Methods and compositions for delivery of unmodified mRNA constructs using mesenchymal stem cells
Patent Information
- Application Number
- EP2024789880
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-10-13
- Filing Date
- 2024-10-11
- Publication Date
- 2026-02-11
AI Technical Summary
Current mRNA vaccine delivery methods, such as lipid nanoparticles (LNPs), face limitations, particularly with repeat dosing for chronic diseases, due to the attenuation of protein expression over time and potential side effects.
The use of mesenchymal stem cells (MSCs) loaded with unmodified mRNA constructs, where the mRNA is purified to remove double-stranded RNA and introduced via a non-endosomal pathway, such as electroporation, to achieve high-level expression of secreted proteins.
This approach results in over 200-fold higher levels of secreted protein expression compared to LNP-delivered modified mRNA agents, while avoiding the need for chemical modifications and potentially reducing side effects.
Smart Images

Figure IMGF000034_0001 
Figure IMGF000035_0001 
Figure 00000066_0000
Abstract
Description
[0001] METHODS AND COMPOSITIONS FOR DELIVERY OF UNMODIFIED mRNA CONSTRUCTS USING MESENCHYMAL STEM CELLS
[0002] Background
[0003] The success of the CO VID- 19 mRNA vaccines has established mRNA agents as viable for use in humans, thus opening up a new biotechnology platform for a wide variety of prophylactic and therapeutic purposes. The current mRNA vaccines utilize modified mRNA (mmRNA) agents, which incorporate chemically modified nucleosides into the mRNA structure, such as modified uracil residues. Chemically modified nucleosides have been used in mRNA agents, such as to enhance stability or escape detection by the innate immune system. To successfully deliver mmRNA agents in vivo, the mmRNAs have been encapsulated into lipid nanoparticles (LNPs). While this has proved efficacious, there are potential limitations to this current approach.
[0004] The inherent lability of mRNA requires a delivery system to protect against degradation by nucleases and to allow cellular uptake during in vivo administration. The current approach using LNPs was first used clinically to allow the in vivo delivery of siRNA (Coelho et al. (2013) New Eng. J. Med. 369:819-829; Adams et al. (2018) New Eng. J. Med. 379:11-21). The LNPs protect the RNA cargo and are taken up via the endosomal pathway, where a portion of the RNA cargo is released from the endosome and eventually gets translated. Early versions of lipid nanoparticles containing ionizable amino lipids used to encapsulate siRNAs are described in, for example, Jayarama et al. (2012) Angew Chem. Int. Ed. Engl. 51:8529-8533. While the original versions of LNPs allowed uptake in the liver and eventually led to approval of the first siRNA therapeutic, they were associated with significant side effects (Coelho et al. (2013) New Eng. J. Med. 369:819-829; Adams et al. (2018) New Eng. J. Med. 379:11-21). However, a new generation of ionizable LNPs have been designed that lead to a larger release of the RNA cargo and marked improvement in safety and efficacy (Cheng et al. (2020) Nature Nanotech. 15:313-320). These newer versions have allowed wide- scale administration with relatively rare serious side effects, and are being harnessed to address a new wave of therapeutic candidates.
[0005] While certain improvements have been made to the LNP technology, there still are significant potential limitations, particularly with regard to repeat dosing, which often would be required in the treatment of chronic diseases with mRNA agents. Even with chemical modifications of the mRNA and packaging in more advanced lipid nanoparticles, the level of protein expression is attenuated with chronic, repeated dosing. This severely limits the opportunity to use mRNA technology in ongoing therapies, such as those that deliver a therapeutic protein of interest that is encoded by the mRNA.
[0006] Thus, while there have been various advances in the use of mRNA agents in humans, there still exists a need in the art for additional methods and approaches, in particular ones that provide alternative means than LNPs for the delivery of mRNA agents in vivo.
[0007] Summary
[0008] State of the art is to use mRNA comprising chemically modified nucleosides to bypass RNAses and innate immune system receptors like toll-like receptors. Examples of chemically modified nucleosides are pseudouridine or N1 -methyl -pseudouridine. However, the production of mRNA comprising chemically modified nucleosides is expensive and labor intensive. The present disclosure relates to methods and compositions for the delivery of secreted proteins in vivo by using mesenchymal stem cells (MSCs) comprising substantially single stranded mRNA without the need for chemically modified nucleosides, but achieve a delivery efficiency over 200-fold higher than observed with LNP-delivered mRNA agents comprising chemically modified nucleosides.
[0009] This surprising effect is achieved by using a cell-based system for delivery of mRNA constructs in vivo in combination with codon optimization of the mRNA to reduce the uridine content and purification of the produced mRNA to reduce the amount of double-stranded RNA. Therefore, the mRNA does not need to comprise any chemically modified nucleosides.
[0010] This is a surprising effect, since the prior art (e.g. Liu et al., 2022) teaches that chemical modifications in mRNA are pivotal. However, this combination of cell-based delivery with substantially single stranded mRNA makes chemically modified nucleosides redundant. The mRNA has been purified to remove dsRNA, therefore “substantially single stranded mRNA” does not exclude that a minor portion of the RNA is double stranded.
[0011] This disclosure provides methods and compositions for delivery of mRNA constructs in vivo by loading the mRNA construct into cells, which then act as the delivery vehicle for the mRNA construct. Furthermore, the compositions and methods of the disclosure have the advantage that they utilize unmodified mRNA constructs, such as mRNA constructs in which all uridine nucleosides are chemically unmodified as compared to current mmRNA agents that comprise chemically modified uridine nucleosides.
[0012] In some embodiments, all nucleosides within the mRNA constructs of the disclosure are chemically unmodified. The mRNA constructs of the disclosure encode a secreted protein and the methods described herein allow for expression of the secreted protein in a subject at substantially higher levels than obtained using modified mRNA agents delivered using LNPs.
[0013] The disclosure is based, at least in part, on the discovery of a combination of approaches, features and elements described herein that significantly enhance the expression of secreted proteins from mRNA constructs introduced into hMSC. As demonstrated in the Examples, levels of secreted protein have been obtained that are over 200-fold higher than observed with LNP-delivered mmRNA agents.
[0014] Accordingly, in one aspect, the disclosure pertains to a method of loading a cell with an mRNA construct preparation, the method comprising:
[0015] (a) removing double- stranded RNA (dsRNA) from the mRNA construct preparation; and
[0016] (b) introducing the mRNA construct preparation into the cell by a non-endosomal pathway of delivery; wherein the cell is a human mesenchymal stem cell (hMSC), the mRNA construct encodes a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified.
[0017] In an embodiment, the mRNA construct has been engineered to reduce uridine content. In an embodiment, all nucleosides in the mRNA construct are chemically unmodified.
[0018] In embodiments, the hMSC is derived from a tissue selected from the group consisting of bone marrow, adipose tissue, peripheral blood, umbilical cord, amniotic fluid, cord blood, placenta and Wharton’s jelly. In other embodiments, the hMSC is an induced MSC (iMSC).
[0019] In embodiments, the mRNA construct encodes a cytokine, an enzyme, a chemokine, an antibody or fragment thereof, an immunomodulatory agent or a growth factor. In an embodiment, the mRNA construct encodes vascular endothelial growth factor (VEGF), such as a VEGF- A protein (e.g., a VEGF-A165 variant).
[0020] In embodiments, the hMSC is a freshly-obtained cell. In embodiments, the hMSC is a cryopreserved cell that has been thawed. In embodiments, the mRNA construct preparation is introduced into the cell by electroporation.
[0021] In embodiments, the method comprises a plurality of hMSCs and the mRNA construct preparation is introduced into cells at a dosage of at least 1 ng mRNA per 1 x 106cells.
[0022] In embodiments, the secreted protein is expressed by the hMSC at a level of at least 0.1 pg secreted protein / lxlO6cells. In embodiments, the secreted protein is expressed by the hMSC at a level of at least 0.5 pg secreted protein / lxlO6cells.
[0023] In another embodiment, the disclosure pertains to a method of loading a cell with an mRNA construct preparation, the method comprising:
[0024] (a) reducing uridine content in the mRNA construct preparation;
[0025] (b) removing double- stranded RNA (dsRNA) from the mRNA construct preparation; and
[0026] (c) introducing the mRNA construct preparation into the cell by a non-endosomal pathway of delivery; wherein the cell is a human mesenchymal stem cell (hMSC), the mRNA construct encodes a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified. In an embodiment, all nucleosides in the mRNA construct are chemically unmodified.
[0027] In another aspect, the disclosure pertains to a method of expressing a secreted protein in a subject in vivo, the method comprising:
[0028] (a) introducing an mRNA construct encoding the secreted protein into human mesenchymal stem cells (hMSCs) by a non-endosomal pathway of delivery, wherein all uridine nucleosides in the mRNA construct are chemically unmodified and the mRNA construct has been purified to remove double-stranded RNA (dsRNA), to thereby prepare mRNA-loaded hMSCs; and
[0029] (b) administering the mRNA-loaded hMSCs to the subject such that the secreted protein encoded by the mRNA construct is expressed in the subject.
[0030] In embodiments, the mRNA construct has been engineered to reduce uridine content. In embodiments, all nucleosides within the mRNA construct are chemically unmodified.
[0031] In embodiments, the hMSCs are derived from a tissue selected from the group consisting of bone marrow, adipose tissue, peripheral blood, umbilical cord, amniotic fluid, cord blood, placenta and Wharton’s jelly. In other embodiments, the hMSC is an induced MSC (iMSC). In embodiments, the mRNA construct encodes a cytokine, an enzyme, a chemokine, an antibody or fragment thereof, an immunomodulatory agent or a growth factor. In embodiments, the mRNA construct encodes vascular endothelial growth factor (VEGF), such as a VEGF- A protein (e.g., a VEGF-A165 variant).
[0032] In embodiments, the hMSCs are freshly-obtained cells. In other embodiments, the hMSCs are cryopreserved cells that are thawed prior to introducing the mRNA construct.
[0033] In embodiments, the mRNA construct is introduced into the hMSCs by electroporation.
[0034] In embodiments, the mRNA construct is introduced into the hMSCs at a dosage of at least 1 ng mRNA per 1 x 106cells.
[0035] In embodiments, the secreted protein is expressed by cells of the subject at a level of at least 1 g / gprot. In embodiments, the secreted protein is expressed by cells of the subject at a level of at least 2 pg / gprot.
[0036] In another aspect, the disclosure pertains to a non-natural engineered human mesenchymal stem cell (hMSC) composition, the composition comprising hMSCs loaded with an mRNA construct, wherein the mRNA construct encodes a secreted protein, wherein all uridine nucleosides in the mRNA construct are chemically unmodified and wherein the secreted protein is expressed by the hMSCs at a level of at least 0.1 pg secreted protein / lxlO6cells. In embodiments, the secreted protein is expressed by the hMSCs at a level of at least 0.5 pg secreted protein / lxlO6cells.
[0037] In embodiments, the mRNA construct has been engineered to reduce uridine content. In embodiments, all nucleosides within the mRNA construct are chemically unmodified.
[0038] In embodiments, the hMSCs are derived from a tissue selected from the group consisting of bone marrow, adipose tissue, peripheral blood, umbilical cord, amniotic fluid, cord blood, placenta and Wharton’s jelly. In other embodiments, the hMSCs are induced MSCs (iMSCs).
[0039] In embodiments, the mRNA construct encodes a cytokine, an enzyme, a chemokine, an antibody or fragment thereof, an immunomodulatory agent or a growth factor. In embodiments, the mRNA construct encodes vascular endothelial growth factor (VEGF), such as a VEGF- A protein (e.g., a VEGF-A165 variant).
[0040] In another aspect, the disclosure also pertains to use of a composition of the disclosure as a medicament. In another aspect, the disclosure pertains to use of a composition of the disclosure for delivery of a secreted protein to a subject, such as for therapy. Another aspect of the disclosure relates to a mesenchymal stem cell comprising a substantially single stranded composition of a mRNA construct introduced into the cell by a non-endosomal pathway of delivery, the mRNA construct comprising a coding sequence, wherein all nucleosides within the mRNA construct are chemically unmodified and optionally wherein the codons of the mRNA construct have been selected to reduce the uridine content.
[0041] These and other aspects of the disclosure are described in further detail herein.
[0042] Brief Description of the Drawings
[0043] FIG. 1 is a bar graph showing the % GFP positive cell population over time in hMSCs electroporated with the indicated amounts of modified or unmodified GFP-encoding mRNA constructs.
[0044] FIG. 2 is a bar graph showing the mean GFP signal intensity over time in hMSCs electroporated with the indicated amounts of modified or unmodified GFP-encoding mRNA constructs.
[0045] FIG. 3 is a bar graph showing the % Annexin-V positive cell population over time in hMSCs electroporated with the indicated amounts of modified or unmodified GFP-encoding mRNA constructs.
[0046] FIG. 4 is a bar graph showing the % dead cell population over time in hMSCs electroporated with the indicated amounts of modified or unmodified GFP-encoding mRNA constructs.
[0047] FIG. 5 is a bar graph showing the accumulated VEGF secretion over time by hMSCs electroporated with the indicated amounts of modified or unmodified VEGF-encoding mRNA constructs.
[0048] FIG. 6 is a bar graph showing the de novo VEGF secretion over time by hMSCs electroporated with the indicated amounts of modified or unmodified VEGF-encoding mRNA constructs.
[0049] FIG. 7 is a bar graph comparing the levels of accumulated VEGF secretion over time by fresh hMSCs (top) or cryopreserved hMSCs (bottom) electroporated with the indicated amounts of modified or unmodified VEGF-encoding mRNA constructs.
[0050] FIG. 8 is a graph comparing the relative expression levels over time of modified VEGF (top) or unmodified VEGF (bottom) mRNA constructs electroporated into fresh or cryopreserved hMSCs at the indicated dosage. FIG. 9 is a bar graph showing dsRNA levels in unpurified and lx, 2x or 3x sequentially purified mRNA construct samples.
[0051] FIG. 10 is a bar graph showing total VEGF secretion over time by hMSCs electroporated with the indicated mRNA construct at the indicated dosage.
[0052] FIG. 11 is a graph showing luciferase expression in vivo over time in mice treated with hMSCs loaded with the indicated mRNA constructs.
[0053] FIG. 12A-12B are graphs showing VEGF expression in vivo in mice treated with hMSCs loaded with the indicated mRNA constructs. FIG. 12A is a graph showing peak VEGF expression over time. FIG. 12B is a bar graph showing total VEGF expression from 0hr-168hr.
[0054] Detailed Description
[0055] As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly states otherwise. Thus, for example, reference to “a mRNA construct” includes a plurality of such constructs.
[0056] The disclosure pertains to methods for preparing and using human mesenchymal stem cells (hMSCs) carrying an mRNA construct, wherein at least some nucleosides, and in some cases all nucleosides, within the construct are chemically unmodified and wherein the mRNA construct encodes a secreted protein. As demonstrated in the Examples, a unique combination of features and elements has been discovered that leads to enhanced expression of chemically unmodified mRNA constructs in hMSCs, particularly those encoding secreted proteins. Moreover, the features and elements of the disclosure allow for delivering unmodified mRNA to a subject using hMSCs, which has been shown to produce significantly higher expression levels of the secreted protein in vivo in the subject as compared to uridine-modified mmRNA delivered using lipid nanoparticles (LNPs), the current standard approach for mRNA delivery in vivo. For example, the approach of the disclosure using hMSCs for delivery of a uridine- unmodified mRNA encoding a secreted protein has been shown to provide as much as 200- fold greater levels of expression of the secreted protein in a subject in vivo as compared to LNP-mediated delivery of uridine-modified mmRNA.
[0057] Various aspects of the disclosure are described in the subsections below. I. Mesenchymal Stem Cells
[0058] The methods and compositions of the disclosure utilize human mesenchymal stem cells (hMSCs) as the host cells into which an mRNA construct is introduced. As used herein, the term “mesenchymal stem cell” (MSC) refers to multipotent stem cells established in the art that can self-renew by dividing and can differentiate into multiple tissues including bone, cartilage, muscle cells, fat cells and connective tissue. The term MSC encompasses both natural stem cells that are naturally present in certain human tissues and induced MSCs that can be prepared in vitro.
[0059] A first aspect of the present disclosure relates to a mesenchymal stem cell comprising a substantially single stranded composition of an mRNA construct introduced into the cell by a non-endosomal pathway of delivery, wherein the mRNA construct comprising a coding sequence, and wherein the codons of the mRNA construct have been selected to reduce the uridine content.
