Methods and microorganisms for production of a product using ethanol as a carbon source

Abstract

Methods and microorganisms for production of a product using ethanol as a carbon source are provided. A multi-stage biofermentation process in which a genetically modified microorganism adapated to grow in a growth media comprising ethanol is provided. The growth media may comprise no added glucose.

Description

Atty Docket No.: 49186-155Methods and Microorganisms for Production of a Product Using Ethanol as a Carbon SourceCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. provisional patentapplication no.63 / 503,527, filed on May 22, 2023, which is incorporated by reference hereinin its entirety.BACKGROUND

[0002] Through evolution, microbiological organisms have developed manystrategies to adapt to their environments, including by using different carbon sources. For amicroorgansism that has been genetically modified so as to optimally produce a particularproduct, flexibility in using more than one type of carbon source is an attractive feature. Thisis especially true where at least one of the alternative carbon sources is inexpensive andabundantly available, such as ethanol.SUMMARY

[0003] The Summary is provided to introduce a selection of concepts that are furtherdescribed below in the Detailed Description. This Summary is not intended to identify keyor essential features of the claimed subject matter, nor is it intended to be used as an aid inlimiting the scope of the claimed subject matter.

[0004] In one aspect, a multi-stage biofermentation process for producing a productfrom a genetically modified microorganism is provided, the process comprising: (A)providing a genetically modified microorganism that: (1) is adapted to grow in a growthmedia comprising ethanol; and (2) comprises: (a) a production pathway comprising at leastone production enzyme for biosynthesis of the product; (b) a mutation of the endogenousadhE gene and of the endogenous adhE gene promotor; and (c) one or more syntheticmetabolic valves for reducing or eliminating flux through multiple metabolic pathwayswithin the genetically modified microorganism when the synthetic metabolic valves areinduced; (B) growing the genetically modified microorganism in a media comprising ethanolin a growth phase; and (C) transitioning to a productive stationary phase, the transitioningcomprising: (1) depleting a limiting nutrient; (2) inducing the one or more syntheticmetabolic valves; and (3) activating the production pathway.Atty Docket No.: 49186-155

[0005] In other aspect, a method is provided for adapting a genetically modified E.coli microorganism comprising synthetic metabolic valves to grow aerobically in a growthmedium comprising ethanol, the method comprising: providing a microorganism with adeletion of endogenous adhE gene; growing the microorganism in an ethanol minimal media;modifying the microorgansism with plasmids encoding synthetic metabolic valves; andpropagating the modified microorganism in a growth process in a media comprising SM10++or FGM10.2_SF 1 g / L glucose and 10 g / L ethanol for at least three propagations.

[0006] In another aspect, a genetically modified E. coli microorganism comprising aproduction pathway is provided, the microorganism comprising: at least one productionenzyme for biosynthesis of the product; a mutation of the endogenous adhE gene and of theendogenous adhE gene promotor; and one or more synthetic metabolic valves for reducingor eliminating flux through multiple metabolic pathways within the genetically modifiedmicroorganism when the synthetic metabolic valves are induced.

[0007] Other methods, features, and advantages are, or will become, apparent uponexamination of the following figures and Detailed Description. All such additional methods,features, and advantages are intended to be included within this description and areprotected by the accompanying claims.BRIEF DESCRIPTION OF THE SEQUENCES

[0008] EM7 promoter:GGTTTAGTTCCTCACCTTGTCGTATTATACTATGCCGATATACTATGCCGATGATTAATTGTCAAC (SEQ ID NO: 1)

[0009] EM7* promoter :GTTGACAATTAATCATCGGCATAGTATAATACGAC (SEQ ID NO: 2)

