cheadle, UK) linked to a LECO Pegasus IV Time of Flight Mass Spectrometer TOF-MS, (LECO Instruments, Stockport, UK). The GC oven was fitted with a Restek Zebron ZB-5HT Inferno TM 30M, capillary column (30m, 0.25-mmID, 0.1μm film thickness). Helium carrier gas was used at 1ml / min constant flow and transfer line temperature was set to 250°C. The oven temperature was set at 80°C for 5 min and then increased to 270°C at a rate of 12°C min-1follwed by increase to 310°C at a rate of 6°C min-1. Mass spectral data was acquired over the m / z range of 50 to 500 in positive electron ionization mode at -70 eV at acquisition rate of 20 spectra / second and 5min acquisition delay. Squalene was quantified against external standard curve using commercial squalene standard (Sigma, cat. No. S3626), derivatised as above. Results are presented on Figure 2 and Figure 7. Example 1. Identification of the candidate genes potentially involved in biosynthesis of peplusol in Euphorbia peplus. Peplusol (1) is an unusual linear triterpene alcohol produced by two members of Euphorbia genus: Euphorbia peplus1and Euphorbia lateriflora16. Peplusol content is reaching 5mg / g of Euphorbia peplus latex and is found, albeit in much lower concentrations, in other tissues of the plant, including roots9Previous experiments have shown the moderate antifungal activities of peplusol against agricultural phytopathogenic fungi17. The biosynthetic route to peplusol most likely starts from farnesyl pyrophosphate, a common precursor to all triterpenes. Proposed biosynthetic routes involve either: oxidation of squalene, which is suggested by our previous results from gene-silencing in E. peplus9, dehydration of a presumed intermediate of squalene synthesis – bisfarensol18or alternatively as a direct result of squalene synthase activity. We have performed whole genome sequencing to be able to identify candidate genes involved in putative biosynthetic pathways leading to peplusol. Sequencing and genome assembly was performed on a single E. peplus individual using Pacbio HiFi combined with Omni-C and bioinformatics pipelines described in the Materials and Methods section. Final HiRise assembled genome sequence covered 286.827 Mbp scaffolded into 158 contigs / scaffolds with L90 of 29.9 Mbps. Eight scaffolds, covering 99.8% of the assembled sequence are corresponding to eight published chromosomes of E. peplus7. Sequence analysis of those eight scaffolds revealed that all but one of them contain telomeric repeats on one or both ends, suggesting almost complete chromosome sequence. Gene annotation was performed on the HiRise assembly using previously obtained RNAseq data from E. peplus roots, leaves, main stems, pods and latex cDNA libraries9as described in Materials and Methods section. Annotation Edit Distance (AED) provides a measurement for how well an annotation agrees with overlapping aligned ESTs, mRNA-seq and protein homology data. AED values range from 0 and 1, with 0 denoting perfect agreement of the annotation to aligned evidence, and 1 denoting no evidence support for the annotation. A very low AED scores obtained for most of the 22,470 predicted genes indicated high quality of the E. peplus genome annotation. Finally, Benchmarking Universal Single-Copy Orthologs (BUSCO) analysis of predicted genes revealed that 94.5% of 255 BUSCO gene searched were found in the annotated HiRise assembly. Analysis of the gene annotations for 158 scaffolds revealed the presence of a single gene annotated as squalene synthase on scaffold 5. We have also identified ten annotated squalene oxidases on scaffolds 2, 4, 5 and 7 and three dehydratases on scaffolds 3, 5 and 6. Our previous Virus Induced Gene Silencing (VIGS) results indicated potential involvement of Cytochrome P450 oxidases in production of peplusol in E. peplus. When CYP71D365 and CYP71D625 expression was silenced by VIGS production of peplusol in latex significantly decreased in VIGS-affected stems (9and unpublished data). It made the two P450s potential candidates involved in biosynthesis of peplusol in E. peplus. Example 2. Functional characterisation of candidate genes using Nicotiana benthamiana heterologous expression system. We amplified full length coding sequences (CDS) from latex and / or stem cDNA of E. peplus for the ten candidate genes, selected as above, using the polymerase chain reaction and primers listed in Table 1 or used synthetic genes in case PCR amplification was unsuccessful. Full length CDS were cloned into the pEAQ-HT expression vector previously shown to drive very high level transgene expression in