[0060] In some embodiments, the hMSCs are derived from adult tissue (such as bone marrow, adipose tissue or peripheral blood). In other embodiments, the hMSCs are derived from prenatal, neonatal or umbilical tissue (such as umbilical cord, amniotic fluid, cord blood, placenta or Wharton’s jelly). In embodiments, the hMSCs are derived from a tissue selected from the group consisting of bone marrow, adipose tissue, peripheral blood, umbilical cord, amniotic fluid, cord blood, placenta and Wharton’s jelly. In yet other embodiments, the hMSCs are induced mesenchymal stem cells (iMSCs). In some embodiments, the MSCs are derived from stem cells. To the extent that reference to "stem cell" is made herein, this should be understood as a reference to a cell exhibiting multilineage differentiative potential. In one embodiment, the stem cell is not obtained by methods that involve the use of human embryos for commercial or industrial purposes. In one embodiment, the stem cell is not obtained by methods that necessarily involve the destruction of a human embryo. It is possible to establish embryonic stem cells without destroying human embryos.
[0061] In one embodiment, the hMSCs are bone marrow mesenchymal stem cells (BMSCs), which can be directly isolated from subjects. U.S. Patent Application US2008 / 0279828A1 discloses methods of mobilization of bone marrow stem cells into the peripheral blood of a donor for harvesting the bone marrow stem cells, and is incorporated herein by reference in its entirety. The method comprises administering to the donor an effective amount of at least one copper chelate, to thereby expand the bone marrow stem cells in vivo, while at the same time reversibly inhibiting differentiation of the bone marrow stem cells; and harvesting the bone marrow stem cells by leukopheresis. Alternatively, cells that differentiate into BMSCs ("BMSC precursors") can be isolated from subjects and then exposed to one or more chemical or biological agents to differentiate into BMSCs in culture. U.S. Pat. No. 5,486,359 describes the isolation of human mesenchymal stem cells, which can differentiate into more than one tissue type (e.g. bone, cartilage, muscle, or marrow stroma) and a method for isolating, purifying, and culturally expanding human mesenchymal stem cells.
[0062] Additional sources of MSCs from adult niches including adipose / fat-derived MSCs and peripheral blood derived MSCs. In addition, MSCs from the pre / neo-natal environment can be used in the methods described herein, including umbilical and placental-derived MSCs. Human umbilical cord and placenta-derived MSCs, as well as peripheral blood derived MSCs can be isolated from patients using methods known in the art, e.g., through a combination of tissue explant cultures and / or by gradient density separation through centrifugation (Beeravolu et al. (2017) J. Vis. Exp, 122; Chong et al. (2012) J Orthop Res., 30(4):634-42). For the isolation of adipose / fat-derived MSCs, the cells can first be isolated using for example, methods involving liposuction and resection (Schneider et al. (2017) Eur. J. Med. Res. 22(1): 17). Although some functional diversity exists within mesenchymal stem cells derived from different patients and / or different tissue sources, for mesenchymal stem cells to maintain their identity they should possess three functional attributes: 1) self-renewal potential; 2) ability to grow on plastics; and 3) ability to differentiate into three major cell types including osteoblast (bone), chondrocyte (cartilage) and adipocyte (fat). Additionally, regardless of the source of MSCs, the MSCs should have differentiation markers such as CD73, CD90 and the lack of CD14, CD34, and CD45 (Ullah et al. (2015) Biosci. Rep., 35(2); Fitzsimmons et al. (2018) Stem Cells Int. 2018: 8031718).
[0063] In an embodiment, the MSCs are induced MSCs (iMSCs) that have been prepared from pluripotent stem cells, such as human embryonic stem cells (ESCs) or human induced pluripotent stem cells (iPSCs). Methods of preparing iMSCs from pluripotent stem cells have been described in the art (see e.g., Soontararak et al. (2018) Stem Cells Transl. Med. 7:456- 467; Yang et al. (2019) Cell Death and Disease 10:718; Xu et al. (2019) Stem Cells 37:754- 765). Culture protocols for differentiation of iMSCs from pluripotent stem cells are also described in detail in US Patent Application Serial No. 18 / 106,327, filed February 6, 2023, the entire contents of which is hereby specifically incorporated by reference.
[0064] In some embodiments of the present disclosure, the MSCs are obtained from a human donor. In some embodiments of the present disclosure, the hMSCs are freshly-obtained cells. As used herein, both the terms “freshly-obtained cells” and “cryopreserved cells” refers to cells, that are thawed, cultured and where subsequently the mRNA is introduced. As used herein, the term “cryopreserved cells” refers to cells that are cryopreserved comprising the mRNA composition and thawed afterwards for use. As used herein, the term “freshly- obtained cells” refers to cells that are not cryopreserved comprising the mRNA composition.
[0065] In embodiments, the hMSCs are freshly-obtained cells. In other embodiments, the hMSCs are cryopreserved cells that are thawed prior to introducing the mRNA construct.
[0066] As described herein, an mRNA construct encoding a secreted protein can be introduced into MSCs and the MSCs are able to secrete the encoded protein. As demonstrated in the Examples, mRNA-loaded MSCs that are freshly seeded onto culture plates after mRNA loading exhibit secretion of the encoded protein. Moreover, mRNA-loaded MSCs that have been cryopreserved after mRNA loading (e.g., at -80° C, then in liquid nitrogen) also exhibit secretion of the encoded protein after thawing and seeding onto culture plates. Accordingly, in one embodiment, the mRNA-loaded hMSC are used fresh after mRNA loading. In another embodiment, the mRNA-loaded hMSC are cryopreserved after mRNA loading and then thawed prior to use. In some embodiment, the MSCs are cryopreserved in 10% DMSO.
[0067] II. Unmodified mRNA Constructs
[0068] The methods and compositions of the disclosure utilize mRNA constructs in which at least some residues, and in some cases all residues, are chemically unmodified. As used herein, a “chemically unmodified” residue within an mRNA construct refers to a nucleobase, nucleoside or nucleotide within the construct that does not contain a chemical modification, such as a methylation. As used herein "nucleoside" refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase"). As used herein, "nucleotide" refers to a nucleoside including a phosphate group. A “chemically unmodified” residue within an mRNA construct differs from a “chemically modified” residue within an mRNA construct in that the latter comprises a chemical modification of the nucleobase, nucleoside or nucleotide.
[0069] For example, a common modification in an mRNA construct comprises use of a chemically modified uridine nucleoside, such as N1 -Methylpseudouridine (m I ), in place of the chemically unmodified uridine residues throughout the mRNA construct, referred to herein as a “uridine-modified” mRNA construct. In contrast, a “uridine-unmodified” mRNA construct of the disclosure uses chemically unmodified uridines throughout the construct. In an embodiment, an mRNA construct of the disclosure is a uridine-unmodified mRNA construct, wherein all uridine nucleosides in the mRNA construct are chemically unmodified. For example, a chemically unmodified mRNA construct of the disclosure can lack Nl- Methylpseudouridine (mlT) at one or more (e.g., at all) uridine positions within the sequence of the mRNA construct.
[0070] Another common mRNA modification comprises use of a chemically modified cytidine nucleoside, such as 5-methyl cytidine, in place of the chemically unmodified cytidine residues throughout the mRNA construct, referred to herein as a “cytidine-modified” mRNA construct. In contrast, a “cytidine-unmodified” mRNA construct of the disclosure uses chemically unmodified cytidines throughout the construct. In an embodiment, an mRNA construct of the disclosure is a cytidine-unmodified mRNA construct, wherein all cytidine nucleosides in the mRNA construct are chemically unmodified. For example, a chemically unmodified mRNA construct of the disclosure can lack 5-methyl cytidine at one or more (e.g., at all) cytidine positions within the sequence of the mRNA construct.
[0071] In another embodiment, an mRNA construct of the disclosure is a fully unmodified mRNA construct, wherein all nucleosides in the mRNA construct are chemically unmodified. The person skilled in the art will appreciate that the mRNA will consists of the nucleosides U, A, C and G before introducing the mRNA into the cell. Furthermore, the skilled person in the art will appreciate, that the mRNA can be modified by the cellular machinery after the mRNA is introduced into the cell.
[0072] An mRNA construct of the disclosure comprises an open reading frame (ORF) that encodes a protein. In some embodiments of the present disclosure, the mRNA construct encodes a secreted protein. Non-limiting examples of secreted proteins that can be encoded by the ORF are described further in Subsection III below.
[0073] In addition to the ORF, the mRNA construct typically comprises additional regulatory elements such as a 5' untranslated region (5'-UTR), a 3' untranslated region (3'-UTR) and / or a poly-A tail. Such additional mRNA elements are well established and available in the art. In some embodiments of the present disclosure, the mRNA construct comprises a 5' untranslated region (UTR). In some embodiments of the present disclosure, the mRNA construct comprises a 3' untranslated region (UTR). In some embodiments of the present disclosure, the mRNA construct comprises a 5' cap. In some embodiments of the present disclosure, the mRNA construct comprises a poly-A tail. In some embodiments of the present disclosure, the UTR is a a-globin UTR. In some embodiments of the present disclosure, the UTR is a P-globin UTR. In some embodiments of the present disclosure, the UTR is customized for the cell host. In some embodiments of the present disclosure, the UTR is customized for the disease microenvironment.
[0074] The mRNA construct comprises a suitable number of base pairs to encompass the ORF and additional elements. In embodiments, the mRNA construct can comprise tens (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100), hundreds (e.g., 200, 300, 400, 500, 600, 700, 800, or 900) or thousands (e.g., 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000) of base pairs.
[0075] In embodiments, the mRNA construct comprises a 5' cap structure, a chain terminating nucleotide, optionally a Kozak sequence (also known as a Kozak consensus sequence), a stem loop, a polyA sequence, and / or a polyadenylation signal.
[0076] A 5' cap structure or cap species is a compound including two nucleoside moieties joined by a linker and may be selected from a naturally occurring cap, a non-naturally occurring cap or cap analog, or an anti-reverse cap analog (ARCA). A cap species may include one or more modified nucleosides and / or linker moieties. For example, a natural mRNA cap may include a guanine nucleotide and a guanine (G) nucleotide methylated at the 7 position joined by a triphosphate linkage at their 5' positions, e.g., m7G(5')ppp(5')G, commonly written as m7GpppG.
[0077] An mRNA construct can comprise a chain terminating nucleoside. For example, a chain terminating nucleoside may include those nucleosides deoxygenated at the 2' and / or 3' positions of their sugar group. Such species may include 3'-deoxyadenosine (cordycepin), 3'- deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, and 2', 3'- dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2', 3'- dideoxycytosine, 2',3'-dideoxyguanosine, and 2',3'-dideoxythymine. In some embodiments, incorporation of a chain terminating nucleotide into an mRNA, for example at the 3'-terminus, may result in stabilization of the mRNA, as described, for example, in International Patent Publication No. WO 2013 / 103659.
[0078] An mRNA construct can comprise a polyA sequence and / or polyadenylation signal. A polyA sequence may be comprised entirely or mostly of adenine nucleotides or analogs or derivatives thereof. A polyA sequence may be a tail located adjacent to a 3' untranslated region of an mRNA. In some embodiments, a polyA sequence may affect the nuclear export, translation, and / or stability of an mRNA.
[0079] An mRNA construct can comprise a microRNA binding site. The sequences of numerous microRNA binding sites are well known in the art. In some embodiments, an mRNA construct may be codon optimized. For example, an mRNA construct can be codon optimized as described in further detail in Subsection IV to enhance expression of the unmodified mRNA in the methods of the disclosure. Moreover, additional codon optimization approaches are known in the art and may be useful for a variety of purposes: matching codon frequencies in host organisms to ensure proper folding, bias GC content to increase mRNA stability or reduce secondary structures, minimize tandem repeat codons or base runs that may impair gene construction or expression, customize transcriptional and translational control regions, insert or remove proteins trafficking sequences, remove / add post translation modification sites in encoded proteins (e.g., glycosylation sites), add, remove or shuffle protein domains, insert or delete restriction sites, modify ribosome binding sites and mRNA degradation sites, adjust translation rates to allow the various domains of the protein to fold properly, or to reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art; non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park, Calif.) and / or proprietary methods. In one embodiment, the mRNA sequence is optimized using optimization algorithms, e.g., to optimize expression in mammalian cells or enhance mRNA stability.
[0080] For example, constructs can be generated after basic codon optimization using IDT codon optimization for expression in humans. This codon optimization algorithm relies on rebalancing codon usage, decreasing sequence complexity and avoiding rare codons. It is mainly used to minimize secondary structures and reduce complexity.
[0081] An mRNA construct of the disclosure may be produced by standard means available in the art, including but not limited to in vitro transcription (IVT) and synthetic methods. Enzymatic (IVT), solid-phase, liquid-phase, combined synthetic methods, small region synthesis, and ligation methods may be utilized. In one embodiment, mRNAs are made using IVT enzymatic synthesis methods. Methods of making polynucleotides by IVT are known in the art and are described in International Application PCT / US2013 / 30062, the contents of which are incorporated herein by reference in their entirety. In some embodiments of the present disclosure, the method to synthesize the mRNA construct is selected from the group of Enzymatic (IVT) methods, solid-phase methods, liquid-phase methods, combined synthetic methods, small region synthesis, and ligation methods. In a preferred embodiment, the mRNA construct is synthesized via in vitro transcription (IVT). In some embodiments of the present disclosure, a T7 polymerase is used for synthesizing the mRNA construct. In some embodiments of the present disclosure, at least 1 ng mRNA, such as at least 10 ng mRNA, such as at least 100 ng mRNA, such as at least 0.5 pg mRNA, such as at least 1 pg mRNA, such as at least 5 pg, such as at least 7 pg mRNA, such as at least 10 pg mRNA, such as at least 100 pg is introduced into lx 106mesenchymal stem cells. In some embodiments of the present disclosure, at most 1 mg mRNA, such as at most 100 pg mRNA, such as 50 pg mRNA, such as at most 25 pg mRNA, such as at most 20 pg mRNA, such as at most 10 pg mRNA is introduced into IxlO6mesenchymal stem cells. In some embodiments of the present disclosure, between 1 ng mRNA and 1 mg mRNA, such as between 10 ng mRNA and 100 pg mRNA, such as between 0.5 pg mRNA and 50 pg mRNA, such as between 1 pg mRNA and 25 pg mRNA, such as between 5 pg mRNA and 20 pg mRNA is introduced into IxlO6mesenchymal stem cells. In some embodiments of the present disclosure, at least IxlO10, such as at least IxlO34, such as at least IxlO16, such as at mRNA molecules with a length of up to 100 nucleotides are introduced into IxlO6mesenchymal stem cells. In some embodiments of the present disclosure, at least 5xl010, such as at least 5xl013, such as at least 5xl016, mRNA molecules with a length of up to 500 nucleotides are introduced into IxlO6mesenchymal stem cells. In some embodiments of the present disclosure, at least IxlO9, such as at least IxlO12, such as at least IxlO16mRNA molecules with a length of up to 1000 nucleotides are introduced into IxlO6mesenchymal stem cells. In some embodiments of the present disclosure, at least 5xl09, such as at least 5xl012, such as at least 5xl015mRNA molecules with a length of up to 5000 nucleotides are introduced into IxlO6mesenchymal stem cells. In some embodiments of the present disclosure, at least IxlO8, such as at least IxlO11, such as at least lxlO14mRNA molecules with a length of up to 10000 nucleotides are introduced into IxlO6mesenchymal stem cells.
[0082] In some embodiments of the present disclosure, at most IxlO16, such as at most IxlO13, such as at most lxlOlomRNA molecules with a length of up to 100 nucleotides are introduced into IxlO6mesenchymal stem cells. In some embodiments of the present disclosure, at most 5xl016, such as at most 5xl013, such as at most 5xl010mRNA molecules with a length of up to 500 nucleotides are introduced into IxlO6mesenchymal stem cells. In some embodiments of the present disclosure, at most IxlO15, such as at most IxlO12, such as at most lxl019mRNA molecules with a length of up to 1000 nucleotides are introduced into IxlO6mesenchymal stem cells. In some embodiments of the present disclosure, wherein at most 5xl015, such as at most 5xl012, such as at most 5xl09mRNA molecules with a length of up to 5000 nucleotides are introduced into IxlO6mesenchymal stem cells. In some embodiments of the present disclosure, at most IxlO14, such as at most IxlO11, such as at most IxlO8, mRNA molecules with a length of up to 10000 nucleotides are introduced into IxlO6mesenchymal stem cells.