[0010] adhE A267T / E568K mutant gene (first reported in PMID: 10922373) –changes to the nucleotide sequence are underlined, italicized, and written in lower case:ATGGCTGTTACTAATGTCGCTGAACTTAACGCACTCGTAGAGCGTGTAAAAAAAGCCCAGCGTGAATATGCCAGTTTCACTCAAGAGCAAGTAGACAAAATCTTCCGCGCCGCCGCTCTGGCTGCTGCAGATGCTCGAATCCCACTCGCGAAAATGGCCGTTGCCGAATCCGGCATGGGTATCGTCGAAGATAAAGTGATCAAAAACCACTTTGCTTCTGAATATATCTACAACGCCTATAAAGATGAAAAAACCTGTGGTGTTCTGTCTGAAGACGACACTTTTGGTACCATCACTATCGCTGAACCAATCGAtty Docket No.: 49186-155GTATTATTTGCGGTATCGTTCCGACCACTAACCCGACTTCAACTGCTATCTTCAAATCGCTGATCAGTCTGAAGACCCGTAACGCCATTATCTTCTCCCCGCACCCGCGTGCAAAAGATGCCACCAACAAAGCGGCTGATATCGTTCTGCAGGCTGCTATCGCTGCCGGTGCTCCGAAAGATCTGATCGGCTGGATCGATCAACCTTCTGTTGAACTGTCTAACGCACTGATGCACCACCCAGACATCAACCTGATCCTCGCGACTGGTGGTCCGGGCATGGTTAAAGCCGCATACAGCTCCGGTAAACCAGCTATCGGTGTAGGCGCGGGCAACACTCCAGTTGTTATCGATGAAACTGCTGATATCAAACGTGCAGTTGCATCTGTACTGATGTCCAAAACCTTCGACAACGGCGTAATCTGTGCTTCTGAACAGTCTGTTGTTGTTGTTGACTCTGTTTATGACGCTGTACGTGAACGTTTTaccACCCACGGCGGCTATCTGTTGCAGGGTAAAGAGCTGAAAGCTGTTCAGGATGTTATCCTGAAAAACGGTGCGCTGAACGCGGCTATCGTTGGTCAGCCAGCCTATAAAATTGCTGAACTGGCAGGCTTCTCTGTACCAGAAAACACCAAGATTCTGATCGGTGAAGTGACCGTTGTTGATGAAAGCGAACCGTTCGCACATGAAAAACTGTCCCCGACTCTGGCAATGTACCGCGCTAAAGATTTCGAAGACGCGGTAGAAAAAGCAGAGAAACTGGTTGCTATGGGCGGTATCGGTCATACCTCTTGCCTGTACACTGACCAGGATAACCAACCGGCTCGCGTTTCTTACTTCGGTCAGAAAATGAAAACGGCGCGTATCCTGATTAACACCCCAGCGTCTCAGGGTGGTATCGGTGACCTGTATAACTTCAAACTCGCACCTTCCCTGACTCTGGGTTGTGGTTCTTGGGGTGGTAACTCCATCTCTGAAAACGTTGGTCCGAAACACCTGATCAACAAGAAAACCGTTGCTAAGCGAGCTGAAAACATGTTGTGGCACAAACTTCCGAAATCTATCTACTTCCGCCGTGGCTCCCTGCCAATCGCGCTGGATGAAGTGATTACTGATGGCCACAAACGTGCGCTCATCGTGACTGACCGCTTCCTGTTCAACAATGGTTATGCTGATCAGATCACTTCCGTACTGAAAGCAGCAGGCGTTGAAACTGAAGTCTTCTTCGAAGTAGAAGCGGACCCGACCCTGAGCATCGTTCGTAAAGGTGCAGAACTGGCAAACTCCTTCAAACCAGACGTGATTATCGCGCTGGGTGGTGGTTCCCCGATGGACGCCGCGAAGATCATGTGGGTTATGTACGAACATCCGGAAACTCACTTCGAAaaaCTGGCGCTGCGCTTTATGGATATCCGTAAACGTATCTACAAGTTCCCGAAAATGGGCGTGAAAGCGAAAATGATCGCTGTCACCACCACTTCTGGTACAGGTTCTGAAGTCACTCCGTTTGCGGTTGTAACTGACGACGCTACTGGTCAGAAATATCCGCTGGCAGACTATGCGCTGACTCCGGATATGGCGATTGTCGACGCCAACCTGGTTATGGACATGCCGAAGTCCCTGTGTGCTTTCGGTGGTCTGGACGCAGTAACTCACGCCATGGAAGCTTATGTTTCTGTACTGGCATCTGAGTTCTCTGATGGTCAGGCTCTGCAGGCACTGAAACTGCTGAAAGAATATCTGCCAGCGTCCTACCACGAAGGGTCTAAAAATCCGGTAGCGCGTGAACGTGTTCACAGTGCAGCGACTATCGCGGGTATCGCGTTTGCGAACGCCTTCCTGGGTGTATGTCACTCAATGGCGCACAAACTGGGTTCCCAGTTCCATATTCCGCACGGTCTGGCAAACGCCCTGCTGATTTGTAACGTTATTCGCTACAATGCGAAAtty Docket No.: 49186-155CGACAACCCGACCAAGCAGACTGCATTCAGCCAGTATGACCGTCCGCAGGCTCGCCGTCGTTATGCTGAAATTGCCGACCACTTGGGTCTGAGCGCACCGGGCGACCGTACTGCTGCTAAGATCGAGAAACTGCTGGCATGGCTGGAAACGCTGAAAGCTGAACTGGGTATTCCGAAATCTATCCGTGAAGCTGGCGTTCAGGAAGCAGACTTCCTGGCGAACGTGGATAAACTGTCTGAAGATGCATTCGATGACCAGTGCACCGGCGCTAACCCGCGTTACCCGCTGATCTCCGAGCTGAAACAGATTCTGCTGGATACCTACTACGGTCGTGATTATGTAGAAGGTGAAACTGCAGCGAAGAAAGAAGCTGCTCCGGCTAAAGCTGAGAAAAAAGCGAAAAAATCCGCTTAA(SEQ ID NO: 3)