N. benthamiana19as described in Materials and Methods. It was previously shown that overexpression of truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase sequence (tHMGR) which encodes the key enzyme involved in IPP biosynthesis via the mevalonate pathway, increases supply of the FPP precursor resulting in enhanced triterpene production in S. cerevisiae20. Truncation of the N-terminal membrane-binding region was shown to remove feedback control of HMGR activity21. We have therefore tested all ten candidate genes including A. thaliana tHMGR in the infiltration mix as described in Materials and Methods section and compared these with the infiltrations where tHMGR was excluded. Production of peplusol following transient expression in N. benthamiana was monitored via LC-MS using genuine peplusol standard with NMR- verified structure determination (described in Materials and Methods section) as a reference. From these candidate genes the only gene transiently expressed in N. benthamiana that yielded peplusol was E. peplus Peplusol Synthase (EpTS) as depicted on Figure 1. Transient co-expression of tHMGR has significantly (50-fold) increased production of peplusol reaching 0.16μg / mg infiltrated leaf dry weight when compared with infiltrations without tHMGR. Squalene was detectable only in samples co-infiltrated with tHMGR and its level was reduced significantly (6.8-fold) when EpTS was co-expressed when compared with empty vector (EV) control. Reduction in squalene content suggests that EpTS competes with endogenous N. benthamiana squalene synthase for FPP - the common substrate for peplusol and squalene synthesis. A second E. peplus genome assembly became publicly available in February 2023. We have aligned 5.1kb genomic DNA sequence containing the EpTS gene from our own assembly with the corresponding genomic fragment from the Johnson et al. 2023 assembly, containing EpTS2 gene (annotated as squalene synthase). Genomic DNA sequence from both assemblies is nearly identical, however, the cDNA annotations differ at the 3' end, which results in the EpTS2 cDNA (Sequence ID No. 6) being 1233bp, which is 60bp longer than the EpTS annotation, and encodes a protein that is 20 amino acids longer (Sequence ID No.8) than the EpTS protein. Differences in the genomic sequence annotations are most likely due to the use of different bioinformatics tools for annotation of the Johnson et al.2023 genome assembly. cDNA-predicted EpTS2 protein sequence contains a full transmembrane domain, understood to be responsible for anchoring squalene synthases in the endoplasmic reticulum. EpTS2 is shown to produce peplusol when heterologously expressed in N. benthamiana (Figure 6) and its peplusol producing activity is very similar to that of EpTS. Peplusol was not detectable either for samples transformed with Arabidopsis thaliana Squalene Synthase24(AtSS) or with the Empty Vector. Transient co-expression of tHMGR has significantly (15- and 35-fold, respectively) increased production of peplusol for EpTS and EpTS2 which has reached 70μg / mg infiltrated leaf dry weight when compared with infiltrations without tHMGR (Figure 6). Squalene was detectable only in samples co- infiltrated with tHMGR and its level was reduced significantly (7- and 12-fold, respectively) when EpTS and EpTS2 were co-expressed when compared with empty vector (EV) control (Figure 6). Reduction in squalene content was not observed with samples transiently overexpressing AtSS, which suggests that both EpTS and EpTS2 compete with endogenous N. benthamiana squalene synthase for FPP - the common substrate for peplusol and squalene synthesis. Example 3. Functional characterisation of EpTS and EpTS2 in Saccharomyces cerevisiae. We have cloned S. cerevisiae – codon optimised EpTS and EpTS2 coding sequence into the pBEVY-L vector under the Gal10 promoter as described in Materials and Methods section. Codon-optimised functionally characterised22Arabidopsis thaliana Squalene Synthase (AtSS) was also cloned into pBEVY-L vector under the Gal10 promoter. Those two constructs and empty vector (EV) control were transformed into haploid wild type CEN.PK-2C background (Y01) as described in Materials and Methods section. Three positive clones selected by colony-PCR for each background / construct combination were grown for 72h in liquid cultures as described in Materials and Methods. Extractions were performed on the whole cultures as well as on cell pellets with media separated and peplusol and squalene accumulation was monitored and quantified via GC- and LC-MS techniques as described in Materials and