Emulsion-based thick-film antifouling coating for highly sensitive electrochemical sensing
Patent Information
- Application Number
- EP2023901637
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-08-09
- Filing Date
- 2023-12-08
- Publication Date
- 2025-12-10
AI Technical Summary
Traditional antifouling coatings for biomedical applications, such as polyethylene glycol and bovine serum albumin, face limitations including incomplete surface blocking, hindrance of electron transfer, limited surface area for bioreceptors, and restricted thickness, which impede the sensitivity and antimicrobial properties of electrochemical sensors.
A composition comprising a non-aqueous phase, an aqueous phase, a proteinaceous material, and a conductive element, formulated as an emulsion, which forms a porous antifouling coating that prevents non-specific interactions, maintains electrochemical signal integrity, and incorporates antimicrobial components, allowing for high sensitivity and robustness.
The emulsion-based antifouling coating enhances the sensitivity and durability of electrochemical sensors by creating a multiscale porous structure that maximizes surface area for target binding while preventing fouling and inflammatory responses, ensuring reliable detection of analytes.
Smart Images

Figure 1.1
Abstract
Description
EMULSION-BASED THICK-FILM ANTIFOULING COATING FOR HIGHLY SENSITIVE ELECTROCHEMICAL SENSINGCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 431,520, filed December 9, 2022, and U.S. Provisional Application No. 63 / 531,745, filed August 9, 2023 the contents of which are incorporated herein by reference in their entireties.SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on December 05, 2023, is named “002806-193020WOPT_SL.xml” and is 10,892 bytes in sizeTECHNICAL FIELD
[0003] The disclosure relates generally to compositions and methods for making antifouling and electrically responsive coatings and electrodes and organic sensors including said coatings, and uses thereof.BACKGROUND
[0004] Traditional antifouling coatings such as polyethylene glycol) (PEG) and bovine serum albumin (BSA) have several limitations in biomedical applications: 1) they physically adsorb onto the sensing surfaces, which cannot ensure full blocking of the active surfaces and they may detach from the surface, 2) they hinder electron transfer in the electrode surfaces, reducing the electrochemical signal, 3) the surface area available for presentation of bioreceptors is limited due to trade-off between electrochemical detection performance and required antifouling properties, and 4) the thickness of existing antifouling layers has been limited to the nanoscale.
[0005] Thus, there is a need for coatings and methods for preparing these coating on various electrical transducers that can accommodate capture agents, prevent non-specific interaction, preserve the ability of the electrical transducer to record electrochemical signals with high sensitivity, while also having antimicrobial components to prevent inflammatory responses. The present disclosure addresses these needs.SUMMARY
[0006] In general, various aspects described herein relate to compositions and their application to surfaces (e.g., conducting and / or transducer surfaces). The coatings protect these surfaces from unwanted interactions that impede or diminish their intended function. Furthermore, the coatings described herein allow to one to produce protein-based porous coatings with ultrahigh sensitivity and antifouling activity.
[0007] In one aspect provided herein is a composition comprising a non-aqueous phase, an aqueous phase, a proteinaceous material, a conductive element, and an emulsifier (surfactant). Generally, the composition can be in form of an emulsion, nanoemulsion, micelle or liposome.
[0008] In some embodiments of any one of the aspects described herein, the composition is an emulsion. For example, the composition is an oil-in-water (o / w) emulsion, water-in-oil (w / o) emulsion, water-in-oil-in-water (w / o / w) emulsion, or oil-in-water-in-oil (o / w / o) emulsion. In some embodiments, the composition is an oil-in-water (o / w) emulsion.
[0009] As one of skill in the art is well aware, a ratio of the aqueous phase to the non- aqueous phase can be adjusted dependent on the type of emulsion desired. For example, for oil-in-water type emulsion, the composition has a higher amount of the aqueous phase relative to the amount of the non-aqueous phase. Accordingly, a ratio of the aqueous phase to the non- aqueous phase can be from about 1000:1 to about l :l (v / v). For example, a ratio of the aqueous phase to the non-aqueous phase is from about 500:1 to about 1:1, from about 250:1 to about 1:1, from about 200:1 to about 1:1, from about 150:1 to about 1:1, from about 100:1 to about 1:1, from about 75:1 to about 1:1, from about 50:1 to about 1 :1, from about 40:1 to about 1:1, from about 30: 1 to about 1:1, from about 20: 1 to about 1 :1, from about 15: 1 to about 1 :1, from about 10:1 to about 1:1, from about 9:1 to about 1 :1, from about 8:1 to about 1:1, from about 7:1 to about 1:1, from about 6:1 to about 1 :1, from about 5:1 to about 1:1, from about 4:1 to about 1:1, from about 2: 1 to about 1 : 1 , or from about 2: 1 to about 1 :1. In some embodiments, a ratio of the aqueous phase to the non-aqueous phase is about 2:1.
[0010] Generally, the non-aqueous phase comprises a water immiscible liquid. For example, the non-aqueous phase comprises an oil, a wax, a fluorocarbon, a silicone, or any combination thereof. In some embodiments of any one of the aspects described herein, the non-aqueous phase comprises an oil. In some embodiments of any one of the aspects described herein, the non-aqueous phase comprises a hydrocarbon, e.g., hexadecane, n-heptane, n-octane, or n-decane.
[0011] The amount of the non-aqueous phase can be adjusted dependent on the type of emulsion desired. For example, for oil-in-water type emulsion, the amount of the non-aqueous phase in the composition is 50 wt% or less. Accordingly, in some embodiments of any one of the aspects described herein, the composition comprises the non-aqueous phase in an amount from about 1 wt% to about 50 wt%. For example, the composition comprises the non-aqueous phase in an amount from about 5 wt% to about 45 wt%, about 10 wt% to about 40 wt%, about 15 wt% to about 35 wt%, or about 20 wt% to about 35 wt%. In some embodiments of any one of the aspects described herein, the composition comprises the non-aqueous phase in an amount from about 25 wt% to about 40 wt%.
[0012] Generally, the aqueous phase comprises water or a water miscible liquid. Same exemplary water-miscible liquids include, but are not limited to, Ct-Q lower alkanols (such as ethanol, propanol, isopropanol, butanol and mixtures thereof), aromatic alcohols (such as benzyl alcohol and / or phenoxyethanol), polyols and polyol ethers (such as 2-butoxyethanol, propylene glycol, propylene glycol monomethyl ether, diethylene glycol monoethyl ether, hexylene glycol, glycerin, ethoxy diglycol, butoxydiglycol, dipropylene glycol, polyglycerol, sorbitol, polyethylene glycol, polypropylene glycol, and mixtures thereof), propylene carbonate, ethylene glycol di stearate (EGDS) and mixtures thereof. The aqueous phase can also comprise a buffer or buffering agent.
[0013] The amount of the aqueous phase can be adjusted dependent on the type of emulsion desired. For example, for oil-in-water type emulsion, the amount of the aqueous phase in the composition is 50 wt% or more. Accordingly, in some embodiments of any one of the aspects described herein, the composition comprises the aqueous phase in an amount from about 50% wt% to about 99 wt%. For example, the composition comprises the aqueous phase in an amount from about 55 wt% to about 95 wt%, about 60 wt% to about 90 wt%, about 62.5 wt% to about 80 wt%, or about 65 wt% to about 75 wt%. In some embodiments of any one of the aspects described herein, the composition comprises the aqueous phase in an amount from about 65 wt% to about 70 wt%.
[0014] The amount of the emulsifier can be adjusted as needed based on the other components of the composition. In some embodiments, the amount of the emulsifier in the composition is from about 0.001% to about 10% (w / v, w / w or v / v). For example, the amount of the emulsifier in the composition is from about 0.005% to about 5%, from about 0.0075% to about 2.5%, or from about 0.001% to about 1% (w / v, w / w or v / v). In some embodiments,the amount of the emulsifier in the composition is from about 0.05% to about 1.5% (w / v, w / w or v / v).
[0015] Generally, the particles of the emulsion have an average diameter (i.e., the number average diameter) of about 2.5 μm or less. For example, the average particle size (i.e., the number average diameter) of the emulsion is about 900 nm or less, about 850 nm or less, about 800 nm or less, about 750 nm or less, about 700 nm or less, about 650 nm or less, about 600 nm or less, about 550 nm or less, about 500 nm or less, about 450 nm or less, about 400 nm or less, or about 350 nm or less. In some embodiments, the particles of the emulsion have an average diameter of (i.e., the number average diameter) of from about 250 nm to about 750 nm. For example, the particles of the emulsion have an average diameter of (i.e., the number average diameter) of from about 300 nm to about 650 nm. In some embodiments, the particles of the emulsion have an average diameter of (i.e., the number average diameter) of from about 325 nm to about 625 nm.
[0016] It is noted that the particles of the emulsion are not limited to a particular shape and size and can include spherical and non-spherical shapes, rod like, faceted, plates, shells, oviods, or other shapes. Further, the particles can be monodisperse or polydisperse. The size distribution of particles can be characterized by Polydispersity index (PDI). PDI of particle size distribution is determined by methods commonly known by one of ordinary skill in the art, for example, by dynamic light scattering (DLS) measurement. With regard to DLS used for particle size determinations, the common use of second or third order cumulant analyses to fit the autocorrelation function leads to the values of PDI. The absolute value of PDI determined from this method ranges from zero and higher, with small values indicating narrower distributions. For example, PDI ranging from 0 to about 0.3 or from 0 to about 0.4 presents relatively monodisperse particle size distributions. This criterion has been generally accepted in the art of dynamic light scattering for particle size determinations. In some embodiments the particles are monodisperse. For example, the particles have a narrow particle size distribution such as having a polydispersity index below about 0.5, such as below about 0.4, below about 0.3 or below about 0.2.
[0017] In some embodiments the particles of the emulsion are monodisperse. For example, the particles of the emulsion have a narrow particle size distribution such as having a polydispersity index below about 0.5, such as below about 0.4, below about 0.3 or below about 0.2. In some embodiments, the particles of the emulsion have a PDI of from about 0.15to about 0.175. For example, the particles of the emulsion have a PDI of about 0.16 to about 0.17. In some embodiments, the particles of the emulsion have a PDI of about 0.165.
[0018] The size of the emulsion particles can be varied by changing the ratio of the aqueous phase to the non-aqueous phase (increasing the ratio decreases droplet size), homogenization time (increasing the homogenization time typically reduces droplet size), operating pressure of homogenization (increasing operating pressure of homogenization typically reduces droplet size), temperature (increasing temperature decreases droplet size), changing the type of non-aqueous phase, and other process parameters. Inclusion of other components in the emulsion may also affect the particle size.
[0019] Inventors have discovered inter alia increasing the homogenization time typically reduces emulsion particle size to a point and further increase in homogenization time leads to an increase in the size of the emulsion particles. Accordingly, in some embodiments of any one of the aspects described herein, the emulsion is prepared by homogenizing (e.g., by ultrasonication) the aqueous and the non-aqueous phases for a period of about 35 minutes or less. For example, the emulsion is prepared by homogenizing (e.g., by ultrasonication) the aqueous and the non-aqueous phases for a period of about 30 minutes or less. In some embodiments, the emulsion is prepared by homogenizing (e.g., by ultrasonication) the aqueous and the non-aqueous phases for a period of from about 5 minutes to about 35 minutes. For example, the emulsion is prepared by homogenizing (e.g., by ultrasonication) the aqueous and the non-aqueous phases for a period of from about 10 minutes to about 30 minutes, the emulsion is prepared by homogenizing (e.g., by ultrasonication) the aqueous and the non- aqueous phases for a period of from about 5 minutes to about 35 minutes, from about 15 minutes to about 30 minutes or from about 20 minutes to about 30 minutes.
[0020] Inventors have discovered inter alia that a homogenization time of 25 minutes unexpectedly and surprisingly yields a narrow particle size distribution, higher emulsion stability, and significantly high (absolute) zeta potential value. In addition, emulsions prepared by homogenizing (e.g., by ultrasonication) the aqueous and the non-aqueous phases for a period of about 25 times are less susceptible to gravitational separation and other physical forces; there by preventing undesirable phenomena like flocculation and sedimentation over time. Accordingly, in some embodiments, the emulsion is prepared by homogenizing (e.g., by ultrasonication) the aqueous and the non-aqueous phases for a period of about 25 minutes.
[0021] The proteinaceous material and / or the conductive element can be present in the aqueous phase or non-aqueous phase of the composition. In some embodiments of any one ofthe aspects provided herein, the proteinaceous material and / or the conductive element is present in the aqueous phase.
[0022] The compositions described herein can be used to coat surface to provide antifouling coating layer on the surface. Accordingly, in another aspect, provided herein is a surface comprising an antifouling coating layer on at least a portion of the surface, wherein the composition comprises a proteinaceous material and a conductive element, and wherein the antifouling coating layer is porous and comprises macropores.
[0023] In some embodiments of any one of the aspects described herein, the antifouling coating layer is directly or indirectly connected with an electrode. For example, the surface is a surface of a conductive substrate (e.g., an electrically conductive substrate). In some embodiments, the substrate is an electrode. In some embodiments of any one of the aspects described herein, the surface is a surface of a medical device.
[0024] Accordingly, in another aspect provided herein is an electrode. The electrode comprises: (i) a conductive substrate (e.g., an electrically conductive substrate); and (2) an antifouling coating layer on at least a portion of a surface of the conductive substrate, and wherein the antifouling coating layer comprises: a proteinaceous material and a conductive element, and wherein the antifouling coating layer is porous and comprises macropores.
[0025] In yet another aspect, in yet another aspect, provided herein is a method for preparing a surface with an antifouling coating layer on at least a part of the surface. The method comprises coating at least a part of a surface with a composition described herein and removing, at least a part of, the non-aqueous phase from the coating layer, thereby producing an antifouling coating layer on at least a part of the surface. Without wishing to be bound by a theory, removal of the non-aqueous phase from the coating layer produces pores in the coating layer. Thus, in some embodiments of any one of the aspects described herein, the antifouling coating layer is porous. For example, the antifouling coating layer comprises macropores.
[0026] In some embodiments of any one of the aspects described herein, the method for preparing a surface with an antifouling coating layer further comprises cross-linking the proteinaceous material. It is noted that the proteinaceous material can be cross-linked prior to or after the step of removing the non-aqueous phase. Accordingly, in some embodiments of any one of the aspects described herein, the method for preparing a surface with an antifouling coating layer further comprises, prior to the step of removing the non-aqueous phase, a step of cross-linking the proteinaceous material. In some other embodiments of any one of the aspects described herein, the method for preparing a surface with an antifouling coating layer furthercomprises a step of cross-linking the proteinaceous material after the step of removing the non- aqueous phase.
[0027] Generally, the antifouling coating layer comprises macropores with a diameter of about 0.1 μm to about 10 μm. For example, the macropores have a diameter of from about 0.5 μm to about 5 μm. In some embodiments of any one of the aspects described herein, the macropores have a diameter of from about 1 μm to about 3 μm. In some embodiments of any one of the aspects described herein, the macropores have a diameter of from about 0.25 μm to about 0.75 μm. For example, the macropores have a diameter of from about 0.3 μm to about 0.65 μm. In some embodiments, the macropores have a diameter from about 0.325 μm to about 0.625 μm.
[0028] In some embodiments of any one of the aspects described herein, the antifouling coating layer comprises mesopores. For example, the antifouling coating layer comprises mesopores with a diameter of about 5 nm to about 99 nm.
[0029] In some embodiments of any one of the aspects described herein, the antifouling coating layer also comprises nanopores. For example, the antifouling coating layer comprises nanopores with a diameter of about 0.1 nm to about 4.5 nm.
[0030] In some embodiments of any one of the aspects described herein, the antifouling coating layer comprises multiscale pores, i.e., both macropores and mesopores. For example, the antifouling coating layer comprises macropores with a diameter of about 0.1 μm to about 10 μm and mesopores with a diameter of about 5 nm to about 99 nm.
[0031] Generally, the antifouling coating layer has a porosity of about 5% to about. 95%. For example, the antifouling coating layer has a porosity of about 20% to about 75%. In some embodiments, the antifouling coating layer has a porosity of about 25% to about 60%, or about 30% to about 50%. For example, the antifouling coating layer has a porosity of about 35% to 45%.
[0032] In some embodiments of any one of the aspects, the antifouling coating layer comprises a target binding molecule, e.g., a molecule capable of binding with a target molecule or target analyte. It is noted that the target binding molecule can be present in the antifouling coating layer or at a surface of the antifouling coating layer. Accordingly, in some embodiments of any one of the aspects described herein, the target binding molecule is on a surface of the antifouling coating layer. In some embodiments of any one of the aspects described herein, the target binding molecule is in pores of the antifouling coating layer. In some embodiments of any one of the aspects described herein, the target binding molecule isimprinted on the antifouling coating layer. Some exemplary target binding molecules include, but are not limited to, a receptor, a ligand for a receptor, an antibody, antigen binding fragment of an antibody, an antigen, an enzyme or a nucleic acid. In some embodiments of any one of the aspects described herein, the target binding molecule is an antibody, an antigen binding fragment of an antibody or an antigen.
[0033] In some embodiment of any one of the aspects described herein, the antifouling coating layer further comprises an antimicrobial agent. For example, the antifouling coating layer further comprises an anti-bacterial agent, antifungal agent and / or anti-viral agent. In some embodiments of any one of the aspects described herein, the anti-microbial agent is an antimicrobial peptide or polymer. In some embodiments of any one of the aspects described herein, the anti-microbial agent is a metal particle, e.g., oxide, copper, or silver nanoparticles.
[0034] In some embodiments of any one of the aspects described herein, the antifouling coating layer further comprises a therapeutic agent. For example, the antifouling coating layer comprises anti-inflammatory drugs such as sirolimus, everolimus, biolimus (A9), zotarolimus (ABT-578), tacrolimus, and pimecrolimus, genistein, steroids (dexamethasone, prednisolone, methylprednisolone and hydrocortisone), fluocinolone acetonide, hormones etc.
[0035] In some embodiments of any one of the aspects described herein, the antifouling coating layer further comprises a polymer. For example, the antifouling coating layer comprises a water polymer. In some embodiments of any one of the aspects described herein, the antifouling coating layer comprises a degradable polymer. Some exemplary polymers include, but are not limited to, poly(N-isopropyl acrylamide) (PNIPAAm), polyethylene glycol (PEG), alginate, polytetrafluoroethylene (PTFE), polyacetylene (PA), polyaniline (PANI), polypyrrole (PPy), polythiophene (PTH), poly(para-phenylene) (PPP), poly(phenylenevinylene) (PPV), and polyfuran (PF).
[0036] In still another aspect, provided herein is a sensor comprising an electrode or a coated surface described herein. Generally, the sensor comprises a fluid-contact surface and the electrode is immobilized on at least a portion of the fluid-contact surface. In some embodiments of any one of the aspects described herein, the fluid-contact surface further comprises a positive control electrode and / or a negative control electrode immobilized thereon. In some embodiments of any one of the aspects described herein, the sensor comprises one or more microfluidic flow cells.
[0037] The electrodes, surfaces and sensors described herein are useful for detecting a target analyte in a sample. Accordingly, in yet another aspect, provided herein is a use of a surface, an electrode or sensor described herein for detecting a target analyte in a sample,
[0038] In still another aspect, provided herein is a method for detecting a target analyte in a sample. Generally, the method comprises contacting a sample suspected of comprising a target analyte with an electrode described herein and detecting binding of the target analyte with a target binding molecule present in or on the antifouling coating. In some embodiments, detecting the binding of the target molecule with the target binding molecule comprises applying a voltage to the electrode, measuring a current generated fem the electrode. Optionally, the second target binding molecule comprises a detectable label, for example, an enzyme, a fluorophore, a chemiluminescent label, colloidal gold, colored glass or plastic (e.g., polystyrene, polypropylene, and latex) beads, a radiolabel, a quantum dot, or any combination thereof.
[0039] In some embodiments of any one of the aspects described herein, the target analyte is a peptide, a polypeptide, a peptidomimetic, a nucleic acid, an oligosaccharide, a polysaccharide, an amino acid, nucleoside, a nucleotide, a carbohydrate, a lipid, a peptidoglycan, a cell, microbial matter, an antigen, a lipid, a steroid, a hormone, a lipopolysaccharide, an endotoxin, a therapeutic agent, a lipid-binding molecule, a cofactor, a small molecule, a toxin, a biological threat agent (e.g., spore, viral, cellular and protein toxin), or any combination thereof.
[0040] The sample suspected of comprising the target analyte can be a biological sample (e.g., blood, saliva, amniotic fluid, sputum, urine, semen, cerebrospinal fluid, bronchial aspirate, perspiration, mucus, liquefied stool sample, synovial fluid, lymphatic fluid, tears, tracheal aspirate, lactation product, and any combination thereof); or a food, an ingredient for preparing a food, poultry, meat, fish, beverage, or dairy product; or a non-biological sample (e.g., water, salt water, pond water, river water, reservoir water, brine, drinking water, industrial water, brown water, waste water, sewerage, soil, and mixtures thereof.
[0041] In another aspect, provided herein is a kit comprising a composition, surface, electrode, or sensor described herein.BRIEF DESCRIPTION OF THE DRAWINGS
[0042] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0043] FIG. 1 shows the schematic of typical antifouling coating with BSA. Step 1 is the immobilization of bioreceptors onto sensing surface; Step 2 is the physical adsorption of BSA to prevent non-specific binding; and Step 3 is the binding with target molecules.
[0044] FIG. 2 shows the schematic of emulsion based antifouling technology. Two immiscible liquids (e.g., oil and water) are mechanically mixed (e.g., through tip sonication) into an emulsion. The antifouling emulsion is coated onto a surface (e.g., a working electrode) through any one of various printing techniques such as nozzle-assisted printing, drop-casting, or spin coating. The emulsion-based antifouling coating comprising covalently cross-linked BSA exhibits a multi-scale porous architecture.
[0045] FIG. 3 shows optical images of a 3D coating created by printing an emulsion ink on a gold electrode and characterization of its multiscale porous structure. A hexadecane- based oil phase was added into a PBS solution based water phase containing BSA, gold nanowires, and an emulsifier, and they were mixed via ultrasonication to form an oil-in-water emulsion. The emulsion ink was coated onto a gold electrode of an electrochemical chip. SEM analysis showed the porous structures contained a coexistence of macropores and nanopores.
[0046] FIG. 4 shows the design of hairpin RNA probe and cyclic voltammetry results for BSA porous structures. An amine-modified hairpin (HP) RNA probe in which two methylene blue (MB) labeled oligonucleotides are hybridized at its 3’ and 5’ ends were covalently conjugated to the surface of the BSA coating. Electrochemical measurements showed that both macropores and multiscale pores resulted in 5 times higher peak current than the coating with nanopore structure and all were better that a solid coating.
[0047] FIGS. 5A-5C show the electrochemical properties and antifouling activities of pentaamine-functionalized reduced graphene oxide (prGOx)-based antifouling coatings.
[0048] FIG. 6 show the cyclic voltammetry result using emulsion-based coating to detect TIMP1. Sensors for detection of tissue inhibitor of metalloproteinase 1 (TIMP1) were assessed using an electrochemical (EC) enzymatic sandwich detection assay. EC readouts using cyclic voltammetry detected TMB that precipitates on the working electrode when oxidized by HRP, as it yields an electro-active product. 10pg / ml of TIMP1 was detected with high sensitivity.
[0049] FIGS. 7A-7G show preparation of emulsion using ultrasonication and their rheological properties. 7a, Schematics of ultrasonication-based oil-in-water emulsion preparation and antifouling coating. BSA cross-linking and pore formation result in the development of a highly-interconnected porous nanocomposite with a micron-scale thickness.7b, Analysis of the oil droplet size distribution at various sonication time via DLS. The sonication time of 25 min yielded average droplet size of 325.2 nm with PDI value of 0.165. Inset images show visible difference between the aqueous solution and the oil-in-water emulsion. 7c, Absorbance retention of emulsion with various sonication time. The absorbance values were obtained from UV-vis measurement at 280 nm. Emulsion sonicated for 25 min maintained 100% absorbance level until 120 min and retained 90% absorbance after a day. Inset images show fresh emulsion (left) at 40 min of sonication and their sedimentation (right) after 30 min of storage. 7d, Illustration of correlation between surface charge of droplet and emulsion stability. Increasing surface charge leads to a stronger electrostatic repulsive force between the droplets, preventing flocculation and maintaining droplet size. 7e, Zeta potential values of emulsion with various sonication time. Error bars represent the standard deviation. Sonication for 25 min yielded a high zeta potential value of -75.5 ± 9.5 mV. 7f, Precise patterning of emulsion on the working electrode, resulting in the formation of a uniform porous nanocomposite. 7g, Confocal microscopy image of porous nanocomposite immobilized with FITC-labeled anti-IgG at excitation wavelength of 488 nm. Scale bars are 500 μm. (7f, 7g)
[0050] FIGS. 8A-8H show characterization of cross-linked nanocomposites. 8a, Schematic of three different cross-linked BSA nanocomposites: thin, thick, and porous emulsion-based nanocomposites (e-nanocomposite). 8b, Top- and side-view SEM images of nanocomposites. Three nanocomposites exhibited dense coatings with corresponding thicknesses and porosities. 8c, Representative CV data in 5 mM ferri- / ferrocyanide solution with three nanocomposites and bare Au electrode. Scan rate is 0.1 V s-1between -0.5 V and 0.5 V. 8d, Oxidation and reduction peak current versus the square root of scan rate (from 0.07 to 1.0 V s-1) (n = 4, independent electrodes, error bar = standard deviation). 8e, Energy dispersive analysis (EDS) map for Au and C in e-nanocomposite. 8f, Negative TOF-SIMS spectra with emulsion coating, y-axis denotes the detected number of secondary ions and x-axis denotes the mass-to-charge (m / z) ratio. CN' and CNO' signals were predominantly presented, indicating abundance of the peptide backbone in the e-nanocomposite. 8g, AFM topography of porous nanocomposite (bottom) and the extracted height profile of black dotted line (top). 8h, Measurement of porosity via MIP. e-nanocomposite has mesopores with an average size of 9.53 nm between the macropores with an average size of 1.123 μm.
[0051] FIGS. 9A-9E show enhancement of electrochemical performance and antifouling activities by e-nanocomposite. 9a, Fabrication of CRISPR / Casl2a-based electrochemical nucleic acid sensor by immobilizing PNA / reporter probe (RP)-HRP ontoporous nanocomposite. Debye volume can be maximized in concave structures. 9b, Measurement of CV according to nanocomposite structures. CV were conducted in 5 mM ferri- / ferrocyanide solution before PNA immobilization (left). After PNA immobilization, RP-HRP hybridization, and TMB precipitation, CV were conducted in PBST (right). Scan rate is 0.1 V s-1between -0.5 and 0.5V. Statistical significance was tested (**P < 0.01, ***P < 0.001, ****P < 0.0001; two-tailed Student’s t-test). Two chips were used for the measurements (n = 8, independent electrodes, error bar = standard deviation). 9c-9e, Comparison of peak current between bare Au electrode and nanocomposite-coated electrodes. Chips were stored for one month at 4 °C in 1% BSA, NPS, and serum (n = 4, independent electrodes, error bar = standard deviation), e-nanocomposite-coated electrodes demonstrated superior antifouling properties against non-specific molecules by maintaining its electrochemical behavior for one month under all biofluid conditions.
[0052] FIGS. 10A-10K show electrochemical detection of viral infection using e- nanocomposite sensor. 10a, Schematics of electrochemical enzymatic detection of SARS- CoV-2 RNA, antigen, and host antibody using e-nanocomposite sensors. 10b-10d, Calibration curves for ORF 1 a gene and nucleocapsid protein of SARS-CoV-2, and IgG antibody using CV with 1 V s-1scan rate between -0.5 and 0.5 V. LOD was defined using three standard deviations (3σ) of the blank solution. CV were measured on four WEs, out of which three were involved in the reaction with the target species, while one served as a negative control. 10e-10g, ROC curves based on the detection results of e-nanocomposite sensors. AUC was 1 , 0.996, and 0.993 for ORF la, nucleocapsid protein, and IgG antibody, respectively. Clinical NPS (Positive: 40, Negative: 20) were used to detect ORFla gene and nucleocapsid protein of SARS-CoV-2, and clinical serum (Positive: 33, Negative: 20) was used to detect the IgG. Each data obtained from three independent electrodes. The experiments were conducted over a total of two rounds. 10h- 10j, Waterfall distribution of peak current for clinical samples. Cut-off values were determined from the ROC curves: 2.12 (ORFla gene), 0.857 (Nucleocapsid protein), and 1.3 (IgG antibody) μA. 10k, Correlation between peak current measured from e-nanocomposite sensor and Ct value measured from RT-qPCR for COVID-19 positive clinical samples. Pearson’s r was -0.67 for antigen testing and 0.42 for antibody testing.
[0053] FIGS. 11A-11B show thick and porous antifouling nanocomposite for electrochemical detection of virus with high accuracy and reliability. 11a, Fabrication of emulsion-processed porous antifouling nanocomposite via nozzle-assisted printing. The AuNWs are embedded to the nanocomposite when BSA is cross-linked by GA.Electrochemical sensor consists of four working electrodes (WE), 11b, Overview of multiplexed detection of SARS-CoV-2 RNA, antigen, and host antibody using emulsion-based nanocomposite electrochemical sensor.
[0054] FIG. 12 shows zeta potential distributions of emulsion with various sonication time.
[0055] FIG. 13 shows comparison of mean peak current values recorded at the bare Au chip and e-nanocomposite-coated chips with various sonication time (n = 4, error bar = standard deviation). Chips were incubated in 1% BSA solution, e-nanocomposite sonicated for 25 min showed the highest uniformity in electrochemical signal for a week.
[0056] FIGS. 14A-14B show 14a, CFD simulation of flow behavior at the nozzle tip using emulsion and aqueous solution (control). Colormap shows the velocity field in mm s-1. Diameter of outlet is 0.25 mm. Flow rate of emulsion at the nozzle tip was reduced compared to the control solution. 14b, Measurement of rheological properties for emulsion and control. Solid line represents Carreau model for emulsion and dashed line indicates Newtonian model for control.
[0057] FIGS 15A-15B show 15a, Contact angles of PBS containing BSA and 15b, emulsion on Au substrate. The smaller the contact angle value, the better the wettability of the solution and the better the adherence to the substrate.
[0058] FIG. 16 shows Chip-to-chip variance of e-nanocomposite-coated chips determined by mean peak current values from CVs (n = 4, error bars = standard deviation). Total average peak current was 20.7 ± 1.09 μA with coefficient of variance of 5.30 %.
[0059] FIG. 17 show shelf-life of e-nanocomposite-coated chips in different storage condition (dry at 4 °C and PBS at 4 °C) (n = 4, error bars = standard deviation).
[0060] FIG. 18 show energy-dispersive X-ray spectroscopy (EDS) analysis of the emulsion-processed nanocomposite. Au peak indicates the AuNWs embedded in the cross- linked BSA matrix.
[0061] FIG. 19 show UV-vis absorbance spectra of solutions with various components.BSA proteins were cross-linked by glutaraldehyde (GA), as indicated by the increase in absorbance at 265-270 nm.
[0062] FIG. 20 show negative TOF-SIMS spectra of Au electrode with BSA and emulsion coating, y-axis denotes the detected number of secondary ions and x-axis denotes the mass-to-charge (m / z) ratio. Au" signal in the spectrum of emulsion-processed nanocomposite was originated from AuNWs.
[0063] FIG. 21 show Raman spectra of BSA, BSA / AuNWs, and e-nanocomposite. C- N peaks of BSA and BSA / AuNWs were 1110.35 cm'1and that of e-nanocomposite was 1120.43 cm'1. 1.83 % shift of C-N peak indicates the peptide bonding formation in e- nanocomposite.
[0064] FIG. 22 show N2 physisorption analysis of thin and e-nanocomposite, a, BET surface area is calculated from the slope and the intercept according to the equation of the linear range. BET surface area of e-nanocomposite is about 38.7-fold higher than that of thin nanocomposite. (SBET, thin nanocomposite: 0.1677 m2 / g, SBET, e-nanocomposite I 6.4859 m2 / g.) b, Langmuir surface area of e-nanocomposite is about 38.7-fold higher than that of thin nanocomposite. Langmuir surface area of the thin nanocomposite is not fitted. (S Langmuir, thin nanocomposite: 0.177 m2 / g, SLangmuir, e-nanocomposite: 6.8526 m2 / g.)
[0065] FIGS. 23A-23B show Nanocomposites immobilized with FITC-labeled anti- IgG. 23a, Confocal microscopy images of thin, thick, and e-nanocomposites. All nanocomposites were imaged with an excitation wavelength 488 nm for FITC. The scale bar represents 1 μm. 23b, Fluorescence intensity variation of the thin, thick, and e-nanocomposites.Image of the e-nanocomposite showed 4.41 and 3.21-fold higher than those of thin and thick nanocomposite due to its increased surface area, (n = 4, error bars = standard deviation.)
[0066] FIG. 24 shows BSA concentration change before (gray) and after (red) the incubation of sensors in a 1% BSA solution for one day (n = 3, independent electrodes, error bar = standard deviation). Concentration was calculated using Nanodrop at a wavelength of 280 nm. For thin nanocomposite-coated sensor, 70.5% of BSA was measured after incubation. For thick nanocomposite sensor, 81.8% of BSA was measured after incubation. For e- nanocomposite sensor, 93% of BSA was measured after incubation, demonstrating superior antifouling properties.
[0067] FIGS. 25A-25D show evaluation of RT-RPA primers for ORF la gene of SARS-CoV-2. Set 1 primers showed the highest signal ratio between positive and negative samples.
[0068] FIG. 26 show sensitivity of the RT-RPA assay. Time-dependent fluorescence intensities during RT-RPA assay with various concentrations of ORF la gene in SARS-CoV-2 RNA. [ORF la primers] = 500 nM, [M-MLV reverse transcriptase] = 20 U, [Murine RNase inhibitor]= 60 U, and [MgOAc] = 15 mM.
[0069] FIG. 27 shows Comparison of the results for assay described herein with conventional ELISA kit. (a) Absorbance intensities at 450 nm in the presence of variousconcentrations of SARS-CoV-2 N protein with the assay described herein and conventional ELISA kit. (b) The linear range of the assay described herein compared to conventional ELISA kit for target N protein (n = 3, error bar = standard deviation). [Capture antibody] = 0.1 μg μl-1and [Detection antibody] = 0.25 μg μl-1.
[0070] FIG. 28A-28B shows determination of SARS-CoV-2 N protein in diluted artificial saliva samples (5%). (28a) Absorbance intensities at 450 nm in the presence of various concentrations of SARS-CoV-2 N protein spiked in artificial saliva samples (5%). (28b) The linear range of the assay described herein for target N protein spiked in artificial saliva samples (5%) (n = 3, error bar = standard deviation). [Capture antibody] = 0.1 μg μl-1and [Detection antibody] = 0.25 μg μl-1.
[0071] FIG. 29 shows determination of SARS-CoV-2 N protein in diluted nasopharyngeal swabs (NFS) samples (10 %). (a) Absorbance intensities at 450 nm in the presence of various concentrations of SARS-CoV-2 N protein spiked in NFS samples (10%). (b) The linear range of the assay described for target N protein spiked in NFS samples (10%) (n = 3, error bar = standard deviation). [Capture antibody] = 0.1 μg μl-1and [Detection antibody] = 0.25 μg μl-1.
[0072] FIG. 30 show optimization of HRF incubation time for antigen and antibody detection using e-nanocomposite sensor (n = 3, error bar = standard deviation).
[0073] FIG. 31 shows optimization of detection antibody concentration for antigen and antibody detection using e-nanocomposite sensor (n = 3, error bar = standard deviation).
[0074] FIG. 32 shows optimization of serum dilution ratio for antibody detection using e-nanocomposite sensor (n = 3, error bar = standard deviation). Two COVID-19 positive serum samples were tested.DETAILED DESCRIPTION
[0075] It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.
[0076] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety for any purpose.
[0077] The methods, compositions, electrodes, surfaces, sensors and structures provided herein are based in part on the preparation of an emulsion type composition comprising a proteinaceous material and a conductive element.
[0078] The composition and methods described herein can be used to prepare thick (>1 μm) and porous antifouling coatings for electrochemical diagnostic sensors with ultrahigh sensitivity and other devices. The compositions and methods described herein can be utilized to form the multiscale porous antifouling coating at any thickness desired. The highly porous nature of the material greatly increases its surface area available for target binding molecules and interactions with target analytes. It can be rapidly applied using nozzle-assisted printing in a form that is highly sensitive and robust. In addition, functional nanomaterials can be embedded within the antifouling coatings.Emulsion
[0079] Accordingly, in one aspect, provided herein is a composition comprising a non- aqueous phase, an aqueous phase, a proteinaceous material, a conductive element, and an emulsifier. It is noted that the composition can be in form of an emulsion, nanoemulsion, micelle, liposome, or a combination thereof. As used herein, the term “emulsion” refers to a mixture of immiscible liquids in which one or more liquids (“dispersed phase”) are dispersed as fine droplets in another liquid (“continuous phase”),
[0080] In some embodiments of any one of the aspects described herein, the composition is an emulsion. For example, the composition is an oil-in-water (o / w) emulsion, water-in-oil (w / o) emulsion, water-in-oil-in-water (w / o / w) emulsion, or oil-in-water-in-oil (o / w / o) emulsion. In some embodiments of any one of the aspects described herein, the composition is an oil-in-water (o / w) emulsion.
[0081] The ratio of ratio of the aqueous phase to the non-aqueous phase in the composition can be adjusted as needed for the composition form desire. For example, a ratio of the aqueous phase to the non-aqueous phase can be from about 1000: 1 to about 1 : 1 (v / v). In some embodiments, a ratio of the aqueous phase to the non-aqueous phase is from about 750: 1 to about 1:1, about 500: 1 to about 1:1, about 250: 1 to about 1:1, about 200: 1 to about 1:1, about 150:1 to about 1:1, about 100:1 to about 1 :1, about 50:1 to about 1:1, about 40:1 to about 1:1, about 30:1 to about 1:1, about 25:1 to about 1 :1, about 20:1 to about 1:1, about 10:1 to about 1:1, or about 5:1 to about 1 :1 (v / v). For example, a ratio of the aqueous phase to the non- aqueous phase is about 20:1, about 19:1, about 18:1, about 17:1, about 16:1, about 15:1, about14:1, about 13:1, about 12:1, about 11:1, about 10:1, about 9:1, about 8.5:1, about 8:1, about 7.5:1, about 7:1, about 65. :1, about 6:1, about 5.5:1, about 5:1, about 4.5:1, about 4:1, about 3.5:1, about 3.25:l, about 3:l, about 2.75:1, about 2.5:1, about 2.25:1, about 2:1, about 1.75:1, about 1.5:1, or about 1.25:1 (v / v). In some embodiments, a ratio of the aqueous phase to the non-aqueous phase is about 2:1.Non-aqueous phase
[0082] Embodiments of the various aspects described herein include a non-aqueous phase. As used herein, the term “non-aqueous phase” refers to a phase of liquid that is not dispersible in water at the molecular or ionic level (e.g.. water insoluble liquids). A “non- aqueous phase” can mean lipophilic phase, hydrophobic phase, and / or oily phase.