[0011] AdhE A267T / E568K mutant polypeptide – amino acid substitutions areunderlined and italicized:MAVTNVAELNALVERVKKAQREYASFTQEQVDKIFRAAALAAADARIPLAKMAVAESGMGIVEDKVIKNHFASEYIYNAYKDEKTCGVLSEDDTFGTITIAEPIGIICGIVPTTNPTSTAIFKSLISLKTRNAIIFSPHPRAKDATNKAADIVLQAAIAAGAPKDLIGWIDQPSVELSNALMHHPDINLILATGGPGMVKAAYSSGKPAIGVGAGNTPVVIDETADIKRAVASVLMSKTFDNGVICASEQSVVVVDSVYDAVRERFTTHGGYLLQGKELKAVQDVILKNGALNAAIVGQPAYKIAELAGFSVPENTKILIGEVTVVDESEPFAHEKLSPTLAMYRAKDFEDAVEKAEKLVAMGGIGHTSCLYTDQDNQPARVSYFGQKMKTARILINTPASQGGIGDLYNFKLAPSLTLGCGSWGGNSISENVGPKHLINKKTVAKRAENMLWHKLPKSIYFRRGSLPIALDEVITDGHKRALIVTDRFLFNNGYADQITSVLKAAGVETEVFFEVEADPTLSIVRKGAELANSFKPDVIIALGGGSPMDAAKIMWVMYEHPETHFEKLALRFMDIRKRIYKFPKMGVKAKMIAVTTTSGTGSEVTPFAVVTDDATGQKYPLADYALTPDMAIVDANLVMDMPKSLCAFGGLDAVTHAMEAYVSVLASEFSDGQALQALKLLKEYLPASYHEGSKNPVARERVHSAATIAGIAFANAFLGVCHSMAHKLGSQFHIPHGLANALLICNVIRYNANDNPTKQTAFSQYDRPQARRRYAEIADHLGLSAPGDRTAAKIEKLLAWLETLKAELGIPKSIREAGVQEADFLANVDKLSEDAFDDQCTGANPRYPLISELKQILLDTYYGRDYVEGETAAKKEAAPAKAEKKAKKSA (SEQ ID NO: 4)BRIEF DESCRIPTION OF THE FIGURES