[0083] In some embodiments of the present disclosure, IxlO6cells comprise at least 1 ng, such as at least 10 ng, such as at least 100 ng, such as at least 0.5 pg, such as at least 1 pg, such as at least 5 pg, such as at least 7 pg, such as at least 10 pg of said mRNA composition. In some embodiments of the present disclosure, IxlO6cells comprise at most 1 mg, such as at most 100 pg, such as at most 50 pg, such as at most 25 pg, such as at most 20 pg, such as at most 10 pg of said mRNA composition. In some embodiments of the present disclosure, IxlO6cells comprise between 1 ng and 1 mg, such as between 10 ng and 100 pg, such as between 0.5 pg and 50 pg, such as between 1 pg and 25 pg , such as between 5 pg and 20 pg of said mRNA composition.
[0084] In some embodiments of the present disclosure, IxlO6cells comprise at least IxlO10, such as at least IxlO13, such as at least lxlO16mRNA molecules of said mRNA composition with a length of up to 100 nucleotides. In some embodiments of the present disclosure, IxlO6cells comprise at least 5xl010, such as at least 5xl013, such as at least 5xlO16mRNA molecules of said mRNA composition with a length of up to 500 nucleotides. In some embodiments of the present disclosure, IxlO6cells comprise at least IxlO9, such as at least IxlO12, such as at least lxlO15mRNA molecules of said mRNA composition with a length of up to 1000 nucleotides. In some embodiments of the present disclosure, IxlO6cells comprise at least IxlO9, such as at least 5xl012, such as at least 5xl015mRNA molecules of said mRNA composition with a length of up to 5000 nucleotides. In some embodiments of the present disclosure, IxlO6cells comprise at least IxlO8, such as at least IxlO11, such as at least lxlO14mRNA molecules of said mRNA composition with a length of up to 10000 nucleotides.
[0085] In some embodiments of the present disclosure, IxlO6cells comprise at most IxlO14, such as at most IxlO11, such as at most lxl08mRNA molecules of said mRNA composition with a length of up to 10000 nucleotides. In some embodiments of the present disclosure, IxlO6cells comprise at most 5xl015, such as at most 5xl012, such as at most 5xl09mRNA molecules of said mRNA composition with a length of up to 5000 nucleotides. In some embodiments of the present disclosure, IxlO6cells comprise at most IxlO15, such as at most IxlO12, such as at most lxl09mRNA molecules of said mRNA composition with a length of up to 1000 nucleotides. In some embodiments of the present disclosure, IxlO6cells comprise at most 5xl016, such as at most 5xl013, such as at most 5xlOlomRNA molecules of said mRNA composition with a length of up to 500 nucleotides. In some embodiments of the present disclosure, IxlO6cells comprise at most IxlO16, such as at most IxlO13, such as at most lxlOlomRNA molecules of said mRNA composition with a length of up to 100 nucleotides.
[0086] In some embodiments of the present disclosure, the method of detecting the amount of mRNA molecules in the mesenchymal stem cells is selected from the group consisting of: RNA sequencing, northern analysis, nuclease protection assays, In- situ hybridization, labelled mRNAs, ddPCR and RT-PCR.
[0087] III. Secreted Proteins
[0088] The mRNA construct used in the methods and compositions of the disclosure encodes a secreted protein. As used herein, a “secreted protein” refers to a protein that is made inside a cell (intracellularly) and then is released outside the cell (extracellularly). The term “secreted protein” is intended to encompass any protein that comprises a signal peptide that directs the protein toward the secretory pathway as well as proteins that are non-classically secreted. Bioinformatics tools exists that can predict secretion via one or the other mechanism with very high likelihood. In an embodiment, the secreted protein comprises a signal peptide that has been engineered into the protein (e.g., a heterologous signal peptide that directs the protein toward the secretory pathway). Numerous classes of secreted proteins are well- established in the art, including a wide variety of secreted proteins that have been demonstrated to be useful therapeutically.
[0089] For example, in embodiments, the mRNA construct encodes a cytokine, an enzyme, a chemokine, an antibody or fragment thereof, an immunomodulatory agent or a growth factor.
[0090] In an embodiment, the secreted protein is a cytokine, such as an interleukin or an interferon that is useful therapeutically. Non-limiting examples of interleukins that have antitumor effects include IL-2, IL-7, IL- 12, IL- 15, IL- 18, IL-21, IL- 24, IL-28, IL-29 and IL-36 (see e.g., Briukhovetska et al. (2021) Nat. Rev. Cancer 21:481-499) or anti-inflammatory effects include IL-4, IL-6, IL-10, IL-13, IL-19 and IL-35. Interferons, e.g., IFN-tx2b or IFN-y, have been shown to be useful in the treatment of, for example, certain viral disorders.
[0091] In an embodiment, the secreted protein is an enzyme, such as an enzyme that is deficient in a subject. For example, in an embodiment, the secreted protein is an enzyme that is lacking in a lysosomal storage disorder to thereby reconstitute the enzyme in the subject. In an embodiment, the mRNA construct encodes alpha-galactosidase (aGAL), for use in the treatment of Fabry disease. In another embodiment, the mRNA construct encodes N- sulfoglucosamine sulfohydrolase, for use in the treatment of Sanfilippo A disease. In another embodiment, the mRNA construct encodes glucocerebrosidase, for use in the treatment of Gaucher disease.
[0092] In an embodiment, the mRNA construct encodes an antibody or fragment thereof (e.g., a therapeutic antibody or fragment thereof), such as for use in immunotherapy in any clinical situation in which such therapeutic antibodies have shown to be beneficial (e.g., cancer treatment, autoimmune disease treatment). Non-limiting examples of antibodies include monoclonal antibodies, human and humanized antibodies, bispecific antibodies, intrabodies, single-chain antibodies (e.g., scFv), nanobodies (e.g., VHH single variable domain) and related agents that comprise immunoglobulin VH and / or VL regions, or binding portions thereof, for binding a target.
[0093] In an embodiment, the mRNA construct encodes a fusion protein, such as an antibody fusion protein comprising all or a portion of an antibody linked to another protein or domain thereof, such as a cytokine or other functional molecule. In an embodiment, the fusion protein comprises an antibody VH region linked to another protein (VH fusions). In another embodiment, the fusion protein comprise an antibody Fc region linked to another protein (Fc fusions).
[0094] In an embodiment, the mRNA construct encodes an immunomodulatory agent, such as an immune checkpoint inhibitor (e.g., that targets PD-1, PD-L1 or CTLA-4) for use in modulating immune responses, such as in cancer. Numerous therapeutically useful checkpoint inhibitors have been established in the art.
[0095] In an embodiment, the mRNA construct encodes a growth factor. Numerous growth factors are known in the art having well-described biological functions, non-limiting examples of which include vascular endothelial growth factor (VEGF), insulin-like growth factor (IGF), platelet-derived growth factor (PDGF), epidermal growth factor (EGF), and the like.
[0096] In an embodiment, the mRNA construct encodes vascular endothelial growth factor (VEGF). In an embodiment, the mRNA construct encodes a VEGF-A protein. The amino acid sequence of human VEGF-A (long form isoform a) is available in the art (e.g., GenBank Accession No. NP_001020537) (SEQ ID NO: 1). In an embodiment, the mRNA construct encodes the human VEGF-A 165 variant.
[0097] In some embodiments of the present disclosure, the secreted protein levels are at 10 times, such as at least 15 times, such as preferably 20 times higher compared to the secreted protein levels of mesenchymal stem cells comprising an mRNA composition comprising dsRNA, e.g. where double- stranded mRNA has not been removed. In some embodiments of the present disclosure, the secreted protein levels are at least 10 times, such as at least 50 times, such as at least 100 times, such as at least 150 times, such as preferably 240 times higher compared to the secreted protein levels of LNPs comprising chemically modified mRNA.
[0098] In some embodiments of the present disclosure, the secreted protein levels are determined. In some embodiments of the present disclosure, the secreted protein levels are determined after 0 hours, such as after at least 1 hour, such as after at least 5 hours, such as after at least 10 hours, such as after at least 24 hours, such as after at least 48 hours, such as after at least 3 days, such as after at least 5 days, such as after at least 7 days. In some embodiments of the present disclosure, the method to detect the secreted protein levels is selected from the group consisting of: ELISA, FACS and luciferin assay.
[0099] IV. Enhancement of Unmodified mRNA Constructs
[0100] The methods and compositions of the disclosure utilize unmodified mRNA constructs that have been enhanced to increase the level of expression of the encoded secreted protein. As described in the Examples, a number of approaches have been shown to enhance expression of uridine -unmodified mRNA constructs when used either alone or, more preferably, in combination, as compared to uridine-modified mRNA constructs. These approaches include optimization of certain codons within the unmodified mRNA construct, purification of the unmodified mRNA preparation prior to introduction into the hMSCs and introduction of the unmodified mRNA construct into the hMSCs by a means that utilizes a non-endosomal pathway.
[0101] In embodiments, the mRNA construct is codon optimized prior to introduction into the hMSCs, e.g., to enhance expression of the encoded secreted protein. In embodiments, the mRNA construct is engineered to reduce overall uridine content. "Reduction of uridine content" refers to decreasing the amount of uridine in an mRNA sequence, which may include the reduction of both natural uridine and chemically modified forms, such as pseudouridine, N1 -methylpseudouridine, 5-methyluridine, 2-thiouridine, 5 -methoxyuridine or 5- hydroxymethyluridine. This reduction can involve the replacement of uridine with alternative nucleotides or modifications that may alter the stability or immune recognition of the mRNA molecule. The process can help improve mRNA stability, reduce immune activation, and enhance protein translation efficiency. Thus, for example the amino acid codon UUU can be replaced by UUC as both encode phenylalanine. Furthermore, amino acid codons can be exchanged to encode for amino acids with common chemical properties, such as size, charge, polarity, or hydrophobicity, allowing them to substitute for one another in proteins without drastically altering the protein's structure or function.
[0102] In some embodiments, the reduction of the uridine content refers to the reduction of nucleotides comprising uracil.
[0103] Algorithms available in the art can be used to reduce uridine content in the mRNA construct. For example, as described in the examples, publicly available codon optimization algorithms were evaluated, and the optimised sequence obtained from the genescript algorithm was used as a starting template for reducing uridine. This algorithm, described as “GenSmart™ Codon Optimization” uses an algorithm based on the "Population Immune Algorithm", which takes advantage of both population genetics and immunology theories. In this approach, more than 200 factors involved in gene expression, including GC content, codon usage and content index, RNase splicing sites, and cis-acting mRNA destabilizing motifs, are screened and validated. Instead of applying a single-factor simulation to computing, a multifactor approach is employed to ensure that all key factors in a certain target gene sequence carry weight. As a result, each gene optimization is fully customized to maximize the likelihood of obtaining a functional and active protein. Additionally, algorithm- optimized sequences can be further processed by manually reducing their uridine content using codon substitution until the lowest level possible is obtained without generating aberrant structure complexities or secondary structures.
[0104] In some embodiments of the present disclosure, the codons of the coding sequence have been selected to reduce the uridine content by a method, wherein the method comprises following steps: a. Codon optimization; b. Reduction of uridine content by selecting uridine low or uridine free codons.
[0105] In some embodiments of the present disclosure, the codons are optimized to rebalance codon usage, decrease sequence complexity, avoid rare codons, minimize secondary structures and / or reduce complexity. In some embodiments of the present disclosure, the IDT codon optimization tool is used for codon optimization. In some embodiments of the present disclosure, the “GenSmart™ Codon Optimization tool is used to reduce the uridine content. In some embodiments of the present disclosure, the construct manufacturing complexity test is used to indicate foreseeable manufacturing problems. Therefore, in some embodiments of the present disclosure, the codons of the coding sequence have been selected to reduce the uridine content by a method, wherein the method comprises following steps: a) Codon optimization; b) Reduction of uridine content by selecting uridine low or uridine free codons c) Adjusting the codon to circumvent manufacturing problems.
[0106] Examples for manufacturing problems are hairpin structures or an unfavorable GC content. In some embodiments of the present disclosure, the absolute uridine content of the mRNA construct in the mRNA composition is reduced by at least 0.5%, such as at least 1%, such as at least 2.5%, such as at least 5%, such as at least 10%, such as at least 15% compared to the uridine content of the naturally occurring mRNA . In some embodiments of the present disclosure, the absolute uridine content of the mRNA construct in the mRNA composition is reduced by at most 15%, such as at most 10%, such as at most 5% compared to the urdine content of the naturally occurring mRNA. In some embodiments of the present disclosure, the absolute uridine content of the mRNA construct in the mRNA composition is reduced by between 0.5% and 15%, such as between 1% and 15%, such as between 2.5% and 15%, such as between 5% and 15%, such as by between 10% and 15% compared to the uridine content of the naturally occurring mRNA.
[0107] For example, the original VEGF mRNA construct (SEQ ID NO: 1) comprises 20.5% uridine (118 of 576 nucleosides are uridine). The absolute uridine content in this construct can be reduced to 17.9% uridine (SEQ ID NO: 2) (103 of 579 nucleosides are uridine) or even 13.2% uridine (SEQ ID NO 3) (76 of 576 nucleosides are uridine). This means that the amount of uridine in the construct was reduced to 64.5% of the original uridine content. In another example, the original Luciferase construct (SEQ ID NO: 4) comprises 25.8% uridine (426 of 1653 nucleosides are uridine). The absolute uridine content in this construct can be reduced to 18.9% uridine (SEQ ID NO: 5) (313 of 1653 nucleosides are uridine) or even to 16.7% uridine (SEQ ID NO: 6) (276 of 1653 nucleosides are uridine). This means that the amount of uridine in the construct was reduced to 64.7% of the original uridine content.
[0108] In some embodiments of the present disclosure, the coding sequence of the naturally occurring mRNA is taken from the mRNA Reference sequence (Refseq) from the mRNA sequenced from the host species naturally expressing the mRNA.. The person skilled in the art will appreciate that the reference sequences are available at databases like e.g, genebank, ensembl and ncbi. In embodiments, the mRNA construct is purified prior to introducing the mRNA preparation into the hMSCs, for example to remove double- stranded RNA (dsRNA) from the preparation. In an embodiment, the mRNA preparation is subjected to at least one chromatography procedure prior to introduction into hMSCs, and may be subjected to additional rounds of purification as needed. Methods for removing dsRNA using chromatographic procedures are well-established in the art. In an embodiment, dsRNA is removed from the mRNA construct preparation using cellulose purification (e.g., as described in Example 1). Alternatively, other forms of purification that remove dsRNA or other impurities can be used (e.g., HPLC, silica based, polyA affinity annealing, etc). Assays known in the art, such as the Dotblot assay described in Example 1, can be used to evaluate the amount of dsRNA in an mRNA preparation, e.g., before and after purification of the preparation on a cellulose column.
[0109] In some embodiments of the present disclosure, at most 10% of all RNA in the mRNA composition is double-stranded RNA, such as at most 8%, such as at most 6%, such as at most 5%, such as at most 3%, such as at most 1%. In some embodiments of the present disclosure, between 0% and 10% of all RNA in the mRNA composition is double- stranded RNA, such as between 0% and 8%, such as between 0% and 6%, such as between 0% and 4%. In some embodiments of the present disclosure, the method to remove dsRNA of the mRNA composition is selected from the group consisting of: cellulose chromatography, High- performance liquid chromatography, silica based chromatography and polyA affinity annealing. In a preferred embodiments of the present disclosure, the dsRNA is removed by cellulose chromatography. In some embodiments of the present disclosure, the mRNA composition is purified at least once, such as at least twice, such as at least three times. In some embodiments of the present disclosure, the method to detect the amount of dsRNA in the mRNA composition is selected from the group consisting of: Dot blot, lateral flow immunoassay, ELISA and dsRNA-sequencing. In a preferred embodiments of the present disclosure, wherein the amount of dsRNA in the mRNA composition is determined via dot blot.
[0110] In embodiments, the mRNA construct is introduced into hMSCs by means that utilize a non-endosomal pathway or approach of delivery. Endosomal pathways are a subset of endocytic pathways for internalizing molecules from the plasma membrane in which the internalized cargo is delivered into endosomes, where they are sorted for onward transport to distinct cellular destinations. Most chemically-based transfection reagents that are used to deliver mRNA constructs into cells, including liposomes and lipid nanoparticles (LNPs), utilize an endosomal pathway of delivery, resulting in the mRNA constructs being exposed to Toll-like receptors (TLRs). While not intending to be limited by mechanism, it has been found that avoiding exposure to these TLRs enables stronger tolerance and / or subsequent translation of mRNA constructs in hMSCs.