[0083] Generally, the non-aqueous phase comprises a water immiscible liquid. The term “water immiscible liquid” as used herein refers to a liquid that does not dissolve in water when mixed with water in an amount of 10% w / w at 20°C. Generally, a water immiscible liquid is liquid at 20°C and is soluble in water to an extent less than about 5% (e.g., about 4%, about 3.5%, about 3%, about 2.5%, about 2%, about 1.5%, about 1 %, about 0.75%, about 0.5%, or about 0.25%) by weight at 20°C. Failure to dissolve means that the liquid forms a separate phase which can be a discrete layer or a dispersion of liquid droplets in the water. In some embodiments, a water immiscible liquid has a vapor pressure to an extent less than 500 mmHg at 25°C to prevent the evaporation during mechanical mixing.
[0084] Exemplary water immiscible liquids include, but are not limited to, silicone oils (including, but not limited, to poly(dimethylsiloxane), poly(methylphenyisiloxane), and their copolymers), petroleum special (Fluka), a saturated, or unsaturated aliphatic hydrocarbon, i ts halogenated derivatives, and combination thereof. The aliphatic hydrocarbons can be normal or branched, for example, but not limited to, hexane, isooctane, decane, dodecane, 1 -dodecene, pentadecane, hexadecane, petroleum ethers, and mineral oils), heptadecane, heptamethyhionan, heptadecene, perfluorotridecane and FLIIORINERT™ Electronic Liquid FC-770 (3M, St, Paul, Minn,), aromatic hydrocarbons (including, but not limited to, benzene, toluene, cumene, alkylbenzenes, allcylarylbenzenes, 2,3,4,5,6-pentatIuoroanisol. 1,3,5- trimethylbenzene and hexylbenzene), esters (including but not limited to 1,4-dioctyl phthalate, dioctyl terephthalate and diisobutyl phthalate), fluorinated hydrocarbons (including, but not limited to, FLUORINERT™ FC-75 (3M) and CTSOLV-100 (Asahi Glass) and other halogenated hydrocarbons, and perfluoropolyethers, including, but not limited to FOMBL1N®,(Ausimont USA, Inc. (Thorofare, N.J.)) and DEMNUM™ (Daikin Industries, Japan). Additional water immiscible liquids that can be used include, but are not limited to, naturally occurring oils such as vegetable oil s (i.e., saturated and unsaturated fatty acids and derivatives).
[0085] In some embodiments of any one of the aspects described herein, the non- aqueous phase comprises an oil, a wax, a fluorocarbon, a silicone, or any combination thereof. For example, the non-aqueous phase comprises an oil.
[0086] In some embodiments of any one of the aspects described herein, the non- aqueous phase comprises an oil selected from the group consisting of hydrocarbons, mineral oil, vegetable oils (e.g., soybean oil, peanut oil, com oil, sunflower oil, almond oil, castor oil, rapeseed oil, cocoa butter, olive oil, palm oil, hydrogenated palm oil, rice bran oil, macadamia integrifolia seed oil, argania spinosa kernel oil, safflower oil, rapeseed oil, palm kernel oil, cotton seed oil, sesame oil, linseed oil, hazelnut oil, walnut oil, pumpkin oil, grape seed oil, brazil nut oil, avocado oil, almond oil, avocado oil, sunflower oil, Jojoba oil, cocoa butter, and flaxseed oil), fats, waxes (e.g., candellila wax, carnauba wax, mineral wax, microcrystalline wax, Montan wax, Ozocerite wax, paraffin wax, petro latum wax, petroleum wax, synthetic wax, silicone waxes animal wax, beeswax, lanolin and its derivatives, vegetable wax, ouricurry wax, Japan wax, Esparto wax, cork fiber wax, and sugar cane wax), fatty alcohols, fatty acids, and medium chain triglycerides.
[0087] In some embodiments of any one of the aspects described herein, the non- aqueous phase comprises a hydrocarbon. The term “hydrocarbon” refers to aliphatic compounds, (e.g., alkane, alkene or alkyne, each of which can be linear or branched), alicyclic compounds (e.g., cycloalkane, cycloalkylene), aromatic compounds, aliphatic- and alicyclic- substituted aromatic compounds, aromatic-substituted aliphatic compounds, aromatic- substituted alicyclic compounds, and the like, comprising from 6 to 20 carbons, Exemplary hydrocarbons include, but are not limited to, hexane, heptane, octane, nonane, decane, dodecane, hexadecane, cyclooctane, cyclononane, cyclodecane, ethylcyclohexane, and ethylcyclooctane. In some embodiments of any one of the aspects described herein, the non- aqueous phase comprises, n-heptane, n-octane, or n-decane.
[0088] In some embodiments of any one of the aspects described herein, the amount of the non-aqueous phase in the composition or antifouling coating layer is about 50 wt% or less. For example, the amount of the non-aqueous phase in the composition or antifouling coating layer is about 49 wt%, about 48 wt%, about 47 wt%, about 46 wt%, about 45 wt%, about 44 wt%, about 43 wt%, about 42 wt%, about 41 wt%, about 40 wt%, about 39 wt%, about 38 wt%,about 37 wt%, about 36 wt%, about 35 wt%, about 34 wt%, about 33 wt%, about 32 wt%, about 31 wt%, about 30 wt%, about 29 wt%, about 28 wt%, about 27 wt%, about 26 wt%, about 25 wt%, about 24 wt%, about 23 wt%, about 22 wt%, about 21 wt%, about 20 wt%, about 19 wt%, about 18 wt%, about 17 wt%, about 16 wt%, about 15 wt%, about 14 wt%, about 13 wt%, about 12 wt%, about 11 wt%, about 10 wt%, about 9 wt%, about 8 wt%, about 7 wt%, about 6 wt%, about 5 wt%, about 4 wt%, about 3 wt%, about 2 wt%, or about 1 wt %. In some embodiments of any one of the aspects described herein, the amount of the non- aqueous phase in the composition or antifouling coating layer is about 30 wt% to about 35 wt%.
[0089] In same embodiments of any one of the aspects described herein, the composition is in form of an emulsion and the non-aqueous phase is the dispersed phase. In some other embodiments of any one of the aspects described herein, the composition is in form of an emulsion and the non-aqueous phase is the continuous phase.Aqueous phase
[0090] Embodiments of the various aspects described herein include an aqueous phase. As used herein, the term “aqueous phase” refers to a phase of liquid that is miscible in water. In other words, the term “aqueous phase” as used herein is a phase that comprises water or a water miscible liquid, such as alcohols, ethers, esters, glycols, polyglycols, and mixtures thereof. Some exemplary water-miscible liquids include, but are not limited to, G-C4 lower alkanols (such as ethanol, propanol, isopropanol, butanol and mixtures thereof), aromatic alcohols (such as benzyl alcohol and / or phenoxyethanol), polyols and polyol ethers (such as 2- butoxyethanol, propylene glycol, propylene glycol monomethyl ether, diethylene glycol monoethyl ether, hexylene glycol, glycerin, ethoxy diglycol, butoxydiglycol, dipropylene glycol, polyglycerol, sorbitol, polyethylene glycol, polypropylene glycol, and mixtures thereof), propylene carbonate, ethylene glycol distearate (EGDS) and mixtures thereof.
[0091] In some embodiments of any one of the aspects described herein, the aqueous phase comprises a buffer or a buffering agent. Some exemplary buffers include, but are not limited to, phosphate buffer, (PBS), acetate buffer, histidine buffer, succinate buffer, HEPES buffer, tris buffer, carbonate buffer, citrate buffer. glycine buffer, barbital buffer, and cacodylate buffer.
[0092] In some embodiments of any one of the aspects described herein, the amount of the aqueous phase in the composition or antifouling coating layer is about 50 wt% or more.For example, the amount of the aqueous phase in the composition or antifouling coating layer is about 99 wt%, about 98 wt%, about 97 wt%, about 96 wt%, about 95 wt%, about 94 wt%, about 93 wt%, about 92 wt%, about 91 wt%, about 90 wt%, about 89 wt%, about 88 wt%, about 87 wt%, about 86 wt%, about 85 wt%, about 84 wt%, about 83 wt%, about 82 wt%, about 81 wt%, about 80 wt%, about 79 wt%, about 787 wt%, about 77 wt%, about 76 wt%, about 75 wt%, about 74 wt%, about 73 wt%, about 72 wt%, about 71 wt%, about 70 wt%, about 69 wt%, about 68 wt%, about 67 wt%, about 66 wt%, about 65 wt%, about 64 wt%, about 63 wt%, about 62 wt%, about 61 wt%, about 60 wt%, about 59 wt%, about 58 wt%, about 57 wt%, about 56 wt%, about 55 wt%, about 54 wt%, about 53 wt%, about 52 wt%, about 51 wt%, or about 50 wt%.
[0093] In some embodiments of any one of the aspects described herein, the composition is in form of an emulsion and the aqueous phase is the continuous phase. In some other embodiments of any one of the aspects described herein, the composition is in form of an emulsion and the non-aqueous phase is the dispersed phase.
[0094] In some embodiments, a ratio of the aqueous phase to the non-aqueous phase is from about 500:1 to about 1.25:1, from about 250:1 to about 1.5:1.75, or from about 100:1 to about 2 : 1. In some embodiments, a ratio of the aqueous phase to the non-aqueous phase is from about 5:1 to about 1.25:1. For example, a ratio of the aqueous phase to the non-aqueous phase is from about 2.5:1 to about 1.5:1. In some embodiments of any one of the aspects described herein, a ratio of the aqueous phase to the non-aqueous phase is about 10:1, about 9.5:1, about 9:1, about 8.5:1, bout 8:1, about 7.5:1, about 7:1, about 8.6:1, about 6:1, about 5.5:1, about 5:1, about 4.5:1, about 4:1, about 3.5:1, about 3:1, about 2.75: 1 , about 2.5 : 1 , about 2:1, about 1.75:1, about 1.5:1, about 1.25:1, or about 1:1.Emulsifier
[0095] In some embodiments of any one of the aspects described herein, the composition or the antifouling coating layer comprises an emulsifier. As used herein, the term “emulsifier” refers to molecules, e.g., amphiphilic molecules that are surface active agents and that stabilize emulsions by reducing the interfacial tension. Exemplary emulsifiers include, but are not limited to, lipids, phospholipids, steroids, lipids, semi-lipoidal molecules, membrane active agents, and any combinations thereof. For example, the emulsifier can be selected from the group consisting of lipids, phospholipids, cholesterol, estrogens; androgens; long-chained alkyl amines which can be primary, secondary, tertiary' or quaternary substituted(e.g., stearylamine); fatty acids (e.g., arachidonic acid): membrane active agents, and any combinations thereof. Mixtures of two or more emulsifiers are useful to vary the surface properties and reactivity. It is noted that the emulsifier can be an anionic, nonionic, cationic, zwitterionic or amphoteric surfactant.
[0096] Nonionic emulsifiers that can stabilize oil-in-water or water-in-oil emulsions are characterized by the Hydrophilic Lipophilic Balance (HLB), which indicates the solubility of the emulsifier. Generally, emulsifiers with high HLB are more soluble in water and facilitate oil-in-water emulsions and emulsifiers with a low HLB are more soluble in oils and facilitate water-in-oil emulsions. Accordingly, in some embodiments of any one of the aspects described herein, the emulsifier has an HLB of at least about 1 , at least about 2, at least about 4, at least about 6. at least about 8, at least about 10, at least about 12, at least about 14, at least about 16, or at least about 18.
[0097] In some embodiments of any one of the aspects described herein, the emulsifier is selected from the group consisting of C12-C18fatty' alcohols; alkoxylated C12-C18fatty alcohols; C12-C18fatty acids; and alkoxylated C12-C18fatty acids, the alkoxylates each having 10 to 30 units of ethylene oxide, propylene oxide, and combinations of ethylene oxide / propylene oxide; C8-C22. alkyl mono- and oligoglycosides; ethoxylated sterols: partial esters of polyglycerols; esters and partial esters of polyols having 2 to 6 carbon atoms and saturated and unsaturated tatty7acids having 12 to 30 carbon atoms; partial esters of polyglycerols; and organosiloxanes; and combinations thereof.
[0098] In some embodiments of any one of the aspects described herein, the emulsifier is sodium dodecylbenzene sulfonate (SDBS), sodium dodecyl sulfate (SDS), glyceryl stearate, PEG 40 stearate, sodium lauroyl sarcosine, potassium lauroyl sarcosine, aodium coco acylsarcosinate, cocoyl flesh Propylhomoserin potassium, sodium lauroylmethyl taurate, sodium cocoyl methyl sodium taurocholate, sodium lauroyl glutamate, lauryl trimethyl ammonium chloride, stearyl trimethyl ammonium chloride, benzethonium chloride, cetyl pyridinium chloride, cetyl pyridinium chloride benzalkonium chloride, stearyl dimethyl benzyl ammonium chloride, polyoxyethylene lauryl ether sodium sulfate, sodium lauryl sulfate, sodium myristyl sulfate, sodium N-lauroyl sarcosinate, sodium N-myristol sarcosine, sodium coconut fatty acid monoglyceride monosulfate, sodium lauryl sulfoacetate, sodium a-olefin sulfonate, sodium N-palmitoyl glutamate, sodium N-methyl-N-acyl taurate, sucrose fatty acid ester, maltose fatty acid ester, maltitol fatty acid ester, lactol fatty acid ester, sorbitan fatty acid ester, polyoxyethylene sorbitan monostearate, polyoxyethylene higher alcohol ether,polyoxyethylene cured Castor oil, polyoxyethylene polyoxypropylene copolymer, polyoxyethylene polyoxypropylene fatty acid ester, polyglycerin fatty acid ester, coconut oil fatty acid amidopropyl betaine, lauryldimethylaminoacetic acid betaine, lauryldimethylamine oxide, 2-alkyl-N-carboxymethyl-N-hydroxyethylimidazolium betaine, N- lauryldiaminoethylglycine, N-myristyldiaminoethylglycine, sodium N-alkyl-1- hydroxyethylimidazoline betaine, or any combination thereof. For example, the emulsifier is SDBS.
[0099] Some more exemplary emulsifiers are ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol , benzyl benzoate, propyleneglycol, 1 ,3 -butyleneglycol, dimethylfonnamide, oils, such as cottonseed oil, groundnut oil, com germ oil, olive oil, castor oil, and sesame oil, glycerol, tctrahydrofurftiryl alcohol, polyethyleneglycols, fatty acid esters of sorbitan, or mixtures of these substances, and the like.
[0100] In some embodiments of any one of the aspects described herein , the amount of the emulsifier in the composition or antifouling coating layer is from about 0.015% to about 0.25% (w / v, w / w or v / v). For example, the amount of the emulsifier in the composition or antifouling coating layer is about 0.01%, about 0.025%, about 0.05%, about 0.075%, about 0.1%, about 0.125%, about 0.15%, about 0.175% or about 0.2% (w / v, w / w or v / v). In some embodiments of any one of the aspects described herein, the amount of the emulsifier in the composition or antifouling coating layer is about 0.1% (w / v, w / w or v / v).Proteinaceous material
[0101] Embodiments of the various aspects described herein include a proteinaceous material. As used herein, the term “proteinaceous” refers to proteins, peptides and the like. Generally, proteinaceous material includes proteins and peptides, functionalized proteins, copolymers including proteins, natural and synthetic variants of these, and mixtures of these.
[0102] In some embodiments, the proteinaceous material is a globular protein. Exemplary globular proteins include, but are not limited to, albumin, Immunoglobulin G (IgG), Immunoglobulin E (IgE), Protein A, avidins, and carbonic anhydrase.
[0103] It is noted that the proteinaceous material can be a glycosylated protein or a non- glycosylated protein.
[0104] In some embodiments of any one of the aspects described herein, the proteinaceous material is a serum albumin. For example, the proteinaceous material can beBovine Serum Albumin (BSA) or human serum albumin (HAS). In some embodiments of any one of the aspects described herein, the proteinaceous material is BSA.
[0105] In some embodiments, the proteinaceous material is denatured. As used herein,“denaturing” is the process of modifying the quaternary, tertiary and secondary molecular structure of a protein from its natural, original or native state. For example, such as by breaking weak bonds (e.g., hydrogen bonds), which are responsible for the highly ordered structure of the protein in its natural state. The process can be accomplished by, for example: physical means, such as by heating, sonication or shearing; by chemical means such as acid, alkali, inorganic salts and organic solvents (e.g., alcohols, acetone or chloroform); and by radiation. A denatured protein, such as an enzyme, losses its original biological activity. In some instances, the denaturing process is reversible, such that the protein molecular structure is regained by the re-forming of the original bonding interactions at least to the degree that the original biological function of the protein is restored. In other instances, the denaturing process is irreversible or non-reversible, such that the original and biological function of the protein is not restored. Cross-linking, for example after denaturing, can reduce or eliminate the reversibility of the denaturing process.
[0106] The degree of denaturing can be expressed as a percent of protein molecules that have been denatured, such as a mole percent. Some methods of denaturing can be more efficient than others. For example, under some conditions, sonication applied to a protein, e.g., serum albumin such as BSA or HSA can denature about 30-40% of the protein and the denaturing is reversible. When BSA is denatured, it undergoes two structural stages. The first stage is reversible whilst the second stage is irreversible (e.g., non-reversible) but does not necessarily result in a complete destruction of the ordered structure. For example, heating up to 65°C can be regarded as the first stage, with subsequent heating above that as the second stage. At higher temperatures, further transformations are seen. In some embodiments, the proteinaceous material e.g., serum album such as BSA or HAS is denatured by heating above about 65°C (e.g., above about 70°C, above about 80°C, above about 90°C, above about 100°C, above about 110°C, above about 120°C), below about 200°C (below about 190°C, 180°C, 170°C, 160°C, 150°C), and for at least about 1 minute (e.g., at least about 2, 3, 4, 5, 10 or 20 minutes) but less than about 24 hours (e.g., less than about 12, 10, 8, 6, 4, 2 1 hour). According to some implementations, any ranges herein described, for example heating at about 90°C but below about 150°C and for at least about 1 minute but less than one hour. As previously noted,the heating can include be included as a separate step to heating of the substrate and include different temperature ranges and heating times.
[0107] In some embodiments of any one of the aspects, denaturing of the proteinaceous material can occur before deposition of the mixture on a substrate surface. In some embodiments of any one of the aspects, denaturing can occur only upon deposition on the substrate surface, for example when only a heating step to heat the substrate is included. In some implementations, denaturing occurs before and after deposition, for example, where heating occurs before and after deposition of the mixture on the substrate surface.
[0108] In some embodiments the proteinaceous material used in the compositions and structures described herein are at least about 20% to about 100% (e.g., 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) denatured. In some embodiments, less than 50% of the denatured protein reverts to its natural state (e.g., less than 40%, less than 30%, less than 20%, less than 10%, less than 1%). Therefore, the reversibility of the denaturing can be described as being 50% reversible, 40% reversible (60% irreversible), 30 % reversible (70% irreversible), 20% reversible (80% irreversible), 10% reversible (90% irreversible) or even 0% reversible (100% irreversible).
[0109] In some embodiments, the proteinaceous material is irreversibly or non- reversibly denatured.
[0110] The proteinaceous material can be cross-linked with other components present in the composition (i.e., the mixture). For example, the proteinaceous material can be cross- linked with the antimicrobial agent, the conductive element, or itself. Accordingly, in some embodiments, the proteinaceous material is cross-linked with the conductive element. For example, the proteinaceous material is cross-linked to the conductive element by a cross- linking agent. In some embodiments of any one of the aspects described herein, the proteinaceous material is cross-linked to the conductive element by a cross-linking agent selected from genipin, polyethylene glycol, and glutaraldehyde. For example, the proteinaceous material is cross-linked to the conductive element by genipin.
[0111] In some embodiments, the proteinaceous material is cross-linked to itself. For example, the proteinaceous material is cross-linked to the conductive element by a cross- linking agent. In some embodiments of any one of the aspects described herein, the proteinaceous material is cross-linked to itself via a cross-linking agent selected from genipin, polyethylene glycol, and glutaraldehyde. For example, the proteinaceous material is cross- linked to itself via genipin.
[0112] The ratio of the proteinaceous material to the cross-linking agent can be from about 100:1 to about 1:1 (w / w). In some embodiments of any one of the aspects described herein, the ratio of the proteinaceous material to the cross-linker is from about 100:1 to about 10: 1 (w / w). For example, the ratio of the proteinaceous material to the cross-linker can be from about 90:1 to about 20:1, about 80:1 to about 30:1, about 70:1 to about 40:1, or about 60:1 to about 50:1 (w / w). In some embodiments, the w / w ratio of proteinaceous material to cross- linker is about 100:1, or about 95:1, or about 90:1, or about 85:1, or about 80:1, about 75:1, or about 70:1, or about 65:1, or about 60:1, about 55:1, or about 50:1, or about 45:1, or about 40:1, about 35:1, or about 30:1, or about 25:1, or about 20:1, or about 15:1, or about 10:1, or about 5:1 or about 1:1.
[0113] The ratio of proteinaceous material to the conductive element in the composition or the antifouling coating layer can be from about 10:1 to 1 :1 (w / w). For example, the w / w ratio of ratio of the proteinaceous material to the conductive element in the composition or the antifouling coating layer is about 10:1, or about 9.5:1, or about 9:1, or about 8.5:1, or about 8:1, or about 7.5:1, or about 8:1, or about 6.5:1, or about 6:1 or about 5.5:1, or about 5:1, or about 4.5:1, or about 4:1, or about 3.5:1 or about 3:1, or about 2.5:1, or about 2:1, or about 1.5:1 or about 1:1 (w / w).
[0114] The amount of the proteinaceous material in the composition or the antifouling coating layer can range from about 1 mg / ml to about 20 mg / ml. For example, the amount of the proteinaceous material in the composition or the antifouling coating layer can be about 1 mg / ml, about 1.5 mg / ml, about 2 mg / ml, about 2.5 mg / ml, about 3 mg / ml, about 3.5 mg / ml, about 4 mg / ml, about 4.5 mg / ml, about 5 mg / ml, about 5.5 mg / ml, about 6 mg / ml, about 6.5 mg / ml, about 7 mg / ml, about 7.5 mg / ml, about 8 mg / ml, about 8.5 mg / ml, about 9 mg / ml, about 9.5 mg / ml, about 10 mg / ml, about 10.5 mg / ml, about 11 mg / ml, about 11.5 mg / ml, about 12 mg / ml, about 12.5 mg / ml, about 13 mg / ml, about 13.5 mg / ml, about 14 mg / ml, about 14.5 mg / ml, about 15 mg / ml, about 15.5 mg / ml, about 16 mg / ml, about 16.5 mg / ml, about 17 mg / ml, about 17.5 mg / ml, about 18 mg / ml, about 18.5 mg / ml, about 19 mg / ml, about 19.5 mg / ml, or about 20 mg / ml. In some embodiments of any one of the aspects described herein, the amount of the proteinaceous material in the composition or the antifouling coating layer is from about 2 mg / ml to about 18 mg / ml, about 3 mg / ml to about 17 mg / ml, about 4 mg / ml to about 16 mg / ml. For example, the amount of the proteinaceous material in the composition or the antifouling coating layer is from about 5 mg / ml to about 15 mg / ml. In some embodiments,the amount of the proteinaceous material in the composition or the antifouling coating layer is from about 5 mg / ml to about 10 mg / ml.
[0115] In some embodiments, the amount of the proteinaceous material in the composition or the antifouling coating layer can range from about 0.1% to about 20% (w / v, w / w or v / v), e.g., from about 0.1% to about 10% (w / v, w / w, or v / v). For example, the amount of the proteinaceous material in the composition or the antifouling coating layer can be about 0.1%, about 0.125%, about 0.15%, about 0.175%, about 0.2%, about 0.225%, about 0.125%, about 0.275%, about 0.3%, about 0.325%, about 0.35%, about 0.375%, about 0.4%, about 0.425%, about 0.45%, about 0.475%, about 0.5%, about 0.525%, about 0.55%, about 0.575%, about 0.6%, about 0.625%, about 0.65%, about 0.675%, about 0.7%, about 0.725%, about 0.75%, about 0.775%, about 0.8%, about 0.825%, about 0.85%, about 0.875%, about 0.9%, about 0.925%, about 0.95%, about 0.975%, about 1%, about 1.125%, about 1.15%, about 1.175%, about 1.2%, about 1.225%, about 1.125%, about 1.275%, about 1.3%, about 1.325%, about 1.35%, about 1.375%, about 1.4%, about 1.425%, about 1.45%, about 1.475%, about 1.5%, about 1.525%, about 1.55%, about 1.575%, about 1.6%, about 1.625%, about 1.65%, about 1.675%, about 1.7%, about 1.725%, about 1.75%, about 1.775%, about 1.8%, about 1.825%, about 1.85%, about 1.875%, about 1.9%, about 1.925%, about 1.95%, about 1.975%, or about 2% (w / v, w / w or v / v). In some embodiments of any one of the aspects described herein, the amount of the proteinaceous material in the composition or the antifouling coating layer is from about 0.25% to about 1.75%, about 0.5% to about 1.5%, or about 0.75% to about 1.25% (w / v, w / w or v / v). For example, the amount of the proteinaceous material in the composition or the antifouling coating layer is about 1% (w / v, w / w or v / v).Conductive element
[0116] Embodiments of the various aspects described herein include a conductive element. As used herein a conductive element is a substance or substrate that has the capability to conduct electricity. The conductive element can comprise conducting and / or semi- conducting materials. Further, the conductive element can be in any desired shape or form. Far example, the conductive element can be in form of particles (e.g., nanoparticles), rods, flakes (e.g., nanoflakes), tubes (e.g., nanotubes), fibers, sheets, films, and the like. For example, the conductive element can be included in the form of a particle, a nano-particle, a micro-particle, a fiber, a nano-fiber, a micro-fiber, a flake, a nanoflake, a microflake, a tube, ananotube, a microtube, a crystal, a nanocrystal, a microcrystal, a wire, a nano-wire, a micro- wire, a rod, a nano-rod, a micro-rod, a foil, a sheet, a web, or any combinations of these forms.
[0117] The conductive element can be formed from one or more metals, e.g., copper, gold, silver, platinum, palladium, indium, iridium, rhodium, ruthenium, osmium, nickel, tin, titanium, tantalum, tungsten, chromium, iron, aluminum, zinc, combinations thereof, or alloys of any of the foregoing. In addition, or in the alternative, a nonmetallic conductive material can be used. Exemplary nonmetallic conductive materials include, but are not limited to, graphite or acetylene black, graphene, conductive ceramics such as indium tin oxide (ITO), titanium nitride, tungsten nitride, tantalum nitride, and conductive polymers such as polylhiophenes, polyanilines, polypynoles, and polyetheylenes and their mixtures and derivatives.
[0118] In some embodiments of any one of the aspects, the conductive element comprises a metal or a metalloid. For example, the conductive element comprises gold. In some embodiments of any one of (he aspects described herein, the conductive element comprises gold particles (e.g., gold nanoparticles), gold wires (e.g., gold nanowires), gold rods (e.g., gold nano-rods), or any combinations thereof.
[0119] In some embodiments of any one of the aspects described herein, the conductive element comprises a conducting carbon-based material. For example, the conductive element comprises an allotrope of carbon atoms arranged in a hexagonal lattice. The allotropes of carbon can include some functionalization, such as oxygen, carboxylates, epoxides, amines, amides and combinations of these, as described below. In some implementations, the functionalization includes poly amine functionalization such as pentaamine functionalization. In some embodiments, the conductive element comprises graphite, graphene, graphene oxide, functionalized graphene oxide, reduced graphene oxide (rGO), functionalized reduced graphene oxide, or carbon nano-tubes (CNTs).
[0120] As used herein “carbon nanotubes” and “graphene” are allotropes of carbon with sp2carbon atoms arranged in a hexagonal, honeycomb lattice. Single layer graphene is a two-dimensional material and is a single layer of graphite. As used herein, more than one layer of graphene can be referred to as graphene, for example between 1 and 200 layers (e.g., about 1 to 100 layers, about 1 to 50 layers, about 1 to 10 layers). Carbon nanotubes are hollow, cylindrical structures, formed as a sheet of graphene rolled into a cylinder.
[0121] As used herein “graphene oxide” is a material that can be formed from the oxidation of graphene or exfoliation of graphite oxide. In a first step for producing graphene oxide, graphite is oxidized. Several methods for oxidation are known, one common methodknown as the Hummers and Offeman method, in which graphite is treated with a mixture of sulphuric acid, sodium nitrate and potassium permanganate (a very strong oxidizer). Other methods are known to be more efficient, reaching levels of 70% oxidization, by using increased quantities of potassium permanganate, and adding phosphoric acid combined with the sulphuric acid, instead of adding sodium nitrate. Exfoliation of graphene oxide provides graphite oxide and can be done by several methods. Sonication can be a very time-efficient way of exfoliating graphite oxide, and it is extremely successful at exfoliating graphene (almost to levels of foil exfoliation), but it can also heavily damage the graphene flakes, reducing them in surface size from microns to nanometers, and also produces a wide variety of graphene platelet sizes. Mechanically stirring is a much less destructive approach, but can take much longer to accomplish.
[0122] Graphite oxide and graphene oxide are very similar, chemically, but structurally, they are very different. Both are compounds having carbon, oxygen and hydrogen in variable ratios. In the most oxidized state the oxygen amount can be as high as about 60 wt%. the amount of hydrogen varies depending on the functionalization, for example, the number of epoxy bridges, hydroxyl groups and carboxyl groups. The main difference between graphite oxide and graphene oxide is the interplanar spacing between the individual atomic layers of the compounds, caused by water intercalation. This increased spacing, caused by the oxidization process, also disrupts the sp2bonding network, meaning that both graphite oxide and graphene oxide are often described as electrical insulators.
[0123] Reduced graphene oxide (rGO) is prepared from reduction of graphene oxide by thermal, chemical or electrical treatments. For example, treating the graphene oxide with; hydrazine, hydrogen plasma, heating in water, high temperature heating (e.g., under nitrogen / argon) and electrochemical reduction. Whereas graphene can be a single carbon layer ideally comprising only carbon, reduced graphene oxide is similar but contains some degree of oxygen functionalization. The amount of oxygen depends on the degree of reduction and in some materials can vary between about 50 wt% and about 1 wt. % (e.g., between about 30 wt.% and about 5 wt.%).
[0124] Reduced graphene oxide can be functionalized or include functional groups. For example, reduced graphene oxide often includes oxygen in the form of carboxyl groups and hydroxyl groups. In some forms, the carboxyl and hydroxyl groups populate the edges of the rGO sheets, which can be functionalized. Accordingly, in some embodiments, the reduced graphene oxide (rGO) is carboxylated reduced graphene oxide or aminated reduced grapheneoxide. As used herein, carbonylated reduced graphene oxide can refer to reduced graphene oxide having carboxyl groups. In some embodiments the amount of oxygen attributable to the carboxyl groups is between about 30 wt.% and about 0.1 wt.% (e.g., between about 10 wt.% and about 1 wt.%). Other forms of functionalization are possible. For example, amine functionalized rGO can be formed by a modified Buchere reaction, wherein ammonia and graphene oxide are reacted using a catalyst such as sodium bisulfite, or epoxide groups on graphene oxide can be opened with p-phenylenediamine. In some embodiments, the amount of nitrogen is between about 30 wt.% and 0.1 wt.% (e.g., between about 10 wt.% and 1 wt.%). In some implementations, a polyamine is used to functionalize rGO. For example, pentaamine functionalized graphene is used in some implementations.
[0125] The tube-shaped carbon nanotubes have diameters in the nanometer scale, such as, for example, between about 0.2 and about 20 nm, preferably between about 0.5 and about 10 nm, and more preferably still between about 1 and about 5 nm. These can be single walled carbon nanotubes (SWCNT), multi walled carbon nanotubes (MWCNT) (e.g., a collection of 2 or more nested tubes of continuously increasing diameters, or mixtures of these). The diameters of MWCNT can be larger than the SWCNT, such as between about 1 and about 100 nm (e.g., between about 1 and about 50 nm, between about 10 and 20 nm, between 5 and 15 nm, between about 30 and 50 nm). Depending on how the precursor graphene sheet is rolled up to make a seamless cylinder that is the carbon nanotube, different isomers of carbon nanotube can be made, for example designated as armchair configuration, chiral configuration, and zigzag configuration. In some embodiments, the carbon nanotubes are carboxylated carbon nanotubes or aminated carbon nanotubes.
[0126] The carbon nanotubes and reduced graphene oxide can include intercalated materials, such as ions and molecules. In some embodiments the carbon nanotubes can be functionalized for example by oxidation to form carboxylic acid groups on the surface, providing CNTs. In addition, in some embodiments, the carbon nanotubes and rGO can be further modified through condensation reactions with the carboxylic acid groups present on the CNTs or rGO (e.g., with alcohols and amines), electrostatic interactions with the carboxylic acid groups (e.g., calcium mediated coupling, or quaternary amines, protonated amine- carboxylate interaction, through cationic polymers or surfactants) or hydrogen bonding through the carboxylic acid groups (e.g., with fatty acids, and other hydrogen bonding molecules). The functionalization can be partial (e.g., wherein less than 90%, less than 80%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, more than 10%,more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, of the available carboxylic acid groups are functionalized) or complete, such as functionalizing substantially all the carboxylic acids (e.g., more than 90%, more than 95%, more than 99% of available carboxylic acid groups).
[0127] In some embodiments of any one of the aspects, the conductive element comprises a conductive polymer. Exemplary conductive polymers include, but are not limited to, polyacrylonitrile (PAN), polyanilmes, polypytroles, polyacetylsnes, polyphenylene sulfide, polythiophene, polyfluorene, polypyrene, polyazulene, polynaphthalene, polycarbazole, polyindole, polyazepine, poly (3, 4-ethylenedioxylhiophene) (PEDOT), poly (p-phenylene sulfide) (EPS), poly(p~phenylens vinylene), poly(fluorenes)s, polyphenylenes, polypyrenss, polyazulenes, polynaphthalenes, polyanilines, polyazepines, polyindoles, polycarbazoles, poly(pyrrole)s, poly(thiophene)s, poly (p-phenylene vinylene) (PPV), and mixtures thereof.
[0128] The conductive element can be cross-linked with other components present in the composition (i.e., the mixture). For example, the conductive element can be cross-linked with the antimicrobial agent, the proteinaceous material, or itself. In some embodiments, the conductive element is cross-linked with another component of the mixture or by a cross-linking agent. In some embodiments of any one of the aspects described herein, the conductive element is cross-linked with another component of the mixture or to itself by a cross-linking agent by a cross-linking agent selected from genipin, polyethylene glycol, and glutaraldehyde. For example, the conductive element is cross-linked with another component of the mixture or to itself by genipin.
[0129] The ratio of the conductive element to the cross-linking agent can be from about100:1 to about 1 :1 (w / w). In some embodiments of any one of the aspects described herein, the ratio of the conductive element to the cross-linker is from about 100:1 to about 10:1 (w / w). For example, the ratio of the proteinaceous material to the cross-linker can be from about 90:1 to about 20:1, about 80:1 to about 30:1, about 70:1 to about 40:1, or about 60:1 to about 50:1 (w / w). In some embodiments, the w / w ratio of the conductive element to cross-linker is about 100:1, or about 95:1, or about 90:1, or about 85:1, or about 80:1, about 75:1, or about 70:1, or about 65:1, or about 60:1, about 55:1, or about 50:1, or about 45:1, or about 40:1, about 35:1, or about 30:1, or about 25:1, or about 20:1, or about 15:1, or about 10:1, or about 5:1 or about 1:1.
[0130] The amount of the conductive element in the composition or the antifouling coating layer can range from about 1 mg / ml to about 20 mg / ml. For example, the amount ofthe conductive element in the composition or the antifouling coating layer can be about 1 mg / ml, about 1.5 mg / ml, about 2 mg / ml, about 2.5 mg / ml, about 3 mg / ml, about 3.5 mg / ml, about 4 mg / ml, about 4.5 mg / ml, about 5 mg / ml, about 5.5 mg / ml, about 6 mg / ml, about 6.5 mg / ml, about 7 mg / ml, about 7.5 mg / ml, about 8 mg / ml, about 8.5 mg / ml, about 9 mg / ml, about 9.5 mg / ml, about 10 mg / ml, about 10.5 mg / ml, about 11 mg / ml, about 11.5 mg / ml, about 12 mg / ml, about 12.5 mg / ml, about 13 mg / ml, about 13.5 mg / ml, about 14 mg / ml, about 14.5 mg / ml, about 15 mg / ml, about 15.5 mg / ml, about 16 mg / ml, about 16.5 mg / ml, about 17 mg / ml, about 17.5 mg / ml, about 18 mg / ml, about 18.5 mg / ml, about 19 mg / ml, about 19.5 mg / ml, or about 20 mg / ml. In some embodiments of any one of the aspects described herein, the amount of the conductive element in the composition or the antifouling coating layer is from about 2 mg / ml to about 18 mg / ml, about 3 mg / ml to about 17 mg / ml, about 4 mg / ml to about 16 mg / ml. For example, the amount of the conductive element in the composition or the antifouling coating layer is from about 5 mg / ml to about 15 mg / ml. hi some embodiments, amount of the conductive element in the composition or the antifouling coating layer is from about 5 mg / ml to about 10 mg / ml.
[0131] In some embodiments, the amount of the conductive element in the composition or the antifouling coating layer can range from about 0.01 to about 20% (w / v, w / w or v / v), e.g., 0.01% to about 10% (w / v, w / w or v / v). For example, the amount of the conductive element in the composition or the antifouling coating layer can be about 0.01%, about 0.0125%, about 0.015%, about 0.0175%, about 0.02%, about 0.0225%, about 0.0125%, about 0.0275%, about 0.03%, about 0.0325%, about 0.035%, about 0.0375%, about 0.04%, about 0.0425%, about 0.045%, about 0.0475%, about 0.05%, about 0.0525%, about 0.055%, about 0.0575%, about 0.06%, about 0.0625%, about 0.065%, about 0.0675%, about 0.07%, about 0.0725%, about 0.075%, about 0.0775%, about 0.08%, about 0.0825%, about 0.085%, about 0.0875%, about 0.09%, about 0.0925%, about 0.095%, about 0.0975%, about 0.1%, about 0.125%, about 0.15%, about 0.175%, about 0.2%, about 0.225%, about 0.125%, about 0.275%, about 0.3%, about 0.325%, about 0.35%, about 0.375%, about 0.4%, about 0.425%, about 0.45%, about 0.475%, about 0.5%, about 0.525%, about 0.55%, about 0.575%, about 0.6%, about 0.625%, about 0.65%, about 0.675%, about 0.7%, about 0.725%, about 0.75%, about 0.775%, about 0.8%, about 0.825%, about 0.85%, about 0.875%, about 0.9%, about 0.925%, about 0.95%, about 0.975%, about 1%, about 1.125%, about 1.15%, about 1.175%, about 1.2%, about 1.225%, about 1.125%, about 1.275%, about 1.3%, about 1.325%, about 1.35%, about 1.375%, about 1.4%, about 1.425%, about 1.45%, about 1.475%, about 1.5%, about 1.525%, about1.55%, about 1.575%, about 1.6%, about 1.625%, about 1.65%, about 1.675%, about 1.7%, about 1.725%, about 1.75%, about 1.775%, about 1.8%, about 1.825%, about 1.85%, about 1.875%, about 1.9%, about 1.925%, about 1.95%, about 1.975%, or about 2% (w / v, w / w or v / v). In some embodiments of any one of the aspects described herein, the amount of the conductive element in the composition or the antifouling coating layer is from about 0.01% to about 2%, about 0.05% to about 1.75%, about 0.1% to about 1.5%, about 0.35% to about 1%, or about 0.25% to about 0.75% (w / v, w / w or v / v). For example, the amount of the conductive element in the composition or the antifouling coating layer is about 0.5% (w / v, w / w or v / v).Target binding molecule
[0132] In some embodiments of any one of the aspects described herein, the composition and / or the antifouling coating layer described herein further comprises a target binding molecule. As used herein, the term “target binding ligand” refers to a molecule that binds to or interacts with a target molecule. In other words, a target binding ligand is a molecule that is capable of binding with a target molecule. The targeting binding ligand can be a natural or synthetic molecule (e.g., a molecular receptor) that binds to a target molecule. Exemplary target binding ligands include, but are not limited to, a receptor, a ligand for a receptor, an antibody, an antigen binding fragment of an antibody, an antigen, an enzyme, or a nucleic acid. The target binding ligand is also referred to as a “capture agent” or “capture molecule” herein.