[0012] The novel features of the invention are set forth with particularity in theclaims. A better understanding of the features and advantages of the present invention willbe obtained by reference to the following Detailed Description that sets forth illustrativeaspects, in which the principles of the invention are used, and the accompanying drawingsof which:Atty Docket No.: 49186-155

[0013] FIG 1 depicts a bar graph of growth of bacterial cells (represented by celldensity (OD600)) versus time in ethanol minimal media in a microorganism expressing theadhE A267T / E568K mutant gene which encodes for the adhE A267T / E568K polypeptidemutant, as compared to controls.

[0014] FIG 2 depicts an ethanol only adaptation growth process.

[0015] FIG 3 compares the kinetics of growth of bacterial cells (represented by celldensity (OD600)): (A) in ethanol, where the endogenous chromosomal adhE gene has beendeleted from the cells, and (1) the cells have been transformed by a plasmid based adhEA267T / E568K mutant gene; or (2) the endogenous adhE gene has been replaced with achromosome based adhE A267T / E568K mutant gene; or (B) in glucose, using theendogenous adhE gene.

[0016] FIG 4 depicts a graph representing shake flask production of a product fromethanol.

[0017] FIG 5 deptics plasmid and genome maps for transformation or deletion andreplacement as described with respect to FIG 3, respectively, of adhE A267T / E568K mutantgene into E. coli.DETAILED DESCRIPTION

[0018] I. Definitions

[0019] Unless otherwise defined, all technical and scientific terms used herein havethe same meaning as commonly understood by one of ordinary skill in the art to which thisinvention pertains. In case of conflict, the present specification, including definitions, willcontrol.

[0020] Unless otherwise specified, “a,” “an,” “the,” “one or more of,” and “at least one”are used interchangeably. The singular forms “a”, “an,” and “the” are inclusive of their pluralforms.

[0021] The recitations of numerical ranges by endpoints include all numberssubsumed within that range (e.g., 0.5 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

[0022] The term “about,” when referring to a value or to an amount of mass, weight,time, volume, concentration, or percentage, is meant to encompass variations of ±10% fromAtty Docket No.: 49186-155the specified amount. The terms “comprising” and “including” are intended to be equivalentand open-ended. The phrase “consisting essentially of” means that the composition ormethod may include additional ingredients and / or steps, but only if the additionalingredients and / or steps do not materially alter the basic and novel characteristics of theclaimed composition or method. The phrase “selected from the group consisting of” is meantto include mixtures of the listed group.

[0023] Moreover, the present disclosure also contemplates that in some aspects, anyfeature or combination of features set forth herein can be excluded or omitted. To illustrate,if the specification states that a complex comprises components A, B, and C, it is specificallyreserved that any of A, B, or C, or a combination thereof, can be omitted and disclaimedsingularly or in any combination.

[0024] The term “amino acid modification” includes an amino acid substitution,insertion, or deletion in a polypeptide sequence. By “amino acid substitution” or“substitution” is meant the replacement of an amino acid at a particular position in a parentpolypeptide sequence with another amino acid. For example, the substitution A267T refersto a modified polypeptide in which the alanine at position 267 is replaced with a threonine.Multiple substitutions are typically separated by a slash or a comma. For example,A267T / E568K refers to a double variant comprising the substitutions A267T and E568K. By“amino acid insertion” or “insertion” is meant the addition of an amino acid at a particularposition in a parent polypeptide sequence. For example, insert -267 designates an insertionat position 267. By “amino acid deletion” or “deletion” is meant the removal of an amino acidat a particular position in a parent polypeptide sequence. For example, A267- designates thedeletion of alanine at position 267.