[0111] Accordingly, the methods of the disclosure utilize a non-endosomal pathway or approach of delivery (i.e., the means of delivery does not deliver the mRNA construct into endosomes). In an embodiment, the non-endosomal means of delivery utilizes a non- endocytic approach, such as a physical delivery method. A non-limiting example of such a method is electroporation, which creates temporary holes in the cell membrane and therefore avoids detection from TLRs situated in the intracellular vesicles. Use of electroporation to introduce nucleic acids into cells is well-established in the art. Electroporation can be performed using a commercially available device (e.g., Nucleofector 2b; Lonza) according to manufacturer’s guidance. Non-limiting examples of electroporation conditions for use with hMSCs and mRNA constructs are described in Example 1. Other methods are known in the art that allow for a similar “perforation”-mediated delivery, non-limiting examples of which include biolistic particle delivery (e.g., using a gene gun) and ultrasonic nebulization (also referred to as sonification). Accordingly, in embodiments, the mRNA construct is delivered into cells by means selected from the group consisting of electroporation, biolistic particle delivery and ultrasonic nebulization.
[0112] In some embodiments of the present disclosure, the non-endosomal pathway of delivery is selected from the group consisting of: Microinjection, Streptolysin-0 permeabilization, permeabilization using anionic peptides and electroporation. In a preferred embodiment, the non-endosomal pathway of delivery is electroporation.
[0113] Another example known in the art of a non-endosomal, physical delivery method for delivery of nucleic acids into cells is buffer-mediated delivery of naked mRNA, such as using a citrate solution. Accordingly, in embodiments, the mRNA construct is delivered into cells by buffer-mediated delivery of naked mRNA into the hMSCs.
[0114] In another embodiment, the non-endosomal means of delivery utilizes an endocytic pathway other than an endosomal pathway. Non-endosomal endocytic pathways include phagocytosis, pinocytosis, clathrin-dependent delivery and clathrin-independent delivery. Approaches are known in the art for delivering cargo to such non-endosomal endocytic pathways, non-limiting examples of which include use of viral particles (e.g., lentivirus, baculovirus) and use of polymers that direct entry of the cargo into a non-endosomal endocytic pathway. In one embodiment of the present disclosure, the MSCs comprise a mRNA composition comprising naked mRNA.
[0115] V. Methods of the Disclosure
[0116] The mRNA constructs and hMSCs of the disclosure are used, in combination with the enhancement approaches described herein, in methods to prepare mRNA-loaded hMSCs. The mRNA-loaded hMSCs can then be used in methods described herein to deliver a secreted protein to a subject in vivo.
[0117] A further aspect of the present disclosure regards a method of loading a cell with an mRNA composition as described herein, the method comprising: a. removing double- stranded RNA (dsRNA) from the mRNA composition; and b. introducing the mRNA composition into the cell by a non-endosomal pathway of delivery; wherein the cell is a human mesenchymal stem cell (hMSC) as described herein, the mRNA composition comprises a mRNA construct encoding a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified.
[0118] A further aspect of the present disclosure regards a method of loading a cell with an mRNA composition as described herein, the method comprising: c. Modifying / selecting the codons of the mRNA construct by: i. Codon optimization; ii. Reduction of uridine content by algorithms; iii. Manually reduction or uridine content; d. Synthesizing said mRNA construct; e. Removing double- stranded RNA (dsRNA) from the mRNA composition; and f. Introducing the mRNA composition into the cell by a non-endosomal pathway of delivery; wherein the cell is a human mesenchymal stem cell (hMSC) as described herein, the mRNA composition comprises a mRNA construct encoding a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified.
[0119] A further aspect of the present disclosure regards a method of preparing an mRNA composition for transfection into a cell, the method comprising g. Selecting an mRNA sequence coding for a protein; h. Optimizing the uridine content; i. Synthesizing the mRNA construct; j. Purifying the mRNA construct to remove double stranded RNA.
[0120] A further aspect of the present disclosure regards a method of expressing a secreted protein, the method comprising introducing an mRNA construct as described herein encoding the secreted protein into mesenchymal stem cells as described herein by a non-endosomal pathway of delivery, wherein all uridine nucleosides in the mRNA construct are chemically unmodified and the mRNA construct has been purified to remove double- stranded RNA (dsRNA), to thereby prepare mRNA-loaded hMSCs.
[0121] Accordingly, in embodiments, the disclosure provides a method of loading a cell with an mRNA construct preparation, the method comprising:
[0122] (a) purifying the mRNA construct preparation (e.g., removing double- stranded RNA (dsRNA) from the mRNA construct preparation); and
[0123] (b) introducing the mRNA construct preparation into the cell by a non-endosomal pathway of delivery (such as electroporation); wherein the cell is a human mesenchymal stem cell (hMSC), the mRNA construct encodes a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified. In embodiments, all nucleosides in the mRNA construct are chemically unmodified.
[0124] In another embodiment, the disclosure provides a method of loading a cell with an mRNA construct preparation, the method comprising:
[0125] (a) reducing uridine content in the mRNA construct preparation;
[0126] (b) purifying the mRNA construct preparation (e.g., removing double-stranded RNA (dsRNA) from the mRNA construct preparation); and
[0127] (c) introducing the mRNA construct preparation into the cell by a non-endosomal pathway of delivery (such as electroporation); wherein the cell is a human mesenchymal stem cell (hMSC), the mRNA construct encodes a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified. In embodiments, all nucleosides in the mRNA construct are chemically unmodified. In yet another embodiment, the disclosure provides a method of expressing a secreted protein in a subject in vivo, the method comprising:
[0128] (a) introducing an mRNA construct encoding the secreted protein into human mesenchymal stem cells (hMSCs) by a non-endosomal pathway of delivery, wherein all uridine nucleosides in the mRNA construct are chemically unmodified and the mRNA construct has been purified to remove double-stranded RNA (dsRNA), to thereby prepare mRNA-loaded hMSCs; and
[0129] (b) administering the mRNA-loaded hMSCs to the subject such that the secreted protein encoded by the mRNA construct is expressed in the subject.
[0130] In embodiments, all nucleosides in the mRNA construct are chemically unmodified.
[0131] In embodiments, the means of non-endosomal delivery is a method as described in Section IV above (e.g., electroporation or other method described above).
[0132] In embodiments, the mRNA construct has been engineered to reduce uridine content, e.g., using algorithms and / or manual analysis, as described in Subsection IV above.
[0133] In embodiments, the mRNA construct preparation is purified as described in Subsection IV above, e.g., by cellulose chromatography to remove dsRNA.
[0134] In embodiments, the mRNA construct preparation is introduced into the hMSCs by a non-endosomal pathway of delivery, such as electroporation, as described in Subsection IV above.
[0135] Suitable types of hMSCs for use in the methods are described in Subsection I above.
[0136] Suitable mRNA constructs and encoded secreted proteins for use in the methods are described in Subsections II and III above, respectively.
[0137] For the step of introducing the mRNA construct into the hMSCs, in an embodiment the mRNA construct preparation is introduced into cells at a dosage of at least 1 ng mRNA per 1 x 106cells. In other embodiments, the dosage is at least 0.01, 0.1, 1, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 10, 20 pg or more per 1 x 106cells.
[0138] Following introduction of the mRNA construct into the hMSCs in vitro, the level of expression of the secreted protein by the hMSCs can be evaluated by standard methods known in the art, such as ELISAs, FACS analysis, enzymatic assays, reporter assays and the like (see e.g., Example 1). In an embodiment, the secreted protein encoded by the mRNA is expressed by the hMSC at a level of at least 0.1 pg secreted protein / lxlO6cells. In other embodiments, the protein is expressed at a level of at least 0.2 pg, 0.3 pg, 0.4 pg, 0.5 pg, 0.6 pg, 0.7 pg, 0.8 pg, 0.9 pg, 1.0 pg or more / lxlO6cells. In other embodiments, the protein is expressed at a level within a range of 0.1-1.0 pg / lxlO6cells or 0.1-0.5 pg / lxlO6cells. For in vivo delivery of the mRNA-loaded hMSCs, they can be administered to the subject by a suitable route of administration. In an embodiment, the route of administration is intramuscular. In another embodiment, the route of administration is intravenous. In another embodiment, the route of administration is intratumoral. Following administration, expression of the secreted protein in the subject can be evaluated by standard methods known in the art, such as ELISAs, FACS analysis, enzymatic assays, reporter assays and the like (see e.g., Example 1). In an embodiment, the secreted protein is expressed by cells of the subject at a level of at least 1 pg / gprot. In other embodiments, the secreted protein is expressed by cells of the subject at a level of at least 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 10, 20, 50, 100 or more pg / gprot. In other embodiments, the protein is expressed at a level within a range of 1.0-100 pg / gprot or 1.0-50 pg / gprot. As used herein gprot is defined as grams of total protein detected with a method as described herein, such as ELISA, FACS, enzymatic assays and reporter assays. In some embodiments of the present disclosure, the amount of the protein of interest is measured as gram of protein per gram of lysed tissue.
[0139] VI. Compositions of the Disclosure
[0140] In another aspect, the disclosure pertains to compositions for use in the methods of the disclosure. In an embodiment, the disclosure provides a non-natural engineered human mesenchymal stem cell (hMSC) composition, the composition comprising hMSCs loaded with an mRNA construct, wherein the mRNA construct encodes a secreted protein, wherein all uridine nucleosides in the mRNA construct are chemically unmodified and wherein the secreted protein is expressed by the hMSCs at a level of at least 0.1 pg secreted protein / lxlO6cells.
[0141] In other embodiments, the protein is expressed at a level of at least 1 ng, 10 ng, 0.2 pg, 0.3 pg, 0.4 pg, 0.5 pg, 0.6 pg, 0.7 pg, 0.8 pg, 0.9 pg, 1.0 pg or more / lxlO6cells. In other embodiments, the protein is expressed at a level within a range of 1 ng - 1 mg / lxlO6cells.
[0142] In embodiments, the mRNA construct has been engineered to reduce uridine content.
[0143] In embodiments, all nucleosides within the mRNA construct are chemically unmodified.
[0144] Suitable types of hMSCs for use in the compositions are described in Subsection I above.
[0145] Suitable mRNA constructs and encoded secreted proteins for use in the compositions are described in Subsections II and III above, respectively. A further aspect of the present disclosure regards a mRNA composition comprising an substantially single stranded mRNA construct encoding a protein wherein the codons of the mRNA construct have been selected to reduce the uridine content.
[0146] VII. Medical uses
[0147] The compositions of the disclosure can be used as a medicament (e.g., for therapy) and to deliver a secreted protein to a subject (e.g., for therapeutic benefit). Accordingly, in an embodiment, the disclosure provides a composition of the disclosure for use as a medicament. In an embodiment, the disclosure provides a composition of the disclosure for delivery of a secreted protein to a subject, e.g., to provide a therapeutic benefit mediated by the secreted protein. A further aspect of the present disclosure regards the mesenchymal stem cells as described herein and / or the mRNA composition as described herein for use in method for delivery of a secreted protein to a subject. A further aspect of the present disclosure regards the mesenchymal stem cells as described herein and / or the mRNA composition as described herein for use the treatment for osteoarthristis, skin-graft rejection, Diabetes, acute lung injury, Fabry disease, Sanfilippo A disease, Gaucher disease, cancer, autoimmune diseases, neurodegenerative diseases, inflammatory disorders and / or stroke.
[0148] Examples
[0149] Below are examples of specific embodiments for carrying out the present present disclosure. The examples are offered for illustrative purposes only and are not intended to limit the scope of the present present disclosure.
[0150] The practice of the present present disclosure will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA techniques and pharmacology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., T.E. Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al, Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3rdEd. (Plenum Press) Vols A and B (1992). Unless otherwise stated, all reagents and chemicals were obtained from commercial sources and used without further purification.
[0151] Example 1: Methods
[0152] This example describes various methodologies used in the subsequent examples. mRNA Synthesis mRNA constructs were synthesized by standard techniques well established in the art such as by in vitro transcription (IVT), e.g., using standard T7 RNA polymerase enzymes. An mRNA construct typically comprises at least the basic components of: a coding region, a 5' untranslated region (UTR) (SEQ ID NO: 8), a 3' untranslated region (UTR) (SEQ ID NO: 9), a 5' cap, and a poly- A tail. An mRNA construct may further comprise one or more additional components and / or modifications as described herein or known in the art. hMSCs
[0153] Human Mesenchymal Stem / Stromal Cells (hMSCs) were obtained from various sources known in the art, including directly from a subject (e.g., bone marrow-derived MSCs) or differentiated from embryonic stem cells (e.g., induced MSCs (iMSCs) prepared from iPSCs).
[0154] Loading of mRNA into MSCs mRNA was loaded into hMSCs by electroporation. Electroporation was performed using a Nucleofector 2b (Lonza) and a commercially available human mesenchymal stem cell kit (Lonza: VPE-1001). Procedures were performed according to manufacturer’s guidance. 82uL of nucleofector solution was combined with 18uL of supplement 1 solution and lOuL of mRNA for a total of Ipg, 5pg, lOpg or 20pg per lxlOA6 hMSC. Electroporation program U- 23 was performed for high transfection efficiency. Cells were then collected and added to ImL pre- warmed Lonza MSC media in a 1.5mL Eppendorf tube and let to recover 15min at 37°C inside an incubator. Tubes were then centrifuged at 500g for 4 min and resuspended in 500uL fresh media.
[0155] GFP Toxicological and Viability Assays
[0156] Four different incremental concentrations of GFP mRNA were electroporated into cells as described above. All electroporated cells (approximately 500,000 cells) were reseeded into two T75 flasks containing 15mL of pre-warmed media. Cells were then left to grow and recover in a 37°C incubator. Cells were harvested after 24h or 72h. In order to avoid annexin-V false positive results, collected cells were left to recover for 15min at 37°C. Live cells were stained with Annexin- V (pro-apoptosis marker) and 7-AAD (Live / dead cell marker) before being processed, gated, and analysed by flowcytometry. Gating for basic Forward and Side scattering was performed to include a singularized cell population. Cells were gated to determine GFP positive fraction, mean intensity of the positive fraction, Annexin- V positive fraction (pro-apoptotic cell population) and 7-AAD positive fraction (dead cell population). All samples were processed, gated and analysed identically.
[0157] Three independent biological replicates per mRNA concentration and two technical replicates were included in the studies described herein.
[0158] VEGF-ELISA
[0159] Four different incremental concentrations of VEGF mRNA were electroporated into cells as described above. Cells were then counted and re-seeded at approximately 50,000 cells per well of a 6-well plate. The remainder of the electroporated cells (approx. 320,000 cells) were cryopreserved. Each biological replicate (n=3 per mRNA concentration) was seeded into two separate wells of a 6-well plate for each performed experiment described herein.
[0160] Accumulated. Secreted Protein
[0161] Cells were seeded in a total media volume of 3mL per well and 2x 150uL of media was collected after each time point (6h, 24h, 48h, 72h, 96h, 168h). 300uL of fresh media was added to each well after each collection point to volume compensate for sampling. Presented data did not include the approximate <1% dilution factor between each collection point or compensate for the natural evaporation of the media.
[0162] All collected samples were collected in 1.5mL Eppendorf tubes and were kept at -80°C until processed for ELISA quantification.
[0163] De-Novo Secreted Protein
[0164] Cells were seeded in a total media volume of 2mL per well and 2x 150uL of media was collected after each time point (6h, 24h, 48h, 72h, 96h, 168h). After each collection time point (except 6h) the totality of the media was exchanged. This enabled to quantify de-novo secreted protein for each bracket of 24h.
[0165] All collected samples were collected in 1.5mL Eppendorf tubes and were kept at -80°C until processed for ELISA quantification.
[0166] Accumulated Secreted Protein Post-Cryopreservation
[0167] Each sample was cryopreserved using a 10% DMSO media mix and quickly transferred into a foam box (Coolcell from Corning) and placed at -80°C overnight. The following day, the tubes were transferred to liquid nitrogen storage for 7 days. Samples were thawed and transferred to a tube containing fresh pre-heated media. After, samples were centrifuged at 500g for 4min, resuspended and cell counted. Cells were subsequently reseeded in 6-well plates and time point samples were collected as previously described.
[0168] All ELISAs were performed using human specific VEGF Quantikine ELISA kits (R&D systems). This assay quantifies human VEGF protein specifically, therefore excluding any endogenous mouse VEGF protein. mRNA Purification mRNA was purified essentially according to the purification method described in Baiersdbrfer et al. (2019) Mol. Therap. Nucl. Acids 15:26-35 and WO 2017 / 182524, the teachings of which on mRNA purification are expressly incorporated herein by reference. Each column was prepared with 0.15g of cellulose, which was prewashed by shaking vigorously at 550RPM for 10 min using Chromatography Buffer (CB = lOmM HEPES, O.lmM EDTA, 125mM NaCl, 16% ethanol).