[0133] In some embodiments of any one of the aspects described herein, the binding of the target binding ligand to the target molecule is a specific binding such that it is selective to that target above non-targets. For example the dissociation constant between the target binding ligand and target molecule is at least about 200 nM, alternatively at least about 150 nM, alternatively at least about 100 nM, alternatively at least about 60 nM, alternatively at least about 50 nM, alternatively at least about 40 nM, alternatively at least about 30 nM, alternatively at least about 20 nM, alternatively at least about 10 nM, alternatively at least about 8 nM, alternatively at least about 6 nM, alternatively at least about 4 nM, alternatively at least about 2 nM, alternatively at least about 1 nM, or greater. In certain embodiments, the specific binding refers to binding where the target binding ligand binds to its target molecule without substantially binding to any other species in the sample / test solution.
[0134] By way of non-limiting examples, a target binding ligand can be selected from antibodies, adnectins, ankyrins, other antibody mimetics and other protein scaffolds, aptamers, nucleic acid (e.g., an RNA or DNA aptamer), protein, peptide, binding partner,oligosaccharides, polysaccharides, lipopolysaccharides, cellular metabolites, cells, viruses, subcellular particles, haptens, pharmacologically active substances, alkaloids, steroids, vitamins, amino acids, avimers, peptidomimetics, hormone receptors, cytokine receptors, synthetic receptors, sugars or molecularly imprinted polymer. The target binding ligand can be selective to a specific target or class of targets such as toxins and biomolecules. For example, the target can be ions, molecules, oligomers, polymers, proteins, peptides, nucleic acids, toxins, biological threat agents such as spore, viral, cellular and protein toxins, carbohydrates (e.g., monosaccharides, disaccharides, oligosaccharides, polyols, and polysaccharides) and combinations of these (e.g., copolymers including these).
[0135] In some embodiments of any one of the aspects described herein, the target binding ligand is an antibody or antigen binding fragment thereof. As used herein, the terms “antibody” and “antibodies” include polyclonal antibodies, monoclonal antibodies, humanized or chimeric antibodies, single chain Fv antibody fragments, Fab fragments, and F(ab)i fragments. Antibodies having specific binding affinity for a target of interest (e.g., an antigen) can be produced through standard methods. As used herein, the terms “antibody” and “antibodies” refer to intact antibody, or a binding fragment thereof that competes with the intact antibody for specific binding and includes chimeric, humanized, fully human, and bispecific antibodies. In some embodiments, binding fragments are produced by recombinant DNA techniques. In additional embodiments, binding fragments are produced by enzymatic or chemical cleavage of intact antibodies. Binding fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv, and single-chain antibodies.
[0136] In some embodiments of the various aspects described herein, the composition and / or the antifouling coating layer can comprise two different capture agents. For example, the composition and / or the antifouling coating layer can comprise a first capture agent for detecting a first target molecule by a first detection modality and a second capture agent for detecting a second target molecule by a second detection modality. For example, the first detection modality can be a nucleic acid-based detection method (e.g., CRISPR / Casl2a-based nucleic acid detection) and the second detection modality can be an ELISA based detection method. In some embodiments, the composition and / or the antifouling coating layer described herein comprises a first capture agent for detecting a first target molecule by a first detection modality; a second capture agent for detecting a second target molecule by a second detection modality; and third capture agent for detecting a third target molecule by a third detection modality.Additional components
[0137] The compositions and antifouling coating layers described herein can comprises additional components. For example, the composition or the antifouling layer can further comprise an antimicrobial agent. The term “antimicrobial agent” as used herein refers to any entity with antimicrobial activity, i.e. the ability to inhibit or reduce the growth and / or kill a microbe, e.g., by at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 90% or more, as compared to in the absence of an antimicrobial agent.
[0138] In some embodiments, the anti-microbial agent is an anti-bacterial agent, antifungal agent, or an anti-viral agent.
[0139] In some embodiments, an antimicrobial agent included in the composition can be an antibiotic. As used herein, the term “antibiotic” is art recognized and includes antimicrobial agents naturally produced by microorganisms such as bacteria (including Bacillus species), actinomycetes (including Streptomyces) or fungi that inhibit growth of or destroy other microbes, or genetically engineered thereof and isolated from such natural source. Substances of similar structure and mode of action can be synthesized chemically, or natural compounds can be modified to produce semi-synthetic antibiotics. Exemplary classes of antibiotics include, but are not limited to, (1) 0-lactams, including the penicillins, cephalosporins monobactams, methicillin, and carbapenems; (2) aminoglycosides, e.g., gentamicin, kanamycin, neomycin, tobramycin, netilmycin, paromomycin, and amikacin; (3) tetracyclines, e.g., doxycycline, minocycline, oxytetracycline, tetracycline, and demeclocycline; (4) sulfonamides (e.g., mafenide, sulfacetamide, sulfadiazine and sulfasalazine) and trimethoprim; (5) quinolones, e.g., ciprofloxacin, norfloxacin, and ofloxacin; (6) glycopeptides (e.g., vancomycin, telavancin, teicoplanin); (7) macrolides, which include for example, erythromycin, azithromycin, and clarithromycin; (8) carbapenems (e.g., ertapenem, doripenem, meropenem, and imipenem); (9) cephalosporins (e.g., cefadroxil, ceftriaxone, cefepime, and ceftobiprole); (10) lincosamides (e.g., clindamycin, and lincomycin); (11) monobactams (e.g., aztreonam); (12) nitrofurans (e.g., furazolidone, and nitrofurantoin); (13) Penicillins (e.g., amoxicillin, and Penicillin G); (14) polypeptides (e.g., bacitracin, colistin, and polymyxin B); and (15) other antibiotics, e.g., ansamycins, polymycins, carbacephem, chloramphenicol, lipopeptide, and drugs against mycobacteria (e.g., the ones causing diseases in mammals, including tuberculosis (Mycobacterium tuberculosis) and leprosy (Mycobacterium leprae), and any combinations thereof. Additional exemplaryantimicrobial agent can include, but are not limited to, antibacterial agents, antifungal agents, antiprotozoal agents, antiviral agents, and any mixtures thereof.
[0140] In some embodiments of any one of the aspects described herein the anti- microbial agent is an anti-bacterial agent. Exemplary antibacterial agents include, but are not limited to, Acrosoxacin, Amifioxacin, Amoxycillin, Ampicillin, Aspoxicillin, Azidocillin, Azithromycin, Aztreonam, Balofloxacin, Benzylpenicillin, Biapenem, Brodimoprim, Cefaclor, Cefadroxil, Cefatrizine, Cefcapene, Cefdinir, Cefetamet, Cefmetazole, Cefprozil, Cefroxadine, Ceftibuten, Cefuroxime, Cephalexin, Cephalonium, Cephaloridine, Cephamandole, Cephazolin,Cephradine, Chlorquinaldol, Chlortetracycline, Ciclacillin, Cinoxacin, Ciprofloxacin, Clarithromycin, Clavulanic Acid, Clindamycin, Clofazimine, Cioxacillin, Danofloxacin, Dapsone, Demeclocycline, Dicloxacillin, Difloxacin, Doxycycline, Enoxacin, Enrofloxacin, Erythromycin, Fleroxacin, Flomoxef, Flucioxacillin, Flumequine, Fosfomycin, Isoniazid, Levofloxacin, Mandelic Acid, Mecillinam, Metronidazole, Minocycline, Mupirocin, Nadifloxacin, Nalidixic Acid, Nifuirtoinol, Nitrofurantoin, Nitroxoline, Norfloxacin, Ofloxacin, Oxytetracycline, Panipenem, Pefloxacin, Phenoxymethylpenicillin, Pipemidic Acid, Piromidic Acid, Pivampicillin, Pivmecillinam, Prulifloxacin, Rufloxacin, Sparfloxacin, Sulbactam, Sulfabenzamide, Sulfacytine, Sulfametopyrazine, Sulphacetamide, Sulphadiazine, Sulphadimidine, Sulphamethizole, Sulphamethoxazole, Sulphanilamide, Sulphasomidine, Sulphathiazole, Temafioxacin, Tetracycline, Tetroxoprim, Tinidazole, Tosufloxacin, Trimethoprim, and phramceutically acceptable salts or esters thereof.
[0141] In some embodiments of any one of the aspects described herein, the anti- bacterial agent is selected from the group consisting of macrolides or ketolides such as erythromycin, azithromycin, clarithromycin, and telithromycin; beta-lactams including penicillin, cephalosporin, and carbapenems such as carbapenem, imipenem, and meropenem; monolactams such as penicillin G, penicillin V, methicillin, oxacillin, cioxacillin, dicloxacillin, nafcillin, ampicillin, amoxicillin, carbenicillin, ticarcillin, meziocillin, piperacillin, azlocillin, temocillin, cepalothin, cephapirin, cephradine, cephaloridine, cefazolin, cefamandole, cefuroxime, cephalexin, cefprozil, cefaclor, loracarbef, cefoxitin, cefmetazole, cefotaxime, ceftizoxime, cefiriaxone, cefoperazone, ceftazidime, cefixime, cefpodoxime, ceftibuten, cefdinir, cefpirome, cefepime, cefadroxil, ceftriaxone, ceftobiprole and astreonam; quinolones such as nalidixic acid, oxolinic acid, norfloxacin, pefloxacin, enoxacin, ofloxacin, levofloxacin, ciprofloxacin, temafioxacin, lomefloxacin, fleroxacin, grepafloxacin, sparfloxacin, trovafloxacin, clinafloxacin, gatifloxacin, moxifloxacin, sitafloxacin,ganefloxacin, gemifloxacin and pazufloxacin; antibacterial sulfonamides and antibacterial sulphanilamides, including para-aminobenzoic acid, sulfadiazine, sulfisoxazole, sulfamethoxazole and sulfathalidine; aminoglycosides such as streptomycin, neomvcin, kanamycin, paromycin, gentamicin, tobramycin, amikacin, netilmicin, spectinomycin, sisomicin, dibekalin and isepamicin; tetracyclines such as tetracycline, chlortetracycline, demeclocycline, minocycline, oxytetracycline, methacycline, doxycycline; rifamycins such as rifampicin (also called rifampin), rifapentine, rifabutin, bezoxazinorifamycin and rifaximin; lincosamides such as lincomycin and clindamycin; glycopeptides such as vancomycin and teicoplanin; streptogramins such as quinupristin and daflopristin; oxazolidinones such as linezolid; polymyxin, colistin and colymycin; trimethoprim, bacitracin, and phosphonomycin. In some preferred embodiments, the antibacterial agent is gentamicin, ampicillin, vancomycin, ceftriaxone or cefepime.
[0142] In some embodiments of any one of the aspects described herein the anti- microbial agent is an antifungal agent. Exemplary antifungal agents include, but are not limited to, Bifonazole, Butoconazole, Chlordantoin, Chlorphenesin, Ciclopirox Olamine, Clotrimazole, Eberconazole, Econazole, Fluconazole, Flutrimazole, Isoconazole, Itraconazole, Ketoconazole, Miconazole, Nifuroxime, Tioconazole, Terconazole, Undecenoic Acid, and pharmaceutically acceptable salts or esters thereof. In some embodiments of any one of the aspects described herien, the antifungal agent is selected from the group consisting of azoles (e.g., barleyconazole, butoconazole, clortrimazole, econazole, fluconazole, isavuconazole, itraconazole, ketoconazole, miconazole, oxyconazole, posaconazole, ravuconazole, saperconazole, sulconazole, tercocnazole, tioconazole, voriconazole, and ciclopirox), polyenes (e.g., natamycin, lucensomycin, nystatin, amphotericin B, etc.), echinocandins (e.g., Cancidas), pradimicins (e.g., beanomicins, nikkomycins, sordarins, allylamines, etc.), Triclosan, Piroctone, fenpropimorph, terbinafine, cyclopyroxolamine, flucitocin, griseofulvin haloprozin, tolnaftate, naphthypine, hydrochloride, morpholine, butenapin, undecylenic acid, propionic acid, and derivatives and analogs thereof.
[0143] In some embodiments of any one of the aspects described herein, the anti- microbial agent is an antiprotozoal agent. Exemplary antiprotozoal agents include, but are not limited to, Acetarsol, Azanidazole, Chloroquine, Metronidazole, Nifuratel, Nimorazole, Omidazole, Propenidazole, Secnidazole, Sineflngin, Tenonitrozole, Temidazole, Tinidazole, and pharmaceutically acceptable salts or esters thereof.
[0144] In some embodiments of any one of the aspects described herein, the anti- microbial agent is an antiviral agent. Exemplary antiviral agents include, but are not limited to, Acyclovir, Brivudine, Cidofovir, Curcumin, Desciclovir, 1 -Docosanol, Edoxudine, Fameyclovir, Fiacitabine, Ibacitabine, Imiquimod, Lamivudine, Penciclovir, Valacyclovir, Valganciclovir, and pharmaceutically acceptable salts or esters thereof.
[0145] An antimicrobial agent can be, for example, but not limited to, a small molecule, a peptide, a peptidomimetics, an antibody or a fragment thereof, a nucleic acid, an enzyme (e.g., an antimicrobial metalloendopeptidase such as lysostaphin), an aptamer, a drug, an antibiotic, a chemical or any entity that can inhibit the growth and / or kill a microbe. In some embodiments of the any one of the aspects described herein, the anti-microbial agent is an antimicrobial peptide or polymer. Examples of antimicrobial peptides include, but are not limited to, mefloquine, venturicidin A, antimycin, myxothiazol, stigmatellin, diuron, iodoacetamide, potassium tellurite hydrate, aDL-vinylglycine, N-ethylmaleimide, L- allyglycine, diaryquinoline, betaine aldehyde chloride, acivcin, psicofuraine, buthionine sulfoximine, diaminopemelic acid, 4-phospho-D-erythronhydroxamic acid, motexafin gadolinium, xycitrin, cathelicidins, defensms, protegrins, mastoparan, poneratoxin, cecropin, moricin, melittin, magainin, dennaseptin, and / or nisin, or modified versions or analogues thereof.
[0146] In some embodiments, the anti-microbial agent is a metal particle. Exemplary metal particles can include silver, titanium oxide, or copper present in any form, e.g., a nanoparticle, a colloid, a suspension, powder, and any combinations thereof. In some embodiments of any one of the aspects described herein the anti-microbial agent is titanium oxide, copper, or silver nanoparticles.
[0147] It is noted that compositions and antifouling layers described herein can comprise two or more different antimicrobial agents. Accordingly, in some embodiments of any one of the aspects described herein, the composition or antifouling layer described herein comprises more than one (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more) different anti-microbial agents. The different anti- microbial agents can be for the same indication, e.g., anti-bacterial, or for different indications, e.g., one anti-microbial agent in the mixture is an anti-bacterial agent and another anti- microbial agent in the mixture is an antifungal agent.
[0148] The anti-microbial agent can comprise a functional group for cross-linking. Exemplary functional groups amenable to cross-linking include, but are not limited to, amino,hydroxyl, alkoxy, carbonyl, carboxyl, silyl, silyloxy, hydrocarbyl, sulfhydryl, cycloalkyl, aryl, thio, mercapto, imino, halo, cyano, nitro, azido, sulfoxy, phosphoryl, oxy, quinone, catechol, and the like. In some embodiments of any one of the aspects described herein, the anti- microbial agent comprises at least one amino (NH2) group.
[0149] In some embodiments of any one of the aspects described herein, the anti- microbial agent is covalently linked to the proteinaceous material or the conductive element. For example, the anti-microbial agent is linked to the proteinaceous material or the conductive element via a linker or cross-linker. In some embodiments of any one of the aspects described herein, the anti-microbial agent is covalently linked to the proteinaceous material via a cross- linking agent such as genipin, polyethylene glycol (PEG), or glutaraldehyde. In some preferred embodiments, the anti-microbial agent is covalently linked to the proteinaceous material via genipin.
[0150] In some embodiments of any one of the aspects described herein, the anti- microbial agent is covalently linked to the conductive element via a cross-linking agent such as genipin, polyethylene glycol (PEG), or glutaraldehyde. In some preferred embodiments, the anti-microbial agent is covalently linked to the conductive element via genipin
[0151] The ratio of the anti-microbial agent to the cross-linking agent can be from about100:1 to about 1 :1 (w / w). In some embodiments of any one of the aspects described herein, the ratio of the anti-microbial agent to the cross-linker is from about 100 : 1 to about 10:1 (w / w). For example, the ratio of the anti-microbial agent to the cross-linker can be from about 90:1 to about 20:1 w / w, about 80:1 to about 30:1 w / w, about 70:1 to about 40:1 w / w, or about 60:1 to about 50:1 w / w. In some embodiments, the w / w ratio of anti-microbial agent to cross-linker is about 100:1, or about 95:1, or about 90:1, or about 85:1, or about 80:1, about 75:1, or about 70: 1, or about 65: 1 , or about 60: 1 , about 55: 1 , or about 50: 1 , or about 45: 1 , or about 40: 1 , about 35:1, or about 30:1, or about 25:1, or about 20:1, about 15:1, or about 10:1.
[0152] Similarly, the ratio of the anti-microbial agent to the proteinaceous material in the composition or the antifouling coating layer can be from about 30:1 to about 1 :1 (w / w). In some embodiments of any one of the aspects described herein, the ratio of the anti-microbial agent to the proteinaceous material in the composition or the antifouling coating layer is from about 25:1 to about 2:1 w / w, about 20:1 to about 3:1 w / w, about 15:1 to about 4:1 w / w, or about 10:1 to about 5:1 w / w. In some embodiments, the w / w ratio of anti-microbial agent to proteinaceous material in the composition or the antifouling coating layer is about 30:1, or about 29.5:1, or about 29:1, or about 28.5:1, or about 28:1, or about 27.5:1, or about 27:1, orabout 26.5:1, or about 26:1, or about 25.5:1, or about 25:1, or about 24.5:1, or about 24:1, or about 23.5:1, or about 23:1, or about 22.5:1, or about 22:1, or about 21.5:1, or about 21 :1, or about 20.5:1, or about 20:1, or about 19.5:1, or about 19:1, or about 18.5:1, or about 18:1, or about 17.5:1, or about 17:1, or about 16.5:1, or about 16:1, or about 15.5:1, or about 15:1, or about 14.5:1, or about 14:1, or about 13.5:1, or about 13:1, or about 12.5:1, or about 12:1, or about 11.5:1, or about 11:1, or about 10.5:1, or about 10:1, or about 9.5:1, or about 9:1, or about 8.5:1, or about 8:1, or about 7.5:1, or about 7:1, or about 6.5:1, or about 2.5:1, or about 2:1, or about 1.5:1, or about 1:1.
[0153] The ratio of the anti-microbial agent to the conductive element in the composition or the antifouling coating layer can be from about 20:1 to 1 :1 (w / w). In some embodiments of any one of the aspects described herein, the ratio of the anti-microbial agent to the conductive element in the composition or the antifouling coating layer is from about 20: 1 to about 5:1. For example, the ratio of the anti-microbial agent to the conductive element in the composition or the antifouling coating layer can be from about 15:1 to 5:1 w / w, 12.5:1 to 3:1 w / w, or 5:1 to 4:1 w / w. In some embodiments, the w / w ratio of anti-microbial agent to the conductive element in the composition or the antifouling coating layer is about 20:1, or about 19.5:1, or about 19:1, or about 18.5:1, or about 18:1, or about 17.5:1, or about 17:1, or about16.5:1, or about 16:1, or about 15.5:1, or about 15:1, or about 14.5:1, or about 14:1, or about13.5:1, or about 13:1, or about 12.5:1, or about 12:1, or about 11.5:1, or about 11 :1, or about10.5:1, or about 10:1, or about 9.5:1, or about 9:1, or about 8.5:1, or about 8:1, or about 7.5:1, or about 7:1, or about 6.5:1, or about 6:1, or about 5.5:1, or about 5:1
[0154] The amount of the antimicrobial agent in the composition or the antifouling coating layer can range from about 1 μg / μL to about 100 μg / μL. For example, the amount of the antimicrobial agent in the composition or the antifouling coating layer can be about 1 μg / μL, about 5 μg / μL, about 10 μg / μL, about 15 μg / μL, about 20 μg / μL, about 25 μg / μL, about 30 μg / μL, about 35 μg / μL, about 40 μg / μL, about 45 μg / μL, about 50 μg / μL, about 55 μg / μL, about 60 μg / μL, about 65 μg / μL, about 70 μg / μL, about 75 μg / μL, about 80 μg / μL, about 85 μg / μL, about 90 μg / μL, about 95 μg / μL, or about 100 μg / μL. In some embodiments, the amount of the antimicrobial agent in the composition or the antifouling coating layer can range from about 1 μg / μL to about 50 μg / μL. For example, the amount of the antimicrobial agent in the composition or the antifouling coating layer can range from about 1 μg / μL to about 50 μg / μL, from about 5 μg / μL to about 25 μg / μL, or from about 10 μg / μL to about 20 μg / μL.
[0155] The amount of the antimicrobial agent in the composition or the antifouling coating layer can range from about 0.1% to about 10% (w / v, w / w, or w / v). For example, the amount of the antimicrobial agent in the composition or the antifouling coating layer can be from about 0.15% to about 5%, from about 0.25% to about 2.5%, from about 0.5% to about 2%, or from about 0.75% to about 1.5% (w / v, w / w, or v / v). In some embodiments, amount of the antimicrobial agent in the composition or the antifouling coating layer is about 0.1% about 0.15%, about 0.2%, about 0.25%, about 0.3%, about 0.35%, about 0.4%, about 0.45%, about 0.5%, about 0.55%, about 0.6%, about 0.65%, about 0.7%, about 0.75%, about 0.8%, about 0.85%, about 0.9%, about 0.95%, about 1% about 1.15%, about 1.2%, about 1.25%, about 1.3%, about 1.35%, about 1.4%, about 1.45%, about 1.5%, about 1.55%, about 1.6%, about 1.65%, about 1.7%, about 1.75%, about 1.8%, about 1.85%, about 1.9%, about 1.95%, or about 2% (w / v, w / w or v / v).
[0156] In some embodiments, the composition or the antifouling coating layer further comprises one or more polymers. Exemplary polymers include, but are not limited to, polyethylene glycol (PEG), alginate, polytetrafluoroethylene (PTFE), polyacetylene (PA), polyaniline (PANI), polypyrrole (PPy), polythiophene (PTH), poly(para-phenylene) (PPP), poly(phenylenevinylene) (PPV), and polyfuran (PF). In another example, in some implementations, the polymer is a natural polymer such as cellulose, natural silk, cotton, or natural rubbers. In some implementations, the polymer is a synthetic polymer, such as nylon, epoxies, polyethylene (e.g. HDPE and LDPE), polypropylene, polybutadiene, polyethylene terephthalate (PET), polycarbonate, polyurethane, fluorinated polymers (e.g. TEFLON®), polystyrene (e.g. Styrofoam), sulfonated polystyrene, aramide (e.g. KEVLAR®), poly acrylonitrile, poly vinyl acetate, poly vinyl chloride (PVC), poly methyl methacrylate (PMMA), Polyhydroxyethyhnethacrylate (PolyHEMA), poly ethers, poly lactic acid, and copolymers and blends of these. In some implementations, the polymer is an ionic polymer, such as a cationic or anionic polymer. In some embodiments, the mixture comprises a polymer selected from the group consisting of polyethylene glycol (PEG), alginate, polytetrafluoroethylene (PTFE), polyacetylene (PA), polyaniline (PANI), polypyrrole (PPy), polythiophene (PTH), poly(para-phenylene) (PPP), poly(phenylenevinylene) (PPV), and polyfuran (PF).
[0157] In some embodiments, the composition or the antifouling coating layer further comprises a drug eluting component. For example, the composition or the antifouling coating layer further comprises a therapeutic in addition to the anti-microbial agent. Exemplarytherapeutic agents include, but are not limited to, anti-inflammatory agents, anti-cancer agents, anti-proliferatives, anti-migratory agents, antifibrotic agents, proapoptotics, anti-neoplastics, immuno-suppressants, and hormones.
[0158] hi some embodiments, the therapeutic agent is an anti-inflammatory agent. As used herein the term “anti-inflammatory agent” refers to a compound (including its analogs, derivatives, prodrugs and pharmaceutically salts) which can be used to treat inflammation or an inflammation related disease or disorder. Exemplary anti-inflammatory agents include, but are not limited to, the known steroidal anti-inflammatory and non-steroidal anti-inflammatory drugs (NSAIDs). Exemplary steroidal anti-inflammatory agents include but are not limited to 21 -acetoxypregnenolone, alclometasone, algestone, amcinonide, beclomethasone, betamethasone, budesonide, chloroprednisone, clobetasol, clobetansone, clocortolone, cloprednol, corticosterone, cortisone, cortivazol, deflazacort, desonide, desoximetasone, dexamethasone, diflorasone, diflucortolone, difluprednate, enoxolone, fluazacort, flucloronide, flumethasone flunisolide, fluocinolone acetonide, fluocinonide, fluocortin butyl, fluocortolone, fluoromethoIone, fluperolone acetate, fluprednidene acetate, fluprednisolone, flurandrenolide, fluticasone propionate, formocortal, halcinonide, halobetasol propionate, halometasone, halopredone acetate, hydrocortamate, hydrocortisone, loteprednol etabonate, mazipredone, medrysone, meprednisone, methylprednisolone, mometasone furcate, paramethosone, prednicarbate, prednisolone, prednisolone 25-diethylamino-acetate, prednisolone sodium phosphate, prednisone, prednival, prednylidene, rimexolone, tixocortol, triamcinolone, triamcinolone acetonide, triamcinolone benetonide, triamcinolone hexacetonide, and analogues and derivatives thereof. Exemplary nonsteroidal anti-inflammatory agents include but are not limited to COX inhibitors (COX-1 or COX nonspecific inhibitors) and selective COX-2 inhibitors. Exemplary COX inhibitors include but are not limited to salicylic acid derivatives such as aspirin, sodium salicylate, choline magnesium trisalicylate, salicylate, diflunisal, sulfasalazine and olsalazine; para-aminophenol derivatives such as acetaminophen; indole and indene acetic acids such as indomethacin and sulindac; heteroaryl acetic acids such as tolmetin, dicofenac and ketorolac; arylpropionic acids such as ibuprofen, naproxen, flurbiprofen, ketoprofen, fenoprofen and oxaprozin; anthranilic acids (fenamates) such as mefenamic acid and meloxicam; enolic acids such as the oxicams (piroxicam, meloxicam); alkanones such as nabumetone; and analogues and derivatives thereof. Exemplary COX-2 inhibitors include but are not limited to diarylsubstituted furanones such as refecoxib; diaryl- substituted pyrazoles such as celecoxib; indole acetic acids such as etodolac and sulfonanilidessuch as nimesulide; and analogues and derivatives thereof. Additional anti-inflammatory agents include, but are not limited to sirolimus, everolimus, biolimus (A9), zotarolimus (ABT- 578), tacrolimus, pimecrolimus, and genistein.
[0159] In some embodiments, the composition or the antifouling coating layer has antimicrobial activity.Cross-linker
[0160] The components of the composition or the antifouling coating layer, e.g., the proteinaceous material, the conductive element, and if present, the target binding molecule and the anti-microbial agent can be cross-linked to each other or to themselves. As used herein, the term “cross-linked” is intended to refer to two or more molecules covalently bonded together. Cross-linking can be intermolecular, i.e., between different components / molecules, or intramolecular, e.g., between the same component / molecule. Further, covalent bonding between two cross-linkable components / molecules can be direct, in which case an atom in one component / molecule is directly bound to an atom in the other component / molecule, or it can be indirect, through a linking group / agent. The term “cross-linkable” refers to a component or molecule that is capable of undergoing reaction to form a cross-linked composition.
[0161] Accordingly, in some embodiments, the composition and / or the antifouling coating layer described herein includes a cross-linking agent or cross-linker. The terms “cross- linking agent”, “cross-linker”, and the like are used interchangeably herein and refer to a compound or molecule that can create a covalent linkage between two cross-linkable components / molecules. Generally, a cross-linking agent contains at least two reactive functional groups that generate eovalent bonds between two or more molecules. Cross-linking agents can be homobifunctional (i.e., having two identical reactive ends) or heterobiftnctional (i.e., having two different reactive ends). Suitable cross-linking agents include, but are not limited to, genipin; polyethylene glycol (PEG); glutaraldehyde; nordihydroguaiaretic acid (NDGA); 3,4-dihydroxyphenylalanine; 1,2-benzenediol; 2,3-dihydroxynaphthaiene; 1,3- benzenediol; adrenalone; catechin; nitrocatechol; 3,4-dihydroxybenzaldehyde; 3,4- dihydroxybenzoic acid: deoxyepinephrine; dobutamine; dopamine; dopexamine; epinephrine; nordefrin: 3-pentadecylcatechol; carbodlimides (e.g., l-ethyl-3- (3-dlmethylaminopropyl) carbodiimide hydrochloride (EDC)); formaldehyde; tannic acid; isocyanates; epichlorohydrin; oxalic acid; malonic acid; succinic acid; glutaric acid; adipic acid; pimelic acid; fumaric acid; maleic acid; malic acid; tartrate: bisepoxides; divinyl sulfone and derivatives (e.g., divinylsulfone (DVS)); butanediol diglycidyl ether (BDDE); dimethyl adipimidate (DMA), dimethyl suberimidate (DMS), Bissulfosuccinimidyl suberate, formaldehyde, p-azidobenzoyl hydrazide; n-5-azido-2-nitrobenzoyloxysuccinimide; n-[4-(p-azidosalicylamido)butyl]-3'-(2'- pyridyldithio) propionamide; p-azidophenyl glyoxal monohydrate; bis [b-(4- azidosalicylamido)ethyl]disulfide; bis [2-(succinimidooxycarbonyloxy)ethyl] sulfone; 1,4-di [3'-(2'-pyridyldithio)propionamido] butane; dithiobis(succinimidyl propionate); disuccinimidyl suberate; disuccinimidyl tartrate; 3,3'-dithiobis(sulfosuccinimidyl propionate); 3,3'-dithiobis(sulfosuccinimidyl propionate) l-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride; ethyleneglycol bis(succinimidyl succinate); N-(E-maleimidocaproic acid hydrazide); [N-(E-maleimidocaproyloxy)-succinimide ester]; N- maleimidobutyryloxysuccinimide ester; hydroxylamine.HCl; maleimide-PEG-succinimidyl carboxy methyl; m-maleimidobenzoyl-N-hydroxysuccinimide Ester; N-hydroxysuccinimidyl- 4-azidosalicylic acid; N-(p-maleimidophenyl isocyanate); N-succinimidyl(4-iodoacetyl) aminobenzoate; succinimidyl-4-(N-maleimidomethyl)cyclohexane- 1 -carboxylate; succinimidyl 4-(p-maleimidophenyl) butyrate; sulfo-disulfosuccinimidyl tartrate; [N-(E- maleimidocaproyloxy)-sulfo succinimide ester; N-Maleimidobutyryloxysulfosuccinimide ester; N-hydroxysulfosuccinimidyl-4-azidobenzoate; m-Maleimidobenzoyl-N-hydroxysulfo succinimide ester; sulfosuccinimidyl (4-azidophenyl)-l,3 dithio propionate; sulfosuccinimidyl 2-(m-azido-o-nitrobenzamido)-ethyl-l,3'-dithio propionate; sulfosuccinimidyl 6-(4'-azido-2'- nitrophenylamino) hexanoate; sulfosuccinimidyl-2-(p-azidosalicylamido)ethyl-l ,3- dithiopropionate; N-(Sulfosuccinimidyl(4-iodoacetyl) amino benzoate); sulfosuccinimidyl-4- (N-maleimidomethyl)cyclohexane- 1 -carboxylate; sulfosuccinimidyl 4-(p-maleimidophenyl) butyrate; poly (ethylene glycol) diglycidyl ether (PEGDE); poly (propylene glycol) diglycidyl ether (PPGDE); and the like. In some embodiments of any one of the aspects described herein, the cross-linking agent is genipin, polyethylene glycol (PEG), or glutaraldehyde. In some preferred embodiments of any one of the aspects described herein the cross-linking agent is genipin.Antifouling surface
[0162] Without wishing to be bound by a theory, the composition, i.e., the composition described herein has antifouling properties. As used herein, the term “antifouling” refers to the effect of preventing, reducing and / or eliminating fouling, i.e., preventing, reducing and / or eliminating the aggregation of molecules such as biomolecules on a surface such that thesurface maintains its initial physical and / or chemical properties (e.g. conductivity). Thus, in some embodiments, the composition is antifouling. The composition can be coated on a surface to impart antifouling properties to the surface. Accordingly, in another aspect provided herein is a surface with antifouling properties. For example, the surface with the antifouling properties comprises a composition described herein.
[0163] In the context of this specification, the term “coated” means that a layer of is present on a surface. For example, a layer of antifouling layer on a surface or a layer of probe on the antifouling layer. The amount of the probe used to coat the antifouling layer can vary with a number of factors such as surface area, coating density, types of probe, and binding performance.
[0164] Without wishing to be bound by a theory, the composition described herein is biocompatible. The term “biocompatible” refers to a material's ability to perform its intended function, with a desired degree of incorporation in a host, without eliciting any undesirable local or systemic effects in that host. Accordingly, in some embodiments, the coated surface is a surface of a medical device. As used herein, a “medical device” refers to a non-naturally occurring object that is inserted or implanted in a subject or applied to a surface of a subject. Exemplary medical devices include, but are not limited to, fibers (wound dressings, bandages, gauze, tape, pads, sponges, including woven and non-woven sponges and those designed specifically for dental or ophthalmic surgeries), surgical, medical or dental instruments, blood oxygenators, ventilators, pumps, drug delivery devices, tubing, wiring, electrodes, contraceptive devices, feminine hygiene products, endoscopes, grafts (including small diameter <6 mm), stents (including coronary, uretheral, renal, biliary, colorectal, esophageal, pulmonary, urethral, and vascular), stent grafts (including abdominal, thoracic, and peripheral vascular), pacemakers, implantable cardioverter-defibrillators, cardiac resynchronization therapy devices, cardiovascular device leads, ventricular assist devices and drivelines, heart valves, vena cava filters, endovascular coils, catheters (including central venous, peripheral central, midline, peripheral, tunneled, dialysis access, urinary, neurological, peritoneal, intra- aortic balloon pump, angioplasty balloon, diagnostic, interventional, drug delivery, etc.), catheter connectors and valves (including needleless connectors), intravenous delivery lines and manifolds, shunts, wound drains (internal or external including ventricular, ventriculoperitoneal, and lumboperitoneal), dialysis membranes, infusion ports, cochlear implants, endotracheal tubes, tracheostomy tubes, ventilator breathing tubes and circuits, guide wires, fluid collection bags, drug delivery bags and tubing, implantable sensors (e.g.,intravascular, transdermal, intracranial), ophthalmic devices including contact lenses, orthopedic devices (including hip implants, knee implants, shoulder implants, spinal implants (including cervical plates systems, pedicle screw systems, interbody fusion devices, artificial disks, and other motion preservation devices), screws, plates, rivets, rods, intramedullary nails, bone cements, artificial tendons, and other prosthetics or fracture repair devices), dental implants, periodontal implants, breast implants, penile implants, maxillofacial implants, cosmetic implants, valves, appliances, scaffolding, suturing material, needles, hernia repair meshes, tension-free vaginal tape and vaginal slings, prosthetic neurological devices, tissue regeneration or cell culture devices, or other medical devices used within or in contact with the body or any portion of any of these.
[0165] In some embodiments, the antifouling coating layer is directly or indirectly connected to an electrode.Electrode
[0166] In another aspect, provided herein is an electrode comprising a conductive substrate and an antifouling coating layer on at least a portion of a surface of the conductive substrate, wherein the antifouling coating layer comprises a composition described herein.
[0167] As used herein an “electrode” is a conductor through which current enters or leaves a medium, where the medium is nonmetallic (i.e., it emits or collects electrons or electron “holes”). For example, the medium can be a complex matrix (e.g., blood or serum). The electrode can be inserted into / onto a tissue such as mammalian tissue and be contacted with tissue and / or fluids therein / thereon. The electrode can be large (e.g., with a working surface area of greater than 1 cm2, greater than 10 cm2, greater than 100 cm2) or the electrode can be small (e.g., with a working surface area of less than 1 cm2, less than 1mm2, less than 100 μm2, less than 10 μm2, less than 1 μm2). The working surface area is the area in contact with the medium and wherein current enters or leaves the medium.
[0168] The conductive substrate can be in any form having a surface that can be coated. For example, the conductive substrate can be included in the form of a conductive particle, a conductive nano-particle, a conductive micro-particle, a conductive nano-fiber, a conductive micro-fiber, a conductive flake, a conductive chip, a conductive crystal, a conductive porous substrate, a conductive wafer, a conductive wire, a conductive nano-wire, a conductive micro- wire, a conductive channel, a conductive nano-channel, a conductive micro-channel, a conductive rod, a conductive nano-rod, a conductive micro-rod, a conductive foil, a conductivesheet, a conductive web, or combination of these forms. In some implementations, the conductive substrate is part of a microfluidic device, such as a channel or chamber therein.
[0169] Metal patterning techniques, such as standard printed circuit board (PCB) technology, offer a number of versatile fabrication options such as (i) track size and spacing less than 100 μm; (ii) high purity electrolytic gold plating several microns thick suitable for electrochemistry and surface modification chemistries; (iii) ease of small-scale prototyping in standard laboratory settings; and (iv) large scale mass manufacturing capabilities at a fraction of the cost of high-end microarrays. In some embodiments, electrodes as disclosed herein may be fabricated using PCB technology.
[0170] In some embodiments, the electrodes are mass fabricated onto non-electrically conductive surfaces such as plastic substrates using inexpensive standard technology such as printed circuit board (PCB) technology, roll-to-roll laser ablation or evaporation. Exemplary non-electrically conductive surfaces include plastic, poly(carbonate) (PC), poly(methyl methacrylate) (PMMA), cyclic olefin polymers (COP) or cyclic olefin copolymers (COC), SU- 8, parylene, silicon nitride, kapton, styrene-ethylene-butylene-styrene (SEBS), poly- dimethysiloxane (PDMS), polyimide, silicon dioxide, and any combination thereof .
[0171] In some embodiments, the electrode is a planar or a 3-dimensional electrode. As used herein, a planar electrode electrically interacts with an electroactive species or mediator on a 2-dimensional surface. As used herein, a 3-dimensional electrode is an electrode displaying a very high surface area per unit volume, caused by no planarity. Without being bound by theory, this provides high turbulence at their interface with an electroactive species or mediator, enhancing the mass transfer process of the electroactive species towards the electrode surface. These characteristics strongly improve the electrochemical reaction rate.