[0025] The term “heterologous DNA,” “heterologous nucleic acid sequence,” and thelike as used herein refer to a nucleic acid sequence wherein at least one of the following istrue: (a) the sequence of nucleic acids is foreign to (i.e., not naturally found in) a given hostmicroorganism; (b) the sequence may be naturally found in a given host microorganism, butin an unnatural (e.g., greater than expected) amount; or (c) the sequence of nucleic acidscomprises two or more subsequences that are not found in the same relationship to eachother in nature. For example, regarding instance (c), a heterologous nucleic acid sequenceAtty Docket No.: 49186-155that is recombinantly produced will have two or more sequences from unrelated genesarranged to make a new functional nucleic acid, such as a nonnative promoter driving geneexpression. The term “heterologous” is intended to include the term “exogenous” as thelatter term is generally used in the art. With reference to the host microorganism's genomeprior to the introduction of a heterologous nucleic acid sequence, the nucleic acid sequencethat codes for the enzyme is heterologous (whether or not the heterologous nucleic acidsequence is introduced into that genome). As used herein, “chromosomal” and “native” and“endogenous” refer to genetic material of the host microorganism.

[0026] As used herein, the term “gene disruption” or grammatical equivalents thereof(and including “to disrupt enzymatic function,” “disruption of enzymatic function,” and thelike) is intended to mean a genetic modification to a microorganism that renders the encodedgene product as having a reduced polypeptide activity compared with polypeptide activityin or from a microorganism cell not so modified. The genetic modification can be, forexample, deletion of the entire gene, deletion or other modification of a regulatory sequencerequired for transcription or translation, deletion of a portion of the gene which results in atruncated gene product (e.g., enzyme) or by any of various mutation strategies that reduceactivity (including to no detectable activity level) the encoded gene product. A disruptionmay broadly include a deletion of all or part of the nucleic acid sequence encoding theenzyme, and also includes, but is not limited to other types of genetic modifications, e.g.,introduction of stop codons, frame shift mutations, introduction or removal of portions ofthe gene, and introduction of a degradation signal, those genetic modifications affectingmRNA transcription levels and / or stability, and altering the promoter or repressor upstreamof the gene encoding the enzyme.

[0027] Bio-production, Micro-fermentation (microfermentation), or Fermentation, asused herein, may be aerobic, microaerobic, or anaerobic.

[0028] When the genetic modification of a gene product, e.g., an enzyme, is referredto herein, including the claims, the genetic modification is of a nucleic acid sequence, such asor including the gene, that normally encodes the stated gene product, i.e., the enzyme.

[0029] Species and other phylogenic identifications are according to the classificationknown to a person skilled in the art of microbiology.Atty Docket No.: 49186-155

[0030] Enzymes are listed here within, with reference to a UniProt identificationnumber, which would be well known to one skilled in the art. The UniProt database can beaccessed at http: / / www.UniProt.org / . When the genetic modification of a gene product, e.g.,an enzyme, is referred to herein, including in the claims, the genetic modification is of anucleic acid sequence, such as or including the gene, that normally encodes the stated geneproduct, i.e., the enzyme.

[0031] Where methods and steps described herein indicate certain events occurringin certain order, those of ordinary skill in the art will recognize that the ordering of certainsteps may be modified, and that such modifications are in accordance with the variations ofthe invention. Additionally, certain steps may be performed concurrently in a parallelprocess when possible, as well as performed sequentially.

[0032] The meaning of abbreviations is as follows: “C” means Celsius or degreesCelsius, as is clear from its usage, “DCW” means dry cell weight, “s” means second(s), “min”means minute(s), “h,” “hr,” or “hrs” means hour(s), “psi” means pounds per square inch, “nm”means nanometers, “d” means day(s), “µL” or “uL” or “ul” means microliter(s), “mL” meansmilliliter(s), “L” means liter(s), “mm” means millimeter(s), “nm” means nanometers, “mM”means millimolar, “µM” or “uM” means micromolar, “M” means molar, “mmol” meansmillimole(s), “µmol” or “uMol” means micromole(s)”, “g” means gram(s), “µg” or “ug” meansmicrogram(s) and “ng” means nanogram(s), “PCR” means polymerase chain reaction, “OD”means optical density, “OD600” means the optical density measured at a photon wavelengthof 600 nm, “kDa” means kilodaltons, “g” means the gravitation constant, “bp” means basepair(s), “kbp” means kilobase pair(s), “% w / v” means weight / volume percent, “% v / v”means volume / volume percent, “IPTG” means isopropyl-µ-D-thiogalactopyranoiside, “aTc”means anhydrotetracycline, “RBS” means ribosome binding site, “rpm” means revolutionsper minute, “HPLC” means high performance liquid chromatography, and “GC” means gaschromatography.