Methods section. Peplusol was clearly detectable only in wild type strain Y01 transformed with EpTS and and EpTS2 but not in wild type strain transformed with AtSS or Empty Vector as shown on Figure 2 and Figure 7. Peplusol yields were reaching 0.55mg / L when extracted from the whole culture expressing EpTS (Figure 1) and 0.61 mg / L for strains expressing EpTS2 (Figure 7). Comparison of amount of peplusol released to the media with that retained in the cells indicated that most of the peplusol is retained in the cells (Figure 2). Squalene measurements indicated that AtSS is a functional squalene synthase as its overexpression increases squalene content over 50-fold when compared to empty vector transformed controls (Figure 2 and Figure 7). Example 4. EpTS protein sequence analysis. Squalene synthase is a divalent metal-ion-dependent enzyme that catalyzes the two-step reductive ‘head-to-head’ condensation of two molecules of farnesyl pyrophosphate to form squalene using presqualene diphosphate (PSPP) as an intermediate. The catalytic mechanism of human squalene synthase has been well described and relies on Mg2+- mediated condensation of two FPP molecules to form an intermediate with a cyclopropane ring which is followed by NADPH-dependent opening of the cyclopropane ring23. Functionally characterised plant squalene synthase proteins typically contain two transmembrane domains in the C-terminal region involved in anchoring the protein in the plasma membrane24Alignment of cDNA – predicted amino acid sequences for EpTS, its homologues from the Euphorbiaceae family and A. thaliana squalene synthase revealed the EpTS protein has a truncation in the C-terminus. Prediction of transmembrane protein topology with hidden Markov model25revealed that the truncated region encodes one of the two predicted transmembrane domains missing in EpTS (Figure 3A). EpTS protein sequence alignment also revealed that the two DXXED motifs involved in FPP substrate binding23as well as residues involved in NADPH recognition23were all conserved in EpTS amino acid sequence (Figure 3A). EpTS nucleotide sequence shares between 30 and 75% and EpTS amino acid sequence shares between 26 and 70% homology with known Prokaryotic and Eukaryotic squalene synthases respectively(Figure 3B). EpTS2 nucleotide sequence is not truncated at the C-terminus and the corresponding protein contains two transmembrane domains which is typical of squalene synthases. EpTS2 nucleotide sequence shares between 33 and 79% and EpTS2 amino acid sequence shares between 27 and 73% homology with known Prokaryotic and Eukaryotic squalene synthases respectively (Figure 3C). REFERENCES 1 Giner, J. L., Berkowitz, J. D. & Andersson, T. J Nat Prod 63, 267-269, (2000). 2 Loureiro, J., Rodriguez, E., Dolezel, J. & Santos, C. Ann Bot-London 100, 875-888, (2007). 3 Cheng, H., Concepcion, G. T., Feng, X., Zhang, H. & Li, H. Nat Methods 18, 170-175, (2021). 4 Laetsch, D. R. & Blaxter, M. L. F1000Research 6, (2017). 5 Guan, D. et al. Bioinformatics 36, 2896-2898, (2020). 6 Putnam, N. H. et al. Genome Res 26, 342-350, (2016). 7 8 Stanke, M., Diekhans, M., Baertsch, R. & Haussler, D. Bioinformatics 24, 637-644, (2008). 9 Czechowski, T. et al. Proc Natl Acad Sci U S A 119, e2203890119, (2022). 10 Langmead, B. & Salzberg, S. L. Nat Methods 9, 357-359, (2012). 11 Cantarel, B. L. et al. Genome Res 18, 188-196, (2008). 12 King, A. J., Brown, G. D., Gilday, A. D., Larson, T. R. & Graham, I. A. Plant Cell 26, 3286-3298, (2014). 13 Reed, J. et al. Metab Eng 42, 185-193, (2017). 14 Gietz, R. D. & Schiestl, R. H. Nat Protoc 2, 35-37, (2007). 15 King, A. J. et al. Chembiochem 17, 1593-1597, (2016). 16 Moses, T. et al. Proc Natl Acad Sci U S A 111, 1634-1639, (2014). 17 Faure, S., Connolly, J. D., Fakunle, C. O. & Piva, O. Tetrahedron 56, 9647-9653, (2000). 18 Hua, J. et al. Phytochemistry 136, 56-64, (2017). 19 Nes, W. D., Le, P., Vantamelen, E. E. & Leopold, E. J. Exp Mycol 14, 74-77, (1990). 20 Sainsbury, F., Saxena, P., Geisler, K., Osbourn, A. & Lomonossoff, G. P. Methods Enzymol 517, 185-202, (2012). 21 Polakowski, T., Stahl, U. & Lang, C. Appl Microbiol Biot 49, 66-71, (1998). 22 Stermer, B. A., Bianchini, G. M. & Korth, K. L. J Lipid Res 35, 1133-1140, (1994). 23 Johnson, A. R. et al. Genome Biol Evol 15, (2023). 24 Nakashima, T. et al. Proc Natl Acad Sci U S A 92, 2328-2332, (1995). 25 Liu, C. I. et al. Acta Crystallogr D Biol Crystallogr 70, 231-241, (2014). 26 Ding, C. et al. Int J Clin Exp Med 8, 12818-12825, (2015). 27 Krogh, A., Larsson, B., von Heijne, G. & Sonnhammer, E. L. J Mol Biol 305, 567-580, (2001).