[0172] In some embodiments the electrode is “Multiplexed” such that it is configured for a multiplexed assay. As used herein a “multiplexed” assay can be used to simultaneously measure multiple analytes or signals such as two or more (e.g., 3 or more, 5 or more, 10 or more, 50 or more, 100 or more, 1000 or more) during a single run or cycle of the assay. The electrode can therefore be configured as an array of electrodes, microelectrodes or electrochemical sensors each of which can be independently electrically attached to a circuit for monitoring the electrical signals. For example, the array of electrodes can be disposed at the bottom, sides or top of a multiwell plate (e.g., microwell plate) arrayed on a flat surface such as a semiconductor chip (e.g., a sensor array chip) or form part of a multielectrode array (e.g., for connection of neurons to electronic circuitry). In some embodiments, thecompositions as described herein, can coat more than one sensor since the coating will not conduct between the sensors due to the anisotropy of the conduction, therefore an array of conductors, sensors or electrodes can be coated forming a multiplexed electrode.
[0173] Electrodes can include materials with metallic conduction and semiconductors. For example, electrodes can include metals, metal alloys, semiconductors, doped materials, conducting ceramics and conducting polymers. Without limitation, electrode materials can include carbon (e.g., graphite, glassy carbon, conductive polymers), copper, titanium, brass, mercury, silver, platinum, palladium, gold, rhodium, zinc, lead, tin, iron, Indium Tin Oxide (ITO), aluminum, stainless steel, tungsten, nickel, zirconium, niobium, tantalum, chromium, molybdenum, manganese, rhenium, ruthenium, rhodium, iridium, silicon, doped silicon, II- VI semiconductors (e.g., ZnO, ZnS, CdSe), III-V semiconductors such as (e,g., GaAs, InSb), ceramics (e.g., TiO2, Fe3O4, MgCr2O4), and conductive polymers (e.g., poly(acetylene)s, poly(p-phenylene vinylene), poly(fluorenes)s, polyphenylenes, polypyrenes, polyazulenes, polynaphthalenes, polyanilines, polyazepines, polyindoles, polycarbazoles, poly(pyrrole)s, poly(thiophene)s, poly(3,4-ethylenedioxythiophene)), polyimide, parylene, benzocyclobutene, and combinations, mixtures and alloys of these.
[0174] In some embodiments, the conductive substrate includes a metal, a metalloid, a conducting polymer, a conducting glassy material, a conducting amorphous material, a conducting biological membrane, a conducting carbon-based material, or any combination of these.
[0175] In some embodiments, the conductive substrate includes gold. In some embodiments, the conductive substrate includes a silica-based glass (e.g., pure silica or mixtures such as borosilicate glass). In some embodiments, the conductive substrate includes graphite, diamond, glassy carbon, or carbon nanotubes (CNTs). In some implementations, the conductive substrate is a chip including gold and a silica-based glass.
[0176] In some embodiments of any one of the aspects described herein, the conductive substrate is a flexible substrate. For example, the conductive substrate comprises a flexible material. Exemplary materials for the flexible substrate include, but are not limited to, polyethylene terephthalate, polyethylene naphathalate, polyimides, polymeric hydrocarbons, celluloses, plastics, polycarbonates, polystyrenes, and any combination thereof.
[0177] Electrodes can also include insulating components such as insulators for electrical and mechanical protection, imparting rigidity and electrical isolation to parts of the electrode.
[0178] In some embodiments, the electrode can be part of an electrochemical cell. For example, the electrode is a working electrode and the electrochemical cell can include a counter electrode and reference electrode.
[0179] Electrochemical methods are methods that rely on a change in the potential, charge or current to characterize the analyte’s chemical reactivity. Some examples include potentiometry, controlled current coulometry, controlled-potential coulometry, amperometry, stripping voltammetry, hydrodynamic voltammetry, polarography, stationary electrode voltammetry, pulsed polarography, electrochemical impedance spectroscopy and cyclic voltammetry. The signals are detected using an electrode or electrochemical sensors coupled to circuits and systems for collection, manipulation and analysis of the signals.
[0180] In some embodiments, the antifouling coating layer of the electrode is adapted for contact with an analyte or a sample comprising an analyte. The antifouling coating can allow analyte to flow through the pores and be detected, for example, by binding to a capture molecule such as an antibody, DNA strand, or aptamer. In some implementations, the coatings can be patterned as a conductive wire or a dielectric / insulating surface. Some implementations include coating microfluidic chips, lab-on-a-chip, and organs on a chip. In some implementations, the coatings can be used in nano-gap and micro-gap devices. For example, these devices include nano-gap electrodes, nanostructured-based electrical biosensors, and nano-gap dielectric biosensor for label free DNA hybridization detection. The coatings can be applied, for example, to the gap between electrodes in the device and thereby protect the surfaces of the gap from fouling. In some implementations, the coating is a cross-linked and porous gel, and the gap is completely or mostly filled in. Analyte can flow through the pores and be detected, for example, by binding to a capture molecule such as an antibody, DNA strand, or aptamer.Antifouling coating layer
[0181] Embodiments of the various aspects described herein include an antifouling coating layer. Generally, the antifouling coating layer is porous. For example, the antifouling coating layer comprises macropores.
[0182] As used herein, the term “macropore” means pores whose aperture, width or diameter is greater than 100 nm. In some embodiments of any one of the aspects described herein, macropores have an aperture, width or diameter from about 0.1 μm to about 10 μm. For example, macropores have an aperture, width or diameter from about 0.25 μm to about 7.5μm. fiom about 0.5 μm to about 5 μm, from about 0.75 μm to about 2.5 μm, or from about 1 μm to about 3 μm. Im some embodiments of any one of the aspects described herein, macropores have an aperture, width or diameter of about 0.1 μm, about 0, 15 μm, about 0.2 μm, about 0.25 μm, about 0.3 μm, about 0.35 μm, about 0.4 μm, about 0.45 μm, about 0.5 μm, about 0.55 μm, about 0.6 μm, about 0.65 μm, about 0.7 μm, about 0.75 μm, about 0.8 μm, about 0.85 μm, about 0.9 μm, about 0.95 μm, about 1 μm, about 1.05 μm, about 1 .1 μm, about 1.15 μm, about 1.2 μm, about 1.25 μm, about 1,3 μm, about 1.35 μm, about 1.4 μm, about 1.45 μm, about 1.5 μm, about 1.55 μm, about 1.6 μm, about 1.65 μm, about 1.7 μm, about 1.75 μm, about 1.8 μm, about 1.85 μm, about 1.9 μm, about 1.95 μm, about 2 μm, about 2.05 μm, about 2.1 μm, about 2.15 μm, about 2.2 μm, about 2.25 μm, about 2.3 μm, about 2.35 μm. about 2.4 μm, about 2.45 μm, about 2.5 μm, about 2.55 μm, about 2.6 μm, about 2.65 μm, about 2.7 μm, about 2.75 μm, about 2.8 μm, about 2.85 μm, about 2.9 μm, about 2.95 μm, about 3 μm, about 3.05 μm, about 3.1 μm, about 3.15 μm, about 3.2 μm, about 3.25 μm, about 3.3 μm, about 3.35 μm, about 3.4 μm, about 3,45 μm, about 3.5 μm, about 3.55 μm, about 3.6 μm, about 3.65 μm, about 3.7 μm, about 3.75 μm, about 3.8 μm, about 3.85 μm, about 3.9 μm, about 3.95 μm, about 4 μm, about 4.05 μm, about 4.1 μm, about 4.15 μm, about 4.2 μm, about 4.25 μm, about 4.3 μm, about 4.35 μm, about 4.4 μm, about 4.45 μm, about 4,5 μm, about 4.55 μm, about 4.6 μm, about 4.65 μm, about 4.7 μm, about 4.75 μm, about 4,8 μm, about 4.85 μm, about 4.9 μm, about 4.95 gm, or about 5 μm.
[0183] In some embodiments of any one of the aspects described herein, the macropores have a diameter of from about 0.25 μm to about 0.75 μm. For example, the macropores have a diameter of from about 0.3 μm to about 0.65 μm. In some embodiments, the macropores have a diameter from about 0.325 μm to about 0.625 μm.
[0184] In some embodiments of any one of the aspects described herein, the antifouling coating layer comprises mesopores. As used herein, the term “mesopores” means pores whose aperture, width or diameter is between about 5 nm and about 99 nm. In some embodiments of any one of the aspects described herein, mesopores have an aperture, width or diameter from about 5 nm to about 50 nm. For example, mesopores have an aperture, width or diameter of about 5 nm, about 5.5 nm, about 6 nm, about 6.5 nm, about 7 nm, about 7.5 nm, about 8 nm, about 8.5 nm, about 9 nm, about 9.5 nm, about 10 nm, about 10.5 nm, about 1 1 urn, about 11 .5 nm, about 12 nm, about 12.5 nm, about 13 nm, about 13.5 nm, about 14 nm, about 14.5 nm, about 15 nm, about 15.5 nm, about 16 nm, about 16.5 nm, about 17 nm, about 17.5 nm, about 18 nm, about 18.5 am, about 19 nm, about 19.5 nm. about 20 nm, about 20.5 nm, about 21 nm,about 21.5 nm, about 22 nm, about 22.5 nm, about 23 mu, about 23.5 nm, about 24 nm, about24.5 urn, about 25 nm, about 25.5 nm, about 26 nm, about 26.5 run. about 27 mi. about 27.5 nm, about 28 nm, about 28.5 nm, about 29 nm, about 29.5 nm, about 30 nm, about 30.5 nm, about 31 nm, about 31.5 nm, about 32 am, about 32.5 nm, about 33 nm, about 33.5 nm, about 34 nm, about 34.5 tun, about 35 nm, about 35.5 nm, about 36 nm, about 36.5 nm, about 37 nm, about 37.5 nm, about 38 nm, about 38.5 nm, about 39 nm, about 39.5 nm, about 40 nm, about40.5 nm, about 41 nm, about 41.5 nm, about 42 nm, about 42.5 nm, about 43 nm, about 43.5 nm, about 44 nm, about 44.5 nm, about 45 nm, about 45.5 nm, about 46 nm, about 46.5 nm, about 47 nm, about 47.5 nm, about 48 nm, about 48.5 nm, about 49 nm, about 49.5 nm, or about 50 nm. Tn some embodiments of any one of the aspects described herein, the mesopores have an aperture, width or diameter from about 5 nm to about 20 mu. For example, the mesopores have an aperture, width or diameter from about 10 am to about 15 nm.
[0185] In some embodiments of any one of the aspects described herein, the antifouling coating layer comprises macropores and mesopores. For example, the antifouling coating layer comprises macropores having an aperture, width or diameter from about 0.1 μm to about 10 μm, and mesopores having an aperture, width or diameter from about 5 nm to about 50 nm. In some embodiments of any one of the aspects described herein, the antifouling coating layer comprises macropores having an aperture, width or diameter from about 1 μm to about 5 μm, and mesopores having an aperture, width or diameter from about 10 nm to about 15 nm.
[0186] In some embodiments of any one of the aspects described herein, the antifouling coating layer comprises nanopores. As used herein, the term “nanopores” means pores whose aperture, width or diameter is less than about 5 nm, typically strictly greater than 0 and less than about 5 nm.
[0187] In some embodiments of any one of the aspects described herein, the antifouling coating layer comprises macropores and nanopores.
[0188] In some embodiments of any one of the aspects described herein, the antifouling coating layer comprises macropores, mesopores and nanopores.
[0189] The antifouling coating layer is porous. As used herein, the term “porous” in the context antifouling coating layer means the antifouling coating layer comprises a plurality of spores, holes, openings, bores, apertures, spaces, perforations, or intervals. While the term porous indicates the presence of voids, it does not specify the specific size of the spores, holes, openings, bores, apertures, spaces, perforations, or intervals. The term “porosity” is widelyunderstood as the ratio of void volume to total volume of a three-dimensional porous body, where the total volume is determined by the macroscopic outer dimensions of the body. Porosity can be indicated as a traction between 0-1 or as a percentage between 0-100%. Porosity can be measure by instruments in the art, such as a porometer. Porosity is inversely proportional to density of the material. Thus, the porosity also can be determined by measuring the density of the coating layer. In some embodiments of any one of the aspects described herein, the porosity can be determined by mercury porosimetry analysis. In some embodiments, mercury porosimetry analysis corresponds to the intrusion of a volume of mercury characteristic of the existence of pores in the antifouling coating layer according to the ASTM D4284-83 standard.
[0190] Generally, the antifouling coating layer has a porosity from about 5% to about 95%. For example, the antifouling coating layer has a porosity from about 10% to about 75%>, about 15% to about 70%, about 20% to about 65%, about 25% to about 60%, or about 30%> to about 55%. In some embodiments of any one of the aspects described herein, the antifouling coating layer has a porosity from about 35% to about 45%. It is noted porosity can be controlled by altering the ratio of non-aqueous phase to the aqueous phase and / or using different types of materials for the non-aqueous and / or aqueous phases.
[0191] The antifouling coating layer can have a thickness greater than about 0.1 μm. In some embodiments, the antifouling coating layer has a thickness from about 0.25 μm to about 100 μm, from about 0.5 μm to about 75 μm, from about 0.75 μm to about 50 μm, or from about 1 μm to about 25 μm. In some embodiments of any one of the aspects described herein, the antifouling coating layer has a thickness from about 0.1 μm to about 100 μm, from about 2 μm to about 75 μm, from about 3 μm to about 50 μm, from about 4 μm to about 25 μm, or from about 5 μm to about 10 μm. For example, the antifouling coating layer has a thickness from about 0.1 μm to about 10 μm. In some embodiments of any one of the aspects described herein, the antifouling coating layer has a thickness of about 0.1 μm, about 0.125 μm, about 0.15 μm, about 0.175 μm, about 2 μm, about 0.225 μm, about 0.25 μm, about 0.275 μm, about 3 μm, about 0.325 μm, about 0.35 μm, about 0.375 μm, about 4 μm, about 0.425 μm, about 0.45 μm, about 0.475 μm, about 5 μm, about 0.525 μm, about 0.55 μm, about 0.575 μm, about 6 μm, about 0.625 μm, about 0.65 μm, about 0.675 μm, about 7 μm, about 0.725 μm, about 0.75 μm, about 0.775 μm, about 8 μm, about 0.825 μm, about 0.85 μm, about 0.875 μm, about 9 μm, about 0.925 μm, about 0.95 μm, about 0.975 μm, about 1 μm, about 1.25 μm, about 1.5 μm, about 1.75 μm, about 2 μm, about 2.25 μm, about 2.5 μm, about 2.75 μm, about 3 μm,about 3.25 pin, about 3.5 μm, about 3.75 μm, about 4 μm, about 4.25 μm, about4.5 μm, about4.75 μm, about 5 μm, about 5.25 μm, about 5.5 μm, about 5.75 μm, about 6 μm, about 6.25 μm, about 6.5 μm, about 6.75 μm, about 7 μm, about 7.25 μm, about 7.5 μm, about 7.75 μm, about 8 μm, about 8.25 μm, about 8.5 μm, about 8.75 μm, about 9 μm, about 9.25 μm, about9.5 μm, about 9.75 μm, about 10 μm, about 10.25 μm, about 10.5 μm, about 10.75 μm, about 11 μm, about 11.25 μm, about 11.5 μm, about 11.75 μm, about 12 μm, about 12.25 μm, about12.5 μm, about 12.75 μm, about 13 μm, about 13.25 μm, about 13.5 μm, about 13.75 μm, about 14 μm, about 14.25 μm, about 14.5 μm, about 14.75 μm, about 15 μm, about 15.25 μm, about15.5 μm, about 15.75 μm, about 16 μm, about 16.25 μm, about 16.5 μm, about 16.75 μm, about 17 μm, about 17.25 μm, about 17.5 μm, about 17.75 μm, about 18 μm, about 18.25 μm, about 18.5 μm, about 18.75 μm, about 19 μm, about 19.25 μm, about 19.5 μm, about 19.75 μm, about 20 μm, about 10.25 μm, about 10.5 μm, about 10.75 μm, about 21 μm, about 21.25 μm, about 21.5 μm, about 21.75 μm, about 22 μm, about 22.25 μm, about 22.5 μm, about 22.75 μm, about 23 μm, about 23.25 μm, about 23.5 μm, about 23.75 μm, about 24 μm, about 24.25 μm, about 24.5 μm, about 24.75 μm, about 25 μm, about 25.25 μm, about 25.5 μm, about25.75 μm, about 26 μm, about 26.25 μm, about 26.5 μm, about 26.75 μm, about 27 μm, about 27.25 μm, about 27.5 μm, about 27.75 μm, about 28 μm, about 28.25 μm, about 28.5 μm, about 28.75 μm, about 29 μm, about 29.25 μm, about 29.5 μm, about 29.75 μm, about 30 μm, about 30.25 μm, about 30.5 μm, about 30.75 μm, about 31 μm, about 31.35 μm, about 31.5 μm, about 31.75 μm, about 32 μm, about 32.35 μm, about 32.5 μm, about 32.75 μm, about 33 μm, about 33.35 μm, about 33.5 μm, about 33.75 μm, about 34 μm, about 34.35 μm, about34.5 μm, about 34.75 μm, about 35 μm, about 35.35 μm, about 35.5 μm, about 35.75 μm, about 36 μm, about 36.35 μm, about 36.5 μm, about 36.75 μm, about 37 μm, about 37.35 μm, about 37.5 μm, about 37.75 μm, about 38 μm, about 38.35 μm, about 38.5 μm, about 38.75 μm, about 39 μm, about 39.35 μm, about 39.5 μm, about 39.75 μm, about 40 μm, about 40.35 μm, about 40.5 μm, about 40.75 μm, about 41 μm, about 41.45 μm, about 41.5 μm, about41.75 μm, about 42 μm, about 42.45 μm, about 42.5 μm, about 42.75 μm, about 43 μm, about 43.45 μm, about 43.5 μm, about 43.75 μm, about 44 μm, about 44.45 μm, about 44.5 μm, about 44.75 μm, about 45 μm, about 45.45 μm, about 45.5 μm, about 45.75 μm, about 46 μm, about 46.45 μm, about 46.5 μm, about 46.75 μm, about 47 μm, about 47.45 μm, about 47.5 μm, about 47.75 μm, about 48 μm, about 48.45 μm, about 48.5 μm, about 48.75 μm, about 49 μm, about 49.45 μm, about 49.5 μm, about 49.75 μm, or about 50 μm. The thickness of antifouling layer can also have a thickness from 100 μm to 500 μm via printing techniquessuch as screen printing, inkjet printing, and layer-by-layer coating. Residue can be removed by washing with solvent or blowing, which makes films have good uniformity.
[0192] Without wishing to be bound by a theory, higher thickness (> 100 um) can be achieved by screen printing and layer-by-layer coating. Screen printing utilizes the mesh-type mask to coat film, which is good for higher thicknesses. In layer-by-layer coating, the coatings are combined sequentially, in which the residues can be removed between successive coating steps by washing with a solvent.
[0193] The size and morphology (e.g., pore diameter, porosity, thickness, etc.) of the coating layer can be characterized by techniques including, but not limited to, dynamic light scattering, coulter counter, microscopy, sieve analysis, dynamic image analysis, static image analysis, and laser diffraction.Methods for preparing the antifouling coating layer
[0194] In another aspect provided herein is a method for preparing a surface with an antifouling coating layer. The method comprises coating at least a part of a surface with a composition described herein and removing, at least a part of, the non-aqueous phase, thereby forming an antifouling coating layer on the surface.
[0195] The composition described herein can be coated on the surface by any suitable technique known in the art. Exemplary method coating methods include, but are not limited to, spin coating, nozzle-assisted printing (e.g., inkjet printing), drop-casting, blade coating, 3D printing, zone-casting, roll coating, roll-to-roll (R2R) coating, spray coating, dip coating, die coating, slot die coating, roll coating, comma coating gravure coating, bar coating, vapor coating, knife coating, or combinations thereof.
[0196] In some embodiments, the surface is coated by spin-coating. Spin coating is a surface coating method in which the coating material, e.g., a composition described herein is deposited on the surface to be coated. The surface is attached to a spinner, which causes the spinner to rotate the surface at a controlled speed, thereby spreading the coating material onto the surface and weting the surface entirely with the coating material. Generally, the surface to be coated is spun at from about 250 rpm to about 5000 rpm. For example, the surface to be coated is spun at from about 500 rpm to about 4000 rpm, from about 1000 rpm to about 3000 rpm, from about 750 rpm to about 2500 rpm or from about 1000 rpm to about 2000 rpm. Inventors have discovered inter alia spinning the surface at about 1500 rpm unexpectedly provides a highly uniform coating layer. Accordingly, in some embodiments of any one of theaspects described herein, the surface to be coated is spun at from about 1250 rpm to about 1750 rpm. In some preferred embodiments, the surface to be coated is spun at about 1500 rpm
[0197] In some embodiments of any one of the aspects described herein, the surface is coated by nozzle-assisted printing (e.g., inkjet printing). Nozzle-assisted printing is a surface coating method in which ink jet technology is used to deposit coating materials on surfaces. Generally, the coating material is injected under pressure (e.g., from about 5 kPa to about 20 kPa). The printing speed can be adjusted us needed to make a uniform coating layer on the surface. For example, the printing speed can be from about 5 mm / s to about 20 mm / s. The temperature of printer bed can be an elevated temperature, e.g., a temperature of about 37°C or higher. In some embodiments, the temperature of the printer bed can be from about 37°C to about 70°C, from about 40°C to about 60°C, or from about 45°C to about 55°C. In some embodiments, the temperature of the printer bed is about 50°C.
[0198] In some embodiments of any one of the aspects described herein, the surface is coated by dip coating. Dip coating is a surface coating method in which the surface to be treated is immersed and then withdrawn from the coating material, e.g., a composition described herein at a defined rate. The dip coating process can be, generally, separated into 3 stages: (i) immersion: the surface is immersed in the solution of the coating material at a constant speed; (ii) dwell time: the surface remains fully immersed and motionless to allow for the coating material to apply itself to the surface; and (Hi) withdrawal: the surface is withdrawn, again at a constant speed. The faster the substrate is withdrawn the thicker the coating material that will be applied to the surface.
[0199] Methods for removing the non-aqueous phase are well known and available to one of skill in the art. For example, the non-aqueous phase can be removed by evaporation or a rapid drying process like air knife, antisolvent-based crystallization, laser based drying, roll to roll printing, and the like. The removal process of the non-aqueous phase can be conducted using two methods: (i) the non-aqueous phase can be evaporated after the aqueous phase is fully evaporated or (ii) the non-aqueous phase and the aqueous phase can be simultaneously evaporated.
[0200] In some embodiments, the non-aqueous phase comprises a degradable polymer. It is noted that the composition can also be mixed with other polymers to create porous 3D matrix, such as dissolvable polymers. Integration of dissolving polymers can also be utilized to increase the porosity of the antifouling layer (e.g., polymers that dissolve in water (saltcrystals); other can be removed by degradation (e.g., proteins or protein aggregates); temperature dependent removal (e.g., poly(N-isopropyl acrylamide) (PNIPAAm)).
[0201] The coating layer can be washed prior to removing the non-aqueous phase.
[0202] In some embodiments, the method for preparing a surface with an antifouling coating layer further comprises a step of cross-linking the proteinaceous material. As used herein, the term “crosslinking” refers to the formation of a bond between the same molecule (e.g., the same proteinaceous material molecule) or between different molecules (e.g., between one molecule of the proteinaceous material and another molecule of the proteinaceous material, or between the proteinaceous material and the conductive element). Exemplary cross-linking methods include, but are not limited to, chemical reactions, irradiation, application of heat, dehydrothemal treatment, enzymatic treatment, and the like. In some embodiments, the cross- linking is via a cross-linking agent. Exemplary cross-linking agents are described herein. In some embodiments, the step of cross-linking the proteinaceous material is prior to the step of removing the non-aqueous phase. Tn some other embodiments, the step of cross-linking the proteinaceous material is after the step of removing the non-aqueous phase.
[0203] In some embodiments of any one of the aspects described herein, the method for preparing a surface with an antifouling coating layer further comprises a step of adding a target binding molecule to the antifouling coating layer. For example, the method comprises a step of coating a surface of the antifouling coating layer with a target binding molecule. In some embodiments, the step of adding the target binding molecule to the antifouling coating layer comprises conjugating, e.g., covalently linking the target binding molecule to a component of the antifouling coating layer. For example, the step of adding the target binding molecule to the antifouling coating layer comprises conjugating, e.g., covalently Unking the target binding molecule with the proteinaceous material in the antifouling coating layer. It is noted that the target binding molecule can be present in the composition prior to the step of coating the surface.
[0204] The step of adding the target binding molecule to the antifouling coating layer can be carried out prior to or after the step of removing the non-aqueous phase. Accordingly, in some embodiments, the step of adding the target binding molecule to the antifouling coating layer is prior to the step of removing the non-aqueous phase. In some other embodiments, the step of adding the target binding molecule to the antifouling coating layer is after the step of removing the non-aqueous phase.
[0205] Further, if the proteinaceous material is cross-linked, the step of adding the target binding molecule to the antifouling coating layer can be carried out prior to or after the cross-linking step. Accordingly, in some embodiments, the step of adding the target binding molecule to the antifouling coating layer is prior to the step of cross-linking the proteinaceous material. In some other embodiments, the step of adding the target binding molecule to the antifouling coating layer is after the step of cross-linking the proteinaceous material.
[0206] Embodiments of the various aspects described herein include denatured proteinaceous material. Accordingly, in some embodiments of the method for preparing a surface with an antifouling coating layer, the method comprises a step of denaturing the proteinaceous material. It is noted the proteinaceous material can be denatured prior to the step of coating the surface (i.e., the composition comprises a denatured proteinaceous material), after the step of coating the surface but prior to the step of removing the non-aqueous phase, or after the step of removing the non-aqueous phase. Further, if the method comprises a step of adding a target binding molecule to the coating, the proteinaceous material can be denatured prior to or after adding the target binding molecule. Preferably, the proteinaceous material is denatured prior to adding the target binding molecule.
[0207] In some embodiments of the method for preparing a surface with an antifouling coating layer, the method comprises preparing the composition, e.g., emulsion. Methods for preparing emulsions are well known and available to one of skill in the art. Generally, a method for forming an emulsion comprises adding together the non-aqueous phase and the aqueous phase and mixing the two phases together to form droplets of one phase in the other. Exemplary methods for mixing the two phases include, but are not limited to, tip sonication, stirring, vortexing, and microfluidics.
[0208] The surface to be coated can be any surface. For example, the surface to be coated can be a surface of a conductive substrate, such as an electrically conductive substrate. In some embodiments, the antifouling coating layer is directly or indirectly connected with an electrode. For example, the surface to be coated is a surface, e.g., a conductive surface of an electrode. In some embodiments of any one of the aspects described herein, the surface to be coated is a surface of a medical device.Analyte detection
[0209] The electrode described herein can be used for detecting analytes, e.g., in a sample. Accordingly, another aspect provided herein relates to methods of detecting at leastone target analyte, including, e.g., at least 2, 3, 4, 5, 6, 7, 8 target analytes or more. Generally, the method comprises contacting a sample suspected of comprising a target analyte with an electrode or described herein and detecting the binding of the target analyte with the target binding ligand. The binding may be detected electrochemically.
[0210] In some embodiments, the method of detecting a target analyte comprises contacting a sample suspected of comprising a target analyte with an electrode described herein and detecting the binding of the target analyte with the target binding ligand. Optionally, detecting the binding of the target molecule with the target binding ligand comprises applying a voltage to the electrode and measuring the current generated from the electrode.
[0211] The applied voltage provides a sufficiently strong electric field to liberate H+from H2O2, but not strong enough to cause electrolysis of water, as electrolysis of water may lead to a decrease in the signal-to-noise ratio (i.e. below - 1.23 V). Typically, the voltage applied is between about 0 V and -2 V, e.g. about -I V. In some embodiments, low voltages can be used including 250 to 500 mV to 300-400 mV. The voltage range can then be -0.25 to -2V or -0.25 to -0.1 V.
[0212] In some embodiments, the target of the target binding molecule can be redox active (e.g., an electroactive analyte) and is directly detected by an electrode. For example, the target binding molecule facilitates detection of the target analyte by the electrode due to it concentrating the analyte near or at the surface of the electrode where it can be detected directly by electrochemical means.
[0213] In some embodiments, the binding of the target analyte to the target binding molecule is detected indirectly by electrochemical means. For example, the target can be detected by binding with a detection agent that catalyzes, directly or indirectly, a redox reaction close to an electrode surface. For example, the target analyte can be contacted with a labeling probe, e.g., a second target binding molecule, wherein the labeling probe comprises a detectable label. Generally, the labeling probe comprises a target binding molecule capable of binding with the target analyte. For example, the labeling probe is a target binding molecule described herein. In some embodiments, the labeling probe is an antibody, antigen binding fragment of an antibody, an antigen, a receptor, a ligand for a receptor, an enzyme, or a nucleic acid.
[0214] In some embodiments, the target analyte is a nucleic acid, e.g., an RNA, and the target analyte is detected using a nucleic acid-based detection modality, e.g., a CRISPR / Cas- based (e.g., CRISPR / Casl2a-based) nucleic acid detection approach. For example, the targetbinding ligand comprises a nucleic acid strand comprising a detectable label. In the presence of a target nucleic acid, the Cas enzyme become activated and cleaves the target binding agent, i.e., the nucleic acid strand comprising the detectable label, and the presence of detectable label is detected. Exemplary nucleic acid-based detection methods include, but are not limited to, DNA endonuclease-targeted CRISPR trans reporter (DETECTR) and specific high-sensitivity enzymatic reporter unlocking (SHERLOCK). CRISPR / Cas-based nucleic acid detection methods are described, for example, in US Pat. Pub. US20200254443, US20220154258, US20230127948, US20230203567, and US20220403451, and PCT Pub. W02022060939, contents of all which are incorporated herein by reference in their entireties.
[0215] Accordingly, in some embodiments, the target analyte is a nucleic acid, e.g., RNA, and the method for detecting comprises: (i) contacting a sample suspected of comprising the target analyte nucleic acid, e.g., RNA with an electrode described herein, wherein the target binding ligand is a nucleic acid comprising a detectable label; (ii) contacting the electrode with an endonuclease (e.g., a CRSIPR / Cas such as CRISPR / Casl2), where the endonuclease is capable of cleaving the nucleic acid comprising the detectable label in presence of the target nucleic acid; and (iii) detecting presence of detectable label remaining bound to the nucleic acid comprising the detectable label.
[0216] As used herein, the term “detectable label” refers to a molecule or composition capable of producing a detectable signal indicative of the presence of a target. Exemplary detectable labels include but are not limited to an enzyme, a fluorophore, a chemiluminescent label, colloidal gold, colored glass or plastic (e.g., polystyrene, polypropylene, and latex) beads, a radiolabel, a quantum dot, or any combination thereof.
[0217] In some embodiments, the labeling probe contacts the target analyte prior to contacting the sample with the electrode or. In some other embodiments, the labeling probe contacts the target analyte after contacting the sample with the electrode or. In some embodiments of any one of the aspects described herein, the detectable label deposits a sacrificial redox active molecule on the electrode surface (e.g., on a coating that is on the surface of the electrode) that then is detected electrochemically.
[0218] In some embodiments of any one of the aspects described herein, the detectable label comprises an enzyme. Non-limiting examples of enzymes include: a peroxidase, alkaline phosphatase, malate dehydrogenase, staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase (HRP), alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-VI-phosphate dehydrogenase, glucoamylase, tyrosinase, acetylcholinesterase, or any combination thereof. In some preferred embodiments, the enzyme is a peroxidase or alkaline phosphatase.
[0219] When the detectable label comprises an enzyme, the method can further comprise contacting the enzyme with a substrate of the enzyme. Exemplary reporter enzyme substrates include, but are not limited to, hydrogen peroxide, carbamide peroxide, nucleotides, oligonucleotides, RNA, DNA, phosphorylated peptides, phosphorylated proteins, phosphorylated small molecules, glucose, phenols, tyrosine, dopamine, catechol, urea, and any combination thereof.
[0220] In some embodiments, the reporter enzyme substrate is hydrogen peroxide. In some embodiments the target analyte can be redox active, and the enzyme is directly responsible for generation of a charge carrier that is detected by an electrode. For example, the binding of the target analyte to the second target binding molecule facilitates generation of the charge carrier near the antifouling layer surface, the conducting antifouling layer conducts the charge carrier, and this impacts the applied voltage and / or current resulting in detection of the target analyte.
[0221] The charge carrier can be any one or more of the following charge carrier types: anions, cations or electrons. In some embodiments, the charge carriers are cations, e.g., hydrogen ions such as protons).
[0222] In some embodiments, the substrate of the enzyme can be redox active, and the enzyme is directly responsible for generation of a charge carrier that is detected by an electrode. For example, the enzyme facilitates generation of the charge carrier near the antifouling layer surface, the conducting antifouling layer conducts the charge carrier, and this impacts the applied voltage and / or current resulting in detection of the target analyte.
[0223] In some embodiments, the enzyme is a redox catalyst and, in the presence of the substrate for said enzyme, the substrate for the reported enzyme is oxidized or reduced, thereby generating a charge carrier. Non-limiting examples of redox active molecules that can be oxidized or reduced and can be substrates to a redox catalyst include, 3, 3', 5,5'- tetramethylbenzidine (TMB), o-phenylenediamine dihydrochloride (OPD), 2,2'-Azinobis [3- ethylbenzothiazoline-6-sulfonic acid] (ABTS), p-Nitrophenyl Phosphate (PNPP), 3,3'- diaminobenzidine (DAB), 4-chloro-l -naphthol (4-CN), 5-bromo-4-chloro-3-indolyl- phosphate (BCIP), nitro blue tetrazolium (NBT), methylene blue, hydroquinone, ferrocene derivatives, and any combination thereof.
[0224] In some embodiments of any one of the aspects, the binding of the target analyte to the target binding molecule can be detected using the methods described in US Patent No. 10 / 753,940, content of which is incorporated herein by reference in its entirety. For example, where the detectable label comprises an enzyme, the method comprises contacting the labeling probe, e.g., labeling probe bound to the target analyte with a reporter erszyme substrate, an electroactive mediator and, optionally, a precipitating agent. It is noted the reporter enzyme substrate, the electroactive mediator and, optionally, the precipitating agent can be contacted with the labeling probe simultaneously or serially. In some embodiments, the reporter enzyme substrate, the electroactive mediator and, optionally, the precipitating agent are contacted simultaneously with the labeling probe, Without wishing to be bound by a reaction the reporter enzyme substrate, the electroactive mediator and, optionally, the precipitating agent with the enzyme conjugated with the label probe forms an electroactive precipitate which is locally deposited near or at the surface of the electrode.
[0225] Exemplary electroactive mediators include, but are not limited to, 3, 3', 5,5’- tetramethylbenzidine (TMB), o-phenylenediamine dihydrochloride (OPD), 2,2'-Azinobis [3- ethylbenzothiazoline-S-sulfenic acid] (ABTS), p~Nitrophenyl Phosphate (PNPP), 3,3'~ diaminobenzidine (DAB), 4-chloro-l -naphthol (4-CN), 5-bromo-4-chloro-3-indolyl- phosphate (BCIP), nitro blue tetrazolium (NBT), methylene blue, hydroquinone, ferrocene derivatives, and any combination thereof. In some embodiments, the electroactive mediator is TMB.
[0226] Exemplary precipitating agents include, but are not limited to, a water-soluble polymer, a pyrrolidinone polymer, a polyaniline, a polypyrrole, a polythiophene, alginic acid, methyl vinyl ether / maleic anhydride copolymer, dextran sulfate, carrageenan, and any combination thereof. In some embodiments, the precipitating agent is a pyrrolidinone polymer.
[0227] In some embodiments of any one of the aspects described herein, the reporter enzyme substrate, the electroactive mediator and, optionally, the precipitating agent are comprised in a composition for contacting with the labeling probe.
[0228] In some embodiments, the voltage applied corresponds to an electrochemical oxidation or reduction potential, or combination thereof, of the electroactive mediator in a fully or partially oxidized state. In some embodiments, the generated current corresponds to a reduction or oxidation current derived from reduction or oxidation of the fully or partially oxidized electroactive mediator. An exemplary voltage window includes, but is not limited to, about -0.2V as reduction potential to +0.2V as oxidation potential versus a reference electrode
[0229] In some implementations, the capture agent is used at a concentration between about 10 and about 5000 μ / mL. In some implementations, the capture agent is used at a concentration between about 50 and 1000 μ / mL, such as between about 100 and 1000 μ / mL, or between about 100 and about 1000 μ / mL. In some implementations, the labeling probe is used at a concentration between about 0.1 and 100 μ / mL, such as between about 0.5 and 50 μ / mL, between about 1 and 20 μ / mL, between about 1 and 8 μ / mL, or between about 2 and 5 μ / mL. In some implementations, the labeling probe includes streptavidin-polyHRP or a similar molecule for signal augmentation. In some implementations, the streptavidin-polyHRP concentration is between about 0.1 and about 100 μ / mL, such as between about 0.5 and 50 μ / mL, or between about 1 and 10 μ / mL. The ranges of concentrations of capture agent and labeling probe can be used in any combination, such as 500 g / mL of capture agent in combination with 5 μ / mL of labeling probe. The ranges of concentrations of capture agent, labeling probe and streptavidin-polyHRP also be used in any combination, such as 500 μ / mL of capture agent, 5 μ / mL of labeling probe and 2 μ / mL streptavidin-polyHRP.Target analytes
[0230] In some embodiments, the analyte is a biological analyte. In some embodiments, the analyte ion, molecule, oligomer, polymer, protein, peptide, polypeptide, peptidomimetic, nucleic acid, antigen, antibody, nucleic acid, toxin, biological threat agent such as spore, viral, cellular and protein toxin, carbohydrate, monosaccharide, disaccharide, oligosaccharide, polyol, and polysaccharide, lipid, peptidoglycan, cell, microbial matter, steroid, hormone, lipopolysaccharide, endotoxin, therapeutic agent, lipid-binding molecule, co-factor, small molecule, fatty acid, chemical, or combinations of these. The analyte is optionally an antigen or antibody indicative of infection or resistance to infection. The analyte is optionally a clinical chemistry analyte.
[0231] In some embodiments, the analyte is immunological or serological, for example an antigen or antibody.
[0232] In some embodiments the analyte is a hormone, for example a gynecological hormone such as luteinizing hormone (LH), progesterone, estradiol or follicle-stimulating hormone. In preferred embodiments the probe detects LH. In some embodiments the probe is a LH specific antibody. In some embodiments the probe is an LH monoclonal antibody. Additionally, or alternatively the hormone may be a pregnancy hormone such as human chorionic gonadotropin (hCG).
[0233] In some embodiments the analyte is a clinical chemistry analyte such as an ion, salt, mineral, metabolite, therapeutic drug, toxicology marker, drug of abuse, transport protein, enzyme, specific protein, lipoprotein or marker, for example diabetes or myocardial infarction markers. In some embodiments the analyte is a metabolite selected from the group of glucose, cholesterol, urea, lactic acid, bilirubin, creatinine, triglycerides. In preferred embodiments the probe is selected to detect glucose or cholesterol.
[0234] In some embodiments, the analyte is a tumor marker. Tumor markers can be used in guiding treatment decisions, monitoring treatment, predicting the change of recovery and to predict or monitor for tumor recurrence.Sample
[0235] In accordance with various embodiments described herein, a sample, including any fluid or specimen (processed or unprocessed) that is intended to be evaluated for the presence of an analyte can be subjected to methods, compositions, kits and systems described herein. The sample or fluid can be liquid, supercritical fluid, solutions, suspensions, gases, gels, slurries, and combinations thereof. The sample or fluid can be aqueous or non-aqueous.
[0236] In some embodiments, the sample can be an aqueous fluid. An aqueous fluid includes biological fluids as described below. Optionally, if the sample is water-based but not fluid, an aqueous solution can be added to produce a fluid sample.