[0169] Loaded columns were then centrifuged at 14,000 RPM for 1 min. Cellulose was rinsed with 500uL of CB and shaken for another 5 min and re-centrifuged.
[0170] 100-500pg of mRNA, diluted to 500uL with CB, was mixed inside the column. The columns were shaken at 550RPM for 60min after which they were centrifuged and the flowthrough was added to a new column.
[0171] The purified mRNA was precipitated by combining the final flow-through with 0.1 volume of 3M Sodium acetate (pH 5.5) and 1 volume of isopropanol. The precipitate was recovered by centrifuging the mixture at 14’000 RPM and the precipitated pellet was eluted using nuclease free water.
[0172] Recovery rates were consistently around 60% of the initial amount of unpurified mRNA. mRNA Codon Optimization
[0173] Initial plasmid constructs were generated after basic codon optimization using IDT codon optimization for expression in humans. This codon optimization algorithm relies on rebalancing codon usage, decreasing sequence complexity and avoiding rare codons. It is mainly used to minimize secondary structures and reduce complexity. Initial mRNA constructs still contained high percentages of Uridine and the IDT algorithm did not optimize for uridine content. Alternative publicly available codon optimization algorithms were evaluated, and the optimised sequence obtained from the genescript algorithm was used as a starting template for reducing uridine. This algorithm, described as “GenSmart™ Codon Optimization” uses an algorithm based on the "Population Immune Algorithm", which takes advantage of both population genetics and immunology theories. In this approach, more than 200 factors involved in gene expression, including GC content, codon usage and content index, RNase splicing sites, and cis-acting mRNA destabilizing motifs, are screened and validated. Instead of applying a single-factor simulation to computing, a multifactor approach is employed to ensure that all key factors in a certain target gene sequence carry weight. As a result, each gene optimization is fully customized to maximize the likelihood of obtaining a functional and active protein.
[0174] Additionally, the optimized sequences were further processed by manually reducing their uridine content using codon substitution until the lowest level possible was obtained without generating aberrant structure complexities or secondary structures.
[0175] Double-Stranded RNA Dotblot
[0176] To conduct the assay, Ipg of mRNA (2uL) diluted in nuclease free water was loaded onto a nitrocellulose membrane (0.45uM pore size, LC2001). Droplets were let to dry for 45min and the membrane was rinsed with TBST and blocked for Ih in 5% milk (TBST) at room temperature.
[0177] Membranes were then probed with an anti-dsRNA antibody (J2) (1:4000) in BSA for Ih at room temperature. Membranes were rinsed 3x lOmin in TBST and probed with a mouse- HRP secondary (1:2000) for Ih at room temperature and rinsed 3x lOmin with TBST.
[0178] Membranes were incubated 2min with Supersignal West Femto Maximum Sensitivity substrate (Thermoscientific). hMSC-mRNA for In Vivo Studies
[0179] All hMSC cells for the in vivo studies were produced from the same donor vial and banked in a similar manner. All mRNAs used for these studies were synthesized in parallel from the same nucleotide mix, enzymes, and purification column kit. mRNA was loaded into the cells as described herein and loaded cells were pooled together before being aliquoted to individual cryo vials containing 5 million cells.
[0180] Approximately 2x 50,000 mRNA loaded cells were re-seeded into 2 wells of a 6-well plate. Media samples were collected after 24h and 48h for quality control in which similar levels of secreted human VEGF protein were detected and quantified by ELISA as described herein. Luciferase expression in luciferase mRNA-loaded hMSC was validated by harvesting and lysing cells after 24h after which the lysates were tested under a GloMax96 (Promega) luminometer and luciferin assay (Promega).
[0181] In Vivo Direct Injections
[0182] Cell Thawing Protocol Cryo vials containing ImL of frozen hMSC were thawed and quickly transferred to a falcon tube containing pre- warmed fresh hMSC media (2mL of fresh media / ImL of frozen cells). Tubes were centrifuged at 400RCF for 4min at RT and pellets were resuspended in lOOuL PBS per thawed cryo vial. mRNA LNP Complexion Protocol
[0183] Each mouse was injected with lOpg of mRNA which was the equivalent amount of mRNA electroporated into 1 million hMSC and injected in the cell + mRNA groups.
[0184] All regents were kept on wet ice before complexion. Once the reagents were complexed, the tubes were kept at RT.
[0185] In a first tube, 40uL of OptiMEM was combined with lOuL of mRNA (Ipg / uL) per lOpg injection. Tubes were flicked several times to mix and left to sit for lOmin at RT.
[0186] In a second tube, 40uL of OptiMEM was combined with lOuL of LNP (RNAiMax) per lOpg injection. Tubes were flicked several times to mix and left to sit for lOmin at RT.
[0187] Both tubes were combined together and resuspended a few times, followed by incubation for 15min at RT.
[0188] In Vivo Luciferase Assay
[0189] Human MSCs were loaded with modified or unmodified Luciferase mRNA, or modified Luciferase complexed with lipofectamine, and injected into the gastrocnemius muscle of mice (lOOuL divided into 4 injection sites). Luciferase protein expression levels and duration was compared between the different treatment groups, using IVIS.
[0190] Prior to IVIS imaging, mice were injected with 150 mg Luciferin / kg body weight (e.g., for a 10 g mouse, 100 pL was injected to deliver 1.5 mg of Luciferin.).
[0191] Luciferin was prepared fresh from a stock solution of Luciferin at 15mg / ml in DPBS, w / o Mg2+ and Ca2+ and filter sterilized through a 0.2 um filter. The Luciferin solution was injected intra-peritoneally (IP) 10-15 minutes before in vivo imaging, or as determined by kinetic curve.
[0192] In Vivo VEGL Assay hMSCs were loaded with purified or unpurified unmodified VEGL mRNAs and injected into the gastrocnemius muscle of mice, or alternatively modified VEGL mRNA was complexed with lipofectamine and injected into the gastrocnemius muscle of mice (lOOuL divided into 4 injection sites).
[0193] At desired time points post-injection, the gastrocnemius muscle was harvested, homogenized, lysed and analyzed for VEGL protein expression levels in the limb muscle using VEGL ELISA as described herein. Example 2: In Vitro Evaluation of mRNA Loading Efficiencies and Expression
[0194] In this example, in vitro assays were used to compare the effect of dosage and chemistry on mRNA loading efficiencies, toxicity, cryopreservation and protein expression for chemically modified and unmodified mRNA constructs.
[0195] In a first set of studies, the effects that mRNA dosage and chemistry had on mRNA loading efficiency, cell toxicity, cell viability and mRNA protein expression was examined. In all experiments, the only difference between chemically modified and unmodified mRNA was the moiety of uridine nucleoside, in which N1 -Methylpseudouridine (ml'P) was used in the chemically modified mRNA (modRNA). Samples were divided into three groups (n=3 / group), as shown in Table 1.
[0196] Table 1 : Study Design
[0197] All cells were electroporated as described in Example 1 using the same program at different dosages and were analyzed 24h and 72h post electroporation. mRNA loading efficiency was evaluated by determining the % GFP positive population by flow cytometry as described in Example 1. Gating for basic Forward and Side scattering was performed to include a singularized cell population. Cells were gated to determine the GFP positive fraction and the mean intensity of the positive fraction. The results for the GFP positive fraction are shown in FIG. 1, which demonstrated that both unmodified and modified mRNA can be efficiently loaded into hMSC, with a % positive level of between 75-95%. Eevels of GFP expression were determined from the mean GFP signal intensity as determined by flow cytometry. The results are shown in FIG. 2, which demonstrated that the expression of GFP is dose dependent in both the chemically modified and unmodified groups but is exponentially stronger when using chemically modified mRNA.
[0198] Cell toxicity was evaluated by staining of live cells with the pro-apoptosis marker Annexin-V as described in Example 1. Cells were gated to determine the Annexin-V positive fraction (pro-apoptotic cell population). The results are shown in FIG. 3, which demonstrated that the samples showed little sign of apoptosis induction regardless of the mRNA composition or concentration used.
[0199] Cell viability was evaluated by staining live cells with the live / dead cell marker 7- AAD as described in Example 1. Cells were gated to determine the 7-AAD positive fraction (dead cell population). The results are shown in FIG. 4, which demonstrated that the samples showed little sign of cell death regardless of the mRNA composition or concentration used.
[0200] Thus, this first set of studies demonstrated that the hMSCs tolerate well different dosages of either unmodified or modified mRNA for at least the first 72 hours posttransfection, which encompasses most of the derived protein expression period.
[0201] In a second set of studies, levels of protein expression and kinetics were evaluated using a secreted protein, VEGF (SEQ ID NO: 1), since secreted proteins are the category of proteins of particular interest for the purpose of cell mediated delivery of proteins encoded by mRNA. Samples were divided into three groups (n=3 / group), as shown in Table 2.
[0202] Table 2: Study Design
[0203] The effect of cryopreservation of mRNA-loaded MSCs on protein secretion was also evaluated by freezing cells in a cryo vial at -80°C overnight, followed by transfer to liquid nitrogen for two weeks. Cells were thawed and cell viability determined by Trypan blue staining and cell counting.
[0204] MSCs were transfected with VEGF mRNA constructs (SEQ ID NO: 1) as described in Example 1 and protein secretion by fresh mRNA-loaded MSCs or cryopreserved mRNA- loaded MSCs was analysed by ELISA for human specific VEGF (also as described in Example 1) at 8h and 1-7 days post-electroporation. Further analysis was performed by analysing accumulated vs de-novo protein expression, the results of which for the fresh samples are shown in FIG. 5 and FIG. 6, respectively. Accumulated means that the media was not exchanged after collecting for each time point (illustrating the total amount of VEGF protein present) and de-novo means that the media means that the totality of the media was exchanged at each time point (illustrating the novo protein synthesis in between each time point).
[0205] The results in FIG. 5 demonstrate that both unmodified and modified VEGF mRNA led to protein secretion in fresh MSCs. Unmodified mRNA at a dose of 5 or 10 pg achieved peak levels of secreted VEGF of approximately 1 ng / lxlO3cells (= Ipg / lxlO6cells), whereas modified mRNA achieved levels 3-4 times higher, consistent with the results observed with the GFP mRNA constructs. The data also indicated that the 5-10 pg dose of unmodified mRNA was likely an upper limit for maximizing protein secretion. The results in FIG. 6 demonstrate that the majority of VEGF synthesis and secretion is completed within the first 24 hours, although significant synthesis (particularly with modified mRNA) is still on-going 72-96 hours post-transfection. Moreover, the data showed that the overall intracellular mRNA stability and translational capacity was similar between unmodified and modified mRNA.
[0206] The effect that cryopreservation had on mRNA loaded cells is shown in FIG. 7 and FIG. 8. These results, which compare VEGF secretion by fresh vs. cryopreserved MSCs over time, demonstrated that VEGF expression by unmodified mRNA-loaded cells was less affected by cryopreservation than MSCs loaded with VEGF modified mRNA, with the effect being amplified with higher dosages.
[0207] Example 3: Enhancement of Unmodified mRNA Constructs
[0208] In the example, approaches and conditions for enhancing the expression of unmodified mRNA in MSCs were identified.
[0209] In a first series of experiments, mRNA constructs were purified to remove dsRNA using cellulose purification, which has been shown to be efficient in removing dsRNA. mRNA purification was performed as described in Example 1. Alternatively, other forms of purification that remove dsRNA or other impurities could be used (e.g., HPLC, silica based, polyA affinity annealing, etc).
[0210] A Dotblot assay (as described in Example 1) using an anti-dsRNA antibody was performed to identify and quantify the relative amount of dsRNA content generated by in vitro transcription of the mRNA constructs. GFP (SEQ ID NO: 7), VEGF (SEQ ID NO: 1) and Luciferase (SEQ ID NO: 4) mRNA constructs were purified; representative results for the Luciferase mRNA construct (SEQ ID N0:4) are shown in FIG. 9. The purification showed a progressive reduction of dsRNA content (due to saturation of the dsRNA to cellulose ratio), which was performed at least 2 or 3 rounds until the level of dsRNA was at a similar range as seen in modified mRNA.
[0211] In a second series of experiments, codon optimization was performed to evaluate whether uridine reduction improved the expression of unmodified mRNA. Codons were first optimized algorithmically as described in Example 1 and were then further optimized manually by codon substitution of uridine rich codons with uridine depleted codons. For optimization of the original VEGF mRNA construct (SEQ ID NO: 1), having 20.5% uridine (118 / 576), two constructs were prepared with progressive reduction in uridine content, VEGF Uridine-mid (SEQ ID NO: 2), having 17.9% uridine, and VEGF Uridine-max (SEQ ID NO: 3), having 13.2% uridine. The results for VEGF secretion of the -mid and -max constructs, compared to the original construct and to VEGF modRNA, are shown in FIG. 10, which demonstrated that reducing the uridine content improved VEGF secretion in both the -mid and -max constructs. Interestingly, the -mid construct, with a uridine reduction down to 17.9%, still appeared to reach a dose plateau between the 5 and lOpg dosage. Further uridine reduction down to 13.2% in the -max construct seemed to slightly improve this limitation, but we still did not observe a striking dose increase between 5 and lOpg.
[0212] FIG. 10 also compares VEGF secretion levels using purification alone, uridine reduction alone and the combination of purification and uridine reduction. For all constructs (SEQ ID NO 1-3), purification seemed to have the most significant effect on VEGF expression, with all purified constructs strongly increasing expression levels beyond the values obtained with VEGF modified mRNA. Further difference may be observed at higher mRNA / cell dosage levels between combined purified-codon optimized mRNA, as the plateau effect is most likely due to an absolute amount of uridine and dsRNA content intracellularly rather than due to a relative proportion in the construct itself.
[0213] Overall, these studies demonstrated that both purification to remove dsRNA from the mRNA construct preparation and codon optimization to reduce the uridine content in the mRNA construct led to increased expression of a secreted protein encoded by an unmodified mRNA construct that had been transfected into hMSCs.
[0214] Example 4: In Vivo Evaluation of Unmodified mRNA Expression
[0215] In this example, in vivo studies were conducted to evaluate the biodistribution and protein expression of unmodified mRNA constructs encoding an intracellular or a secreted protein pre-loaded into hMSCs. The studies were designed to establish the biodistribution of direct injections of hMSC and the kinetics of expression of an intracellular protein and a secreted protein.
[0216] In a first set of experiments, hMSCs were electroporated with unpurified or purified Luciferase unmodified mRNA construct (SEQ ID NO: 4). Purification was performed as described in Examples 1 and 3. NSG mice (n=20 mice, 4 per group) were injected intramuscularly with 100 uL containing: (i) IxlO6hMSCs (sham control); (ii) IxlO6hMSCs loaded with lOpg Luciferase unmodified mRNA (SEQ ID NO: 4); (iii) IxlO6hMSCs loaded with lOpg cellulose-purified Luciferase unmodified mRNA (SEQ ID NO: 4); (iv) IxlO6hMSCs loaded with lOpg Luciferase modified mRNA (modRNA); or (v) LNP complexed with Luciferase modRNA (positive control). Luciferase expression was assayed at 6hr, 24hr, 48hr, 72hr and 168hr post-injection by IVIS imaging as described in Example 1. The IVIS assay showed protein expression only at the site of injection (intramuscular injection in the gastrocnemius magnus muscle).
[0217] Relative quantification of Luciferase expression in vivo, summarized in FIG. 11, showed similar protein expression with the hMSC-Luci sample and the LNP-modLuci sample, although LNP delivery into the muscle maintained a lower baseline expression longer than the expression in the hMSC. Peak expression was also similar between the hMSC- purified-Luci sample and the hMSC-modLuci sample, demonstrating the effectiveness of purification in increasing protein expression from the unmodified mRNA sample.
[0218] In a second set of experiments, the comparative in vivo expression kinetics of a secreted protein (VEGF) was investigated. A similar experiment to the Luciferase one was performed, comparing unmodified VEGF (SEQ ID NO: 1), purified unmodified VEGF (SEQ ID NO: 1) and LNP-modVEGF. hMSCs were electroporated with unpurified or purified VEGF unmodified mRNA construct. Purification was performed as described in Examples 1 and 3. NSG mice were injected intramuscularly with 100 uL containing: (i) IxlO6hMSCs (sham control; n=18); (ii) IxlO6hMSCs loaded with lOpg VEGF unmodified mRNA (SEQ ID NO: 1) (n=24); (iii) IxlO6hMSCs loaded with lOpg cellulose-purified VEGF unmodified mRNA (SEQ ID NO: 1) (n=24); or (iv) LNP complexed with VEGF modRNA (positive control; n=18). VEGF expression was assayed at 6-8hr, 24hr, 48hr, 72hr, 96hr and 168hr post- injection by ELISA as described in Example 1.