Claims

CLAIMS 1 An isolated nucleic acid molecule that encodes a polypeptide with pepulsol synthase activity wherein said nucleic acid molecule comprises or consists of a nucleotide sequence selected from the group: i) a nucleotide sequence as represented by the sequence in SEQ ID NO: 1 or SEQ ID NO: 2; ii) a nucleotide sequence wherein said sequence is degenerate as a result of the genetic code to the nucleotide sequence defined in (i); iii) a nucleic acid molecule the complementary strand of which hybridizes under stringent hybridization conditions to the sequence in SEQ ID NO: 1 or SEQ ID NO: 2 wherein said nucleic acid molecule encodes a polypeptide with triterpene synthase activity; iv) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence as represented in SEQ ID NO: 3; v) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence wherein said amino acid sequence is modified by addition deletion or substitution of at least one amino acid residue as represented in iv) above and which has retained or enhanced pepulsol synthase activity.

2. An isolated nucleic acid molecule that encodes a polypeptide with peplusol synthase activity wherein said nucleic acid molecule comprises or consists of a nucleotide sequence selected from the group: i) a nucleotide sequence as represented by the sequence in SEQ ID NO: 6 or SEQ ID NO: 7; ii) a nucleotide sequence wherein said sequence is degenerate as a result of the genetic code to the nucleotide sequence defined in (i); iii) a nucleic acid molecule the complementary strand of which hybridizes under stringent hybridization conditions to the sequence in SEQ ID NO: 6 or SEQ ID NO: 7 wherein said nucleic acid molecule encodes a polypeptide with triterpene synthase activity; iv) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence as represented in SEQ ID NO: 8; v) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence wherein said amino acid sequence is modified by addition deletion or substitution of at least one aminoacid residue as represented in iv) above and which has retained or enhanced peplusol synthase activity.

3. An isolated polypeptide selected from the group: i) a polypeptide comprising or consisting of an amino acid sequence as represented in SEQ ID NO: 3; or ii) a modified polypeptide comprising or consisting of a modified amino acid sequence wherein said polypeptide is modified by addition deletion or substitution of at least one amino acid residue of the sequence presented in SEQ ID NO: 3 and which has peplusol synthase activity.

4. An isolated polypeptide selected from the group: i) a polypeptide comprising or consisting of an amino acid sequence as represented in SEQ ID NO: 8; or ii) a modified polypeptide comprising or consisting of a modified amino acid sequence wherein said polypeptide is modified by addition deletion or substitution of at least one amino acid residue of the sequence presented in SEQ ID NO: 8 and which has peplusol synthase activity.

5. A vector comprising a nucleic acid molecule according to claims 1 or 2.

6. A cell transformed or transfected with a nucleic acid molecule or vector according to claim 1, 2 or 5.

7. The cell according to claim 6 wherein there is provided a cell transformed or transfected with: i) a first nucleic acid molecule encoding a peplusol synthase according to claims 1 or 2; and ii) a second nucleic acid molecule encoding a 3-hydroxy-3- methylglutaryl coenzyme A reductase wherein said first and second nucleic acid molecules are co-expressed in said cell.

8. The cell according to claim 7 wherein said nucleic acid encoding a 3-hydroxy-3- methylglutaryl coenzyme A reductase has a truncation of the N-terminal membrane- binding region.

9. The cell according to claims 7 or 8 wherein said second nucleic acid molecule comprises or consists of a nucleotide sequence selected from the group consisting of: i) a nucleotide sequence as represented by the sequence in SEQ ID NO: 4 ii) a nucleotide sequence wherein said sequence is degenerate as a result of the genetic code to the nucleotide sequence defined in (i); iii) a nucleic acid molecule the complementary strand of which hybridizes under stringent hybridization conditions to the sequence in SEQ ID NO: 4 wherein said nucleic acid molecule encodes a polypeptide with 3-hydroxy-3-methylglutaryl coenzyme A activity; iv) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence as represented in SEQ ID NO: 5 v) a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence wherein said amino acid sequence is modified by addition deletion or substitution of at least one amino acid residue as represented in iv) above and which has retained or enhanced 3-hydroxy-3-methylglutaryl coenzyme A activity.

10. The cell according to any one of claims 6-9 wherein said cell is a plant cell.

11. The cell according to any one of claims 6-9 wherein said cell is a microbial cell.

12. The cell according to claim 11 wherein said cell is a bacterial cell.

13. The cell according to claim 11 wherein said cell is a fungal cell.

14. A plant comprising a plant cell according to claim 10.

15. Use of a cell according to any one of claims 10 to 13 in the production of a triterpene.

16. The use according to claim 15 wherein said triterpene is peplusol.

17. A process for the modification of farnesyl diphosphate comprising: i) providing a plant cell according to claim 10; ii) cultivating said plant cell to produce a transgenic plant; and optionally iii) harvesting said transgenic plant, or part thereof.

18. A process for the production of peplusol comprising: i) providing a microbial cell according to any one of claims 11 to 13 and a culture medium; ii) cultivating the microbial cell under conditions that modifies farnesyl diphosphate to produce peplusol; and optionally iii) isolating said peplusol from the microbial cell or cell culture.

19. Use of a nucleic acid molecule according to claims 1 or 2 in the manufacture of a peplusol synthase.

20. Use of a peplusol synthase polypeptide according to claims 3 or 4 in the manufacture of peplusol.