[0237] In some embodiments, the sample can include a biological fluid obtained from a subject. Exemplary biological fluids obtained from a subject can include, but are not limited to, blood (including whole blood, plasma, cord blood and serum), lactation products (e.g., milk), amniotic fluids, sputum, saliva, urine, semen, cerebrospinal fluid, bronchial aspirate, perspiration, mucus, liquefied stool sample, synovial fluid, lymphatic fluid, tears, tracheal aspirate, and any combination thereof. In some embodiments, a biological fluid can include a homogenate of a tissue specimen (e.g., biopsy) from a subject. In one embodiment, a test sample can comprise a suspension obtained from homogenization of a solid sample, or a fragment thereof obtained from a subject.
[0238] In some embodiments, the sample can include a fluid or specimen obtained from an environmental source. For example, the fluid or specimen obtained from the environmental source can be obtained or derived from food products or industrial food products, food produce, poultry, meat, fish, beverages, dairy products, water (including wastewater), surfaces, ponds, rivers, reservoirs, swimming pools, soils, food processing and / or packaging plants, agriculturalplaces, hydrocultures (including hydroponic food farms), pharmaceutical manufacturing plants, animal colony facilities, and any combinations thereof.
[0239] In some embodiments, the sample can be a non-biological fluid. As used herein, the term “non-biological fluid” refers to any fluid that is not a biological fluid as the term is defined herein. Exemplary non-biological fluids include, but are not limited to, water, salt water, brine, drinking water, industrial water, brown water, sewerage, and mixtures thereof. Preferred non-biological fluids are drinking or industrial water or sewerage.
[0240] In some embodiments, the sample is pre-processed prior to contacting with the electrode or the sensor.Sensors
[0241] In another aspect provided herein is a sensor comprising an electrode as described herein or an as described herein.
[0242] In the context of this specification, the term “sensor” refers a device that senses the presence and / or amount of something. For example, the sensor could sense the presence of a chemical such as glucose, a protein such as an antigen, or an antibody in a biological fluid.
[0243] A sensor has two basic components: the sensing surface (or receptor) and the transducer. The sensing surface interacts with the target analyte and the transducer converts this interaction into a readable electronic signal. The sensor performance characteristics depend on both the components. The sensor selectivity and affinity towards the target analyte depends solely on the sensing surface because the analyte interacts only at the sensing surface. Other performance metrics such as sensitivity, resolution, and calibration depend on both components.
[0244] In some embodiments the sensor may be an eRapid chip. Such devices are generally described in “ Enabling Multiplexed Electrochemical Detection of Biomarkers with High Sensitivity in Complex Biological Samples, Sanjay S. Timilsina, Pawan Jolly, Nolan Durr, Mohamed Yafia, and Donald E. Ingber, Acc. Chem. Res. 2021, 54, 18, 3529-3539”, which is hereby incorporated herein in its entirety.
[0245] The sensor may have a channel length of between about 5 μm and about 50 μm, or between about 10 μm and about 30 μm, or about 20 μm, and a channel width of between about 1 mm and about 20 mm, or between about 1 mm and about 10 mm, or about 3 mm.
[0246] In some embodiments, the sensor has one or more fluid-contact surfaces, and the electrode is immobilized on at least a portion of the fluid contact surface. In someembodiments, the sensor has one or more wells. In some embodiments, each well of the sensor comprises an inner bottom surface on which one or more analyte specific electrodes are immobilized. In some embodiments, the wells are open cells comprising open tops, enclosed sides and bottom, and one or more analyte-specific electrodes immobilized on the inner fluid- contact surface of the wells. In some embodiments, the sensor comprises 1, 2, 3, 4, 5, 6, 8, 10, 12, 16, 24, 32, 48, 64, 96 or more open wells. In one embodiment the sensor is in the form of a 96-well microtiter plate.
[0247] In some embodiments, the wells are microfluidic flow cells comprising an enclosed top, sides and bottom, wherein the top of each flow cell includes a fluid inlet and a fluid outlet and comprising one or more analyte-specific electrodes immobilized on the inner fluid-contact surface of the wells. In some embodiments, the electrochemical sensor comprises 1, 2, 3, 4, 5, 6, 8, 10, 12, 16, 24, 32, 48, 64, 96 or more microfluidic flow cells. Another embodiment is in the form of a 96-well microtiter plate, wherein each well comprises an enclosed top having a fluid inlet and a fluid outlet. In some embodiments, the sensor comprises both one or more open cells and one or more flow cells. Each well contains an array of analyte- specific electrodes (e.g., 32 gold electrodes) that can be individually modified with capture probes to bind the corresponding target analyte (e.g., pathogen, protein, carbohydrate, toxin, drug, etc.) present in the collected sample. In some embodiments, one sample is introduced into each well. In embodiments having two or more wells, portions of the same sample can be introduced into more than one well, or different samples can be introduced into different wells. Thus, in embodiments having multiple wells, multiple samples can be simultaneously assayed.
[0248] Also provided herein is the use of a sensor. In some embodiments, the sensor may be for sensing an analyte in a sample. The analyte is optionally a biological analyte. In an embodiment the analyte is an antibody, antigen, protein, peptide or chemical. The sample may be any aqueous solution but is preferably a biological fluid, more preferably a bodily fluid, and still more preferably, saliva.Kits
[0249] In another aspect, the present disclosure provides a kit comprising a composition, surface, electrode, or sensor described herein.
[0250] In addition to the above-mentioned components, any embodiments of the kits described herein can include informational material. The informational material can be descriptive, instructional, marketing or other material that relates to the methods describedherein and / or the use of the aggregates for the methods described herein. For example, the informational material can describe methods for using the kits provided herein to perform an assay for capture and / or detection of a target analyte. The kit can also include an empty container and / or a delivery device, e.g., which can be used to deliver a test sample to a test container.
[0251] The informational material of the kits is not limited in its form. In many cases, the informational material, e.g., instructions, is provided in printed matter, e.g., a printed text, drawing, and / or photograph, e.g., a label or printed sheet. However, the informational material can also be provided in other formats, such as Braille, computer readable material, video recording, or audio recording. In another embodiment, the informational material of the kit is a link or contact information, e.g., a physical address, email address, hyperlink, website, or telephone number, where a user of the kit can obtain substantive information about the formulation and / or its use in the methods described herein. Of course, the informational material can also be provided in any combination of formats.
[0252] In some embodiments, the kit can contain separate containers, dividers or compartments for each component and informational material. For example, each different component can be contained in a bottle, vial, or syringe, and the informational material can be contained in a plastic sleeve or packet. In other embodiments, the separate elements of the kit are contained within a single, undivided container. For example, a collection of magnetic nanoparticles is contained in a bottle, vial or syringe that has attached thereto the informational material in the form of a label.
[0253] Some embodiments of the present invention can be defined as any of the following numbered embodiments:
[0254] Embodiment 1 : A composition comprising a non-aqueous phase, an aqueous phase, a proteinaceous material, a conductive element, and an emulsifier (surfactant).
[0255] Embodiment 2: The composition of embodiment 1, wherein the composition is an emulsion, nanoemulsion, micelle or liposome.
[0256] Embodiment 3: The composition of embodiment 1 or 2, wherein the composition is an oil-in-water (o / w) emulsion, water-in-oil (w / o) emulsion, water-in-oil-in- water (w / o / w) emulsion, or oil-in-water-in-oil (o / w / o) emulsion.
[0257] Embodiment 4: The composition of any one of embodiments 1-3, wherein a ratio of the aqueous phase to the non-aqueous phase is from about 1000:1 to about 1 :1 (v / v)(e.g., from about 500:1 to about 1:1, 250:1 to about 1:1, from about 200:1 to about 1:1, from about 150:1 to about 1 :1, from about q00:l to about 1 :1, from about 75:1 to about 1:1, from about 50:1 to about 1 :1, from about 40:1 to about 1:1, from about 30:1 to about 1:1, from about 20: 1 to about 1 :1, from about 15: 1 to about 1:1, from about 10: 1 to about 1 :1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2.75:1, about 2.5:1, about 2:1, about 1.75:1, about 1.5:1, about 1.25:1, or about 1 :1).
[0258] Embodiment 5: The composition of any one of embodiments 1-4, wherein the non-aqueous phase comprises an oil, a wax, a fluorocarbon, a silicone, or any combination thereof.
[0259] Embodiment 6: The composition of any one of embodiments 1-5, wherein the non-aqueous phase comprises an oil.
[0260] Embodiment 7: The composition of any one of embodiments 1-6, wherein the non-aqueous phase comprises an oil selected from the group consisting of hydrocarbons, mineral oil, vegetable oils (e.g., soybean oil, peanut oil, com oil, sunflower oil, almond oil, castor oil, rapeseed oil, cocoa butter, olive oil, palm oil, hydrogenated palm oil, rice bran oil, macadamia integrifolia seed oil, argania spinosa kernel oil, safflower oil, rapeseed oil, palm kernel oil, coton seed oil, sesame oil, linseed oil, hazelnut oil, walnut oil, pumpkin oil, grape seed oil, brazil nut oil, avocado oil, almond oil, avocado oil, sunflower oil, Jojoba oil, cocoa buter, and flaxseed oil), fats, waxes (e.g., candellila wax, carnauba wax, mineral wax, microcrystalline wax, Montan wax, Ozocerite wax, paraffin wax, petro latum wax, petroleum wax, synthetic wax, silicone waxes animal wax, beeswax, lanolin and its derivatives, vegetable wax, ouricurry wax, Japan wax, Esparto wax, cork fiber wax, and sugar cane wax), fatty alcohols, faty acids, and medium chain triglycerides.
[0261] Embodiment 8: The composition of any one of embodiments 1-7, wherein the non-aqueous phase comprises a hydrocarbon.
[0262] Embodiment 9: The composition of any one of embodiments 1-8, wherein the non-aqueous phase comprises hexadecane, n-heptane, n-octane, or n-decane.
[0263] Embodiment 10: The composition of any one of embodiments 1-9, wherein the composition comprises the non-aqueous phase in an amount from about 1 wt% to about 50 wt%.
[0264] Embodiment 11: The composition of any one of embodiments 1-10, wherein the aqueous phase comprises water, a water-miscible liquid (such as lower alkanols, e.g.,methanol, ethanol or propanol; glycols and polyglycols and the like), or any combination thereof.
[0265] Embodiment 12: The composition of any one of embodiments 1-11, wherein the aqueous phase comprises a buffer (e.g., phosphate buffer, phosphate buffered saline (PBS), acetate buffer, histidine buffer, succinate buffer, HEPES buffer, tris buffer, carbonate buffer, citrate buffer, glycine buffer, barbital buffer, and cacodylate buffer).
[0266] Embodiment 13: The composition of any one of embodiments 1-12, wherein the composition comprises the aqueous phase in an amount about from about 50 wt% to about 95 wt%
[0267] Embodiment 14: The composition of any one of embodiments 1-13, wherein the emulsifier is an anionic, nonionic, cationic, zwitterionic or amphoteric surfactant.
[0268] Embodiment 15: The composition of any one of embodiments 1-14, wherein the emulsifier is selected from the group consisting of C12-C18fatty alcohols; alkoxylated C12- Ci8 fatty alcohols; C12-C18fatty acids; and alkoxylated C12-C18fatty acids, the alkoxylates each having 10 to 30 units of ethylene oxide, propylene oxide, and combinations of ethylene oxide / propylene oxide; C8-C22 alkyl mono- and oligoglycosides; ethoxylated sterols; partial esters of polyglycerols; esters and partial esters of polyols having 2 to 6 carbon atoms and saturated and unsaturated fatty acids having 12 to 30 carbon atoms; partial esters of polyglycerols; and organosiloxanes; and combinations thereof.
[0269] Embodiment 16: The composition of any one of embodiments 1-15, wherein the emulsifier is sodium dodecylbenzene sulfonate, sodium dodecyl sulfate (SDS), glyceryl stearate, PEG 40 stearate, sodium lauroyl sarcosine, potassium lauroyl sarcosine, aodium coco acylsarcosinate, cocoyl flesh Propylhomoserin potassium, sodium lauroylmethyl taurate, sodium cocoyl methyl sodium taurocholate, sodium lauroyl glutamate, lauryl trimethyl ammonium chloride, stearyl trimethyl ammonium chloride, benzethonium chloride, cetyl pyridinium chloride, cetyl pyridinium chloride benzalkonium chloride, stearyl dimethyl benzyl ammonium chloride, polyoxyethylene lauryl ether sodium sulfate, sodium lauryl sulfate, sodium myristyl sulfate, sodium N-lauroyl sarcosinate, sodium N-myristol sarcosine, sodium coconut fatty acid monoglyceride monosulfate, sodium lauryl sulfoacetate, sodium a-olefin sulfonate, sodium N-palmitoyl glutamate, sodium N-methyl-N-acyl taurate, sucrose fatty acid ester, maltose fatty acid ester, maltitol fatty acid ester, lactol fatty acid ester, sorbitan fatty acid ester, polyoxyethylene sorbitan monostearate, polyoxyethylene higher alcohol ether, polyoxyethylene cured Castor oil, polyoxyethylene polyoxypropylene copolymer,polyoxyethylene polyoxypropylene faty acid ester, polyglycerin fatty acid ester, coconut oil fatty acid amidopropyl betaine, lauryldimethylaminoacetic acid betaine, lauryldimethylamine oxide, 2-alkyl-N-carboxymethyl-N-hydroxyethylimidazolium betaine, N- lauryldiaminoethylglycine, N-myristyldiaminoethylglycine, sodium N-alkyl-1- hydroxyethylimidazoline betaine, or any combination thereof.
[0270] Embodiment 17: The composition of any one of embodiments 1-16, wherein the emulsifier is present in an amount from about 0.01% to about 10% (w / v).
[0271] Embodiment 18: The composition of any one of embodiments 1-17, wherein the emulsion comprises particles having a size of about 2.5 μm or less, optionally, a size of about 900 nm or less, and preferably a size of from about 250 nm to about 750 nm, and more preferably a size from about 325 nm to about 625 nm, and even more preferably a size of about 500 nm.
[0272] Embodiment 19: The composition of any one of embodiments 1-18, wherein the conducting element is in the aqueous phase.
[0273] Embodiment 20: The composition of any one of embodiments 1-19, wherein the composition comprises the conductive element in an amount from about 0.01% to about 10% (w / v).
[0274] Embodiment 21 : The composition of any one of embodiments 1-20, wherein a ratio of the proteinaceous material to the conductive element is from about 10:1 to about 1 :1 (w / w).
[0275] Embodiment 22: The composition of any one of embodiments 1-21, wherein the conducting material comprises conductive particles, conductive rods, conductive fibers, conductive nano-particles, conductive polymers, conductive nano-flakes, conductive nanotubes, semi-conductive particles, semi-conductive rods, semi-conductive fibers, semi- conductive nano-particles, semi-conductive nano-flakes, semi-conductive nanotubes, or semi- conductive polymers.
[0276] Embodiment 23: The composition of any one of embodiments 1-22, wherein the conducting material is a metal, a metalloid, a conducting polymer, a conducting carbon- based material, or any combination thereof.
[0277] Embodiment 24: The composition of any one of embodiments 1-23, wherein the conducting material comprises an allotrope of carbon atoms arranged in a hexagonal latice.
[0278] Embodiment 25: The composition of any one of embodiments 1-24, wherein the conducting material is graphite, functionalised graphene oxide, reduced graphene oxide, or carbon nanotubes (CNTs).
[0279] Embodiment 26: The composition of embodiment 25, wherein the carbon nanotubes are carboxylated carbon nanotubes or aminated carbon nanotubes.
[0280] Embodiment 27: The composition of embodiment 25, wherein the reduced graphene oxide is a carboxylated reduced graphene oxide or an aminated reduced graphene oxide.
[0281] Embodiment 28: The composition of any one of embodiments 1-23, wherein the conductive material comprises gold.
[0282] Embodiment 29: The composition of any one of embodiments 1-28, wherein the proteinaceous material is in the aqueous phase.
[0283] Embodiment 30: The composition of any one of embodiments 1-29, wherein the composition comprises the proteinaceous material in an amount from about 0.1% to about 10% (w / v).
[0284] Embodiment 31: The composition of any one of embodiments 1-30, wherein the proteinaceous material is denatured.
[0285] Embodiment 32: The composition of any one of embodiments 1-31, wherein the proteinaceous material is non-reversibly denatured.
[0286] Embodiment 33: The composition of any one of embodiments 1-32, wherein the proteinaceous material is a globular protein.
[0287] Embodiment 34: The composition of any one of embodiments 1-33, wherein the proteinaceous material is a non-glycosylated protein.
[0288] Embodiment 35: The composition of any one of embodiments 1-34, wherein the proteinaceous material is a serum albumin protein.
[0289] Embodiment 36: The composition of any one of embodiments 1-35, wherein the proteinaceous material is bovine serum albumin (BSA) or human serum albumin (HSA).
[0290] Embodiment 37: The composition of any one of embodiments 1-36, wherein the proteinaceous material is cross-linked with the conductive element.
[0291] Embodiment 38: The composition of any one of embodiments 1-37, wherein the proteinaceous material is cross-linked to the conductive element by a linker.
[0292] Embodiment 39: The composition of embodiment 38, wherein the linker is glutaraldehyde, genipin, or polyethylene glycol.
[0293] Embodiment 40: The composition of any one of embodiments 1-39, wherein the proteinaceous material is cross-linked to itself.
[0294] Embodiment 41: The composition of any one of embodiments 1-40, wherein the proteinaceous material is cross-linked to itself by a linker.
[0295] Embodiment 42: The composition of embodiment 41, wherein the linker is glutaraldehyde, genipin, or polyethylene glycol.
[0296] Embodiment 43: The composition of any one of embodiments 1-42, wherein the composition further comprises a target binding molecule capable of binding with a target molecule.
[0297] Embodiment 44: The composition of embodiment 43, wherein the target binding molecule is covalently linked to the proteinaceous material.
[0298] Embodiment 45: The composition of embodiment 43 or 44, wherein the target binding molecule is a receptor, a ligand for a receptor, an antibody, antigen binding fragment of an antibody, an antigen, an enzyme or a nucleic acid.
[0299] Embodiment 46: The composition of any one of embodiments 43-45, wherein the target binding molecule is an antibody, an antigen binding fragment of an antibody or an antigen.
[0300] Embodiment 47: The composition of any one of embodiments 43-46, wherein composition comprises a first capture agent for detecting a first target molecule by a first detection modality and a second capture agent for detecting a second target molecule by a second detection modality.
[0301] Embodiment 48: The composition of embodiment 47, wherein one of the first and second detection modality is a nucleic acid-based detection method (e.g., CRISPR / Cas 12a- based nucleic acid detection) and the other one is an ELISA based detection method.
[0302] Embodiment 49: The composition of any one of embodiments 1-48, wherein the composition comprises an anti-microbial agent.
[0303] Embodiment 50: The composition of embodiment 49, wherein the anti- microbial agent is an anti-bacterial agent, antifungal agent or anti-viral agent.
[0304] Embodiment 51 : The composition of embodiment 49 or 50, wherein the anti- microbial agent is an anti-bacterial agent.
[0305] Embodiment 52 : The composition of embodiment 51 , wherein the anti-bacterial agent is selected from the group consisting of macrolides or ketolides such as erythromycin, azithromycin, clarithromycin, and telithromycin; beta-lactams including penicillin,cephalosporin, and carbapenems such as carbapenem, imipenem, and meropenem; monolactams such as penicillin G, penicillin V, methicillin, oxacillin, cioxacillin, dicloxacillin, nafcillin, ampicillin, amoxicillin, carbenicillin, ticarcillin, meziocillin, piperacillin, azlocillin, temocillin, cepalothin, cephapirin, cephradine, cephaloridine, cefazolin, cefamandole, cefuroxime, cephalexin, cefprozil, cefaclor, loracarbef, cefoxitin, cefinetazole, cefotaxime, ceftizoxime, cefiriaxone, cefoperazone, ceftazidime, cefixime, cefpodoxime, ceftibuten, cefdinir, cefpirome, cefepime, cefadroxil, ceftriaxone, ceftobiprole and astreonam; quinolones such as nalidixic acid, oxolinic acid, norfloxacin, pefloxacin, enoxacin, ofloxacin, levofloxacin, ciprofloxacin, temafloxacin, lomefloxacin, fleroxacin, grepafloxacin, sparfloxacin, trovafloxacin, clinafloxacin, gatifloxacin, moxifloxacin, sitafloxacin, ganefloxacin, gemifloxacin and pazufloxacin; antibacterial sulfonamides and antibacterial sulphanilamides, including para-aminobenzoic acid, sulfadiazine, sulfisoxazole, sulfamethoxazole and sulfathalidine; aminoglycosides such as streptomycin, neomvcin, kanamycin, paromycin, gentamicin, tobramycin, amikacin, netilmicin, spectinomycin, sisomicin, dibekalin and isepamicin; tetracyclines such as tetracycline, chlortetracycline, demeclocycline, minocycline, oxytetracycline, methacycline, doxycycline; rifamycins such as rifampicin (also called rifampin), rifapentine, rifabutin, bezoxazinorifamycin and rifaximin; lincosamides such as lincomycin and clindamycin; glycopeptides such as vancomycin and teicoplanin; streptogramins such as quinupristin and daflopristin; oxazolidinones such as linezolid; polymyxin, colistin and colymycin; trimethoprim, bacitracin, and phosphonomycin.
[0306] Embodiment 53: The composition of embodiment 49 or 50, wherein the anti- microbial agent is an antifungal agent.
[0307] Embodiment 54: The composition of embodiment 53, wherein the antifungal agent is selected from the group consisting of azoles (e.g., barleyconazole, butoconazole, clortrimazole, econazole, fluconazole, isavuconazole, itraconazole, ketoconazole, miconazole, oxyconazole, posaconazole, ravuconazole, saperconazole, sulconazole, tercocnazole, tioconazole, voriconazole, and ciclopirox), polyenes (e.g., natamycin, lucensomycin, nystatin, amphotericin B, etc.), echinocandins (e.g., Cancidas), pradimicins (e.g., beanomicins, nikkomycins, sordarins, allylamines, etc.), Triclosan, Piroctone, fenpropimorph, terbinafme, cyclopyroxolamine, flucitocin, griseofulvin haloprozin, tolnaftate, naphthypine, hydrochloride, morpholine, butenapin, undecylenic acid, propionic acid, and derivatives and analogs thereof.
[0308] Embodiment 55: The composition of embodiment 49 or 50, wherein the anti- microbial agent is an antimicrobial peptide or polymer.
[0309] Embodiment 56: The composition of embodiment 49 or 50, wherein the anti- microbial agent is a metal particle.
[0310] Embodiment 57 The composition of embodiment 56, wherein anti-microbial agent is titanium oxide, copper, or silver nanoparticles.
[0311] Embodiment 58: The composition of any one of embodiments 1-57, wherein the composition further comprises a therapeutic agent, e.g., anti-inflammatory drugs sirolimus, everolimus, biolimus (A9), zotarolimus (ABT-578), tacrolimus, and pimecrolimus, genistein, steroids (dexamethasone, prednisolone, methylprednisolone and hydrocortisone), fluocinolone acetonide, hormones etc.
[0312] Embodiment 59: The composition of any one of embodiments 1-58, wherein the emulsion further comprises a polymer.
[0313] Embodiment 60: The composition of embodiment 59, wherein the polymer is a water miscible polymer.
[0314] Embodiment 61: The composition of embodiment 59 or 60, wherein the polymer is a degradable polymer
[0315] Embodiment 62: The composition of any one of embodiments 59-61, wherein the polymer is selected from the group consisting of poly(N-isopropyl acrylamide) (PNIPAAm), polyethylene glycol (PEG), alginate, polytetrafluoroethylene (PTFE), polyacetylene (PA), polyaniline (PANI), polypyrrole (PPy), polythiophene (PTH), poly(para- phenylene) (PPP), poly(phenylenevinylene) (PPV), and polyfuran (PF).
[0316] Embodiment 63: A surface comprising an antifouling coating layer on at least a part of the surface, wherein the antifouling coating layer comprises a composition of any one of embodiments 1-62.
[0317] Embodiment 64: An electrode comprising: (i) a conductive substrate (e.g., an electrically conductive substrate); and (2) an antifouling coating layer on at least a portion of a surface of the conductive substrate, and wherein the antifouling coating layer comprises: a proteinaceous material and a conductive element, and wherein the antifouling coating layer is porous and comprises macropores.
[0318] Embodiment 65: The electrode of embodiment 64, wherein the antifouling coating layer comprises macropores with a diameter of about 0.1 μm to about 10 μm (e.g., about 0.5 μm to about 5 μm, such as from about 1 μm to about 3 μm).
[0319] Embodiment 66: The electrode of any one of clams 64-65, wherein the conductive substrate comprises gold, silver, copper, platinum, aluminum, stainless steel, tungsten, indium tin oxide, titanium, lead, nickel, palladium, zirconium, niobium, tantalum, chromium, molybdenum, manganese, rhenium, ruthenium, rhodium, iridium, silicon, polyimide, parylene, benzocyclobutene, carbon, graphite, or any combination thereof.
[0320] Embodiment 67: The electrode of any one of embodiments 64-66, wherein the conductive substrate comprises a flexible substrate.
[0321] Embodiment 68: The electrode of embodiment 67, wherein the flexible substrate comprises polyethylene terephthalate, polyethylene naphathalate, polyimides, polymeric hydrocarbons, celluloses, plastics, polycarbonates, polystyrenes, or any combination thereof.
[0322] Embodiment 69: The electrode of any one of embodiments 64-68, wherein the antifouling coating layer is adapted for contact with an analyte or a sample comprising an analyte.
[0323] Embodiment 70: The electrode of any one of embodiments 64-69, wherein the electrode is a planar or 3 -dimensional electrode.
[0324] Embodiment 71 : A surface comprising an antifouling coating layer on at least a part of the surface, wherein the antifouling coating layer comprises: a proteinaceous material and a conductive element, and wherein the antifouling coating layer is porous and comprises macropores.
[0325] Embodiment 72: The surface of embodiment 71, wherein the antifouling coating layer comprises macropores with a diameter of about 0.1 μm to about 10 μm (e.g., about 0.5 μm to about 5 μm, such as from about 1 μm to about 3 μm).
[0326] Embodiment 73: The surface of embodiment 71 or 72, wherein the antifouling coating layer is directly or indirectly connected with an electrode.
[0327] Embodiment 74: A method for preparing a surface with an antifouling coating layer, the method comprising: (a) coating at least a part of a surface with a composition of any one of embodiments 1-62; and (b) removing, at least a part of, the non-aqueous phase, thereby forming an antifouling coating layer on the surface.
[0328] Embodiment 75: The method of embodiment 74, wherein the antifouling coating layer is porous and comprises macropores.
[0329] Embodiment 76: The method of embodiment 74 or 75, wherein the antifouling coating layer is porous and the comprises macropores with a diameter of about 0.1 μm to about 10 μm (e.g., about 0.5 μm to about 5 μm, such as from about 1 μm to about 3 μm).
[0330] Embodiment 77: The method of any one of embodiments 74-76, wherein the method further comprises cross-linking the proteinaceous material.
[0331] Embodiment 78: The method of any one of embodiments 74-77, wherein said step of cross-linking the proteinaceous material is prior to the step of removing the non-aqueous phase.
[0332] Embodiment 79: The method of any one of embodiments 74-78, wherein said step of cross-linking the proteinaceous material is after the step of removing the non-aqueous phase.
[0333] Embodiment 80: The method of any one of embodiments 74-79, further comprising a step of coating a surface of the antifouling coating layer with a target binding molecule.
[0334] Embodiment 81 : The method of embodiment 80, wherein said coating with the target binding molecule comprises conjugating the target binding molecule to a component of the antifouling coating layer.
[0335] Embodiment 82: The method of embodiment 80 or 81, wherein said coating with the target binding molecule comprises conjugating the target binding molecule with the proteinaceous material.
[0336] Embodiment 83: The method of any one of embodiments 74-82, wherein said coating the surface comprises spin coating, nozzle-assisted printing (e.g., inkjet printing), drop- casting, roll coating, spray coating, dip coating, gravure coating, bar coating, vapor coating, or knife coating.
[0337] Embodiment 84: The method of any one of embodiments 74-83, wherein the antifouling coating layer is directly or indirectly connected with an electrode.
[0338] Embodiment 85: The method of any one of embodiments 74-84, wherein the surface is a surface of a conductive substrate (e.g., an electrically conductive substrate).
[0339] Embodiment 86: The method of embodiment 85, wherein the substrate is an electrode.
[0340] Embodiment 87: The electrode of any one of embodiments 64-70, the surface of any one of embodiments 71-73 or the method of any one of embodiments 74-86, wherein the antifouling coating layer has a porosity of about 5% to about 95%.
[0341] Embodiment 88: The electrode, surface or method of embodiment 87, wherein the antifouling coating layer comprises mesopores (e.g., pores having a diameter from about 5 nm to about 99 nm).
[0342] Embodiment 89: The electrode, surface or method of embodiment 87 or 88, wherein the antifouling coating layer comprises an emulsifier.
[0343] Embodiment 90: The electrode, surface, or method of embodiment 89, wherein the emulsifier is an anionic, nonionic, cationic, zwitterionic or amphoteric surfactant.
[0344] Embodiment 91: The electrode, surface, or method of embodiment 89 or 90, wherein the emulsifier is selected from the group consisting of C12-C18fatty alcohols; alkoxylated C12-C18fatty alcohols; C12-C18fatty acids; and alkoxylated C12-C18fatty acids, the alkoxylates each having 10 to 30 units of ethylene oxide, propylene oxide, and combinations of ethylene oxide / propylene oxide; C8-C22alkyl mono- and oligoglycosides; ethoxylated sterols; partial esters of polyglycerols; esters and partial esters of polyols having 2 to 6 carbon atoms and saturated and unsaturated fatty acids having 12 to 30 carbon atoms; partial esters of polyglycerols; and organosiloxanes; and combinations thereof
[0345] Embodiment 92: The composition of any one of embodiments 89-91, wherein the emulsifier is sodium dodecylbenzene sulfonate, sodium dodecyl sulfate (SDS), glyceryl stearate, PEG 40 stearate, sodium lauroyl sarcosine, potassium lauroyl sarcosine, aodium coco acylsarcosinate, cocoyl flesh Propylhomoserin potassium, sodium lauroylmethyl taurate, sodium cocoyl methyl sodium taurocholate, sodium lauroyl glutamate, lauryl trimethyl ammonium chloride, stearyl trimethyl ammonium chloride, benzethonium chloride, cetyl pyridinium chloride, cetyl pyridinium chloride benzalkonium chloride, stearyl dimethyl benzyl ammonium chloride, polyoxyethylene lauryl ether sodium sulfate, sodium lauryl sulfate, sodium myristyl sulfate, sodium N-lauroyl sarcosinate, sodium N-myristol sarcosine, sodium coconut fatty acid monoglyceride monosulfate, sodium lauryl sulfoacetate, sodium a-olefin sulfonate, sodium N-palmitoyl glutamate, sodium N-methyl-N-acyl taurate, sucrose fatty acid ester, maltose fatty acid ester, maltitol fatty acid ester, lactol fatty acid ester, sorbitan fatty acid ester, polyoxyethylene sorbitan monostearate, polyoxyethylene higher alcohol ether, polyoxyethylene cured Castor oil, polyoxyethylene polyoxypropylene copolymer, polyoxyethylene polyoxypropylene fatty acid ester, polyglycerin fatty acid ester, coconut oil fatty acid amidopropyl betaine, lauryldimethylaminoacetic acid betaine, lauryldimethylamine oxide, 2-alkyl-N-carboxymethyl-N-hydroxyethylimidazolium betaine, N-lauryldiaminoethylglycine, N-myristyldiaminoethylglycine, sodium N-alkyl-1- hydroxyethylimidazoline betaine, or any combination thereof.
[0346] Embodiment 93: The electrode, surface, or method of any one of embodiments 88-92, wherein the antifouling coating layer comprises an oil, a wax, a fluorocarbon, a silicone, or any combination thereof.
[0347] Embodiment 94: The electrode, surface, or method of any one of embodiments 88-93, wherein the antifouling coating layer comprises an oil.
[0348] Embodiment 95: The electrode, surface, or method of any one of embodiments 88-94, wherein the antifouling coating layer comprises an oil selected from the group consisting of hydrocarbons, mineral oil, vegetable oils (e.g., soybean oil, peanut oil, com oil, sunflower oil, almond oil, castor oil, rapeseed oil, cocoa butter, olive oil, palm oil, hydrogenated palm oil, rice bran oil, macadamia integrifolia seed oil, argania spinosa kernel oil, safflower oil, rapeseed oil, palm kernel oil, cotton seed oil, sesame oil, linseed oil, hazelnut oil, walnut oil, pumpkin oil, grape seed oil, brazil nut oil, avocado oil, almond oil, avocado oil, sunflower oil, Jojoba oil, cocoa butter, and flaxseed oil), fats, waxes (e.g., candellila wax, carnauba wax, mineral wax, microcrystalline wax, Montan wax, Ozocerite wax, paraffin wax, petro latum wax, petroleum wax, synthetic wax, silicone waxes animal wax, beeswax, lanolin and its derivatives, vegetable wax, ouricurry wax, Japan wax, Esparto wax, cork fiber wax, and sugar cane wax), fatty alcohols, fatty acids, and medium chain triglycerides.
[0349] Embodiment 96: The electrode, surface, or method of any one of embodiments 88-95, wherein the antifouling coating layer comprises a hydrocarbon.
[0350] Embodiment 97: The electrode, surface, or method of any one of embodiments 88-96, wherein the antifouling coating layer comprises hexadecane, n-heptane, n-octane, or n- decane.
[0351] Embodiment 98: The electrode, surface, or method of any one of embodiments 88-97, wherein a ratio of the proteinaceous material to the conductive element is from about 10:1 to about 1:1 (w / w).
[0352] Embodiment 99: The electrode, surface, or method of any one of embodiments 88-98, wherein the conducting material comprises conductive particles, conductive rods, conductive fibers, conductive nano-particles, conductive polymers, conductive nano-flakes, conductive nanotubes, semi-conductive particles, semi-conductive rods, semi-conductive fibers, semi-conductive nano-particles, semi-conductive nano-flakes, semi-conductive nanotubes, or semi-conductive polymers.
[0353] Embodiment 100: The electrode, surface, or method of any one of embodiments 88-99, wherein the conducting material is a metal, a metalloid, a conducting polymer, a conducting carbon based material, or any combination thereof.
[0354] Embodiment 101 : The electrode, surface, or method of any one of embodiments 88-100, wherein the conducting material comprises an allotrope of carbon atoms arranged in a hexagonal lattice.
[0355] Embodiment 102: The electrode, surface, or method of any one of embodiments 88-101, wherein the conducting material is graphite, functionalised graphene oxide, reduced graphene oxide, or carbon nano-tubes (CNTs).
[0356] Embodiment 103: The electrode, surface, or method of embodiment 88-102, wherein the carbon nanotubes are carboxylated carbon nanotubes or aminated carbon nanotubes.
[0357] Embodiment 104: The electrode, surface, or method of embodiment 102, wherein the reduced graphene oxide is a carboxylated reduced graphene oxide or an aminated reduced graphene oxide.
[0358] Embodiment 105: The electrode, surface, or method of any one of embodiments 88-104, wherein the conductive material comprises gold.
[0359] Embodiment 106: The electrode, surface, or method of any one of embodiments 88-105, wherein the proteinaceous material is denatured.
[0360] Embodiment 107: The electrode, surface, or method of any one of embodiments 88-106, wherein the proteinaceous material is non-reversibly denatured.
[0361] Embodiment 108: The electrode, surface, or method of any one of embodiments 88-107, wherein the proteinaceous material is a globular protein.
[0362] Embodiment 109: The electrode, surface, or method of any one of embodiments 88-108, wherein the proteinaceous material is a non-glycosylated protein.
[0363] Embodiment 110: The electrode, surface, or method of any one of embodiments 88-109, wherein the proteinaceous material is a serum albumin protein.
[0364] Embodiment 111: The electrode, surface, or method of any one of embodiments 88-110, wherein the proteinaceous material is bovine serum albumin (BSA) or human serum albumin (HSA).
[0365] T Embodiment 112: he electrode, surface, or method of any one of embodiments88-111, wherein the proteinaceous material is cross-linked with the conductive element.
[0366] Embodiment 113: The electrode, surface, or method of any one of embodiments 88-112, wherein the proteinaceous material is cross-linked to the conductive element by a linker.
[0367] Embodiment 114: The electrode, surface, or method of embodiment 113, wherein the linker is glutaraldehyde, genipin, or polyethylene glycol.
[0368] Embodiment 115: The electrode, surface, or method of any one of embodiments 88-114, wherein the proteinaceous material is cross-linked to itself.
[0369] Embodiment 116: The electrode, surface, or method of any one of embodiments 88-115, wherein the proteinaceous material is cross-linked to itself by a linker.
[0370] Embodiment 117: The electrode, surface, or method of embodiment 116, wherein the linker is glutaraldehyde, genipin, or polyethylene glycol.
[0371] Embodiment 118: The electrode, surface, or method of any one of embodiments 88-117, wherein the antifouling coating layer comprises a target binding molecule capable of binding with a target molecule.
[0372] Embodiment 119: The electrode, surface, or method of embodiment 118, wherein the target binding molecule is on a surface of the antifouling coating layer.
[0373] Embodiment 120: The electrode, surface, or method of embodiment 118 or 119, wherein the target binding molecule is in pores of the antifouling coating layer.
[0374] Embodiment 121 : The electrode, surface, or method of any one of embodiments 118-120, wherein the target binding molecule is imprinted on the antifouling coating layer.
[0375] Embodiment 122: The electrode, surface, or method of any one of embodiments 118-121, wherein the target binding molecule is covalently linked to the proteinaceous material.
[0376] Embodiment 123: The electrode, surface, or method of any one of embodiments 118-122, wherein the target binding molecule is a receptor, a ligand for a receptor, an antibody, antigen binding fragment of an antibody, an antigen, an enzyme or a nucleic acid.
[0377] Embodiment 124: The electrode, surface, or method of any one of embodiments 118-123, wherein the target binding molecule is an antibody, an antigen binding fragment of an antibody or an antigen.
[0378] Embodiment 125: The electrode, surface, or method of any one of embodiments 118-123, wherein the antifouling layer comprises a first target binding molecule for detecting a first target molecule by a first detection modality and a second target binding agent for detecting a second target molecule by a second detection modality.
[0379] Embodiment 126: The electrode, surface, or method oof embodiment 125, wherein one of the first and second detection modality is a nucleic acid-based detection method (e.g., CRISPR / Casl2a-based nucleic acid detection) and the other one is an ELISA based detection method.
[0380] Embodiment 127: The electrode, surface, or method of any one of embodiments 88-126, wherein the antifouling coating layer further comprises an anti-microbial agent.
[0381] Embodiment 128: The electrode, surface, or method of embodiment 127, wherein the anti-microbial agent is an anti-bacterial agent, antifungal agent or anti-viral agent.
[0382] Embodiment 129: The electrode, surface, or method of embodiment 127 or 128, wherein the anti-microbial agent is an anti-bacterial agent.