[0033] While various aspects of the present invention have been shown anddescribed herein, it is emphasized that such aspects are provided by way of example only.Numerous variations, changes, and substitutions may be made without departing from theinvention herein in its various aspects. Specifically, and for whatever reason, for anyAtty Docket No.: 49186-155grouping of compounds, nucleic acid sequences, polypeptides, including specific proteinssuch as functional enzymes, metabolic pathway enzymes or intermediates, elements, orother compositions, or concentrations stated or otherwise presented herein in a list, table,or other grouping unless clearly stated otherwise, each such grouping provides the basis forand serves to identify various subset aspects, the subset aspects in their broadest scopecomprising every subset of such grouping by exclusion of one or more members (or subsets)of the respective stated grouping. Moreover, when any range is described herein, unlessclearly stated otherwise, that range includes all values therein and all sub-ranges therein.General Consideration

[0034] II. Microorganisms

[0035] Features as described and claimed herein may be provided in a microorganismselected from the listing herein, or another suitable microorganism, that also comprises oneor more natural, introduced, or enhanced product bio-production pathways. Thus, in someaspects, the microorganism(s) comprises an endogenous product production pathway(which may, in some such aspects, be enhanced), whereas in other aspects themicroorganism does not comprise an endogenous product production pathway.

[0036] More particularly, based on the various criteria described herein, suitablemicrobial hosts for the bio-production of a chemical product generally may include, but arenot limited to the organisms described in the Methods Section.

[0037] The host microorganism or the source microorganism for any gene or proteindescribed herein may be selected from the following list of microorganisms: Citrobacter,Enterobacter, Clostridium, Klebsiella, Aerobacter, Lactobacillus, Aspergillus, Saccharomyces,Schizosaccharomyces, Zygosaccharomyces, Pichia, Kluyveromyces, Candida, Hansenula,Debaryomyces, Mucor, Torulopsis, Methylobacter, Escherichia, Salmonella, Bacillus,Streptomyces, and Pseudomonas. In some aspects the host microorganism is an E.colimicroorganism.

[0038] III. Bio-production Reactors and Systems

[0039] Fermentation systems utilizing methods and / or compositions according tothe invention are also within the scope of the invention. Any of the recombinantmicroorganisms as described and / or referred to herein may be introduced into an industrialAtty Docket No.: 49186-155bio-production system where the microorganisms convert a carbon source into a product ina commercially viable operation. The bio-production system includes the introduction ofsuch a recombinant microorganism into a bioreactor vessel, with a carbon source substrateand bio-production media suitable for growing the recombinant microorganism, andmaintaining the bio-production system within a suitable temperature range (and dissolvedoxygen concentration range if the reaction is aerobic or microaerobic) for a suitable time toobtain a desired conversion of a portion of the substrate molecules to a selected chemicalproduct. Bio-productions may be performed under aerobic, microaerobic, or anaerobicconditions, with or without agitation. Industrial bio-production systems and their operationare well-known to those skilled in the arts of chemical engineering and bioprocessengineering.

[0040] The amount of a product produced in a bio-production media generally can bedetermined using a number of methods known in the art, for example, high performanceliquid chromatography (HPLC), gas chromatography (GC), or GC / Mass Spectroscopy (MS).

[0041] IV. Genetic Modifications, Nucleotide Sequences, and Amino Acid Sequences

[0042] Aspects of the present invention may result from introduction of an expressionvector into a host microorganism, wherein the expression vector contains a nucleic acidsequence coding for an enzyme that is, or is not, normally found in a host microorganism.