[0219] Representative VEGF expression in vivo are shown in FIG. 12A-12B, which demonstrate that significantly higher secreted protein levels can be achieved in vivo using the purified VEGF unmodified mRNA construct (SEQ ID NO: 1) as compared to the other samples. Levels at least 20-fold higher were observed, with levels >400-fold higher detected at certain time points. Total protein expression from Oh to 168h (the sum of calculated areas for between timepoint bracket) it was quantified that: hMSC-purif-VEGF ~19.8-fold > hMSC-VEGF and hMSC-purif-VEGF ~240-fold > LNP-modVEGF (see FIG. 12B).
[0220] Expression levels using MSCs loaded with intracellular vs secreted modified mRNA were compared to published studies reporting expression levels using modified mRNAs loaded into fibroblasts (Yu et al. (2019) J. Controlled. Release 310:103-114). hMSC (electroporated) and fibroblasts (LNP-mediated transfection) expressed similar amounts of intracellular protein (Luciferase) with the same modified mRNA Luciferase construct. In contrast, with respect to secreted proteins, hMSCs loaded with unmodified purified VEGF mRNA (SEQ ID NO: 1) had an 8-fold higher level of expression of secreted VEGF as compared to 2x the dosage of fibroblasts loaded with similar mRNA / cell dose of modified VEGF mRNA, suggesting approximately 16-fold stronger secretion when using hMSC rather than fibroblasts to deliver secreted proteins in vivo. Thus, hMSCs exhibit a preference for expressing secreted proteins encoded by mRNA as compared to fibroblasts.
[0221] The contrasting results observed with the luciferase experiment compared to the VEGF experiment indicate that much higher yields of secreted proteins can be obtained from “secretory enthusiastic” mRNA-loaded MSCs. The further combination of non-endosomal mRNA loading methods (such as electroporation), in contrast to use of LNP-mediated delivery, enabled the efficient utilization of unmodified mRNAs. Moreover, in combination, purification of the unmodified mRNA (to similar levels as obtained with modified mRNAs) enabled similar secreted protein expression levels as seen with modified mRNA.
[0222] Furthermore, the combination of mRNA (modified or unmodified) in hMSC for in vivo delivery of secreted proteins is superior to LNP-mediated delivery, at similar dosages. Unmodified mRNA can be used to obtain significant protein yields by loading them into cells using non-endosomal pathways of delivery (i.e., electroporation) which bypasses the detection by endosomal toll-like receptors (TLRs) and reduces the activation of the innate immune system. Additionally, similar expression to chemically modified mRNAs of secreted protein by mRNA-loaded cells can be obtained by removing impurities such as dsRNAs, and by codon optimizing the mRNA sequences to reduce the amount of Uridine content.
[0223] In summary, the combination of elements described herein enables substantial secreted protein yields in vivo (e.g., more than 200-fold) compared to LNP-based delivery of modified mRNA (e.g., more than 200-fold higher levels of expression). References
[0224] Adams et al. (2018) New Eng. J. Med. 379:11-21
[0225] Baiersdorfer et al. (2019) Mol. Therap. Nucl. Acids 15:26-35
[0226] Beeravolu et al. (2017) J. Vis. Exp, 122 Briukhovetska et al. (2021) Nat. Rev. Cancer 21:481-499)
[0227] Cheng et al. (2020) Nature Nanotech. 15:313-320
[0228] Chong et al. (2012) J Orthop Res., 30(4):634-42
[0229] Coelho et al. (2013) New Eng. J. Med. 369:819-829
[0230] Fitzsimmons et al. (2018) Stem Cells Int. 2018: 8031718 Jayarama et al. (2012) Angew Chem. Int. Ed. Engl. 51:8529-8533
[0231] Schneider et al. (2017) Eur. J. Med. Res. 22(1):17).
[0232] Ullah et al. (2015) Biosci. Rep., 35(2);
[0233] Soontararak et al. (2018) Stem Cells Transl. Med. 7:456-467;
[0234] Yang et al. (2019) Cell Death and Disease 10:718; Xu et al. (2019) Stem Cells 37:754-765
[0235] Sequence overview
[0236] SEQ ID NO 1:
[0237] VEGF-A coding sequence:
[0238] 5’- atgaactttctgctgtcttgggtgcattggagccttgccttgctgctctacctccaccatgccaagtggtcccaggctgcacccatggcag aaggaggagggcagaatcatcacgaagtggtgaagttcatggatgtctatcagcgcagctactgccatccaatcgagaccctggtgga catcttccaggagtaccctgatgagatcgagtacatcttcaagccatcctgtgtgcccctgatgcgatgcgggggctgctgcaatgacg agggcctggagtgtgtgcccactgaggagtccaacatcaccatgcagattatgcggatcaaacctcaccaaggccagcacataggag agatgagcttcctacagcacaacaaatgtgaatgcagaccaaagaaagatagagcaagacaagaaaatccctgtgggccttgctcag agcggagaaagcatttgtttgtacaagatccgcagacgtgtaaatgttcctgcaaaaacacagactcgcgttgcaaggcgaggcagctt gagttaaacgaacgtacttgcagatgtgacaagccgaggcggtga-3’
[0239] SEQ ID NO 2:
[0240] VEGF-A mid uridine reduction sequence:
[0241] 5’- atgaacttcctgctgagctgggtccactggagcctggccctgctcctgtacctgcaccacgccaagtggtcccaggccgctcctatggc cgagggcggcggacagaaccaccacgaggtggtcaaattcatggacgtgtaccagcggagctactgccatcctattgaaaccctggt ggacatcttccaggagtaccccgatgaaatcgagtatatcttcaagcccagctgcgtgccactgatgcggtgcggcggctgctgcaatg atgagggcctggaatgtgtgcctacagaggaaagcaatatcaccatgcagatcatgagaatcaagccccaccagggccaacacatcg gcgagatgtcttttctgcagcacaacaagtgcgagtgcagacctaagaaagacagagccagacaggagaacccctgtggaccttgttc tgaacggagaaagcacctgttcgtgcaggatcctcaaacatgcaaatgctcctgtaaaaacaccgacagcagatgcaaggctcgcca gctggaactgaacgagcggacctgtagatgcgacaagcctagaaggtga-3’
[0242] SEQ ID NO 3:
[0243] VEGF-A max uridine reduction sequence:
[0244] 5’- atgaacttcctgctgagctgggtacactggagcctggccctgctcctgtacctgcaccacgcaaagtggagccaggcagcaccgatg gccgagggcggcggacagaaccaccacgaggtggtcaaattcatggacgtgtaccagcggagctactgccacccgatagagaccc tggtggacatcttccaggagtaccccgacgaaatcgagtacatcttcaagcccagctgcgtgccactgatgcggtgcggcggctgctg caatgatgagggcctggaatgcgtgccaacagaggaaagcaacatcaccatgcagatcatgagaatcaagccccaccagggccaac acatcggcgagatgagcttcctgcagcacaacaagtgcgagtgcagaccgaagaaagacagagccagacaggagaacccctgcg gaccgtgcagcgaaaggagaaagcacctgttcgtgcaggacccacaaacatgcaaatgcagctgcaaaaacacagacagcagatg caaggccagacagctggaactgaacgagcggacctgcagatgcgacaagccaagaagatga-3’ SEQ ID NO 4:
[0245] Luciferase coding sequence:
[0246] 5’- gggaaactctatagggcgaattgggccctctagatgcatgctcgagcggccgccttcctactcaggctttattcaaagaccaagaggta caggtgcaagggagagaagaagggcatggccagaaggcaagccccgcagaaggcagcggccctctagaattacacggcgatcttt ccgcccttcttggcctttatgaggatctctctgatttttcttgcgtcgagttttccggtaagacctttcggtacttcgtccacaaacacaactcc tccgcgcaactttttcgcggttgttacttgactggcgacgtaatccacgatctctttttccgtcatcgtctttccgtgctccaaaacaacaacg gcggcgggaagttcaccggcgtcatcgtcgggaagacctgcgacacctgcgtcgaagatgttggggtgttggagcaagatggattcc aattcagcgggagccacctgatagcctttgtacttaatcagagacttcaggcggtcaacgatgaagaagtgttcgtcttcgtcccagtaa gctatgtctccagaatgtagccatccatccttgtcaatcaaggcgttggtcgcttccggattgtttacataaccggacataatcataggacc tctcacacacagttcgcctctttgattaacgcccagcgttttcccggtatccagatccacaaccttcgcttcaaaaaatggaacaactttacc gaccgcgcccggtttatcatccccctcgggtgtaatcagaatagctgatgtagtctcagtgagcccatatccttgcctgatacctggcaga tggaacctcttggcaaccgcttccccgacttccttagagaggggagcgccaccagaagcaatttcgtgtaaattagataaatcgtatttgt caatcagagtgcttttggcgaagaaggagaatagggttggcaccagcagcgcactttgaatcttgtaatcctgaaggctcctcagaaac agctcttcttcaaatctatacattaagacgactcgaaatccacatatcaaatatccgagtgtagtaaacattccaaaaccgtgatggaatgg aacaacacttaaaatcgcagtatccggaatgatttgattgccaaaaataggatctctggcatgcgagaatctcacgcaggcagttctatga ggcagagcgacccctttaggcagaccgtagatccgaaggagttcatgatcagggcaatggcttggccctatcgaaggatctgggcca aaatc-3’
[0247] SEQ ID NO 5:
[0248] Luciferase mid uridine reduction sequence:
[0249] 5’- atggaagatgccaaaaacatcaagaaaggccctgcccctttctaccccctggaggacggcacagctggcgaacagctgcataaggc catgaagagatacgctctggtccctggaacaatcgccttcaccgacgctcacatcgaggtggatatcacatacgccgagtacttcgaga tgagcgtgcggctggccgaggccatgaaacgctacggcctgaacacaaaccacagaatcgtagtgtgcagcgagaacagtctgcag ttctttatgcctgtgctgggcgccctgttcatcggcgtggcagtggccccagccaacgacatctacaacgagagagagctgttgaattct atgggcatcagccagcctaccgtggtgttcgtgtccaagaagggcctgcagaagatcctgaatgtgcagaagaagctgccgatcatcc agaaaatcatcatcatggacagcaagacagattaccagggttttcagagcatgtacaccttcgtaaccagccacctgcctcctggcttca acgagtacgacttcgtgcccgaatcttttgatagagataagaccattgctctgatcatgaacagcagcggcagcaccggactgcccaag ggcgtggctctgccccaccggaccgcctgtgtgaggttttctcacgcccgggaccccatcttcggcaaccagatcattcccgatacgg ctatcctgagcgtggtgcctttccaccacggcttcggaatgttcacaacactgggctacctgatctgcggctttagagtggtgctgatgta ccggttcgaggaagaactgttcctgagatctctgcaggactacaagatccaaagcgccctcctggtgcctacactgttttccttcttcgcc aagtctaccctgatcgacaagtatgacctgtccaacctgcacgagatcgccagcggcggcgccccactgagcaaagaagtcggcga ggccgtggccaaaagattccatctgcccggcatcagacagggctatggccttaccgagacaacctctgccatactgatcacccctgag ggcgacgataagcctggcgccgtgggcaaggtggtgccattcttcgaggccaaagtggtggacctggacaccggcaagaccctgg gcgtgaatcaaagaggcgaactgtgcgtccggggccctatgatcatgagcggatacgtgaacaaccctgaggccaccaacgccctg atcgacaaggacggctggctgcacagcggcgatatcgcctactgggacgaggatgagcacttctttatcgtggacagactgaagtccc tgatcaagtacaagggctaccaggtggcccccgctgaactggagagcatcctgctgcaacaccccaatatcttcgacgccggagtcg ctggcctgcctgatgacgacgccggcgagctgcctgctgccgtggtggtgctggagcacggaaagaccatgaccgaaaaggaaatc gtcgactatgtggctagccaggttaccaccgccaagaagctcagaggaggagtagtgttcgtggacgaagtgcctaaggggctgacc ggaaaactggatgccagaaagattcgggaaatcctgatcaaggccaagaaaggcggcaagatcgccgtgtga-3’
[0250] SEQ ID N0 6:
[0251] Luciferase max uridine reduction sequence:
[0252] 5’- atggaagatgccaaaaacatcaagaaaggcccagcgccgttctaccccctggaggacggcacagcaggcgaacagctgcacaagg ccatgaagagatacgcactggtcccaggaacaatcgccttcaccgacgcacacatcgaggtggatatcacatacgccgagtacttcga gatgagcgtgcggctggccgaggccatgaaacgctacggcctgaacacaaaccacagaatcgtagtatgcagcgagaacagcctgc agttcttcatgccagtgctgggcgccctgttcatcggcgtggcagtggcgccagccaacgacatctacaacgagagagagctgctgaa ctcaatgggcatcagccagccaaccgtggtgttcgtgtccaagaagggcctgcagaagatcctgaatgtgcagaagaagctgccgat catccagaaaatcataatcatggacagcaagacagactaccaggggttccagagcatgtacaccttcgtaaccagccacctgcctcctg gcttcaacgagtacgacttcgtgcccgagagctttgatagagataagaccatagctctgatcatgaacagcagcggcagcaccggact gcccaagggcgtggctctgccccaccggaccgcctgtgtgaggttttctcacgcccgggaccccatcttcggcaaccagatcataccc gatacggctatcctgagcgtggtgccgttccaccatggcttcggaatgttcacaacactgggctacctgatctgcggctttagagtggtg ctgatgtaccggttcgaggaagaactgttcctgagaagcctgcaggactacaagatccaaagcgccctcctggtgcccacactgttttc cttcttcgccaagtctaccctgatagacaagtacgacctgagcaacctgcacgaaatcgccagcggcggcgccccactgagcaaaga agtcggcgaggccgtggccaaaagattccatctgcccggcatcagacagggctatggccttaccgaaacaacctctgccatactgatc accccagaaggcgacgacaagcctggcgccgtgggcaaggtagtgccattcttcgaggcgaaagtggtggacctggacaccggca agaccctgggcgtgaatcaaagaggcgaactgtgcgtccggggcccaatgatcatgagcggatacgtcaacaacccggaggccac caacgccctgatcgacaaagacggctggctgcacagcggcgatatcgcctactgggacgaggatgagcacttctttatcgtggacag actgaagtccctgatcaagtacaagggctaccaggtggcccccgcagaactggagagcatcctgctgcaacaccccaatatcttcgac gcgggagtcgctggcctgcctgatgacgacgccggcgagctgccagcagccgtggtggtgctggaacacggaaagaccatgaccg aaaaggaaatcgtcgactacgtggcaagccaggttaccaccgcgaagaagctcagagggggagtagtgttcgtggacgaagtgcca aaggggctgaccggaaaactggatgccagaaagatccgggaaatcctgatcaaggccaagaaaggcggcaagatcgccgtgtga-
[0253] 3’
[0254] SEQ ID NO 7: GFP coding sequence:
[0255] 5’- atgaactttctgctgtcttgggtgcattggagccttgccttgctgctctacctccaccatgccaagtggtcccaggctgcacccatggcag aaggaggagggcagaatcatcacgaagtggtgaagttcatggatgtctatcagcgcagctactgccatccaatcgagaccctggtgga catcttccaggagtaccctgatgagatcgagtacatcttcaagccatcctgtgtgcccctgatgcgatgcgggggctgctgcaatgacg agggcctggagtgtgtgcccactgaggagtccaacatcaccatgcagattatgcggatcaaacctcaccaaggccagcacataggag agatgagcttcctacagcacaacaaatgtgaatgcagaccaaagaaagatagagcaagacaagaaaatccctgtgggccttgctcag agcggagaaagcatttgtttgtacaagatccgcagacgtgtaaatgttcctgcaaaaacacagactcgcgttgcaaggcgaggcagctt gagttaaacgaacgtacttgcagatgtgacaagccgaggcggtga-3’
[0256] SEQ ID NO 8:
[0257] 5’UTR:
[0258] 5’-ttggaccctcgtacagaagctaatacgactcactatagggaaataagagagaaaagaagagtaagaagaaatataagagccacc- 3’
[0259] SEQ ID NO 9:
[0260] 3’UTR:
[0261] 5’- gctgccttctgcggggcttgccttctggccatgcccttcttctctcccttgcacctgtacctcttggtctttgaataaagcctgagtaggaag -3’
[0262] Items
[0263] 1. A mesenchymal stem cell comprising a substantially single stranded composition of a mRNA construct introduced into the cell by a non-endosomal pathway of delivery, the mRNA construct comprising a coding sequence, wherein all nucleosides within the mRNA construct are chemically unmodified.