[0383] Embodiment 130: The electrode, surface, or method of embodiment 129, wherein the anti-bacterial agent is selected from the group consisting of macrolides or ketolides such as erythromycin, azithromycin, clarithromycin, andtelithromycin; beta-lactams including penicillin, cephalosporin, and carbapenems such as carbapenem, imipenem, and meropenem; monolactams such as penicillin G, penicillin V, methicillin, oxacillin, cioxacillin, dicloxacillin, nafcillin, ampicillin, amoxicillin, carbenicillin, ticarcillin, meziocillin, piperacillin, azlocillin, temocillin, cepalothin, cephapirin, cephradine, cephaloridine, cefazolin, cefamandole, cefuroxime, cephalexin, cefprozil, cefaclor, loracarbef, cefoxitin, cefinetazole, cefotaxime, ceftizoxime, ceftriaxone, cefoperazone, ceftazidime, cefixime, cefpodoxime, ceftibuten, cefdinir, cefpirome, cefepime, cefadroxil, ceftriaxone, ceftobiprole and astreonam; quinolones such as nalidixic acid, oxolinic acid, norfloxacin, pefloxacin, enoxacin, ofloxacin, levofloxacin, ciprofloxacin, temafloxacin, lomefloxacin, fleroxacin, grepafloxacin, sparfloxacin, trovafloxacin, clinafloxacin, gatifloxacin, moxifloxacin, sitafloxacin, ganefloxacin, gemifloxacin and pazufloxacin; antibacterial sulfonamides and antibacterial sulphanilamides, including para-aminobenzoic acid, sulfadiazine, sulfisoxazole, sulfamethoxazole and sulfathalidine; aminoglycosides such as streptomycin, neomvcin, kanamycin, paromycin, gentamicin, tobramycin, amikacin, netilmicin, spectinomycin, sisomicin, dibekalin and isepamicin; tetracyclines such as tetracycline, chlortetracycline, demeclocycline, minocycline, oxytetracycline, methacycline, doxycycline; rifamycins such as rifampicin (also called rifampin), rifapentine, rifabutin, bezoxazinorifamycin and rifaximin; lincosamides such as lincomycin and clindamycin; glycopeptides such as vancomycin and teicoplanin; streptogramins such as quinupristin and daflopristin; oxazolidinones such as linezolid; polymyxin, colistin and colymycin; trimethoprim, bacitracin, and phosphonomycin.
[0384] Embodiment 131 : The electrode, surface, or method of embodiment 127 or 128, wherein the anti-microbial agent is an antifungal agent.
[0385] Embodiment 132: The electrode, surface, or method of embodiment 131, wherein the antifungal agent is selected from the group consisting of azoles (e.g., barleyconazole, butoconazole, clortrimazole, econazole, fluconazole, isavuconazole, itraconazole, ketoconazole, miconazole, oxyconazole, posaconazole, ravuconazole, saperconazole, sulconazole, tercocnazole, tioconazole, voriconazole, and ciclopirox), polyenes (e.g., natamycin, lucensomycin, nystatin, amphotericin B, etc.), echinocandins (e.g., Cancidas), pradimicins (e.g., beanomicins, nikkomycins, sordarins, allylamines, etc.), Triclosan, Piroctone, fenpropimorph, terbinafine, cyclopyroxolamine, flucitocin, griseofulvin haloprozin, tolnaftate, naphthypine, hydrochloride, morpholine, butenapin, undecylenic acid, propionic acid, and derivatives and analogs thereof.
[0386] Embodiment 133: The electrode, surface, or method of embodiment 127 or 128, wherein the anti-microbial agent is an antimicrobial peptide or polymer.
[0387] Embodiment 134: The electrode, surface, or method of embodiment 127 or 128, wherein the anti-microbial agent is a metal particle.
[0388] Embodiment 135: The electrode, surface, or method of embodiment 134, wherein anti-microbial agent is titanium oxide, copper, or silver nanoparticles.
[0389] Embodiment 136: The electrode, surface, or method of any one of embodiments 88-135, wherein the antifouling coating layer further comprises a therapeutic agent, e.g., anti- inflammatory drugs sirolimus, everolimus, biolimus (A9), zotarolimus (ABT-578), tacrolimus, and pimecrolimus, genistein, steroids (dexamethasone, prednisolone, methylprednisolone and hydrocortisone), fluocinolone acetonide, hormones etc.
[0390] Embodiment 137: The electrode, surface, or method of any one of embodiments 88-136, wherein the antifouling coating layer further comprises a polymer.
[0391] Embodiment 138: The electrode, surface, or method of embodiment 137, wherein the polymer is a water miscible polymer.
[0392] Embodiment 139: The electrode, surface, or method of embodiment 137 or 138, wherein the polymer is a degradable polymer
[0393] Embodiment 140: The electrode, surface, or method of any one of embodiments 137-139, wherein the polymer is selected from the group consisting of poly(N-isopropyl acrylamide) (PNIPAAm), polyethylene glycol (PEG), alginate, polytetrafluoroethylene(PTFE), polyacetylene (PA), polyaniline (PANI), polypyrrole (PPy), polythiophene (PTH), poly(para-phenylene) (PPP), poly(phenylenevinylene) (PPV), and polyfuran (PF).
[0394] Embodiment 141 : A sensor comprising an electrode or a surface of any one the preceding clams.
[0395] Embodiment 142: The sensor of embodiment 141 , wherein the sensor comprises a fluid-contact surface and the electrode is immobilized on at least a portion of the fluid-contact surface.
[0396] Embodiment 143: The sensor of embodiment 141 or 142, wherein the sensor comprises one or more microfluidic flow cells.
[0397] Embodiment 144: The sensor of any one of embodiments 141-143, wherein the sensor comprises one or more microfluidic flow cells.
[0398] Embodiment 145: The sensor of any one of embodiments 141-144, wherein the fluid-contact surface further comprises a positive control electrode and / or a negative control electrode immobilized thereon.
[0399] Embodiment 146: Use of an electrode or sensor of any one of the preceding embodiments for detecting a target analyte in a sample.
[0400] Embodiment 147: A method for detecting a target analyte in a sample, the method comprising: contacting a sample suspected of comprising a target analyte with an electrode of any one the preceding embodiments and detecting binding of the target analyte with the target binding ligand.
[0401] Embodiment 148: The method of embodiment 147, wherein said detecting the binding of the target molecule with the target binding ligand comprises applying a voltage to the electrode.
[0402] Embodiment 149: The method of embodiment 147 or 148, wherein said detecting the binding of the target molecule with the target binding ligand comprises measuring a current generated from electrode.
[0403] Embodiment 150: The method of any one of embodiments 147-149, wherein said detecting the binding of the target molecule with the target binding molecule comprises contacting a second target binding molecule to the target molecule, wherein the second target binding molecule comprises a detectable label.
[0404] Embodiment 151 : The method of embodiment 150, wherein said contacting with the second target binding molecule is prior to contacting the sample with the electrode.
[0405] Embodiment 152: The method of embodiment 150, wherein said contacting with the second target binding molecule is after contacting the sample with the electrode.
[0406] Embodiment 153: The method of any one of embodiments 150-152, wherein the detectable label comprises an enzyme, a fluorophore, a chemiluminescent label, colloidal gold, colored glass or plastic (e.g., polystyrene, polypropylene, and latex) beads, a radiolabel, a quantum dot, or any combination thereof.
[0407] Embodiment 154: The method of any one of embodiments 150-153, wherein the detectable label comprises an enzyme.
[0408] Embodiment 155: The method of embodiment 154, wherein the enzyme is a peroxidase, alkaline phosphatase, malate dehydrogenase, staphylococcal nuclease, delta-V- steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-VI-phosphate dehydrogenase, glucoamylase or acetylcholinesterase.
[0409] Embodiment 156: The method of embodiment 154 or 155, wherein the enzyme is a peroxidase or alkaline phosphatase.
[0410] Embodiment 157: The method of any one of embodiments 154-156, wherein the method further comprises contacting the enzyme with a substrate of the enzyme.
[0411] Embodiment 158: The method of any one of embodiments 150-157, wherein the detectable label facilitates generation of a charge carrier.
[0412] Embodiment 159: The method of embodiment 158, wherein said detecting the binding of the target molecule with the target binding molecule comprises detecting the charge carrier.
[0413] Embodiment 160: The method of any one of embodiments 147-159, wherein the target analyte is a peptide, a polypeptide, a peptidomimetic, a nucleic acid, an oligosaccharide, a polysaccharide, an amino acid, nucleoside, a nucleotide, a carbohydrate, a lipid, a peptidoglycan, a cell, microbial matter, an antigen, a lipid, a steroid, a hormone, a lipopolysaccharide, an endotoxin, a therapeutic agent, a lipid-binding molecule, a cofactor, a small molecule, a toxin, a biological threat agent (e.g., spore, viral, cellular and protein toxin), or any combination thereof.
[0414] Embodiment 161 : The method of any one of embodiments 147-160, wherein the target analyte is a protein, an antibody, an antigen binding fragment of an antibody, an antigen, a hormone, or a metabolite.
[0415] Embodiment 162: The method of any one of embodiments 147-160, wherein the target analyte is a nucleic acid, e.g., the target analyte is an RNA molecule.
[0416] Embodiment 163: The method of embodiment 162, wherein the method comprises: (i) contacting the sample suspected of comprising the target analyte nucleic acid, e.g., RNA with an electrode of any one the preceding embodiments, wherein the target binding ligand is a nucleic acid comprising a detectable label; (ii) contacting the electrode with an endonuclease (e.g., a CRSIPR / Cas such as CRISPR / Casl2), where the endonuclease is capable of cleaving the nucleic acid comprising the detectable label in presence of the target nucleic acid; and (iii) detecting presence of detectable label remaining bound to the nucleic acid comprising the detectable label.
[0417] Embodiment 164: The method of any one of embodiments 147-163, wherein the target analyte is a tumor marker or a clinical chemistry target.
[0418] Embodiment 165: The method of any one of embodiments 147-164, wherein the sample is a biological sample (e.g., blood, saliva, amniotic fluid, sputum, urine, semen, cerebrospinal fluid, bronchial aspirate, perspiration, mucus, liquefied stool sample, synovial fluid, lymphatic fluid, tears, tracheal aspirate, lactation product, and any combination thereof).
[0419] Embodiment 166: The method of any one of embodiments 147-165, wherein the sample is a food, an ingredient for preparing a food, poultry, meat, fish, beverage, or dairy product.
[0420] Embodiment 167: The method of any one of embodiments 147-166, wherein the sample is a non-biological sample (e.g., water, salt water, pond water, river water, reservoir water, brine, drinking water, industrial water, brown water, waste water, sewerage, soil, and mixtures thereof.
[0421] Embodiment 168: The method of any one of embodiments 147-167, wherein the sample is pre-processed prior to contacting with the electrode.
[0422] Embodiment 169: A kit comprising a composition, surface, electrode, or sensor of any one of the preceding embodiments.Some selected definitions
[0423] For convenience, certain terms employed herein, in the specification, examples and appended claims are collected herein. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. Unless explicitly stated otherwise, or apparent from context, the terms and phrases below do not exclude the meaningthat the term or phrase has acquired in the art to which it pertains. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
[0424] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as those commonly understood to one of ordinary skill in the art to which this invention pertains. Although any known methods, devices, and materials may be used in the practice or testing of the invention, the methods, devices, and materials in this regard are described herein.
[0425] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0426] Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number.
[0427] As used herein the term “comprising” or “comprises” is used in reference to compositions, methods, and respective components) thereof, that are essential to the invention, yet open to the inclusion of unspecified elements, whether essential or not. In other words, except where the context requires otherwise, the term “comprise” and variations of the term, such as “comprising”, “comprises” and “comprised”, are not intended to exclude further additives, components, integers or steps.
[0428] The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless thecontext clearly indicates otherwise. It is further noted that the claims can be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.
[0429] As used herein, the term “binding” or “bound” generally refers to a reversible binding of one molecule to molecule via, e.g., van der Waals force, hydrophobic force, hydrogen bonding, and / or electrostatic force. The binding interaction between two molecules can be described by a dissociation constant (Kd) or association constant (K).
[0430] Specific elements of any of the disclosed embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.EXAMPLES
[0431] The following examples illustrate some embodiments and aspects of the invention. It will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be performed without altering the spirit or scope of the Invention, and such modifications and variations are encompassed within the scope of the invention as defined in the claims which follow. The following examples do not in any way limit the invention.Example 1:
[0432] Traditional antifouling coatings such as polyethylene glycol) (PEG) and bovine serum albumin (BSA) have several limitations in biomedical applications: 1) they physically adsorb onto the sensing surfaces, which cannot ensure full blocking of the active surfaces and they may detach from the surface, 2) they hinder electron transfer in the electrode surfaces, reducing the electrochemical signal, 3) the surface area available for presentation of bioreceptors is limited due to trade-off between electrochemical detection performance and required antifouling properties, and 4) the thickness of existing antifouling layers has been limited to the nanoscale.
[0433] Presented here is a method to formulate a thick (> 1 μm) antifouling coating with macro- and nano-scale pores for electrochemical diagnostic sensors with ultrahigh sensitivityusing an emulsion ink. Oil-in-water emulsion can be utilized to form the multiscale porous antifouling coating at any thickness desired and the highly porous nature of the material greatly increases its surface area available for bioreceptor presentation and interactions with analytes. It is desirable as an antifouling coating as it can be rapidly applied using nozzle-assisted printing in a form that is highly sensitive and robust, plus functional nanomaterials can be embedded within the layer.Background
[0434] Biofouling, the contamination of surfaces by non-specific biomolecules, is of great concern in biomedical applications. Antifouling coatings have been developed by modifying biosensing surfaces with antifouling biomaterials (e.g., PEG, zwitterionic polymers, and BSA) to resist adsorption or bind of non-specific molecules that can interfere with the sensor performance. BSA, the abundant protein component of plasma, is the most common passivating agent due to its cost-effectiveness, stability, superior biocompatibility, and ease of passivation.
[0435] To apply an antifouling layer to electrochemical sensors, a working electrode with specific bioreceptors already bound is typically incubated in a BSA solution, followed by physical adsorption of BSA onto exposed the sensing surface (Fig. 1). The bound BSA blocks active sites and prevents additional non-specific molecules present in experimental samples from binding the measurement platform. Therefore, both the process by which BSA positioned during coating and the 3D structure of the antifouling layer can significantly influence biosensing performance (e.g., sensitivity, specificity).Invention
[0436] BSA based antifouling coating has been typically limited to noncovalent adsorption to the sensing surface. Disclosed herein is the develoμment of an emulsion-based antifouling coating composed of covalently cross-linked BSA that exhibits a multi-scale porous architecture (Fig. 2). An emulsion is a biphasic liquid mixture containing two immiscible liquids (e.g., oil and water). The inventors formulated the oil-in-water emulsion using Tip sonication where oil microdroplets are well dispersed in a PBS solution. Using various printing techniques, such as nozzle-assisted printing, drop-casting, or spin coating, this emulsion ink can be coated onto the working electrode.
[0437] When two immiscible liquids are introduced together, they tend to form two layers to minimize their free energy. Emulsion formation occurs through mechanical mixing, breaking up the two immiscible liquids into different sized oil droplets at their interfaces (Oil-in-water emulsion). Evaporation of the oil solvent combined with covalent crosslinking of BSA using glutaraldehyde or crosslinking of BSA followed by the evaporation of oil solvent results in the production of a coating that contains multi-scale pores corresponding to the sites where oil droplets evaporated. The thickness of this antifouling coating can be varied between 100 nm to 10 μm and its porosity can be controlled by altering the ratio of oil to water or using different types of oil compounds or different solvents. The thickness of the coating could be further increased but may have an insulation effect. However, such high thickness could be explored with other sensing technologies like microgap sensors, or alternative to using conventional polymers. By incorporating conducting nanomaterials (e.g., reduced graphene, gold nanoparticles, carbon nanotubes, etc.) within the emulsion, it is also possible to maintain transmission of electrochemical signals through the material.
[0438] The inventors reduced this concept to practice by first adding hexadecane (oil phase) into a PBS solution (water phase) containing BSA, gold nanowires (AuNWs), and SDBS (emulsifier). The volume percentage (hexadecane solution / PBS solution x 100%) of a mixture can be tuned to control the final porosity (e.g., pore size, pore-to-pore distance). SDBS was used as an emulsifier to help stabilize the suspension of oil droplets throughout the continuous phase, although other emulsifiers (e.g., SDS, Glyceryl Stearate, PEG 40 Stearate) may be used in its place. The mixture was then ultrasonicated to form an oil-in-water emulsion. Inkjet printing was used to coat this emulsion ink onto the working gold electrode of an electrochemical chip. Pressure (5-20kPa) was created to inject the ink, printing speed (5-20 mm / s) was tested to make a uniform liquid layer on the patterned electrode, and the temperature of printer bed was optimized to 50 °C. The chips were later rinsed and washed with PBS buffer in a shaker for 30 minutes. Mercury porosimetry analysis revealed a broad distribution of pore sizes within the 3D BSA matrix, including both macropores (1-3 μm) and nanopores (10-15 nm) that were generated by the evaporation of hexadecane and BSA-glutaraldehyde (GA) crosslinking, respectively (i.e., macropores are defined as materials having pores with diameters greater than 50nm). SEM and AFM were also utilized to investigate the porous structures, which clearly showed the coexistence of both sized pores (Fig. 3).
[0439] To investigate how this highly porous structure affects electrochemical signal detection, an amine-modified hairpin (HP) RNA probe was designed in which two methylene blue (MB) labeled oligonucleotides are hybridized at its 3' and 5' ends (Fig. 4). Covalent conjugation chemistry using EDC / NHS activation was used to attach the HP probes to the surface of the BSA coating. More specifically, the gold electrodes covered with porousantifouling BSA coating containing numerous HP RNA probes on its surface were incubated with 400 mM of EDC and 200 mM of NHS in 0.1 M MES buffer PH 6 for 30 minutes, rinsed with ultra-pure water, and dried with compressed air. Thereafter, the spotting of 1 μM HP probes on top of the working electrode area was performed using a microarray pin. The spotted chips were stored overnight at 4 °C in a humidity chamber. After conjugation, the chips were washed with nuclease-free DEPC-treated water containing 1 x rCutSmart buffer, quenched with 15 μL of 1 M ethanolamine for 30 minutes, and blocked with 10 pL of 2.5% BSA in PBS for 1 hour.
[0440] One control solid coating and 3 types of porous coatings were prepared using different emulsion ink formulations and their electrochemical performances were compared: BSA alone (no pores), BSA / GA / AuNWs (nanopores), BSA / AuNWs / Hexadecane (macropores), and BSA / AuNWs / GA / Hexadecane (multiscale pores). Electrochemical measurements, which were performed using cyclic voltammetry in 5 mM ferri- / ferrocyanide solution, showed that both macropores and multiscale pores resulted in a 5 times higher peak current than the coating with nanopore structures, and all were better than a solid coating. That is contributed to the fact that the presence of macropores increase film thickness and surface area-to- volume ratio of the matrix, which enables more redox probes to be attached to the BSA matrix.
[0441] To demonstrate the versatility of the emulsion method creating for nanocomposite conductive coatings, the inventors made reduced graphene oxide (rGO)-based BSA porous structures using spin coating. By using rGO, the nanocomposite cost can be reduced by ~ 99% compared to AuNWs. Also, pentaamine-functionalized rGOx (prGOx) based antifouling coating has been previously developed for unprecedented antifouling activities and diagnostic sensitivity (1, 2).
[0442] PrGOx was used to make the emulsion-based porous structures and determine their antifouling activities. First, the emulsion was made by sonicating a mixture of water phase solution (5mg prGOx / 10mg BSA / lml PBS) and oil phase solution (0.5 ml n-hexane). Then 10 pl GA was added to the 1ml emulsion ink, which was spin-coated (optimized at 1500 rpm) onto the piranha cleaned gold electrode to generate a highly uniform liquid layer. The chips were later annealed at 50 °C for 10 sec to induce the ultrafast crosslinking of BSA. The resulting emulsion-based BSA coating layer showed good antifouling activities by maintaining a very high current density of 83% even after 1 day of incubation in 1% soluble BSA (Fig. 5). To date, there are no reports of such an antifouling coating with micrometer thickness that displaysa high electrochemical signal as well as antifouling effects (the thickness of traditional antifouling coatings is about 10 nm).
[0443] For a proof-of-concept experiment, sensors were designed for detection of tissue inhibitor of metalloproteinase 1 (TIMP1) using an electrochemical (EC) enzymatic sandwich detection assay (Fig. 6). Briefly, the prGOx based EC chips were selectively coated with target-specific antibodies using spotting. Then, the chips were rinsed and incubated with serial diluted target proteins (0.01-10 ng / ml TIMP1 in RPMI medium with 10% fetal bovine serum (FBS)) for 1 hour, followed by sequentially incubating with biotinylated anti-target detection antibodies, streptavidin conjugated to HRP, and a form of tetramethylbenzidine (TMB enhanced one component, Sigma) that specifically precipitates on the working electrodes. When precipitated, the TMB creates an electro-active non-soluble layer on the electrode surface. Finally, EC readouts were performed using cyclic voltammetry in PBST (PBS with 0.05% Tween 20) to detect the TMB that precipitates on the working electrode when oxidized by HRP, as it yields an electro-active product. This assay allowed for dectecting the 10 μg / ml of TIMP1 with high sensitivity. To date, there are no reports of such an antifouling coating with micrometer scale thickness that shows a high sensitivity for TIMP1 or any other analyte. Moreover, increasing porosity and surface area enhances sensitivity relative to the previously described eRAPID antifouling coating method that only contains nanoscale pores (i.e., the LoD for the emulsion coating estimated at a confidence level of 3.3 was 20.9 μg / ml, which was 11 times lower than that of the previous eRAPID coating).REFERENCES:1. Zupancic, U., Jolly, P., Estrela, P., Moschou, D., Ingber, D. E., Graphene Enabled Low-Noise Surface Chemistry for Multiplexed Sepsis Biomarker Detection in Whole Blood. Adv. Funct. Mater. 2021, 31.2. Timilsina, S. S., Durr, N., Yafia, M., Sallum, H., Jolly, P., Ingber, D. E., Ultrarapid Method for Coating Electrochemical Sensors with Antifouling Conductive Nanomaterials Enables Highly Sensitive Multiplexed Detection in Whole Blood. Adv. Healthcare Mater. 2022, 11, 2102244.Example 2: Enhancing sensitivity of multiplexed electrochemical sensors with a nozzle jet-printed, thick, porous, antifouling conductive coating
[0444] Develoμment of field-deployable biochemical sensor devices that are capable of reliably detecting bioanalytes in complex biological fluids with high specificity andsensitivity is vital for diagnosis and management of various diseases, including viral infections. Described herein is a micrometer-thick, porous nanocomposite coating with both exceptional antifouling and electroconducting properties that greatly enhances the sensitivity of electrochemical sensors. Nozzle-assisted printing of oil-in-water emulsion is used to create a 1 micrometer thick coating composed of cross-linked albumin with interconnected pores, which also contains electroconducting gold nanowires. Using this approach, the antifouling conductive coating can be deposited only on the surface of the working electrode, and not on the reference and counter electrodes, which greatly facilitates the fabrication and functionality of multiplexed electrochemical sensors. The layer effectively resists biofouling and maintains rapid electron transfer kinetics for over one month when exposed directly to complex biological fluids, including serum and nasopharyngeal secretions. Compared to previously described thinner (nanometer thick) antifouling electroconductive coating made with drop casting or a spin coating of the same thickness, the nozzle-printed sensors coated with this thick porous nanocomposite exhibited sensitivities that were enhanced by 3.75- to 17-fold when three different target biomolecules were tested. As a result, emulsion-coated, multiplexed electrochemical sensors coated were able to carry out simultaneous detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) nucleic acid, antigen, and host antibody in clinical specimens with high sensitivity and specificity. This thick porous emulsion coating technology may provide a way to address hurdles currently restricting the application of electrochemical sensors for point-of-care (POC) diagnostic applications, as well as their use in implantable devices and other healthcare monitoring systems.
[0445] Bioelectronic devices, such as electrochemical sensors used for medical diagnostics, have witnessed remarkable growth, finding diverse applications in healthcare, energy, and environmental monitoring1-3. However, biofouling, the unwanted accumulation of biological materials on electrodes, presents a key challenge for the commercial develoμment of bioelectronic devices because it leads to performance and reliability issues due to inaccurate electrode functioning in biofuel cells, medical implants, and biosensors.4, 5Biofouling also can trigger immune responses and infections when devices contact living tissues6- 7. Therefore, practical strategies to mitigate biofouling are crucial for improving electronic device performance if they are to be successfully applied to solve critical medical diagnostic and sensing challenges.
[0446] Several antifouling technologies have been developed to combat biofouling6. These include tailored microtopography and surface functionalization techniques8-10, whichcan utilize hydrophilic or charged surfaces to repel biomolecules or biocidal surfaces to inhibit microbial growth11'13. Other approaches include using physical barriers, such as membranes or filters, to prevent fouling agents from reaching the device surface14. Despite significant progress in antifouling technologies, several challenges persist. First, conventional strategies exhibit limited mechanical robustness and stability as coatings may degrade or lose effectiveness over time due to environmental conditions or mechanical stress15. Second, antifouling coatings can sometimes obscure active sites on electrodes, rendering them inactive16, 17. This often poses a considerable barrier to mass transport, impeding the diffusion of target analytes toward the sensor surface, which leads to reduced sensitivity and longer response times17. Third, producing antifouling layers is costly, and thus scaling up for large- scale applications poses difficulties18, 19. Fourth, there is a risk of introducing toxic substances that could adversely affect human health or the environment20.
[0447] The manipulation of surface microarchitecture is a promising approach to achieving remarkable antifouling characteristics21. This method capitalizes on the intricate interplay between the small-scale physical features of a surface and the physicochemical properties of a fluid, thereby optimizing its hydrophobicity, capillary forces, and diffusion22. Notably, the implementation of porous structures, inspired by diverse biological systems, has proven effective in hindering biofouling through the control of pore size and capillary forces23,24. In addition to the antifouling capability, introducing interconnected pores into these coatings offers advantages that can enhance biomedical device functionalities by facilitating the efficient movement (i.e., diffusion) of fluids, ions, and molecules, enabling faster reaction kinetics and reduced response times25. This is particularly advantageous in applications such as biosensing (i.e., enhanced diffusion of molecules) that often utilize microfluidic systems where enhancing mass transport can improve signal detection, as well as in drug delivery (i.e., efficient release and distribution of therapeutic agents).26, 27Porous coatings also provide increased surface area for biodetection, which allows for greater interaction with biomolecules, such as nucleic acids, proteins, and cells, which enables a higher degree of biomolecular recognition and thus improves the sensing capabilities27. Surface packing density and film thickness are also critical factors for resisting non-specific biomolecular adsorption28, 29. For example, a surface coverage of over 80% has been shown to be essential for maintaining stable resistance against non-specific adsorption,30emphasizing the importance of high-density grafting of the surface layer.
[0448] Thin (~10 nanometer thick) porous antifouling coatings have been developed that are also impregnated with electroconducting materials, such as gold nanowires (AuNWs) or graphene oxide flakes, to further enhance conductivity while maintaining good biofouling properties even in complex biological fluids, such as serum and plasma16, 31. However, thin films with less than 50 nm thickness can face durability challenges over time due to physical shear stress30, 32. Also, because this thin antifouling coating was deposited using drop casting, it was applied to the entire surface of a multi-electrode array, which potentially can compromise the characteristics of the reference and counter electrodes and lead to a decrease in detection reliability33. For example, because the working electrode is the site where the desired electrochemical event occurs during molecular detection, the presence of an antifouling coating containing conductive materials at all sites could result in signal leakage between the electrodes and hinder the faradaic process at the working electrode.
[0449] For these reasons, in the present study, the inventors set out to develop a thicker porous antifouling conductive coating that could circumvent all of these potential limitations and thereby, provide significantly enhanced biosensing sensitivity. To address this challenge, a nozzle-printing method was developed to deposit an emulsion-templated porous nanocomposite coating with increased thickness (~ 1 μm) in precise positions on the surface of a multiplexed gold electrode array and compared its functionality to a drop cast nanocomposite antifouling coating16that is approximately 100-times thinner (~10 nm). Both nanocomposite coatings consist of the same cross-linked bovine serum albumin (BSA) matrix containing conductive nanomaterials, in this case gold nanowires (AuNWs). However, the nozzle-jet printing approach allowed us to locally deposit the thicker emulsion coating on the working electrode without compromising the characteristics of the reference and counter electrodes. As a result, a thick porous coating with unparalleled antifouling and conductive properties that greatly enhances multiplexed electrochemical sensor sensitivity was produced. The increased capabilities of this approach were also demonstrated by carrying out simultaneous detection of multiple clinically relevant bioanalytes - severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) nucleic acid, antigen, and host antibody - in clinical specimens with high sensitivity and specificity.Emulsion formulation and rheological properties
[0450] Porous structures can be prepared using various methods, including replica techniques, emulsion templating, direct foaming, capillary suspensions, and additive manufacturing34, 35. However, use of emulsion templating was pursued because it allows forthe simple and fine control of morphology by manipulating phase states, droplet size, and packing density25. Additionally, optimizing the type of immiscible liquids and the degree of droplet dispersion can improve rheological properties, which can lead to improved process efficiency.
[0451] The emulsion was applied to the surface of the electrodes using nozzle printing because it is a high-resolution and uniform patterning technique that offers several advantages over conventional printing techniques, such as screen-printing, drop-casting, and blade coating36'38. This approach not only reduces chip-to-chip variation but also ensures low-cost and high-throughput processability,39’40which can be crucial for future commercial scale-up. For the nozzle printing used here, an oil-in-water emulsion was prepared by ultrasonicating two immiscible liquids: an oil phase (hexadecane) and a water phase (phosphate buffer saline containing BSA and AuNWs) (Fig. 7a). To physically stabilize the matrix, glutaraldehyde (GA) was added to the emulsion immediately before printing, and then the emulsion was heated after printing to initiate cross-linking of the BSA31,41and promote oil evaporation, resulting in formation of interconnected nanoscale pores within a structurally stabilized matrix (Fig. 7a).
[0452] To monitor the maintenance of the emulsion state, the size distribution of oil droplets in the emulsion was analyzed by varying the sonication time. Dynamic light scattering (DLS) results indicated that the average droplet size decreased from 579.9 nm to 325.2 nm as the sonication time increased from 1 min to 25 min (Fig. 7b). When the sonication duration was extended to 40 min, the droplet size expanded back to the micron-scale. Notably, the sonication time of 25 min yielded a narrow size distribution, as characterized by a polydispersity index (PDI) value of 0.165.
[0453] To assess the shelf-life of the emulsion, UV-vis absorbance was measured (Fig. 7c) as the presences of oil droplets causes the scattering of light42, 43. When the sonication time deviated from 25 min, phase separation between oil and water occurred within 30 min, resulting in reduced absorbance retention ratios below 90%. In contrast, sonication of the emulsion for 25 min resulted in remarkable stability, with a 100% absorbance level being maintained for 2 hours and 90% absorbance was retained even after a day. When oil droplet diameter is less than 500 nm, nanoscale emulsions are less susceptible to gravitational separation and other physical forces, preventing undesirable phenomena like flocculation and sedimentation over time44. These findings support the notion that reducing the size and improving the uniformity of oil droplets contributed to an extended shelf-life of the emulsion observed herein.
[0454] Zeta potential offers information about the surface charge of dispersed droplets, further providing an indication of emulsion stability45. Increasing surface charge leads to a stronger electrostatic repulsive force between the droplets (Fig. 7d), preventing flocculation and maintaining droplet size46. Sonication for 25 min yielded a significantly high (absolute) zeta potential value of -75.5 ± 9.5 mV (Fig. 7e and Fig. 13). In contrast, deviations from this optimal sonication time decreased zeta potential. This observation is consistent with the results in Fig. 7b, c, confirming that a stable emulsion has a high zeta potential, while an unstable emulsion has a zeta potential approaching zero. Therefore, the sonication time was optimized to 25 min for subsequent experiments (Fig. 14).
[0455] A computational fluid dynamics (CFD) simulation was also conducted to investigate the velocity field during nozzle printing (Fig. 15a). For an aqueous solution without oil additives (control), inviscid flow resulted in a velocity surge at the nozzle tip, inducing drop splitting and unstable liquid ejection. In contrast, the emulsion displayed a moderate flow at the nozzle end, enabling stable patterning onto the electrode surface (Fig. 15b and 16). The emulsion exhibited shear-thinning behavior, a non-Newtonian property where the viscosity decreases under high shear rates. This behavior was modeled using the Carreau model, where the viscosity of the emulsion reached an appropriate value in the high-stress range47. The flow rate of emulsion at the nozzle tip was significantly reduced compared to the control solution, which exhibited Newtonian behavior with constant viscosity. As corroborated by the previous simulation42, the emulsion demonstrated superior performance in nozzle printing by virtue of its shear-thinning behavior and the prevention of high-speed droplet splitting. The capability to achieve uniform nanocomposite formation through nozzle printing is important because it allows for precise patterning of the emulsion on the working electrode and not on neighboring reference or counter electrodes (Fig. 7f,g) as well as the fabrication of high-performance electrochemical devices with minimized chip-to-chip variation (Fig. 17 and 18).Characterization of the emulsion-based nanocomposite
[0456] T o explore whether the thick nozzle printed coating obtained with the optimized emulsion exhibits improved properties, it was compared to two different antifouling conducting coatings also composed of cross-linked BSA containing the same concentration of AuNWs: a thin (~10 nm) nanocomposite coating that was created with the drop casting method previously shown to show excellent antifouling properties16and a thicker coating with the same composition and thickness as the emulsion coating, which was fabricated using spin coating (Fig. 8a). SEM images confirmed that all three nanocomposites exhibited dense coatings withthe corresponding thicknesses (i.e., ~ 10 nm for thin nanocomposite and 1 μm for both thick coating), although the emulsion exhibited larger pore sizes (17 to 51 nm vs 0.72 to 1.73 μm) (Fig. 8b).
[0457] The electrochemical characteristics of the nanocomposites at the interface with the solution were evaluated using cyclic voltammetry (CV) (Fig. 8c). Each nanocomposite underwent oxidation and reduction cycles in an electrochemically active solution. As expected, the cross-linking of albumin formed mesopores within the thin 10 nm coating, leading to relatively high peak currents. However, simply increasing the thickness of this nanocomposite to the micrometer scale using spin coating rendered the electrode nearly inactive, likely because of relatively decreased porosity (Fig. 8b). This thick nanocomposite only displayed 5.73% oxidation and 12.4% reduction peak currents compared to a bare electrode. In contrast, the nozzle printed emulsion-based nanocomposite of similar thickness incorporated more pores that were larger (34.8 nm vs 1.13 μm), and this was accompanied by significantly enhanced electrochemical activity. The emulsion-based coating exhibited 59.2% oxidation and 63.5% reduction currents based on a diffusion-limited process despite being more than 1 μm thick (Fig. 8d). This improved performance also may be to the AuNWs being more exposed to the solution through the macropores, thereby promoting nanoparticle-mediated electron transfer (Fig. 8e and Fig. 19).
[0458] To better understand the enhanced electrochemical properties of the porous emulsion-based nanocomposite, structural analyses was conducted. The BSA protein undergoes cross-linking through GA even in the presence of oil droplets as indicated by the UV-vis absorbance spectra, and this likely strengthens the structure before the formation of macropores (Fig. 20). This is further evident from the negative time-of-flight secondary ion mass spectrometry (TOF-SIMS) spectrum of the nozzle printed coating, which revealed that CN" and CNO" signals were presented in its spectrum, indicating an abundance of the peptide backbone of BSA within the coating (Fig. 8f and Fig. 21). Raman spectroscopic analyses also revealed a shift of the C-N peak, confirming the formation of peptide bonds between BSA and GA (Fig. 22). Atomic force microscopy (AFM) and mercury intrusion porosimetry (MIP) measurements verified the presence of macropores with an average size of 1.123 μm and mesopores with an average size of 9.53 nm (Fig. 8g, h). In addition, the emulsion-based nanocomposite exhibited a 38.7-fold increase in Brunauer-Emmett-Teller (BET) surface area compared to the thin nanocomposite (Fig. 23). These analyses confirmed the successful fabrication of a thick and highly porous nanocomposite composed of cross-linked BSAcontaining AuNWs. The engineered porosity effectively addresses the challenge of electrochemical deactivation that compromises many conventional antifouling coating approaches.Enhancement of electrochemical performance and antifouling activities
[0459] Field-deployable diagnostics must be portable and cost-effective, and provide accurate results rapidly using convenient sample types such as saliva or nasal swabs48. To compare the electrochemical performance and antifouling activities of the three antifouling conductive coatings, biosensors for detection of the SARS-CoV-2 gene, ORF la, were developed using the CRISPR / Casl2a-based nucleic acid detection approach in which Casl2a becomes activated in the presence of a target RNA and cleaves a single strand DNA (ssDNA) reporter probe conjugated with biotin that is normally bound to a complementary protein nucleic acid (PNA) immobilized on the surface of the nanocomposite. The presence of bound biotinylated reporter probe is detected by addition of poly streptavidin-horseradish peroxidase (HRP) and addition of a precipitable form of its substrate, 3,3',5,5'-tetramethylbenzidine (TMB), which results in its localized deposition on the surface of the working electrode49and an increase in peak current. Thus, detection of the target RNA results in CRISPR-based cleavage of the bound reporter probe and a reduction in peak current (Fig. 9a).
[0460] To examine the diffusion phenomena of electroactive species across the nanocomposite structures, CV was carried out using potassium ferro / ferricyanide solution prior to PNA immobilization on the electrodes (Fig. 9b, left). In line with the results displayed in Fig. 8c, d, the thin nanocomposite exhibited a higher peak current than the thick emulsion- based nanocomposite. This can be attributed to the enhanced diffusion of electroactive species owing to the nanoscale thickness of thin nanocomposite. Importantly, the thick emulsion-based coating demonstrated the most reproducible peak currents, showing the potential to create a more reliable sensing platform.
[0461] When the currents of the three nanocomposite-coated sensors were analyzed using this approach, the thick emulsion-based nanocomposite delivered more than 2.3-fold higher peak current than the thin nanocomposite (Fig. 9b, right). This result suggests an increased density of PNA and bound reporter probe as well as resultant TMB precipitation, which is likely driven by the expanded surface area available for redox reactions. This initial high peak current is pivotal for ensuring high sensitivity in CRISPR-based electrochemical diagnostics. During the analysis of confocal microscopy using FITC-labeled anti-IgG, thistrend was further validated by observing a 4.41 -fold increase in fluorescent intensity in the emulsion-based nanocomposite compared to the thin nanocomposite (Fig. 24).
[0462] The robustness of the nanocomposite-coated sensors was also evaluated in the face of various biofluids (Fig. 9c-e and Fig. 25). When chips were immersed in a 1% BSA solution or complex clinical samples, such as serum and nasopharyngeal samples, the bare Au electrodes quickly lost their activity due to the continuous adsorption of non-specific molecules and conductivity was entirely lost within 1 h in serum. The thin nanocomposite-coated electrodes exhibited relatively stable electrochemical characteristics for up to a week in a 1% BSA solution, consistent with past studies16. However, when subjected to these complex clinical samples, they experienced a steady cunent decrease, with approximately a 28% compared to the initial peak cunent after a week of exposure for both samples. In contrast, electrodes coated with the thick emulsion-based nanocomposite demonstrated superior antifouling properties against non-specific molecules by maintaining its electrochemical behavior for an entire month under all biofluid conditions (Fig. 9c-e). Compared to the initial peak cunent of approximately 20 pA, they exhibited only a slight signal decrease of about 1.9% over the course of a month and showed a high device uniformity with a coefficient variation of 8%.Electrochemical detection of viral infection
[0463] POC diagnostics play an indispensable role in detecting viruses beyond the confines of laboratories, thereby mitigating community transmission, as evidenced by the COVID-19 pandemic50. A comprehensive analysis of nucleic acid, antigen, and serological diagnosis can significantly increase testing accessibility, and expedite containment and treatment strategies. Whether a biosensor capable of simultaneous detection of SARS-CoV-2 RNA, antigen, and host antibody with enhanced sensitivity using the thick emulsion-based antifouling coating (Fig. 10a) could be developed was thus explored.