[0043] The ability to genetically modify a host cell is essential for the production ofany genetically modified (recombinant) microorganism. The mode of gene transfertechnology may be by electroporation, conjugation, transduction, or natural transformation.A broad range of host conjugative plasmids and drug resistance markers are available. Thecloning vectors are tailored to the host organisms based on the nature of antibiotic resistancemarkers that can function in that host. Also, as disclosed herein, a genetically modified(recombinant) microorganism may comprise modifications other than via plasmidintroduction, including modifications to its genomic DNA.

[0044] More generally, nucleic acid constructs can be prepared comprising anisolated polynucleotide encoding a polypeptide having enzyme activity operably linked toone or more (several) control sequences that direct the expression of the coding sequencein a microorganism, such as E. coli, under conditions compatible with the control sequences.Atty Docket No.: 49186-155The isolated polynucleotide may be manipulated to provide for expression of thepolypeptide. Manipulation of the polynucleotide's sequence prior to its insertion into avector may be desirable or necessary depending on the expression vector. The techniquesfor modifying polynucleotide sequences utilizing recombinant DNA methods are wellestablished in the art.

[0045] The control sequence may be an appropriate promoter sequence, a nucleotidesequence that is recognized by a host cell for expression of a polynucleotide encoding apolypeptide of the present invention. The promoter sequence may contain transcriptionalcontrol sequences that mediate the expression of the polypeptide. The promoter may be anynucleotide sequence that shows transcriptional activity in the host cell of choice, includingmutant, truncated, and hybrid promoters, and may be obtained from genes encodingextracellular or intracellular polypeptides either homologous or heterologous to the hostcell. The techniques for modifying and using recombinant DNA promoter sequences are wellestablished in the art.

[0046] For various aspects of the invention, the genetic manipulations may include amanipulation directed to change regulation of, and therefore ultimate activity of, an enzymeor enzymatic activity of an enzyme identified in any of the respective pathways. Such geneticmodifications may be directed to transcriptional, translational, and post-translationalmodifications that result in a change of enzyme activity and / or selectivity under selectedculture conditions. Genetic manipulation of nucleic acid sequences may increase copynumber and / or comprise use of mutants of an enzyme related to product production.Specific methodologies and approaches to achieve such genetic modification are well knownto one skilled in the art.

[0047] In various aspects, to function more efficiently, a microorganism maycomprise one or more gene deletions. For example, in E. coli, the genes encoding the lactatedehydrogenase (ldhA), phosphate acetyltransferase (pta), pyruvate oxidase (poxB),pyruvate-formate lyase (pflB), methylglyoxal synthase (mgsA), acetate kinase (ackA), clpXPprotease specificity enhancing factor (sspB), ATP-dependent Lon protease (lon), outermembrane protease (ompT), arcA transcriptional dual regulator (arcA), and iclRtranscriptional regulator (iclR) may be disrupted, including deleted. Such gene disruptions,Atty Docket No.: 49186-155including deletions, are not meant to be limiting and may be implemented in variouscombinations in various aspects. Gene deletions may be accomplished by numerousstrategies well known in the art, as are methods to incorporate foreign DNA into a hostchromosome.

[0048] In various aspects, to function more efficiently, a microorganism maycomprise one or more synthetic metabolic valves, comprised of enzymes targeted forcontrolled proteolysis, expression silencing, or a combination of both. For example, oneenzyme encoded by one gene or a combination of numerous enzymes encoded by numerousgenes in E. coli may be designed as synthetic metabolic valves to alter metabolism andimprove product formation. Representative genes in E. coli may include but are not limitedto the following: fabI, zwf, gltA, ppc, udhA, lpd, sucD, aceA, pfkA, lon, rpoS, pykA, pykF, tktA,and tktB. It is well known to one skilled in the art how to identify homologues of these genesand / or other genes in additional microbial species.