[0264] 2. A mesenchymal stem cell comprising a substantially single stranded composition of a mRNA construct introduced into the cell by a non-endosomal pathway of delivery, the mRNA construct comprising a coding sequence, wherein the codons of the mRNA construct have been selected to reduce the uridine content.
[0265] 3. The mesenchymal stem cell according to item 2, wherein all nucleosides within the mRNA construct are chemically unmodified.
[0266] 4. The mesenchymal stem cell according to any one of the preceding items, wherein the mRNA construct encodes a protein, such as a secreted protein.
[0267] 5. The mesenchymal stem cell according to any one of the preceding items, wherein the mRNA construct encodes a cytokine, an enzyme, a chemokine, an antibody or fragment thereof, an immunomodulatory agent or a growth factor.
[0268] 6. The mesenchymal stem cell according to any one of the preceding items, wherein the mRNA construct comprises a 3’ and / or 5' untranslated region (UTR).
[0269] 7. The mesenchymal stem cell according to any one of the preceding items, wherein the mRNA construct comprises a 5' cap.
[0270] 8. The mesenchymal stem cell according to any one of the preceding items, wherein the mRNA construct comprises a poly-A tail.
[0271] 9. The mesenchymal stem cell according to any one of the preceding items, wherein the mRNA construct comprises a 5' untranslated region (UTR), a 3' untranslated region (UTR), a 5' cap, and a poly-A tail. 10. The mesenchymal stem cell according to any one of the preceding items, wherein the method to synthesize the mRNA construct is selected from the group of Enzymatic (IVT) methods, solid-phase methods, liquid-phase methods, combined synthetic methods, small region synthesis, and ligation methods.
[0272] 11. The mesenchymal stem cell according to any one of the preceding items, wherein the mRNA construct is synthesized via in vitro transcription (IVT).
[0273] 12. The mesenchymal stem cell according to item 11, wherein a T7 polymerase is used for synthesizing the mRNA construct.
[0274] 13. The mesenchymal stem cell according to any one of the preceding items, wherein the non-endosomal pathway of delivery is selected from the group consisting of: biolistic particle delivery, ultrasonic nebulization, sonification, buffer-mediated delivery, delivery utilizing phagocytosis, pinocytosis, clathrin-dependent delivery and / or clathrin-independent delivery by virus particles and / or polymers, microinjection, streptolysin-0 permeabilization, permeabilization using anionic peptides and electroporation.
[0275] 14. The mesenchymal stem cell according to any one of the preceding items, wherein the non-endosomal pathway of delivery is electroporation.
[0276] 15. The mesenchymal stem cell according to any one of the preceding items, wherein at least 1 ng mRNA, such as at least 10 ng mRNA, such as at least 100 ng mRNA, such as at least 0.5 pg mRNA, such as at least 1 pg mRNA, such as at least 5 pg, such as at least 7 pg mRNA, such as at least 10 pg mRNA, such as at least 100 pg is introduced into lx 106mesenchymal stem cells.
[0277] 16. The mesenchymal stem cell according to any one of the preceding items, wherein at most 1 mg mRNA, such as at most 100 pg mRNA, such as 50 pg mRNA, such as at most 25 pg mRNA, such as at most 20 pg mRNA, such as at most 10 pg mRNA is introduced into IxlO6mesenchymal stem cells. 17. The mesenchymal stem cell according to any one of the preceding items, wherein between 1 ng mRNA and 1 mg mRNA, such as between 10 ng mRNA and 100 pg mRNA, such as between 0.5 pg mRNA and 50 pg mRNA, such as between 1 pg mRNA and 25 pg mRNA, such as between 5 pg mRNA and 20 pg mRNA is introduced into IxlO6mesenchymal stem cells.
[0278] 18. The mesenchymal stem cell according to any one of the preceding items, wherein at least IxlO10, such as at least IxlO13, such as at least IxlO16mRNA molecules with a length of up to 100 nucleotides are introduced into IxlO6mesenchymal stem cells.
[0279] 19. The mesenchymal stem cell according to any one of the preceding items, wherein at least 5xl010, such as at least 5xl013, such as at least 5xlO16mRNA molecules with a length of up to 500 nucleotides are introduced into IxlO6mesenchymal stem cells.
[0280] 20. The mesenchymal stem cell according to any one of the preceding items, wherein at least IxlO9, such as at least IxlO12, such as at least IxlO15mRNA molecules with a length of up to 1000 nucleotides are introduced into IxlO6mesenchymal stem cells.
[0281] 21. The mesenchymal stem cell according to any one of the preceding items, wherein at least 5xl09, such as at least 5xl012, such as at least 5xl015mRNA molecules with a length of up to 5000 nucleotides are introduced into IxlO6mesenchymal stem cells.
[0282] 22. The mesenchymal stem cell according to any one of the preceding items, wherein at least IxlO8, such as at least IxlO11, such as at least lxlO14mRNA molecules with a length of up to 10000 nucleotides are introduced into IxlO6mesenchymal stem cells.
[0283] 23. The mesenchymal stem cell according to any one of the preceding items, wherein at most IxlO16, such as at most IxlO13, such as at most IxlO10mRNA molecules with a length of up to 100 nucleotides are introduced into IxlO6mesenchymal stem cells.
[0284] 24. The mesenchymal stem cell according to any one of the preceding items, wherein at most 5xl016, such as at most 5xl013, such as at most lxl09mRNA molecules with a length of up to 500 nucleotides are introduced into IxlO6mesenchymal stem cells. 25. The mesenchymal stem cell according to any one of the preceding items, wherein at most IxlO15, such as at most IxlO12, such as at most IxlO9mRNA molecules with a length of up to 1000 nucleotides are introduced into IxlO6mesenchymal stem cells.
[0285] 26. The mesenchymal stem cell according to any one of the preceding items, wherein at most 5xl015, such as at most 5xl012, such as at most 5xl09mRNA molecules with a length of up to 5000 nucleotides are introduced into IxlO6mesenchymal stem cells.
[0286] 27. The mesenchymal stem cell according to any one of the preceding items, wherein at most IxlO14, such as at most IxlO11, such as at most IxlO8mRNA molecules with a length of up to 10000 nucleotides are introduced into IxlO6mesenchymal stem cells.
[0287] 28. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise at least 1 ng, such as at least 10 ng, such as at least 100 ng, such as at least 0.5 pg, such as at least 1 pg, such as at least 5 pg, such as at least 7 pg, such as at least 10 pg of said mRNA composition.
[0288] 29. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise at most 1 mg, such as at most 100 pg, such as at most 50 pg, such as at most 25 pg, such as at most 20 pg, such as at most 10 pg of said mRNA composition.
[0289] 30. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise between 1 ng and 1 mg, such as between 10 ng and 100 pg, such as between 0.5 pg and 50 pg, such as between 1 pg and 25 pg , such as between 5 pg and 20 pg of said mRNA composition.
[0290] 31. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise at least IxlO10, such as at least IxlO13, such as at least lxlO16mRNA molecules of said mRNA composition with a length of up to 100 nucleotides. 32. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise at least 5xlO10, such as at least 5xl013, such as at least 5xl016mRNA molecules of said mRNA composition with a length of up to 500 nucleotides.
[0291] 33. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise at least IxlO9, such as at least IxlO12, such as at least IxlO15mRNA molecules of said mRNA composition with a length of up to 1000 nucleotides.
[0292] 34. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise at least 5xl09, such as at least 5xl012, such as at least 5xl015mRNA molecules of said mRNA composition with a length of up to 5000 nucleotides.
[0293] 35. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise at least IxlO8, such as at least IxlO11, such as at least IxlO14mRNA molecules of said mRNA composition with a length of up to 10000 nucleotides.
[0294] 36. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise at most IxlO16, such as at most IxlO13, such as at most IxlO10mRNA molecules of said mRNA composition with a length of up to 100 nucleotides.
[0295] 37. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise at most 5xl016, such as at most 5xl013, such as at most 5xl010mRNA molecules of said mRNA composition with a length of up to 500 nucleotides.
[0296] 38. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise at most IxlO15, such as at most IxlO12, such as at most IxlO19mRNA molecules of said mRNA composition with a length of up to 1000 nucleotides.
[0297] 39. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise at most 5xl015, such as at most 5xl012, such as at most 5xl09mRNA molecules of said mRNA composition with a length of up to 5000 nucleotides. The mesenchymal stem cell according to any one of the preceding items, wherein IxlO6cells comprise at most IxlO14, such as at most IxlO11, such as at most IxlO8mRNA molecules of said mRNA composition with a length of up to 10000 nucleotides. The mesenchymal stem cell according to any one of items 31 to 40, wherein, the method of detecting the amount of mRNA molecules in the mesenchymal stem cells is selected from the group consisting of: RNA sequencing, northern analysis, nuclease protection assays, In-situ hybridization and RT-PCR. The mesenchymal stem cell according to any one of the preceding items, wherein at most 10% of all RNA in the mRNA composition is double- stranded RNA, such as at most 8%, such as at most 6%, such as at most 5%, such as at most 3%, such as at most 1%. The mesenchymal stem cell according to any one of the preceding items, wherein between 0% and 10% of all RNA in the mRNA composition is double- stranded RNA, such as between 0% and 8%, such as between 0% and 6%, such as between 0% and 4%. The mesenchymal stem cell according to any one of the preceding items, wherein the method to remove dsRNA of the mRNA composition is selected from the group consisting of: cellulose chromatography, High-performance liquid chromatography, silica based chromatography and polyA affinity annealing. The mesenchymal stem cell according to any one of the preceding items, wherein the dsRNA is removed by cellulose chromatography. The mesenchymal stem cell according to any one of the items 44 to 45, wherein the mRNA composition is purified at least once, such as at least twice, such as at least three times. The mesenchymal stem cell according to any one of the items 42 to 46, wherein the method to detect the amount of dsRNA in the mRNA composition is selected from the group consisting of: Dot blot, lateral flow immunoassay, ELISA, electrophoresis, northernblot, spectroscopy e.g., mass spectroscopy and dsRNA-sequencing.
[0298] 48. The mesenchymal stem cell according to any one of the items 42 to 46, wherein the amount of dsRNA in the mRNA composition is determined via dot blot.
[0299] 49. The mesenchymal stem cell according to any one of the preceding items, wherein the codons of the coding sequence have been selected to reduce the uridine content by a method, wherein the method comprises following steps: a. Codon optimization; b. Reduction of uridine content by selecting uridine low or uridine free codons.
[0300] 50. The mesenchymal stem cell according to item 49, wherein the codons are optimized to rebalance codon usage, decrease sequence complexity, avoid rare codons, minimize secondary structures and / or reduce complexity.
[0301] 51. The mesenchymal stem cell according to any one of the items 49 to 50, wherein the IDT codon optimization tool is used for codon optimization.
[0302] 52. The mesenchymal stem cell according to any one of the items 49 to 51, wherein the “GenSmart™ Codon Optimization tool is used to reduce the uridine content.
[0303] 53. The mesenchymal stem cell according to any one of the preceding items, wherein the absolute uridine content of the mRNA construct in the mRNA composition is reduced by at least 0.5%, such as at least 1%, such as at least 2.5%, such as at least 5%, such as at least 10%, such as at least 15% compared to the uridine content of the naturally occurring mRNA.
[0304] 54. The mesenchymal stem cell according to any one of the preceding items, wherein the absolute uridine content of the mRNA construct in the mRNA composition is reduced by at most 15%, such as at most 10%, such as at most 5% compared to the uridine content of the naturally occurring mRNA.
[0305] 55. The mesenchymal stem cell according to any one of the preceding items, wherein the absolute uridine content of the mRNA construct in the mRNA composition is reduced by between 0.5% and 15%, such as between 0.5% and 15%, such as between 2.5% and 15%, such as between 5% and 15%, such as by between 10% and 15% compared to the uridine content of the naturally occurring mRNA.
[0306] 56. The mesenchymal stem cell according to any one of the preceding items, wherein the cell is derived from a tissue selected from the group consisting of bone marrow, adipose tissue, peripheral blood, umbilical cord, amniotic fluid, cord blood, placenta and Wharton’s jelly.
[0307] 57. The mesenchymal stem cell according to any one of the preceding items, wherein the cell is differentiated from stem cells.
[0308] 58. The mesenchymal stem cell according to any one of the preceding items, wherein the cells are cryopreserved and / or thawed prior to administering to the subject.
[0309] 59. The mesenchymal stem cell according to any one of the preceding items, wherein the cells are cryopreserved in 10% DMSO.
[0310] 60. A mRNA composition comprising a substantially single stranded mRNA construct encoding a protein wherein the codons of the mRNA construct have been selected to reduce the uridine content.
[0311] 61. The mRNA composition according to item 60, wherein all nucleosides within the mRNA construct are chemically unmodified.
[0312] 62. The mRNA composition according to any one of the items 60 to 61, wherein the mRNA construct encodes a cytokine, an enzyme, a chemokine, an antibody or fragment thereof, an immunomodulatory agent or a growth factor.
[0313] 63. The mRNA composition according to any one of the items 60 to 62, wherein the mRNA construct comprises a coding region.
[0314] 64. The mRNA composition according to any one of the items 60 to 63, wherein the mRNA construct comprises a 3’ and / or 5' untranslated region (UTR). 65. The mRNA composition according to any one of the items 60 to 64, wherein the mRNA construct comprises a 5' cap.
[0315] 66. The mRNA composition according to any one of the items 60 to 65, wherein the mRNA construct comprises a poly-A tail.
[0316] 67. The mRNA composition according to any one of the items 60 to 66, wherein the mRNA construct comprises a 5' untranslated region (UTR), a 3' untranslated region (UTR), a 5' cap, and a poly-A tail.
[0317] 68. The mRNA composition according to any one of the items 60 to 67, wherein the method to synthesize the mRNA construct is selected from the group of Enzymatic (IVT) methods, solid-phase methods, liquid-phase methods, combined synthetic methods, small region synthesis, and ligation methods.
[0318] 69. The mRNA composition according to any one of the items 60 to 68, wherein the mRNA construct is synthesized via in vitro transcription (IVT).
[0319] 70. The mRNA composition according to item 69, wherein a T7 polymerase is used for synthesizing the mRNA construct.
[0320] 71. The mRNA composition according to any one of the items 60 to 70, wherein at most 10% of all RNA in the mRNA composition is double-stranded RNA, such as at most 8%, such as at most 6%, such as at most 5%, such as at most 3%, such as at most 1%.
[0321] 72. The mRNA composition according to any one of the items 60 to 71, wherein between 0% and 10% of all RNA in the mRNA composition is double-stranded RNA, such as between 0% and 8%, such as between 0% and 6%, such as between 0% and 4%.
[0322] 73. The mRNA composition according to any one of the items 60 to 72, wherein the method to remove dsRNA of the mRNA composition is selected from the group consisting of: cellulose chromatography, High-performance liquid chromatography, silica based chromatography and polyA affinity annealing. The mRNA composition according to any one of the items 60 to 73, wherein the dsRNA is removed by cellulose chromatography. The mRNA composition according to any one of the items 60 to 74, wherein the mRNA composition is purified at least once, such as at least twice, such as at least three times. The mRNA composition according to any one of the items 60 to 75, wherein the method to detect the amount of dsRNA in the mRNA composition is selected from the group consisting of: Dot blot, lateral flow immunoassay, ELISA and dsRNA- sequencing. The mRNA composition according to any one of the items 60 to 76, wherein the amount of dsRNA in the mRNA composition is determined via dot blot. The mRNA composition according to any one of the items 60 to 77, wherein the codons the coding sequence have been selected to reduce the uridine content by a method, wherein the method comprises following steps: a. Codon optimization; b. Reduction of uridine content by selecting uridine low or uridine free codons. The mRNA composition according to item 78, wherein the codons are optimized to rebalance codon usage, decrease sequence complexity, avoid rare codons, minimize secondary structures and / or reduce complexity. The mRNA composition according to any one of the items 78 to 79, wherein the IDT codon optimization tool is used for codon optimization. The mRNA composition according to any one of the items 78 to 80, wherein the “GenSmart™ Codon Optimization tool is used to reduce the uridine content. The mRNA composition according to any one of the items 60 to 81, wherein the uridine content of the mRNA construct in the mRNA composition is reduced by at last 5%, such as at least 10%, such as at least 15%, such as at least 20% compared to the naturally occurring mRNA and / or codon optimized mRNA.
[0323] 83. The mRNA composition according to any one of the items 60 to 82, wherein the uridine content of the mRNA construct in the mRNA composition is reduced by at most 20%, such as at most 15%, such as at most 10%, such as at most 5% compared to the naturally occurring mRNA and / or codon optimized mRNA.