[0464] The CRISPR / Casl2a detection approach was used to detect the presence of SARS-CoV-2 RNA, which is measured as a decrease in peak current that is inversely proportional to the target RNA concentration. Reverse transcription and recombinase polymerase amplification (RT-RPA) were used to amplify the ORFla gene of SARS-CoV-2 because RT-RPA can amplify dsDNA up to 1 kb under moderate conditions (i.e., at room temperature or 37°C)51(Table 1). Four sets of primers for RT-RPA were evaluated and optimized using a fluorescence readout (Fig. 26 and 27). To evaluate sensitivity in relation tothe nanocomposite structures, the RT-RPA product, Casl2a / gRNA, and reporter probe were incubated on electrochemical sensors with different antifouling coatings and measured the peak current after the precipitation of TMB. The calibration curve of the thin nanocomposite-coated sensor displayed a linear increase from 1.7 to 170 copies p.1'1, with a limit of detection (LOD) of 4.01 copies μl-1(Fig. 10b). The calibration curve of the thick emulsion-based nanocomposite sensor demonstrated a linear increase in peak current from 0.1 to 10 copies μl-1, marking a sensitivity improvement of over 3.5-fold (LOD of 0.22 copies μl-1), which is based on the enhanced electrochemical performance of the sensor.
[0465] In addition to the CRISPR-based detection, an affinity-based sandwich strategy was implemented into the thick emulsion-based sensor, broadening its detection capability to include both SARS-CoV-2 antigen and host antibody52(Fig. 28-30). This strategy involves capturing the target antigen and antibody respectively using an antibody and antigen that are immobilized on the surface of the nanocomposites. Subsequently, these targets interact with a biotinylated secondary antibody, which binds with HRP and supports TMB precipitation. The optimization process for this sensor with the thick emulsion-based coating that is tailored for immunological diagnostics is presented in Fig. 31 and 32. Notably, this sensor exhibited a significantly improved sensitivity to the SARS-CoV-2 nucleocapsid protein, displaying a LOD of 1.9 μg ml'1, which is 10-fold lower than that of the thin nanocomposite (Fig. 10c). Similarly, a marked linearity was observed for IgG detection, with a relative LOD improvement of 17- fold (Fig. 10d). These data demonstrate the ability of the thick porous emulsion-based coating to substantially enhance target protein sensitivity while reducing noise, owing to its exceptional antifouling properties.
[0466] The performance of biosensors coated with the thick porous nanocomposite were then assessed using clinical samples. The electrochemical detection of the ORFla gene was initially conducted with these sensors using nasopharyngeal samples obtained from patients (Positive: 40, Negative: 20) (Table 2). The sensors were also used to detect SARS- CoV-2 nucleocapsid protein in the same samples (Positive: 40, Negative: 20) and IgG in serum (Positive: 33, Negative: 20), respectively (Table 3 and 4). The diagnostic results were deduced from the observed peak currents (Fig. 33). The receiver operating characteristic (ROC) curves for all targets illustrated impressive diagnostic accuracy with area under the curve (AUC) values of 1 for ORFla, 0.996 for the antigen, and 0.993 for the antibody (Fig. 10e-g). The ROC curves also provided cut-off current values that optimized the sum of sensitivity and specificity: 2.12 (ORFla), 0.857 (antigen), and 1.3 (IgG) pA. Utilizing these cut-off values, the emulsion-based nanocomposite biosensor accurately differentiated between positive and negative clinical samples with high sensitivity and specificity (Fig. 10h-j and Supplementary Table 5). The current results demonstrate the outstanding performance of biosensors coated with the thick emulsion-based antifouling nanocomposite across various clinical diagnostic applications.
[0467] The correlation between the electrochemical detection results and cycle threshold (Ct) values from RT-qPCR for the clinical samples was further explored (Fig. 10k). The plot revealed that the peak current from nucleic acid detection maintained relative consistency to the changes in Ct values. The CRISPR / Casl2a-based sensor was successful in detecting ORFla even at high Ct values (> 30). Moreover, a negative correlation was identified between Ct values and antigen detection levels with a Pearson's r value of -0.67. This suggests that the detected antigen increases in tandem with the viral load in the clinical sample, which is consistent with the clinical observation that SARS-CoV-2 RNA and antigen levels typically rise proportionally during the initial 6 days post-infection and subsequently decrease53, 54. Meanwhile, a mild positive correlation between Ct values and IgG detection levels was observed, reflected by a Pearson's r value of 0.42. Unlike RNA and antigen, antibodies begin to be detected after 6 days of viral infection due to seroconversion, and their titers remain stable for several months, echoing the antibody detection results53, 54. The remarkable AUC values achieved for ORFla, the antigen, and the antibody underscore the high sensitivity and specificity of the emulsion-based multiplexed biosensor, suggesting its practical efficacy for diagnostics of viral infections.Multiplexed detection of viral RNA, antigen, and antibody
[0468] The complex nature of COVID- 19 infections requires a comprehensive approach to analyzing test results for effective patient management and pandemic control, which can include molecular, antigen, and serology tests50. However, there is an unmet need for advanced diagnostic technologies that can carry out all of these detection assays simultaneously, which could facilitate a more accurate and comprehensive assessment of viral infections55. For this reason, simultaneously detection of SARS-CoV-2 nucleic acid, antigen, and host antibody was performed by spotting different capture probes onto adjacent working electrodes within the same sensor chip using the precise control capability of the nozzle jet printing method. Previous research suggests that nasopharyngeal specimens from severe SARS-CoV-2 patients contain detectable levels of RNA, antigen, and antibodies56. However,the patients examined were not as severely affected, and IgG was not detected in their sample across a broad spectrum of Ct values. Therefore, patient serum was spiked into the nasopharyngeal samples to verify the performance of the multiplexed COVID- 19 biosensor. Two consecutive assays were conducted: initially, 20 pl of the serum-spiked nasopharyngeal sample was incubated on a chip to detect both nucleocapsid protein and host antibody, and then RT-RPA was carried out using 5 pl of the sample, and the resulting products were incubated on the same chip with Casl2 / gRNA and reporter probe. Each target was then quantified simultaneously as an electrochemical signal, facilitated by the binding of poly streptavidin- HRP and the precipitation of TMB.
[0469] Four experimental sets were designed to evaluate the performance of multiplexing (Fig. 11a,b). Each set consisted of four distinct combinations determined by the presence or absence of spiked antibodies in COVID-19 positive and negative patient samples. In the positive sample spiked with IgG (SET 1), a positive molecular diagnostic response was observed for ORF la and both nucleocapsid protein and IgG targets also were detected as the difference between positive samples and the negative control is statistically significant. Conversely, in COVID- 19 positive nasopharyngeal samples without spiked IgG (SET 2), there was no significant alteration in the peak current from IgG detection as expected. Notably, the three targets were successfully distinguished with 100% accuracy in COVID-19 negative clinical samples based on the presence or absence of IgG (SET 3 and 4). These results suggest that the excellent antifouling properties and high porosity of the emulsion-based nanocomposite biosensor can resist non-specific binding and accurately recognize several target molecules simultaneously with excellent sensitivity and specificity in human clinical samples. The electrochemical sensors coated with the emulsion-based antifouling coating could be used to diagnose SARS-CoV-2 infection across a broader temporal range and to monitor disease progression. They may also offer potential utility in evaluating the efficacy of vaccination responses by simultaneously detecting viral RNA, antigen, and antibodies.
[0470] In this study, the inventors developed a nozzle printing method for selectively templating an emulsion-based, micrometer thick, porous coating that has both excellent antifouling and electroconducting properties on the surface of working electrodes, but not over closely apposed reference and counter electrodes (Fig. 12a). The technology leverages the unique properties of oil-in-water emulsions to achieve precise control over droplet size, surface charge, and ink stability. The removal of oil components within the composite results in a uniform distribution of pores, which leads to synergistic antifouling effects at the micro-scalelevel and enhanced diffusion through interconnected pores. The porous nanocomposite surface also can be easily functionalized with multiple capture probes via carbodiimide reaction, enabling enzymatic recognition of multiple target molecules57. This novel nanocomposite coating successfully mitigates the challenges of biofouling even with complex biological fluids and probe loading, and thus enhances the diagnostic performance of electrochemical sensors, as well as facilitates their multiplexing on the same chip (Table 6). Impressively, because of its porosity and the presence of conducting AuNWs within the cross-linked BSA nanocomposite, the coating maintains efficient electron transfer despite its thickness exceeding one micrometer (i.e., 100 times thicker than conventional antifouling matrices). Because of the interconnected pores achieved through BSA cross-linking and oil evaporation from the emulsion, the integration of nanoelectrodes promote enhanced electron diffusion, and thereby proper signal transmission at the working electrode.
[0471] A key element of this fabrication method is the use of nozzle printing, which is a high-resolution and uniform patterning technique that offers several advantages over conventional printing techniques such as screen-printing, drop-casting, and blade coating36'38. This approach not only reduces chip-to-chip variation but also ensures low-cost and high- throughput processability39’40. Using this method, multiplexed electrochemical sensors were fabricated that enabled simultaneous detection of SARS-CoV-2 RNA, antigens, and host antibodies with high sensitivity and specificity (Fig. 12b). The porous nanocomposite surface can be easily functionalized with multiple capture probes via carbodiimide reaction, enabling enzymatic recognition of multiple target molecules57. The exceptional antifouling activity of nanocomposite prevents signal degradation from non-specific species in nasopharyngeal secretions and serum. This advantage presents the potential to streamline sample pre- processing steps in on-site diagnostics. The developed high-precision diagnostic technology enables the collection of extensive immunological data in a simplified manner, allowing for a deeper understanding of the correlation between biomarkers of virus infection. Moreover, it has the potential to contribute to the analysis of individual immunity and vaccine efficacy, thereby improving quarantine measures and individual-tailored medical strategies and enabling prompt response to future infectious diseases.
[0472] This novel coating technology holds significant promise in the field of electrochemical biosensors. The excellent antifouling activity of the coating effectively prevents signal degradation caused by non-specific species in complex biofluids, which can streamline sample pre-processing steps in on-site diagnosis, simplifying overall testingmethodology and reducing the occurrence of false signals. Furthermore, the ability to functionalize the surface of the porous nanocomposite with multiple capture probes allows for the enzymatic recognition of various target molecules, including viral RNA, antigens, and host antibodies, as demonstrated here. This comprehensive diagnostic ability could be vital in managing future pandemics, where swift and accurate diagnosis is crucial. The collection of extensive diagnostic data in a simplified manner should enhance the understanding of the correlations among various biomarkers over the course of a viral infection. This may contribute not only to the enhancement of diagnostic accuracy and the monitoring of viral outbreaks, but also to the comprehension of disease progression and the customization of patient management strategies. Finally, the creation of a robust barrier against non-specific adsorption presents new opportunities for other types of biomedical devices as well, including healthcare monitoring and implantable devices. By reducing undesirable interactions with non-specific biomolecules, this technology has the potential to amplify device performance and durability, thereby improving their reliability.REFERENCES1. Sheng H, Zhang X, Liang J, Shao M, Xie E, Yu C, et al. Recent Advances of Energy Solutions for Implantable Bioelectronics. Adv. Healthc. Mater. 10, 2100199 (2021).2. Li Z, Tian X, Qiu C-W, Ho JS. Metasurfaces for bioelectronics and healthcare. Nat. Electron. 4, 382-391 (2021).3. Atkinson JT, Su L, Zhang X, Bennett GN, Silberg JJ, Ajo-Franklin CM. Real-time bioelectronic sensing of environmental contaminants. Nature 611, 548-553 (2022).4. Ratner BD, Bryant SJ. Biomaterials: where we have been and where we are going. Annu. Rev. Biomed. Eng. 6, 41-75 (2004).5. Maan AMC, Hofinan AH, Vos WM, Kamperman M. Recent Develoμments and Practical Feasibility of Polymer-Based Antifouling Coatings. Adv. Fund. Mater. 30, (2020).6. Daffom KA, Lewis JA, Johnston EL. Antifouling strategies: History and regulation, ecological impacts and mitigation. Mar. Pollut. Bull. 62, 453-465 (2011).7. Fu J, Zhang H, Guo Z, Feng D-q, Thiyagarajan V, Yao H. Combat biofouling with microscopic ridge-like surface morphology: a bioinspired study. J. R. Soc. Interface 15, 20170823 (2018).8. Magin CM, Cooper SP, Brennan AB . Non-toxic antifouling strategies . Materials Today 13, 36-44 (2010).9. Therien- Aubin H, Chen L, Ober CK. Fouling-resistant polymer brush coatings.Polymer 52, 5419-5425 (2011). Sakala GP, Reches M. Peptide-Based Approaches to Fight Biofouling. Adv. Mater. Interfaces 5, 1800073 (2018). Ostuni E, Chaμman RG, Hohnlin RE, Takayama S, Whitesides GM. A Survey of Structure-Property Relationships of Surfaces that Resist the Adsorption of Protein. Langmuir 17, 5605-5620 (2001). Cloutier M, Mantovani D, Rosei F. Antibacterial Coatings: Challenges, Perspectives, and Opportunities. Trends Biotechnol. 33, 637-652 (2015). Wei T, Tang Z, Yu Q, Chen H. Smart Antibacterial Surfaces with Switchable Bacteria- Killing and Bacteria-Releasing Capabilities. ACS Appl. Mater. Interfaces 9, 37511- 37523 (2017). Gao A, Yan Y, Li T, Liu F. Biomimetic urchin-like surface based on poly (lactic acid) membrane for robust anti-wetting and anti-bacteria properties. Mater. Lett. 237, 240- 244 (2019). Li J, Ueda E, Paulssen D, Levkin PA. Slippery Lubricant-Infused Surfaces: Properties and Emerging Applications. Adv. Fund. Mater. 29, 1802317 (2019). Sabate del Rio J, Henry OYF, Jolly P, Ingber DE. An antifouling coating that enables affinity-based electrochemical biosensing in complex biological fluids. Nat Nanotechnol. 14, 1143-1149 (2019). Campuzano S, Pedrero M, Yanez-Sedeno P, Pingarron JM. Antifouling (Bio)materials for Electrochemical (Bio)sensing. Int. J. Mol. Sci. 20, (2019). van Andel E, Lange SC, Pujari SP, Tijhaar EJ, Smulders MMJ, Savelkoul HFJ, et al. Systematic Comparison of Zwitterionic and Non-Zwitterionic Antifouling Polymer Brushes on a Bead-Based Platform. Langmuir 35, 1181-1191 (2019). Zheng L, Sundaram HS, Wei Z, Li C, Yuan Z. Applications of zwitterionic polymers. React. Funct. Polym. 118, 51-61 (2017). Bixler GD, Bhushan B. Biofouling: lessons ftom nature. Philosophical Transactions of the Royal Society A: Mathematical, Physical and Engineering Sciences 370, 2381-2417 (2012). Damodaran VB, Murthy NS. Bio-inspired strategies for designing antifouling biomaterials. Biomater. Res. 20, 18 (2016). Yang WJ, Neoh K-G, Kang E-T, Teo SL-M, Rittschof D. Polymer brush coatings for combating marine biofouling. Prog. Polym. Sci. 39, 1017-1042 (2014). Cao X, Pettitt ME, Wode F, Arpa Sancet MP, Fu J, Ji J, et al. Interaction of Zoospores of the Green Alga Ulva with Bioinspired Micro- and Nanostructured Surfaces Prepared by Polyelectrolyte Layer-by-Layer Self-Assembly. Adv. Funct. Mater. 20, 1984-1993 (2010). Bers AV, Wahl M. The Influence of Natural Surface Microtopographies on Fouling. Biofouling 20, 43-51 (2004). Aidemir Dikici B, Claeyssens F. Basic Principles of Emulsion Templating and Its Useas an Emerging Manufacturing Method of Tissue Engineering Scaffolds. Front. Bioeng. BiotechnoL 8, 875 (2020). Brauker JH, Carr-Brendel VE, Martinson LA, Crudele J, Johnston WD, Johnson RC. Neovascularization of synthetic membranes directed by membrane microarchitecture. J. Biomed. Mater. Res. 29, 1517-1524 (1995). RoyChaudhuri C. A review on porous silicon based electrochemical biosensors: Beyond surface area enhancement factor. Sens. Actuators B Chem. 210, 310-323 (2015). Li L, Chen S, Zheng J, Ratner BD, Jiang S. Protein Adsorption on Oligo(ethylene glycol)-Terminated Alkanethiolate Self-Assembled Monolayers: The Molecular Basis for Nonfouling Behavior. The Journal of Physical Chemistry B 109, 2934-2941 (2005). Zhao C, Li L, Wang Q, Yu Q, Zheng J. Effect of Film Thickness on the Antifouling Performance of Poly(hydroxy-functional methacrylates) Grafted Surfaces. Langmuir 27, 4906-4913 (2011). Yang W, Chen S, Cheng G, Vaisocherova H, Xue H, Li W, et al. Film Thickness Dependence of Protein Adsorption from Blood Serum and Plasma onto Poly(sulfobetaine)-Grafted Surfaces. Langmuir 24, 9211-9214 (2008). Zupancic U, Jolly P, Estrela P, Moschou D, Ingber DE. Graphene Enabled Low-Noise Surface Chemistry for Multiplexed Sepsis Biomarker Detection in Whole Blood. Adv. Funct. Mater. 31, (2021). Azzaroni O, Brown AA, Huck WTS. UCST Wetting Transitions of Polyzwitterionic Brushes Driven by Self-Association. Angew. Chem., Int. Ed. 45, 1770-1774 (2006). Elgrishi N, Rountree KJ, McCarthy BD, Rountree ES, Eisenhart TT, Dempsey JL. A Practical Beginner’s Guide to Cyclic Voltammetry. J. Chem. Educ. 95, 197-206 (2017). McClements DJ, Jafari SM. Improving emulsion formation, stability and performance using mixed emulsifiers: A review. Adv. Colloid Interface Sci. 251, 55-79 (2018). Alison L, Menasce S, Bouville F, Tervoort E, Mattich I, Other A et al. 3D printing of sacrificial templates into hierarchical porous materials. Sci. Rep. 9, 409 (2019). Suikkola J, Bjominen T, Mosallaei M, Kankkunen T, Iso-Ketola P, Ukkonen L, et al. Screen-Printing Fabrication and Characterization of Stretchable Electronics. Sci. Rep. 6, 25784 (2016). Lee J-C, Woo JH, Lee H-J, Lee M, Woo H, Baek S, et al. Microfluidic Screening- Assisted Machine Learning to Investigate Vertical Phase Separation of Small Molecule :Polymer Blend. Adv. Mater. 34, 2107596 (2022). Lee J-C, Seo H, Lee M, Kim D, Lee HS, Park H, et al. Investigation of the Effect of 3D Meniscus Geometry on Fluid Dynamics and Crystallization via In Situ Optical Microscopy-Assisted Mathematical Modeling. Adv. Mater. 34, 2105035 (2022). Park Y-G, An HS, Kim J-Y, Park J-U. High-resolution, reconfigurable printing of liquid metals with three-dimensional structures. Sci. Adv. 5, eaaw2844 (2019). Kwon K-S, Rahman MK, Phung TH, Hoath SD, Jeong S, Kim JS. Review of digital printing technologies for electronic materials. Flex. Print. Electron. 5, 043003 (2020).Ma X, Sun X, Hargrove D, Chen J, Song D, Dong Q, et al. A Biocompatible and Biodegradable Protein Hydrogel with Green and Red Autofluorescence: Preparation, Characterization and In Vivo Biodegradation Tracking and Modeling. Sci. Rep. 6, 19370 (2016). Kim SY, Choo Y, Bilodeau RA, Yuen MC, Kaufman G, Shah DS, et al. Sustainable manufacturing of sensors onto soft systems using self-coagulating conductive Pickering emulsions. Sci. Robot. 5, eaay3604 (2020). Shukla T, Uμmanyu N, Prakash Pandey S, Gosh D. Chapter 1 - Lipid nanocarriers. In: Grumezescu AM (ed). Lipid Nanocarriers for Drug Targeting. William Andrew Publishing, 2018, pp 1-47. Guha IF, Anand S, Varanasi KK. Creating nanoscale emulsions using condensation. Nat. Commun. 8, 1371 (2017). Zhang Y, Li K, Han X, Chen Q, Shao L, Bai D. A photochemical-responsive nanoparticle boosts doxorubicin uptake to suppress breast cancer cell proliferation by apoptosis. Sci. Rep. 12, 10354 (2022). Kadu PJ, Kushare SS, Thacker DD, Gattani SG. Enhancement of oral bioavailability of atorvastatin calcium by self-emulsifying drug delivery systems (SEDDS). Pharm. Dev. Technol. 16, 65-74 (2011). Carreau PJ. Rheological Equations from Molecular Network Theories. Trans. Soc. Rheol. 16, 99-127 (1972). Valera E, Jankelow A, Lim J, Kindratenko V, Ganguli A, White K, et al. CO VID-19 Point-of-Care Diagnostics: Present and Future. ACS Nano 15, 7899-7906 (2021). Timilsina SS, Durr N, Yafia M, Sallum H, Jolly P, Ingber DE. Ultrarapid Method for Coating Electrochemical Sensors with Antifouling Conductive Nanomaterials Enables Highly Sensitive Multiplexed Detection in Whole Blood. Adv. Healthc. Mater. 11, 2102244 (2022). Vandenberg O, Martiny D, Rochas O, van Belkum A, Kozlakidis Z. Considerations for diagnostic COVID-19 tests. Nat. Rev. Microbiol. 19, 171-183 (2021). Patchsung M, Jantarug K, Pattama A, Aphicho K, Suraritdechachai S, Meesawat P, et al. Clinical validation of a Casl3-based assay for the detection of SARS-CoV-2 RNA. Nat. Biomed. Eng. 4, 1140-1149 (2020). Timilsina SS, Ramasamy M, Durr N, Ahmad R, Jolly P, Ingber DE. Biofabrication of Multiplexed Electrochemical Immunosensors for Simultaneous Detection of Clinical Biomarkers in Complex Fluids. Adv. Healthc. Mater. 11, e2200589 (2022). Dhar BC. Diagnostic assay and technology advancement for detecting SARS-CoV-2 infections causing the COVID-19 pandemic. Anal. Bioanal. Chem. 414, 2903-2934 (2022). van Bockel D, Munier CML, Turville S, Badman SG, Walker G, Stella AO, et al. Evaluation of Commercially Available Viral Transport Medium (VTM) for SARS- CoV-2 Inactivation and Use in Point-of-Care (POC) Testing. Viruses 12, (2020). Yelagandula R, Bykov A, Vogt A, Heinen R, Ozkan E, Strobl MM, et al. Multiplexed detection of SARS-CoV-2 and other respiratory infections in high throughput bySARSeq. Nat. Commun. 12, 3132 (2021).56. Crescenzo-Chaigne B, Behillil S, Enouf V, Escriou N, Petres S, Ungeheuer MN, et al. Nasopharyngeal and serological anti SARS-CoV-2 IgG / IgA responses in COVID-19 patients. J Clin. Virol. Plus 1, 100041 (2021).57. Najjar D, Rainbow J, Sharma Timilsina S, Jolly P, de Puig H, Yafia M, et al. A lab-on- a-chip for the concurrent electrochemical detection of SARS-CoV-2 RNA and anti- SARS-CoV-2 antibodies in saliva and plasma. Nat. Biomed. Eng. 6, 968-978 (2022).Materials and MethodsPreparation of electrochemical chip
[0473] Electrochemical chips with working, reference, and counter electrodes were fabricated by depositing metallic electrodes (Cr / Au = 5 / 50 nm) onto a glass substrate (2.5 cm x 2.0 cm) using an e-beam evaporator (SNTEK Co., Ltd.). Before use, the chips underwent a cleaning process consisting of a 5 min sonication with acetone followed by another 5 min sonication with isopropanol. Subsequently, the chips were subjected to O2 plasma treatment (Femtoscience Inc., Korea) at 80 W for 8 minutes.Emulsion preparation using ultrasonication
[0474] To prepare the emulsion, a solution of 10 mg ml'1bovine serum albumin (BSA)(Sigma Aldrich, USA, no. A7906) and 30 % (v / v) gold nanowires (AuNWs) (Sigma Aldrich, USA, no. 716944) in PBS (Sigma-Aldrich, USA, no. D8537) was added to hexadecane (Sigma- Aldrich, USA, no. H6703) in a volume ratio of 2:1. The mixture was then sonicated using a micro-tip sonicator at 20 % amplitude, with a pulsing pattern of the 30s on and 10s off, for a total duration of 25 min (VC 505, Sonics & Materials). After sonication, the resulting emulsion was mixed with 70 % glutaraldehyde (GA) (Sigma Aldrich, USA, no. G7776) in a volume ratio of 70: 1. Prior to this, the GA was diluted in PBS at a volume ratio of 1 :7.Characterization of emulsion and porous nanocomposites
[0475] Emulsion was sonicated with 1, 5, 15, 25, and 40 min, and subsequently diluted to a 1:100 ratio for UV-vis spectroscopy, zeta-potential, and dynamic light scattering measurements. UV-vis spectroscopy (Lambda 1050, Perkin Elmer) was measured at 270 nm. Zeta potential and dynamic light scattering measurements (Zetasizer Nano, Malvern Instruments Ltd.) were measured at 25 °C. Contact angle measurements (SEO Phoenix) of the emulsion and an aqueous solution dissolved with 10 mg ml'1BSA were performed with O2plasma-treated gold chip. Porosity was measured by the mercury intrusion porosimetry (MIP) (Autopore 9605, Micromeritics). BET surface area was measured by the Nitrogen physisorption (3Flex, Micromeritics). BSA concentration was measured using Nanodrop (NanoDrop™ One, Thermo Fisher). Raman spectra and TOF-SIMS were measured using ARAMIS (Horiba Jobin Yvon) and TOF-SIMS5 (ION-TOF GmbH), respectively. Surface characterizations of both top and cross-sectional views were characterized using SEM (Hitachi S4800). Top views of all three nanocomposites were obtained by coating the samples onto O2plasma-treated glass substrates. Cross-sectional views of all three nanocomposites were carried out by coating the samples onto O2-plasma treated Si wafers. The topography and height profile of the emulsion-composite was measured by AFM (Probes Co, LTD., Korea). The AFM sample was prepared by coating the emulsion-composite onto an Oi-plasma treated Si wafer.Rheology measurement and CFD analysis of nozzle printing
[0476] The rheology measure is done with MCR 302 rheometer (Anton Paar). Shear rate (y) was swept from 0.01 to 100 s-1. Shear stress and viscosity are determined when steady stress is reached. Samples are freshly prepared before measurements. Emulsion is fitted to the Carreau model whose shear rate dependent viscosity is defined as previous article.where μinfis infinite shear rate viscosity; μ0is zero shear rate viscosity; Z is relaxation time; and n is power index. For control ink, Newtonian model is used whose viscosity is constant independently to y.
[0477] To study the velocity field of nozzle printing with two rheology models, computational fluid dynamic (CFD) simulation is conducted with COMSOL Multiphysics. Navier-stokes equations are used as governing equation to describe incompressible Newtonian fluids in geometry. Because the flow rate was in Laminar flow regime (Re=pUL / μ<10), the turbulent effect is not included [1]. For liquids with viscosity μ, momentum and mass conservation equations are solved aswhere u is the flow velocity; p is the pressure. Liquid properties follow the rheological measurement. The equation (1) is coupled with apparent viscosity (μapp) defined by Carreaumodel as described in rheology measure section. The meshing is constructed under ‘higher’ option, which is tested confine enough.Fabrication of thin-, thick-, emulsion-nanocomposites
[0478] The emulsion-processed nanocomposite was patterned onto the working electrode using a nozzle-assisted printer (BIO X6, CELLINK) at a pressure of 5 kPa and a printing speed of 20 mm s-1. The printing bed was heated to 30 °C during printing. After printing, the chips were placed in an oven at 80 °C for 30 min to induce BSA crosslinking and evaporation of the oil droplets. Subsequently, the emulsion-processed nanocomposite was washed with PBS in a shaker at 400 rpm for 30 min to remove any residual oil, followed by DI- water washing and drying with N2blowing to eliminate any remaining chemicals.
[0479] For the thin-nanocomposite, an aqueous solution consisting of 10 mg ml'1BSA and 30 % (v / v) AuNWs in 10 mM PBS was mixed with glutaraldehyde (GA) in a volume ratio of 68:2. The mixture was drop-casted onto the chip preheated to 85 °C for 30 s. The thin- nanocomposite was washed with PBS in shaker for 5 min, followed by DLwater washing and drying using N2 gas. Thick-nanocomposite was prepared using the same aqueous solution. The aqueous solution was spin-coated at 500 rpm for 45 s. The resulting liquid film was then heated in an oven at 85 °C for 30 min. The chip was washed with PBS in a shaker for 5 min, followed by DLwater washing and drying with N2 gas.Electrochemical characterization of the nanocomposites
[0480] Before EC characterization, all nanocomposites were functionalized using a solution of 400 mM l-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) (Sigma Aldrich, USA, no. E7750) and 200 mM N-hydroxysuccinimide (NHS) (Sigma Aldrich, USA, no. 130672) in a 50 mM MES buffer (Sigma-Aldrich, USA, no. M1317) for 30 min. To quench any unreacted functional groups, the nanocomposites were incubated with 1 M ethanolamine (Sigma- Aldrich, USA, no. 398136) in PBS for 30 min. Cyclic voltammograms (CV) were performed in 5 mM [Fe(CN)6]3' / 4' (Sigma-Aldrich, USA, no. P3289 and no. 702587) in 1 M KC1 (Sigma-Aldrich, USA, no. 58221) with a scan rate of 0.1 V s-1, covering a voltage range from -0.5 V and to 0.5 V (ZIVE SP1, WonATech, Co., Ltd.). The peak oxidation currents of all nanocomposites were calculated using IVMAN 1.5 software. To evaluate the antifouling activities, the chips were incubated in a 1 wt% BSA solution, nasopharyngeal specimens, and serum for various durations: 1 h, 3 h, 1 day, 1 week, and 1 month. Bare gold was used as acontrol to assess any decrease in electrochemical properties. The shelf-life of the emulsion- processed nanocomposite was tested under two different conditions: PBS at 4 °C and dry at 4 °C for various durations: 1 h, 1 day, 3 days, and 1 week.Fluorescence characterization of nanocomposites
[0481] All nanocomposites were functionalized using a solution of 400 mM EDC and 200 mM NHS in a 50 mM MBS buffer for 30 min. Nanocomposites were spotted with FITC- labeled anti-IgG (Sigma- Aldrich, USA, no. F9512) of 1 mg ml'1and washed thoroughly with PBS. Fluorescence images were demonstrated with the confocal microscope (Andor Dragonfly 200) with an excitation wavelength 488 nm. Fluorescence intensities were calculated by ImageJ measurements.Reverse transcription-recombinase polymerase amplification (RT-RPA)
[0482] According to the instructions provided in the Twist Amp manual, the primers and probe for the RT-RPA were designed to amplify a specific segment of the SARS-CoV-2 ORF gene. The sequence of the primers (Bioneer, Korea) utilized for ORF gene detection is as follows: Forward primer: 5’- AAATTGTTAAATTTATCTCAACCTGTGCTTGT-3’ (SEQ ID NO: 1), Reverse primer: 5’- AGTTTCTTCTCTGGATTTAACACACTTTCT -3’ (SEQ ID NO: 2) RT-RPA was performed in a reaction mixture containing 2.4 pl each of forward and reverse primer (10 pM), 29.5 pL rehydration buffer, 2.5 pl SYBR green I dye (20x), 1 pl M- MLV reverse transcriptase (200 U μl-1), 1.5 pl Murine Rnase inhibitor (40 U μl-1), 5 pl target RNA, and 3.2 pl nuclease-free water. The mixture was vortexed and subsequently added to the freeze-dried reaction pellets (TwistAmp basic kit, TwistDx, Cambridge, UK), followed by gentle mixing. To initiate the reaction, 2.5 pL of magnesium acetate (MgOAc) was dispensed into the tube's cap and spun down. The fluorescence signal of the RT-RPA reaction was monitored at 1 min intervals using a CFX Opus 96 RT-PCR system (Bio-Rad, CA, USA).ELISA assay for antigen and antibody detection
[0483] 96-well plates were used for ELISA assay. Capture probes, consisting of 1 μg ml'1SARS-CoV-2 nucleocapsid polyclonal antibody (Invitrogen, PAI -41386) for antigen detection and 0.5 μg ml'1antigen SI (SinoBiological, 40591-V08H) for antibody detection, were prepared in a 10 mM PBS buffer (pH 7.4). A volume of 100 pl of capture probes was added to ELISA plates (BioLegend, 423501) and incubated overnight at 4 °C. Subsequently,the plates were washed three times with 200 pl PBST, followed by the addition of 200 pl of blocking buffer (5% non-fat dry milk) for 1 h. 100 pl of clinical samples (e.g., NPS and serum), diluted in 2.5% non-fat dry milk, were added to well and incubated for 1 h. Detection antibodies, including lμg ml'1biotinylated Anti-SARS-CoV-2 nucleocapsid protein antibody (Abeam, ab284656) for antigen detection and including lμg ml'1biotin-SP AfifiniPure F(ab')2 Fragment Goat Anti-Human IgG (Jackson ImmunoResearch, 109-066-170) for antibody detection, were prepared. A volume of 100 pl of detection antibodies was added to the plates and incubated for 1 h. The plates were then supplemented with 100 pl of streptavidin-HRP (diluted 1 :200 in 2.5% blocking buffer), followed by a washing step. Turbo TMB substrate (100 pl; ThermoFisher, 34022) was added and incubated for 20 minutes, after which 100 pl of 0.1 M H2SO4 in water was added to stop the reaction. The absorbance of the plates was measured at 450 nm using a microplate reader (Safire, Tecan).CRISPR-based electrochemical detection of ORFla gene
[0484] Nucleic acids used in this study were synthesized from Integrated DNA Technologies, Inc. (Coralville, IA), Bioneer Co. (Daejeon, Korea), and Panagene (Daejeon, Korea). SARS-CoV-2 virus strain (BetaCoV / Korea / KCDC03 / 2020) and genomic RNA were obtained from the Korea Disease Control and Prevention Agency (KDCA) and stored at -80 °C until further use. The oligonucleotides for CRISPR assay were in the following sequence. PNA capture probe: 5’amine-ACAACAACAACAACA-3’ (SEQ ID NO: 10), Reporter probe: 5’-Biotin-AT TAT TAT TAT TAT TTG TTG TTG TTG TTG T-3’ (SEQ ID NO: 11). Poly streptavidin-HRP (Thermo Fisher, N200) binds to biotin within reporter probe, leading to localized TMB precipitation. Following RT-RPA amplification without viral RNA extraction, 5 pl of RT-RPA products were added to mixtures containing 42.5 pl CRISPR mix (100 nM Casl2a, 100 nM gRNA) and 50 nM reporter probes. The mixture was incubated for 20 min at 37 °C to activate Casl2a, resulting in cleavage of the reporter probe and preventing its binding to HRP. The chips, which were spotted with PNA capture probes, were incubated with a 40 pl mixture for 5 min, followed by incubation with poly streptavidin-HRP and TMB for 5 min and 2.5 min, respectively. Cyclic voltammetry measurements were performed using a potentiostat (ZIVE SP1, WonATech, Co., Ltd) with a scan rate of IV s-1.Electrochemical detection of SARS-CoV-2 antigen and host antibody
[0485] The chips were spoted with capture probes of 1 mg ml'1SARS-CoV-2 nucleocapsid polyclonal antibody (Thermo Fisher, PAI-41386) for antigen detection and 0.5 mg ml'1antigen SI (SinoBiological, 40591-V08H) for antibody detection. To obtain the calibration curve (Fig. 10b-d), SARS-CoV-2 nucleocapsid protein (GenScript, Z03480) and IgG (Invitrogen, MA5-35939) were selected as target antigen and antibody, respectively. After conjugation, the chips were washed with PBS and quenched using IM ethanolamine in PBS. To block any remaining binding sites, a solution of 5% non-fat dry milk in PBS containing 0.05% Tween 20 was applied. Each chip was then used to detect the SARS-CoV-2 nucleocapsid protein and IgG antibody against the immobilized capture probes. For the clinical studies, a total of 60 NPS samples and 53 serum samples were obtained from Gyeongsang National University College of Medicine. All samples were stored at -70 °C until they were used. The protocol was reviewed and approved by the Institutional Review Board of Gyeongsang National University College of Medicine in Changwon, Korea (IRB approval number: 2020-10-002). For antigen sensing, 5 pl of clinical NPS was mixed with 20 pl of a 2.5% non-fat dry milk solution. Similarly, for antibody sensing, 2.5 pl of clinical serum was mixed with 22.5 pl of a 2.5% non-fat dry milk solution. These mixtures were then incubated on the chips for 30 min. After rinsing with PBS, 25 μg ml'1detection antibodies (biotinylated Anti-SARS-CoV-2 nucleocapsid protein antibody for antigen detection and biotin-SP AffiniPure F(ab')2 Fragment Goat Anti-Human IgG for antibody detection) were added to the chips, followed by the addition of diluted poly streptavidin-HRP (1 :1000) in 0.1% BSA in PBST for 5 min and TMB for 2.5 min. CV measurements were performed with a scan rate of IV s-1to extract the peak oxidation current.Multiplexed electrochemical detection of nucleic acid, antigen, and antibody
[0486] To detect multiple targets on a chip, four working electrodes (WE) were utilized, each spoted with different capture probes: WEI with PNA, WE2 with SARS-CoV-2 nucleocapsid polyclonal antibody, WE3 with antigen SI, and WE4 as a BSA control. To determine the optimal dilution ratio of serum spiked into negative NPS (RT-qPCR negative), the spiked NPS was prepared by adding 2 pl of serum to 18 pl of NPS. The prepared spiked NPS was then added to the chip and incubated for 30 min. After rinsing, a solution containing the respective detection antibodies for antigen and antibody sensing was added and allowed to incubate for another 30 min. Simultaneously, NPS without RNA extraction was amplified using RT-RPA for 15 min, as mentioned previously. Following the amplification, 5 pl of theRT-RPA products were added to the CRISPR mix containing reporter probes and incubated on the chip for 20 minutes at 37 °C. The chips were then incubated with poly streptavidin-HRP and TMB for 5 and 2.5 min, respectively. CV measurements were performed with a scan rate of IV s-1, and the peak current was calculated using IVMAN 1.5 software.Table 1. Sequences of oligonucleotide used in this experiment.Table 2. Diagnostic results of 60 clinical samples (positive: 40, negative:20) by qRT-PCR and the electrochemical assay for detection of SARS-CoV-2 ORF la gene. Cut-off current value was determined from ROC curves: 2.12 μA.Table 3. Diagnostic results of 60 clinical samples (positive: 40, negative:20) by qRT-PCR and the electrochemical assay for detection of SARS-CoV-2 nucleocapsid protein. Cut-off current value was determined from ROC curves: 0.857 pA.Table 4. Diagnostic results of 53 clinical samples (positive: 33, negative: 20) by qRT-PCR and the electrochemical assay for detection of IgG. NPS were used to extract the Ct values. Cut-off current value was determined from ROC curves: 1.3 pA.Table 5. Summary of the ROC curve analysis of the clinical samples for electrochemical detection.Table 6. Comparison of the method described herein with previous electrochemical-basedSARS-CoV-2 detection.ORFla gene Nucleocapsid IgG antibody proteinReferences51. Chaibun, T., et al. Rapid electrochemical detection of coronavirus SARS-CoV-2. Nat Commun. 12, 802 (2021)52. Peng, R., et al. SPEEDS: A portable serological testing platform for rapid electrochemical detection of SARS-CoV-2 antibodies. Biosens. Bioelectron. 197, 113762 (2022)53. Yakoh, A., et al. Paper-based electrochemical biosensor for diagnosing COVID-19: Detection of SARS-CoV-2 antibodies and antigen. Biosens. Bioelectron. 176, 112912 (2021)54. Seo, G., et al. Rapid detection of COVID-19 causative virus (SARS-CoV-2) in human nasopharyngeal swab specimens using field-effect transistor-based biosensor. ACS nano, 14(4), 5135 (2020)55. Dou, Y., et al. A smartphone-based three-in-one biosensor for co-detection of SARS- CoV-2 viral RNA, antigen and antibody. Chem. Commun. 58(41), 6108 (2022)56. Li, X. et al. Enhancing the performance of paper-based electrochemical impedance spectroscopy nanobiosensors: An experimental approach. Biosens. Bioelectron. 177, 112672 (202...
Claims
CLAIMSWhat is claimed is:
1. A composition comprising a non-aqueous phase, an aqueous phase, a proteinaceous material, a conductive element, and an emulsifier (surfactant).
2. The composition of claim 1, wherein the composition is an emulsion, nanoemulsion, micelle or liposome.
3. The composition of claim 1 or 2, wherein the composition is an oil-in-water (o / w) emulsion, water-in-oil (w / o) emulsion, water-in-oil-in-water (w / o / w) emulsion, or oil-in-water-in-oil (o / w / o) emulsion.
4. The composition of any one of claims 1 -3, wherein a ratio of the aqueous phase to the non- aqueous phase is from about 1000: 1 to about 1 : 1 (v / v) (e.g., from about 500: 1 to about 1:1, 250:1 to about 1:1, from about 200:1 to about 1:1, from about 150:1 to about 1:1, from about q00:l to about 1:1, from about 75:1 to about 1:1, from about 50:1 to about 1:1, from about 40:1 to about 1:1, from about 30:1 to about 1:1, from about 20:1 to about 1:1, from about 15:1 to about 1:1, from about 10:1 to about 1:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2.75:1, about 2.5:1, about 2:1, about 1.75:1, about 1.5:1, about 1.25:1, or about 1:1).
5. The composition of any one of claims 1-4, wherein the non-aqueous phase comprises an oil, a wax, a fluorocarbon, a silicone, or any combination thereof.
6. The composition of any one of claims 1-5, wherein the non-aqueous phase comprises an oil.
7. The composition of any one of claims 1-6, wherein the non-aqueous phase comprises an oil selected from the group consisting of hydrocarbons, mineral oil, vegetable oils (e.g., soybean oil, peanut oil, com oil, sunflower oil, almond oil, castor oil, rapeseed oil, cocoa butter, olive oil, palm oil, hydrogenated palm oil, rice bran oil, macadamia integrifolia seed oil, argania spinosa kernel oil, safflower oil, rapeseed oil, palm kernel oil, cotton seed oil, sesame oil, linseed oil, hazelnut oil, walnut oil, pumpkin oil, grape seed oil, brazil nut oil, avocado oil, almond oil, avocado oil, sunflower oil, Jojoba oil, cocoa butter, and flaxseed oil), fats, waxes (e.g., candellila wax, carnauba wax, mineral wax, microcrystalline wax, Montan wax, Ozocerite wax, paraffin wax, petro latum wax, petroleum wax, synthetic wax,silicone waxes animal wax, beeswax, lanolin and its derivatives, vegetable wax, ouricurry wax, Japan wax, Esparto wax, cork fiber wax, and sugar cane wax), fatty alcohols, fatty acids, and medium chain triglycerides.
8. The composition of any one of claims 1-7, wherein the non-aqueous phase comprises a hydrocarbon.
9. The composition of any one of claims 1-8, wherein the non-aqueous phase comprises hexadecane, n-heptane, n-octane, or n-decane.
10. The composition of any one of claims 1-9, wherein the composition comprises the nonaqueous phase in an amount from about 1 wt% to about 50 wt%.
11. The composition of any one of claims 1-10, wherein the aqueous phase comprises water, a water-miscible liquid (such as lower alkanols, e.g., methanol, ethanol or propanol; glycols and polyglycols and the like), or any combination thereof.
12. The composition of any one of claims 1-11, wherein the aqueous phase comprises a buffer (e.g., phosphate buffer, phosphate buffered saline (PBS), acetate buffer, histidine buffer, succinate buffer, HEPES buffer, tris buffer, carbonate buffer, citrate buffer, glycine buffer, barbital buffer, and cacodylate buffer).
13. The composition of any one of claims 1-12, wherein the composition comprises the aqueous phase in an amount about from about 50 wt% to about 95 wt%14. The composition of any one of claims 1-13, wherein the emulsifier is an anionic, nonionic, cationic, zwitterionic or amphoteric surfactant.
15. The composition of any one of claims 1-14, wherein the emulsifier is selected from the group consisting of C12-C18fatty alcohols; alkoxylated C12-C18fatty alcohols: C12-C18fatty acids; and alkoxylated C12-C18fatty acids, the alkoxyhtes each having .10 to 30 units of ethylene oxide, propylene oxide, and combinations of ethylene oxide / propylene oxide; C8- C22alkyl mono- and oligoglycosides; ethoxylated sterols: partial esters of polyglycerols; esters and partial esters of polyols having 2 to 6 carbon atoms and saturated and unsaturated fattyracids having 12 to 30 carbon atoms; partial esters of polyglycerols; and organosiloxanes; and combinations thereof16. The composition of any one of claims 1-15, wherein the emulsifier is sodium dodecylbenzene sulfonate, sodium dodecyl sulfate (SDS), glyceryl stearate, PEG 40 stearate, sodium lauroyl sarcosine, potassium lauroyl sarcosine, aodium cocoacylsarcosinate, cocoyl flesh Propylhomoserin potassium, sodium lauroyhnethyl taurate, sodium cocoyl methyl sodium taurocholate, sodium lauroyl glutamate, lauryl trimethyl ammonium chloride, stearyl trimethyl ammonium chloride, benzethonium chloride, cetyl pyridinium chloride, cetyl pyridinium chloride benzalkonium chloride, stearyl dimethyl benzyl ammonium chloride, polyoxyethylene lauryl ether sodium sulfete, sodium lauryl sulfete, sodium myristyl sulfete, sodium N-lauroyl sarcosinate, sodium N-myristol sarcosine, sodium coconut fetty acid monoglyceride monosulfete, sodium lauryl sulfoacetate, sodium a-olefin sulfonate, sodium N-palmitoyl glutamate, sodium N-methyl- N-acyl taurate, sucrose fetty acid ester, maltose fetty acid ester, maltitol fetty acid ester, lactol fetty acid ester, sorbitan fetty acid ester, polyoxyethylene sorbitan monostearate, polyoxyethylene higher alcohol ether, polyoxyethylene cured Castor oil, polyoxyethylene polyoxypropylene copolymer, polyoxyethylene polyoxypropylene fetty acid ester, polyglycerin fetty acid ester, coconut oil fetty acid amidopropyl betaine, lauryldimethylaminoacetic acid betaine, lauryldimethylamine oxide, 2-alkyl-N- carboxymethyl-N-hydroxyethylimidazolium betaine, N-lauryldiaminoethylglycine, N- myristyldiaminoethylglycine, sodium N-alkyl-1 -hydroxyethylimidazoline betaine, or any combination thereof.
17. The composition of any one of claims 1-16, wherein the emulsifier is present in an amount from about 0.01% to about 10% (w / v).
18. The composition of any one of claims 1-17, wherein the emulsion comprises articles having a size of about 2.5 μm or less, optionally, a size of about 900 nm or less, and preferably a size of from about 250 nm to about 750 nm, and more preferably a size from about 325 nm to about 625 nm, and even more preferably a size of about 500 nm.
19. The composition of any one of claims 1-18, wherein the conducting element is in the aqueous phase.
20. The composition of any one of claims 1-19, wherein the composition comprises the conductive element in an amount from about 0.01% to about 10% (w / v).
21. The composition of any one of claims 1-20, wherein a ratio of the proteinaceous material to the conductive element is from about 10:1 to about 1:1 (w / w).
22. The composition of any one of claims 1-21, wherein the conducting material comprises conductive particles, conductive rods, conductive fibers, conductive nano-particles,conductive polymers, conductive nano-flakes, conductive nanotubes, semi-conductive particles, semi-conductive rods, semi-conductive fibers, semi-conductive nano-particles, semi-conductive nano-flakes, semi-conductive nanotubes, or semi-conductive polymers.
23. The composition of any one of claims 1-22, wherein the conducting material is a metal, a metalloid, a conducting polymer, a conducting carbon-based material, or any combination thereof.
24. The composition of any one of claims 1-23, wherein the conducting material comprises an allotrope of carbon atoms arranged in a hexagonal lattice.
25. The composition of any one of claims 1-24, wherein the conducting material is graphite, functionalised graphene oxide, reduced graphene oxide, or carbon nanotubes (CNTs).
26. The composition of claim 25, wherein the carbon nanotubes are carboxylated carbon nanotubes or aminated carbon nanotubes.
27. The composition of claim 25, wherein the reduced graphene oxide is a carboxylated reduced graphene oxide or an aminated reduced graphene oxide.
28. The composition of any one of claims 1-23, wherein the conductive material comprises gold.
29. The composition of any one of claims 1-28, wherein the proteinaceous material is in the aqueous phase.
30. The composition of any one of claims 1-29, wherein the composition comprises the proteinaceous material in an amount from about 0.1% to about 10% (w / v).
31. The composition of any one of claims 1-30, wherein the proteinaceous material is denatured.
32. The composition of any one of claims 1-31, wherein the proteinaceous material is non- reversibly denatured.
33. The composition of any one of claims 1-32, wherein the proteinaceous material is a globular protein.
34. The composition of any one of claims 1-33, wherein the proteinaceous material is a nonglycosylated protein.
35. The composition of any one of claims 1-34, wherein the proteinaceous material is a serum albumin protein.
36. The composition of any one of claims 1-35, wherein the proteinaceous material is bovine serum albumin (BSA) or human serum albumin (HSA).
37. The composition of any one of claims 1-36, wherein the proteinaceous material is cross- linked with the conductive element.
38. The composition of any one of claims 1-37, wherein the proteinaceous material is cross- linked to the conductive element by a linker.
39. The composition of claim 38, wherein the linker is glutaraldehyde, genipin, or polyethylene glycol.
40. The composition of any one of claims 1-39, wherein the proteinaceous material is cross- linked to itself.
41. The composition of any one of claims 1-40, wherein the proteinaceous material is cross- linked to itself by a linker.
42. The composition of claim 41 , wherein the linker is glutaraldehyde, genipin, or polyethylene glycol.
43. The composition of any one of claims 1-42, wherein the composition further comprises a target binding molecule capable of binding with a target molecule.
44. The composition of claim 43, wherein the target binding molecule is covalently linked to the proteinaceous material.
45. The composition of claim 43 or 44, wherein the target binding molecule is a receptor, a ligand for a receptor, an antibody, antigen binding fragment of an antibody, an antigen, an enzyme or a nucleic acid.
46. The composition of any one of claims 43-45, wherein the target binding molecule is an antibody, an antigen binding fragment of an antibody or an antigen.
47. The composition of any one of claims 43-46, wherein composition comprises a first capture agent for detecting a first target molecule by a first detection modality and a second capture agent for detecting a second target molecule by a second detection modality.
48. The composition of claim 47, wherein one of the first and second detection modality is a nucleic acid-based detection method (e.g., CRISPR / Casl2a-based nucleic acid detection) and the other one is an ELISA based detection method.
49. The composition of any one of claims 1-48, wherein the composition comprises an anti- microbial agent.
50. The composition of claim 49, wherein the anti-microbial agent is an anti-bacterial agent, antifungal agent or anti-viral agent.
51. The composition of claim 49 or 50, wherein the anti-microbial agent is an anti-bacterial agent.
52. The composition of claim 51, wherein the anti-bacterial agent is selected from the group consisting of macrolides or ketolides such as erythromycin, azithromycin, clarithromycin, and telithromycin; beta-lactams including penicillin, cephalosporin, and carbapenems such as carbapenem, imipenem, and meropenem; monolactams such as penicillin G, penicillin V, methicillin, oxacillin, cioxacillin, dicloxacillin, nafcillin, ampicillin, amoxicillin, carbenicillin, ticarcillin, mezlocillin, piperacillin, azlocillin, temocillin, cepalothin, cephapirin, cephradine, cephaloridine, cefazolin, cefamandole, cefuroxime, cephalexin, cefprozil, cefaclor, loracarbef, cefoxitin, cefmetazole, cefotaxime, ceftizoxime, cefiriaxone, cefoperazone, ceftazidime, cefixime, cefpodoxime, ceftibuten, cefdinir, cefpirome, cefepime, cefadroxil, ceftriaxone, ceftobiprole and astreonam; quinolones such as nalidixic acid, oxolinic acid, norfloxacin, pefloxacin, enoxacin, ofloxacin, levofloxacin, ciprofloxacin, temafloxacin, lomefloxacin, fleroxacin, grepafloxacin, sparfloxacin, trovafloxacin, clinafloxacin, gatifloxacin, moxifloxacin, sitafloxacin, ganefloxacin, gemifloxacin and pazufloxacin; antibacterial sulfonamides and antibacterial sulphanilamides, including para-aminobenzoic acid, sulfadiazine, sulfisoxazole, sulfamethoxazole and sulfathalidine; aminoglycosides such as streptomycin, neomvcin, kanamycin, paromycin, gentamicin, tobramycin, amikacin, netilmicin, spectinomycin, sisomicin, dibekalin and isepamicin; tetracyclines such as tetracycline, chlortetracycline, demeclocycline, minocycline, oxytetracycline, methacycline, doxycycline; rifamycins such as rifampicin (also called rifampin), rifapentine, rifabutin, bezoxazinorifamycin and rifaximin; lincosamides such as lincomycin and clindamycin; glycopeptides such as vancomycin and teicoplanin; streptogramins such as quinupristin and daflopristin; oxazolidinones such as linezolid; polymyxin, colistin and colymycin; trimethoprim, bacitracin, and phosphonomycin.
53. The composition of claim 49 or 50, wherein the anti-microbial agent is an antifungal agent.
54. The composition of claim 53, wherein the antifungal agent is selected from the group consisting of azoles (e.g., barleyconazole, butoconazole, clortrimazole, econazole,fluconazole, isavuconazole, itraconazole, ketoconazole, miconazole, oxyconazole, posaconazole, ravuconazole, saperconazole, sulconazole, tercocnazole, tioconazole, voriconazole, and ciclopirox), polyenes (e.g., natamycin, lucensomycin, nystatin, amphotericin B, etc.), echinocandins (e.g., Cancidas), pradimicins (e.g., beanomicins, nikkomycins, sordarins, allylamines, etc.), Triclosan, Piroctone, fenpropimorph, terbinafine, cyclopyroxolamine, flucitocin, griseofiilvin haloprozin, tolnaftate, naphthypine, hydrochloride, morpholine, butenapin, undecylenic acid, propionic acid, and derivatives and analogs thereof.
55. The composition of claim 49 or 50, wherein the anti-microbial agent is an antimicrobial peptide or polymer.
56. The composition of claim 49 or 50, wherein the anti-microbial agent is a metal particle.
57. The composition of claim 56, wherein anti-microbial agent is titanium oxide, copper, or silver nanoparticles.
58. The composition of any one of claims 1-57, wherein the composition further comprises a therapeutic agent, e.g., anti-inflammatory drugs sirolimus, everolimus, biolimus (A9), zotarolimus (ABT-578), tacrolimus, and pimecrolimus, genistein, steroids (dexamethasone, prednisolone, methylprednisolone and hydrocortisone), fluocinolone acetonide, hormones etc.
59. The composition of any one of claims 1-58, wherein the emulsion further comprises a polymer.
60. The composition of claim 59, wherein the polymer is a water miscible polymer.
61. The composition of claim 59 or 60, wherein the polymer is a degradable polymer62. The composition of any one of claims 59-61, wherein the polymer is selected from the group consisting of poly(N-isopropyl acrylamide) (PNIPAAm), polyethylene glycol (PEG), alginate, polytetrafluoroethylene (PTFE), polyacetylene (PA), polyaniline (PANI), polypyrrole (PPy), polythiophene (PTH), poly(para-phenylene) (PPP), poly(phenylenevinylene) (PPV), and polyfuran (PF).
63. A surface comprising an antifouling coating layer on at least a part of the surface, wherein the antifouling coating layer comprises a composition of any one of claims 1-62.
64. An electrode comprising: (i) a conductive substrate (e.g., an electrically conductive substrate); and (2) an antifouling coating layer on at least a portion of a surface of theconductive substrate, and wherein the antifouling coating layer comprises: a proteinaceous material and a conductive element, and wherein the antifouling coating layer is porous and comprises macropores.
65. The electrode of claim 64, wherein the antifouling coating layer comprises macropores with a diameter of about 0.1 μm to about 10 μm (e.g., about 0.5 μm to about 5 μm, such as from about 1 μm to about 3 μm).
66. The electrode of any one of clams 64-65, wherein the conductive substrate comprises gold, silver, copper, platinum, aluminum, stainless steel, tungsten, indium tin oxide, titanium, lead, nickel, palladium, zirconium, niobium, tantalum, chromium, molybdenum, manganese, rhenium, ruthenium, rhodium, iridium, silicon, polyimide, parylene, benzocyclobutene, carbon, graphite, or any combination thereof.
67. The electrode of any one of claims 64-66, wherein the conductive substrate comprises a flexible substrate.
68. The electrode of claim 67, wherein the flexible substrate comprises polyethylene terephthalate, polyethylene naphathalate, polyimides, polymeric hydrocarbons, celluloses, plastics, polycarbonates, polystyrenes, or any combination thereof.
69. The electrode of any one of claims 64-68, wherein the antifouling coating layer is adapted for contact with an analyte or a sample comprising an analyte.
70. The electrode of any one of claims 64-69, wherein the electrode is a planar or 3- dimensional electrode.
71. A surface comprising an antifouling coating layer on at least a part of the surface, wherein the antifouling coating layer comprises: a proteinaceous material and a conductive element, and wherein the antifouling coating layer is porous and comprises macropores.
72. The surface of claim 71, wherein the antifouling coating layer comprises macropores with a diameter of about 0.1 μm to about 10 μm (e.g., about 0.5 μm to about 5 μm, such as from about 1 μm to about 3 μm).
73. The surface of claim 71 or 72, wherein the antifouling coating layer is directly or indirectly connected with an electrode.
74. A method for preparing a surface with an antifouling coating layer, the method comprising: (a) coating at least a part of a surface with a composition of any one of claims 1-62; and(b) removing, at least a part of, the non-aqueous phase, thereby forming an antifouling coating layer on the surface.
75. The method of claim 74, wherein the antifouling coating layer is porous and comprises macropores.
76. The method of claim 74 or 75, wherein the antifouling coating layer is porous and the comprises macropores with a diameter of about 0.1 μm to about 10 μm (e.g., about 0.5 μm to about 5 μm, such as from about 1 μm to about 3 μm).
77. The method of any one of claims 74-76, wherein the method further comprises cross- linking the proteinaceous material.
78. The method of any one of claims 74-77, wherein said step of cross-linking the proteinaceous material is prior to the step of removing the non-aqueous phase.
79. The method of any one of claims 74-78, wherein said step of cross-linking the proteinaceous material is after the step of removing the non-aqueous phase.
80. The method of any one of claims 74-79, further comprising a step of coating a surface of the antifouling coating layer with a target binding molecule.
81. The method of claim 80, wherein said coating with the target binding molecule comprises conjugating the target binding molecule to a component of the antifouling coating layer.
82. The method of claim 80 or 81, wherein said coating with the target binding molecule comprises conjugating the target binding molecule with the proteinaceous material.
83. The method of any one of claims 74-82, wherein said coating the surface comprises spin coating, nozzle-assisted printing (e.g., inkjet printing), drop-casting, roll coating, spray coating, dip coating, gravure coating, bar coating, vapor coating, or knife coating.
84. The method of any one of claims 74-83, wherein the antifouling coating layer is directly or indirectly connected with an electrode.
85. The method of any one of claims 74-84, wherein the surface is a surface of a conductive substrate (e.g., an electrically conductive substrate).
86. The method of claim 85, wherein the substrate is an electrode.
87. The electrode of any one of claims 64-70, the surface of any one of claims 71-73 or the method of any one of claims 74-86, wherein the antifouling coating layer has a porosity of about 5% to about 95%.
88. The electrode, surface or method of claim 87, wherein the antifouling coating layer comprises mesopores (e.g., pores having a diameter from about 5 nm to about 99 nm).
89. The electrode, surface or method of claim 87 or 88, wherein the antifouling coating layer comprises an emulsifier.
90. The electrode, surface, or method of claim 89, wherein the emulsifier is an anionic, nonionic, cationic, zwitterionic or amphoteric surfactant.
91. The electrode, surface, or method of claim 89 or 90, wherein the emulsifier is selected from the group consisting of C12-C18fatty alcohols; alkoxylated C12-C18fatty alcohols; C12- C18fatty acids; and alkoxylated C12-C18fatty acids, the alkoxylates each having 10 to 30 units of ethylene oxide, propylene oxide, and combinations of ethylene oxide / propylene oxide: C8-C22alkyl mono- and oligoglycosides: ethoxylated sterols; partial esters of polyglycerols; esters and partial esters of polyols having 2 to 6 carbon atoms and saturated and unsaturated fatty acids having 12 to 30 carbon atoms; partial esters of polyglycerols: and organosiloxanes; and combinations thereof92. The composition of any one of claims 89-91, wherein the emulsifier is sodium dodecylbenzene sulfonate, sodium dodecyl sulfate (SDS), glyceryl stearate, PEG 40 stearate, sodium lauroyl sarcosine, potassium lauroyl sarcosine, aodiurn coco acylsarcosinate, cocoyl flesh Propylhomoserin potassium, sodium lauroylmethyl taurate, sodium cocoyl methyl sodium taurocholate, sodium lauroyl glutamate, lauryl trimethyl ammonium chloride, stearyl trimethyl ammonium chloride, benzethonium chloride, cetyl pyridinium chloride, cetyl pyridinium chloride benzalkonium chloride, stearyl dimethyl benzyl ammonium chloride, polyoxyethylene lauryl ether sodium sulfate, sodium lauryl sulfate, sodium myristyl sulfate, sodium N-lauroyl sarcosinate, sodium N-myristol sarcosine, sodium coconut fatty acid monoglyceride monosulfate, sodium lauryl sulfoacetate, sodium a-olefin sulfonate, sodium N-palmitoyl glutamate, sodium N-methyl- N-acyl taurate, sucrose fatty acid ester, maltose fatty acid ester, maltitol fatty acid ester, lactol fatty acid ester, sorbitan fatty acid ester, polyoxyethylene sorbitan monostearate, polyoxyethylene higher alcohol ether, polyoxyethylene cured Castor oil, polyoxyethylene polyoxypropylene copolymer, polyoxyethylene polyoxypropylene fatty acid ester, polyglycerin fatty acid ester, coconut oil fatty acid amidopropyl betaine, lauryldimethylaminoacetic acid betaine, lauryldimethylamine oxide, 2-alkyl-N-carboxymethyl-N-hydroxyethylimidazolium betaine, N-lauryldiaminoethylglycine, N- myristyldiaminoethylglycine, sodium N-alkyl-l-hydroxyethylimidazoline betaine, or any combination thereof.
93. The electrode, surface, or method of any one of claims 88-92, wherein the antifouling coating layer comprises an oil, a wax, a fluorocarbon, a silicone, or any combination thereof.
94. The electrode, surface, or method of any one of claims 88-93, wherein the antifouling coating layer comprises an oil.
95. The electrode, surface, or method of any one of claims 88-94, wherein the antifouling coating layer comprises an oil selected from the group consisting of hydrocarbons, mineral oil, vegetable oils (e.g., soybean oil, peanut oil, com oil, sunflower oil, almond oil, castor oil, rapeseed oil, cocoa butter, olive oil, palm oil, hydrogenated palm oil, rice bran oil, macadamia integrifolia seed oil, argania spinosa kernel oil, safflower oil, rapeseed oil, palm kernel oil, cotton seed oil, sesame oil, linseed oil, hazelnut oil, walnut oil, pumpkin oil, grape seed oil, brazil nut oil, avocado oil, almond oil, avocado oil, sunflower oil, Jojoba oil, cocoa butter, and flaxseed oil), fats, waxes (e.g., candellila wax, carnauba wax, mineral wax, microcrystalline wax, Montan wax, Ozocerite wax, paraffin wax, petro latum wax, petroleum wax, synthetic wax, silicone waxes animal wax, beeswax, lanolin and its derivatives, vegetable wax, ouricurry wax, Japan wax, Esparto wax, cork fiber wax, and sugar cane wax), fatty alcohols, fatty acids, and medium chain triglycerides.
96. The electrode, surface, or method of any one of claims 88-95, wherein the antifouling coating layer comprises a hydrocarbon.
97. The electrode, surface, or method of any one of claims 88-96, wherein the antifouling coating layer comprises hexadecane, n-heptane, n-octane, or n-decane.
98. The electrode, surface, or method of any one of claims 88-97, wherein a ratio of the proteinaceous material to the conductive element is from about 10:1 to about 1:1 (w / w).
99. The electrode, surface, or method of any one of claims 88-98, wherein the conducting material comprises conductive particles, conductive rods, conductive fibers, conductive nano-particles, conductive polymers, conductive nano-flakes, conductive nanotubes, semi- conductive particles, semi-conductive rods, semi-conductive fibers, semi-conductive nano-particles, semi-conductive nano-flakes, semi-conductive nanotubes, or semi-conductive polymers.
100. The electrode, surface, or method of any one of claims 88-99, wherein the conducting material is a metal, a metalloid, a conducting polymer, a conducting carbon based material, or any combination thereof.
101. The electrode, surface, or method of any one of claims 88-100, wherein the conducting material comprises an allotrope of carbon atoms arranged in a hexagonal lattice.
102. The electrode, surface, or method of any one of claims 88-101, wherein the conducting material is graphite, functionalised graphene oxide, reduced graphene oxide, or carbon nano-tubes (CNTs).
103. The electrode, surface, or method of claim 88-102, wherein the carbon nanotubes are carboxylated carbon nanotubes or aminated carbon nanotubes.
104. The electrode, surface, or method of claim 102, wherein the reduced graphene oxide is a carboxylated reduced graphene oxide or an aminated reduced graphene oxide.
105. The electrode, surface, or method of any one of claims 88-104, wherein the conductive material comprises gold.
106. The electrode, surface, or method of any one of claims 88-105, wherein the proteinaceous material is denatured.
107. The electrode, surface, or method of any one of claims 88-106, wherein the proteinaceous material is non-reversibly denatured.
108. The electrode, surface, or method of any one of claims 88-107, wherein the proteinaceous material is a globular protein.
109. The electrode, surface, or method of any one of claims 88-108, wherein the proteinaceous material is a non-glycosylated protein.
110. The electrode, surface, or method of any one of claims 88-109, wherein the proteinaceous material is a serum albumin protein.
111. The electrode, surface, or method of any one of claims 88-110, wherein the proteinaceous material is bovine serum albumin (BSA) or human serum albumin (HSA).
112. The electrode, surface, or method of any one of claims 88-111, wherein the proteinaceous material is cross-linked with the conductive element.
113. The electrode, surface, or method of any one of claims 88-112, wherein the proteinaceous material is cross-linked to the conductive element by a linker.
114. The electrode, surface, or method of claim 113, wherein the linker is glutaraldehyde, genipin, or polyethylene glycol.
115. The electrode, surface, or method of any one of claims 88-114, wherein the proteinaceous material is cross-linked to itself.
116. The electrode, surface, or method of any one of claims 88-115, wherein the proteinaceous material is cross-linked to itself by a linker.
117. The electrode, surface, or method of claim 116, wherein the linker is glutaraldehyde, genipin, or polyethylene glycol.
118. The electrode, surface, or method of any one of claims 88-117, wherein the antifouling coating layer comprises a target binding molecule capable of binding with a target molecule.
119. The electrode, surface, or method of claim 118, wherein the target binding molecule is on a surface of the antifouling coating layer.
120. The electrode, surface, or method of claim 118 or 119, wherein the target binding molecule is in pores of the antifouling coating layer.
121. The electrode, surface, or method of any one of claims 118-120, wherein the target binding molecule is imprinted on the antifouling coating layer.
122. The electrode, surface, or method of any one of claims 118-121, wherein the target binding molecule is covalently linked to the proteinaceous material.
123. The electrode, surface, or method of any one of claims 118-122, wherein the target binding molecule is a receptor, a ligand for a receptor, an antibody, antigen binding fragment of an antibody, an antigen, an enzyme or a nucleic acid.
124. The electrode, surface, or method of any one of claims 118-123, wherein the target binding molecule is an antibody, an antigen binding fragment of an antibody or an antigen.
125. The electrode, surface, or method of any one of claims 118-123, wherein the antifouling layer comprises a first target binding molecule for detecting a first target molecule by a first detection modality and a second target binding agent for detecting a second target molecule by a second detection modality.
126. The electrode, surface, or method oof claim 125, wherein one of the first and second detection modality is a nucleic acid-based detection method (e.g., CRISPR / Casl2a-based nucleic acid detection) and the other one is an ELISA based detection method.
127. The electrode, surface, or method of any one of claims 88-126, wherein the antifouling coating layer further comprises an anti-microbial agent.
128. The electrode, surface, or method of claim 127, wherein the anti-microbial agent is an antibacterial agent, antifungal agent or anti-viral agent.
129. The electrode, surface, or method of claim 127 or 128, wherein the anti-microbial agent is an anti-bacterial agent.
130. The electrode, surface, or method of claim 129, wherein the anti-bacterial agent is selected from the group consisting of macrolides or ketolides such as erythromycin, azithromycin, clarithromycin, and telithromycin; beta-lactams including penicillin, cephalosporin, and carbapenems such as carbapenem, imipenem, and meropenem; monolactams such as penicillin G, penicillin V, methicillin, oxacillin, cioxacillin, dicloxacillin, nafcillin, ampicillin, amoxicillin, carbenicillin, ticarcillin, meziocillin, piperacillin, azlocillin, temocillin, cepalothin, cephapirin, cephradine, cephaloridine, cefazolin, cefamandole, cefuroxime, cephalexin, cefprozil, cefaclor, loracarbef, cefoxitin, cefinetazole, cefotaxime, cefitizoxime, cefiriaxone, cefoperazone, ceftazidime, cefixime, cefpodoxime, ceftibuten, cefdinir, cefpirome, cefepime, cefadroxil, ceftriaxone, ceftobiprole and astreonam; quinolones such as nalidixic acid, oxolinic acid, norfloxacin, pefloxacin, enoxacin, ofloxacin, levofloxacin, ciprofloxacin, temafloxacin, lomefloxacin, fleroxacin, grepafloxacin, sparfloxacin, trovafloxacin, clinafloxacin, gatifloxacin, moxifloxacin, sitafloxacin, ganefloxacin, gemifloxacin and pazufloxacin; antibacterial sulfonamides and antibacterial sulphanilamides, including para-aminobenzoic acid, sulfadiazine, sulfisoxazole, sulfamethoxazole and sulfathalidine; aminoglycosides such as streptomycin, neomvcin, kanamycin, paromycin, gentamicin, tobramycin, amikacin, netilmicin, spectinomycin, sisomicin, dibekalin and isepamicin; tetracyclines such as tetracycline, chlortetracycline, demeclocycline, minocycline, oxytetracycline, methacycline, doxycycline; rifamycins such as rifampicin (also called rifampin), rifapentine, rifabutin, bezoxazinorifamycin and rifaximin; lincosamides such as lincomycin and clindamycin; glycopeptides such as vancomycin and teicoplanin; streptogramins such as quinupristinand daflopristin; oxazolidinones such as linezolid; polymyxin, colistin and colymycin; trimethoprim, bacitracin, and phosphonomycin.
131. The electrode, surface, or method of claim 127 or 128, wherein the anti-microbial agent is an antifungal agent.
132. The electrode, surface, or method of claim 131, wherein the antifungal agent is selected from the group consisting of azoles (e.g., barleyconazole, butoconazole, clortrimazole, econazole, fluconazole, isavuconazole, itraconazole, ketoconazole, miconazole, oxyconazole, posaconazole, ravuconazole, saperconazole, sulconazole, tercocnazole, tioconazole, voriconazole, and ciclopirox), polyenes (e.g., natamycin, lucensomycin, nystatin, amphotericin B, etc.), echinocandins (e.g., Cancidas), pradimicins (e.g., beanomicins, nikkomycins, sordarins, allylamines, etc.), Triclosan, Piroctone, fenpropimorph, terbinafme, cyclopyroxolamine, flucitocin, griseofulvin haloprozin, tolnaftate, naphthypine, hydrochloride, morpholine, butenapin, undecylenic acid, propionic acid, and derivatives and analogs thereof.
133. The electrode, surface, or method of claim 127 or 128, wherein the anti-microbial agent is an antimicrobial peptide or polymer.
134. The electrode, surface, or method of claim 127 or 128, wherein the anti-microbial agent is a metal particle.
135. The electrode, surface, or method of claim 134, wherein anti-microbial agent is titanium oxide, copper, or silver nanoparticles.
136. The electrode, surface, or method of any one of claims 88-135, wherein the antifouling coating layer further comprises a therapeutic agent, e.g., anti-inflammatory drugs sirolimus, everolimus, biolimus (A9), zotarolimus (ABT-578), tacrolimus, and pimecrolimus, genistein, steroids (dexamethasone, prednisolone, methylprednisolone and hydrocortisone), fluocinolone acetonide, hormones etc.
137. The electrode, surface, or method of any one of claims 88-136, wherein the antifouling coating layer further comprises a polymer.
138. The electrode, surface, or method of claim 137, wherein the polymer is a water miscible polymer.
139. The electrode, surface, or method of claim 137 or 138, wherein the polymer is a degradable polymer140. The electrode, surface, or method of any one of claims 137-139, wherein the polymer is selected from the group consisting of poly(N-isopropyl acrylamide) (PNIPAAm), polyethylene glycol (PEG), alginate, polytetrafluoroethylene (PTFE), polyacetylene (PA), polyaniline (PANI), polypyrrole (PPy), polythiophene (PTH), poly(para-phenylene) (PPP), poly(phenylenevinylene) (PPV), and polyfuran (PF).
141. A sensor comprising an electrode or a surface of any one the preceding clams.
142. The sensor of claim 141, wherein the sensor comprises a fluid-contact surface and the electrode is immobilized on at least a portion of the fluid-contact surface.
143. The sensor of claim 141 or 142, wherein the sensor comprises one or more microfluidic flow cells.
144. The sensor of any one of claims 141-143, wherein the sensor comprises one or more microfluidic flow cells.
145. The sensor of any one of claims 141-144, wherein the fluid-contact surface further comprises a positive control electrode and / or a negative control electrode immobilized thereon.
146. Use of an electrode or sensor of any one of the preceding claims for detecting a target analyte in a sample.
147. A method for detecting a target analyte in a sample, the method comprising: contacting a sample suspected of comprising a target analyte with an electrode of any one the preceding claims and detecting binding of the target analyte with the target binding ligand.
148. The method of claim 147, wherein said detecting the binding of the target molecule with the target binding ligand comprises applying a voltage to the electrode.
149. The method of claim 147 or 148, wherein said detecting the binding of the target molecule with the target binding ligand comprises measuring a. current generated from electrode.
150. The method of any one of claims 147-149, wherein said detecting the binding of the target molecule with the target binding molecule comprises contacting a second target binding molecule to the target molecule, wherein the second target binding molecule comprises a detectable label.
151. The method of claim 150, wherein said contacting with the second target binding molecule is prior to contacting the sample with the electrode.
152. The method of claim 150, wherein said contacting with the second target binding molecule is after contacting the sample with the electrode.
153. The method of any one of claims 150-152, wherein the detectable label comprises an enzyme, a fluorophore, a chemiluminescent label, colloidal gold, colored glass or plastic (e.g., polystyrene, polypropylene, and latex) beads, a radiolabel, a quantum dot, or any combination thereof.
154. The method of any one of claims 150-153, wherein the detectable label comprises an enzyme.
155. The method of claim 154, wherein the enzyme is a peroxidase, alkaline phosphatase, malate dehydrogenase, staphylococcal nuclease, delta- V-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, betagalactosidase, ribonuclease, urease, catalase, glucose-VI-phosphate dehydrogenase, glucoamylase or acetylcholinesterase.
156. The method of claim 154 or 155, wherein the enzyme is a peroxidase or alkaline phosphatase.
157. The method of any one of claims 154-156, wherein the method further comprises contacting the enzyme with a substrate of the enzyme.
158. The method of any one of claims 150-157, wherein the detectable label facilitates generation of a charge carrier.
159. The method of claim 158, wherein said detecting the binding of the target molecule with the target binding molecule comprises detecting the charge carrier.
160. The method of any one of claims 147-159, wherein the target analyte is a peptide, a polypeptide, a peptidomimetic, a nucleic acid, an oligosaccharide, a polysaccharide, an amino acid, nucleoside, a nucleotide, a carbohydrate, a lipid, a peptidoglycan, a cell, microbial matter, an antigen, a lipid, a steroid, a hormone, a lipopolysaccharide, an endotoxin, a therapeutic agent, a lipid-binding molecule, a cofactor, a small molecule, a toxin, a biological threat agent (e.g., spore, viral, cellular and protein toxin), or any combination thereof.
161. The method of any one of claims 147-160, wherein the target analyte is a protein, an antibody, an antigen binding fragment of an antibody, an antigen, a hormone, or a metabolite.
162. The method of any one of claims 147-160, wherein the target analyte is a nucleic acid, e.g., the target analyte is an RNA molecule.
163. The method of claim 162, wherein the method comprises: (i) contacting the sample suspected of comprising the target analyte nucleic acid, e.g., RNA with an electrode of any one the preceding claims, wherein the target binding ligand is a nucleic acid comprising a detectable label; (ii) contacting the electrode with an endonuclease (e.g., a CRSIPR / Cas such as CRISPR / Casl2), where the endonuclease is capable of cleaving the nucleic acid comprising the detectable label in presence of the target nucleic acid; and (iii) detecting presence of detectable label remaining bound to the nucleic acid comprising the detectable label.
164. The method of any one of claims 147-163, wherein the target analyte is a tumor marker or a clinical chemistry target.
165. The method of any one of claims 147-164, wherein the sample is a biological sample (e.g., blood, saliva, amniotic fluid, sputum, urine, semen, cerebrospinal fluid, bronchial aspirate, perspiration, mucus, liquefied stool sample, synovial fluid, lymphatic fluid, tears, tracheal aspirate, lactation product, and any combination thereof).
166. The method of any one of claims 147-165, wherein the sample is a food, an ingredient for preparing a food, poultry, meat, fish, beverage, or dairy product.
167. The method of any one of claims 147-166, wherein the sample is a non-biological sample (e.g., water, salt water, pond water, river water, reservoir water, brine, drinking water, industrial water, brown water, waste water, sewerage, soil, and mixtures thereof.
168. The method of any one of claims 147-167, wherein the sample is pre-processed prior to contacting with the electrode.
169. A kit comprising a composition, surface, electrode, or sensor of any one of the preceding claims.