[0324] 84. The mRNA composition according to any one of the items 60 to 83, wherein the uridine content of the mRNA construct in the mRNA composition is reduced by between 5% and 20%, such as by between 10% and 15% compared to the naturally occurring mRNA and / or codon optimized mRNA.
[0325] 85. A method of loading a cell with an mRNA composition according to any one of the items 60 to 84, the method comprising: a. removing double- stranded RNA (dsRNA) from the mRNA composition; and b. introducing the mRNA composition into the cell by a non-endosomal pathway of delivery; wherein the cell is a human mesenchymal stem cell (hMSC) according to any one of the items 1 to 59, the mRNA composition comprises a mRNA construct encoding a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified.
[0326] 86. A method of loading a cell with an mRNA composition according to any one of the items 60 to 84, the method comprising: a. Modifying / selecting the codons of the mRNA construct by: i. Codon optimization; ii. Reduction of uridine content by algorithms; iii. Manually reduction or uridine content; b. Synthesizing said mRNA construct; c. Removing double- stranded RNA (dsRNA) from the mRNA composition; and d. Introducing the mRNA composition into the cell by a non-endosomal pathway of delivery; wherein the cell is a human mesenchymal stem cell (hMSC) according to any one of the items 1 to 59, the mRNA composition comprises a mRNA construct encoding a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified. The method according to any one of the items 85 to 86, wherein the cell is loaded with an mRNA composition comprising naked mRNA. A method of preparing an mRNA composition for transfection into a cell, the method comprising a. Selecting an mRNA sequence coding for a protein; b. Optimizing the uridine content; c. Synthesizing the mRNA construct; d. Purifying the mRNA construct to remove double stranded RNA. A method of expressing a secreted protein, the method comprising introducing an mRNA construct according to any one of the items 60 to 84 encoding the secreted protein into mesenchymal stem cells according to any one of the items 1 to 59 by a non-endosomal pathway of delivery, wherein all uridine nucleosides in the mRNA construct are chemically unmodified and the mRNA construct has been purified to remove double-stranded RNA (dsRNA), to thereby prepare mRNA-loaded hMSCs. The method according to any one of the items 85 to 89, wherein the secreted protein levels are determined. The method according to item 90, wherein the secreted protein levels are determined after 0 hours, such as after at least 1 hour, such as after at least 5 hours, such as after at least 10 hours, such as after at least 24 hours, such as after at least 48 hours, such as after at least 3 days, such as after at least 5 days, such as after at least 7 days. The method according to any one of the items 90 to 91, wherein the method to detect the secreted protein levels is selected from the group consisting of: ELISA, FACS and luciferin assay. The mesenchymal stem cells according to any one of the items 1 to 59 and / or the mRNA composition according to any one of the items 60 to 84 for use in method for delivery of a secreted protein to a subject. The mesenchymal stem cells according to any one of the items 1 to 59 and / or the mRNA composition according to any one of the items 60 to 84 for use the treatment for osteoarthristis, skin-graft rejection, Diabetes, acute lung injury, cancer, autoimmune disorders, inflammatory disorders and / or stroke. A method of loading a cell with an mRNA construct preparation, the method comprising:
[0327] (a) removing double- stranded RNA (dsRNA) from the mRNA construct preparation; and
[0328] (b) introducing the mRNA construct preparation into the cell by a non-endosomal pathway of delivery; wherein the cell is a human mesenchymal stem cell (hMSC), the mRNA construct encodes a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified. The method of item 95, wherein the mRNA construct has been engineered to reduce uridine content. The method of item 95, wherein all nucleosides within the mRNA construct are chemically unmodified. The method of item 95, wherein the hMSC is derived from a tissue selected from the group consisting of bone marrow, adipose tissue, peripheral blood, umbilical cord, amniotic fluid, cord blood, placenta and Wharton’s jelly. The method of item 95, wherein the hMSC is an induced MSC (iMSC). 100. The method of item 95, wherein the mRNA construct encodes a cytokine, an enzyme, a chemokine, an antibody or fragment thereof, an immunomodulatory agent or a growth factor.
[0329] 101. The method of item 100, wherein the mRNA construct encodes vascular endothelial growth factor (VEGF).
[0330] 102. The method of item 95, which further comprises culturing the hMSCs after introducing the mRNA construct preparation and detecting expression of the secreted protein.
[0331] 103. The method of item 95, which further comprises cryopreserving the hMSCs after introducing the mRNA construct preparation.
[0332] 104. The method of item 95, wherein the mRNA construct preparation is introduced into the cell by electroporation.
[0333] 105. The method of item 95, which comprises a plurality of hMSCs and wherein the mRNA construct preparation is introduced into cells at a dosage of at least 1 ng mRNA per 1 x 106cells.
[0334] 106. The method of item 95, wherein the secreted protein is expressed by the hMSC at a level of at least 0.1 ug secreted protein / lxlO6cells.
[0335] 107. The method of item 95, wherein the secreted protein is expressed by the hMSC at a level of at least 0.5 ug secreted protein / lxlO6cells.
[0336] 108. A method of loading a cell with an mRNA construct preparation, the method comprising:
[0337] (a) reducing uridine content in the mRNA construct preparation;
[0338] (b) removing double- stranded RNA (dsRNA) from the mRNA construct preparation; and
[0339] (c) introducing the mRNA construct preparation into the cell by a non-endosomal pathway of delivery; wherein the cell is a human mesenchymal stem cell (hMSC), the mRNA construct encodes a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified.
[0340] 109. The method of item 108, wherein all nucleosides within the mRNA construct are chemically unmodified.
[0341] 110. A method of expressing a secreted protein in a subject in vivo, the method comprising:
[0342] (a) introducing an mRNA construct encoding the secreted protein into human mesenchymal stem cells (hMSCs) by a non-endosomal pathway of delivery, wherein all uridine nucleosides in the mRNA construct are chemically unmodified and the mRNA construct has been purified to remove double-stranded RNA (dsRNA), to thereby prepare mRNA-loaded hMSCs; and
[0343] (b) administering the mRNA-loaded hMSCs to the subject such that the secreted protein encoded by the mRNA construct is expressed in the subject.
[0344] 111. The method of item 109, wherein the mRNA construct has been engineered to reduce uridine content.
[0345] 112. The method of item 109, wherein all nucleosides within the mRNA construct are chemically unmodified.
[0346] 113. The method of item 109, wherein the hMSCs are derived from a tissue selected from the group consisting of bone marrow, adipose tissue, peripheral blood, umbilical cord, amniotic fluid, cord blood, placenta and Wharton’s jelly.
[0347] 114. The method of item 109, wherein the hMSC is an induced MSC (iMSC).
[0348] 115. The method of item 109, wherein the mRNA construct encodes a cytokine, an enzyme, a chemokine, an antibody or fragment thereof, an immunomodulatory agent or a growth factor. 116. The method of item 109, wherein the mRNA construct encodes vascular endothelial growth factor (VEGF).
[0349] 117. The method of item 109, wherein the mRNA-loaded hMSCs are cryopreserved and thawed prior to administering to the subject.
[0350] 118. The method of item 109, wherein the mRNA construct is introduced into the hMSCs by electroporation.
[0351] 119. The method of item 109, wherein the mRNA construct is introduced into the hMSCs at a dosage of at least 1 ng mRNA per 1 x 106cells.
[0352] 120. The method of item 109, wherein the secreted protein is expressed by the mRNA-loaded hMSCs at a level of at least 1 ug / gprot.
[0353] 121. The method of item 119, wherein the secreted protein is expressed by the mRNA-loaded hMSCs at a level of at least 2 ug / gprot.
[0354] 122. A non-natural engineered human mesenchymal stem cell (hMSC) composition, the composition comprising hMSCs loaded with an mRNA construct, wherein the mRNA construct encodes a secreted protein, wherein all uridine nucleosides in the mRNA construct are chemically unmodified and wherein the secreted protein is expressed by the hMSCs at a level of at least 0.1 ug secreted protein / lxlO6cells.
[0355] 123. The composition of item 121, wherein the secreted protein is expressed by the hMSCs at a level of at least 0.5 ug secreted protein / lxlO6cells.
[0356] 124. The composition of item 121, wherein the mRNA construct has been engineered to reduce uridine content.
[0357] 125. The composition of item 121, wherein all nucleosides within the mRNA construct are chemically unmodified. 126. The composition of item 121, wherein the hMSCs are derived from a tissue selected from the group consisting of bone marrow, adipose tissue, peripheral blood, umbilical cord, amniotic fluid, cord blood, placenta and Wharton’s jelly.
[0358] 127. The composition of item 121, wherein the hMSCs are induced MSCs (iMSCs).
[0359] 128. The composition of item 121, wherein the mRNA construct encodes a cytokine, an enzyme, a chemokine, an antibody or fragment thereof, an immunomodulatory agent or a growth factor.
[0360] 129. The composition of item 127, wherein the mRNA construct encodes vascular endothelial growth factor (VEGF).
[0361] 130. The composition of any one of items 121-128 for use as a medicament.
[0362] 131. The composition of any one of items 121-128 for delivery of the secreted protein to a subject.
[0363] 132. A secreted protein, wherein the secreted protein is encoded by an mRNA construct introduced into human mesenchymal stem cells (hMSCs) by a non- endosomal pathway of delivery to prepare mRNA-loaded hMSCs, wherein all uridine nucleosides in the mRNA construct are chemically unmodified and the mRNA construct has been purified to remove double-stranded RNA (dsRNA), and wherein the secreted protein encoded by the mRNA construct is expressed in a subject after administering the mRNA-loaded hMSCs to the subject.
Claims
Claims1. A mesenchymal stem cell comprising a substantially single stranded composition of a mRNA construct introduced into the cell by a non-endosomal pathway of delivery, the mRNA construct comprising a coding sequence, wherein all nucleosides within the mRNA construct are chemically unmodified and optionally wherein the codons of the mRNA construct have been selected to reduce the uridine content.
2. A mesenchymal stem cell comprising a substantially single stranded composition of a mRNA construct introduced into the cell by a non-endosomal pathway of delivery, the mRNA construct comprising a coding sequence, wherein the codons of the mRNA construct have been selected to reduce the uridine content.
3. The mesenchymal stem cell according to claim 2, wherein all nucleosides within the mRNA construct are chemically unmodified.
4. The mesenchymal stem cell according to any one of the preceding claims, wherein the mRNA construct encodes a protein, such as a secreted protein.
5. The mesenchymal stem cell according to any one of the preceding claims, wherein the mRNA construct encodes a cytokine, an enzyme, a chemokine, an antibody or fragment thereof, an immunomodulatory agent or a growth factor.
6. The mesenchymal stem cell according to any one of the preceding claims, wherein the method to synthesize the mRNA construct is selected from the group of Enzymatic (IVT) methods, solid-phase methods, liquid-phase methods, combined synthetic methods, small region synthesis, and ligation methods.
7. The mesenchymal stem cell according to any one of the preceding claims, wherein the non-endosomal pathway of delivery is selected from the group consisting of: biolistic particle delivery, ultrasonic nebulization, sonification, buffer-mediated delivery, delivery utilizing phagocytosis, pinocytosis, clathrin-dependent delivery and / or clathrin-independent delivery by virus particles and / or polymers, microinjection,streptolysin-0 permeabilization, permeabilization using anionic peptides and electroporation.
8. The mesenchymal stem cell according to any one of the preceding claims, wherein between 1 ng mRNA and 1 mg mRNA, such as between 10 ng mRNA and 100 pg mRNA, such as between 0.5 pg mRNA and 50 pg mRNA, such as between 1 pg mRNA and 25 pg mRNA, such as between 5 pg mRNA and 20 pg mRNA is introduced into IxlO6mesenchymal stem cells.
9. The mesenchymal stem cell according to any one of the preceding claims, wherein at least 5xl09, such as at least 5xl012, such as at least 5xl015mRNA molecules with a length of up to 5000 nucleotides are introduced into IxlO6mesenchymal stem cells.
10. The mesenchymal stem cell according to any one of the preceding claims, wherein IxlO6cells comprise between 1 ng and 1 mg, such as between 10 ng and 100 pg, such as between 0.5 pg and 50 pg, such as between 1 pg and 25 pg , such as between 5 pg and 20 pg of said mRNA composition.
11. The mesenchymal stem cell according to any one of the preceding claims, wherein IxlO6cells comprise at least 5xl09, such as at least 5xl012, such as at least 5xl015mRNA molecules of said mRNA composition with a length of up to 5000 nucleotides.
12. The mesenchymal stem cell according to any one of the preceding claims, wherein at most 10% of all RNA in the mRNA composition is double- stranded RNA, such as at most 8%, such as at most 6%, such as at most 5%, such as at most 3%, such as at most 1%.
13. The mesenchymal stem cell according to any one of the preceding claims, wherein the method to remove dsRNA of the mRNA composition is selected from the group consisting of: cellulose chromatography, High-performance liquid chromatography, silica based chromatography and polyA affinity annealing.
14. The mesenchymal stem cell according to any one of the preceding claims, wherein the codons of the coding sequence have been selected to reduce the uridine content by a method, wherein the method comprises following steps: a. Codon optimization; b. Reduction of uridine content by selecting uridine low or uridine free codons.
15. The mesenchymal stem cell according to claim 14, wherein the codons are optimized to rebalance codon usage, decrease sequence complexity, avoid rare codons, minimize secondary structures and / or reduce complexity.
16. The mesenchymal stem cell according to any one of the preceding claims, wherein the absolute uridine content of the mRNA construct in the mRNA composition is reduced by at least 0.5%, such as at least 1%, such as at least 2.5%, such as at least 5%, such as at least 10%, such as at least 15% compared to the uridine content of the naturally occurring mRNA.
17. The mesenchymal stem cell according to any one of the preceding claims, wherein the cell is derived from a tissue selected from the group consisting of bone marrow, adipose tissue, peripheral blood, umbilical cord, amniotic fluid, cord blood, placenta and Wharton’s jelly.
18. The mesenchymal stem cell according to any one of the preceding claims, wherein the cell is differentiated from stem cells.
19. The mesenchymal stem cell according to any one of the preceding claims, wherein the cells are cryopreserved and / or thawed prior to administering to the subject.
20. A mRNA composition comprising a substantially single stranded mRNA construct encoding a protein wherein the codons of the mRNA construct have been selected to reduce the uridine content.
21. The mRNA composition according to claim 20, wherein all nucleosides within the mRNA construct are chemically unmodified.
22. A method of loading a cell with an mRNA composition, the method comprising: a. removing double- stranded RNA (dsRNA) from the mRNA composition; and b. introducing the mRNA composition into the cell by a non-endosomal pathway of delivery; wherein the cell is a human mesenchymal stem cell (hMSC), the mRNA composition comprises a mRNA construct encoding a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified.
23. A method of loading a cell with an mRNA composition according to any one of the claims 20 to 21, the method comprising: a. Modifying / selecting the codons of the mRNA construct by: i. Codon optimization; ii. Reduction of uridine content by algorithms; iii. Manually reduction or uridine content; b. Synthesizing said mRNA construct; c. Removing double- stranded RNA (dsRNA) from the mRNA composition; and d. Introducing the mRNA composition into the cell by a non-endosomal pathway of delivery; wherein the cell is a human mesenchymal stem cell (hMSC) according to any one of the claims 1 to 19, the mRNA composition comprises a mRNA construct encoding a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified.
24. A method of preparing an mRNA composition for transfection into a cell, the method comprising a. Selecting an mRNA sequence coding for a protein; b. Optimizing the uridine content; c. Synthesizing the mRNA construct; d. Purifying the mRNA construct to remove double stranded RNA.
25. A method of expressing a secreted protein, the method comprising introducing an mRNA construct encoding the secreted protein into mesenchymal stem cells by a non- endosomal pathway of delivery, wherein all uridine nucleosides in the mRNA construct are chemically unmodified and the mRNA construct has been purified to remove double-stranded RNA (dsRNA), ereby prepare mRNA-loaded hMSCs.
26. The mesenchymal stem cells according to any one of the claims 1 to 19 and / or the mRNA composition according to any one of the claims 20 to 21 for use the treatment for osteoarthristis, skin-graft rejection, Diabetes, acute lung injury, cancer, autoimmune disorders, inflammatory disorders and / or stroke.
27. A method of loading a cell with an mRNA construct preparation, the method comprising:(a) removing double- stranded RNA (dsRNA) from the mRNA construct preparation; and(b) introducing the mRNA construct preparation into the cell by a non-endosomal pathway of delivery; wherein the cell is a human mesenchymal stem cell (hMSC), the mRNA construct encodes a secreted protein and all uridine nucleosides in the mRNA construct are chemically unmodified.