[0049] For all nucleic acid and amino acid sequences provided herein, it isappreciated that conservatively modified variants of these sequences are included and arewithin the scope of the invention in its various aspects. Functionally equivalent nucleic acidand amino acid sequences (functional variants), which may include conservatively modifiedvariants as well as more extensively varied sequences, which are well within the skill of theperson of ordinary skill in the art, and microorganisms comprising these, also are within thescope of various aspects of the invention, as are methods and systems comprising suchsequences and / or microorganisms.

[0050] Accordingly, as described in various sections above, some compositions,methods and systems of the present invention comprise providing a genetically modifiedmicroorganism that comprises both a production pathway to make a desired product froma central intermediate in combination with synthetic metabolic valves to redistribute flux.

[0051] Aspects of the invention also regard provision of multiple geneticmodifications to improve microorganism overall effectiveness in converting a selectedcarbon source into a selected product. Particular combinations are shown, such as in theExamples, to increase specific productivity, volumetric productivity, titer, and yieldsubstantially over more basic combinations of genetic modifications.Atty Docket No.: 49186-155

[0052] In addition to the above-described genetic modifications, in various aspectsgenetic modifications, including synthetic metabolic valves, also are provided to increase thepool and availability of the cofactor NADPH and / or NADH, which may be consumed in theproduction of a product.

[0053] V. Synthetic Metabolic Valves

[0054] Use of synthetic metabolic valves allows for simpler models of metabolicfluxes and physiological demands during a production phase, turning a growing cell into astationary phase biocatalyst. These synthetic metabolic valves can be used to turn offessential genes and redirect carbon, electrons, and energy flux to product formation in amulti-stage fermentation process. One or more of the following provides the describedsynthetic valves: 1) transcriptional gene silencing or repression technologies in combinationwith 2) inducible and selective enzyme degradation and 3) nutrient limitation to induce astationary or non-dividing cellular state. Synthetic metabolic valves are generalizable to anypathway and microbial host. Synthetic metabolic valves allow for novel rapid metabolicengineering strategies useful for the production of renewable chemicals and fuels and anyproduct that can be produced via whole cell catalysis.

[0055] In particular, the invention describes the construction of synthetic metabolicvalves comprising one or more or a combination of the following: controlled gene silencingand controlled proteolysis. One well skilled in the art is aware of several methodologies forgene silencing and controlled proteolysis.

[0056] V.A Gene Silencing

[0057] In particular, the invention describes the use of controlled gene silencing toprovide the control over metabolic fluxes in controlled multi-stage fermentation processes.There are several methodologies known in the art for controlled gene silencing, includingbut not limited to mRNA silencing or RNA interference, silencing via transcriptionalrepressors, and CRISPR interference. Methodologies and mechanisms for RNA interferenceare taught by Agrawal et al. “RNA Interference: Biology, Mechanism, and Applications”Microbiology and Molecular Biology Reviews, December 2003; 67(4) p657-685. DOI:10.1128 / MMBR.67.657-685.2003. Methodologies and mechanisms for CRISRPRinterference are taught by Qi et al. “Repurposing CRISPR as an RNA-guided platform forAtty Docket No.: 49186-155sequence-specific control of gene expression” Cell February 2013; 152(5) p1173-1183. DOI:10.1016 / j.cell.2013.02.022. In addition, methodologies and mechanisms for CRISRPRinterference using the native E. coli CASCADE system are taught by Luo et al. “Repurposingendogenous type I CRISPR-Cas systems for programmable gene repression” NAR. October2014; DOI: 10.1093. In additional, numerous transcriptional repressor systems are wellknown in the art and can be used to turn off gene expression.

[0058] V.B Controlled Proteolysis

[0059] In particular, the invention describes the use of controlled protein degradationor proteolysis to provide the control over metabolic fluxes in controlled multi-stagefermentation processes. There are several methodologies known in the art for controlledprotein degradation, including but not limited to targeted protein cleavage by a specificprotease and controlled targeting of proteins for degradation by specific peptide tags.Systems for the use of the E. coli clpXP protease for controlled protein degradation are taughtby McGinness et al, “Engineering controllable protein degradation”, Mol Cell. June 2006;22(5) p701-707. This methodology relies upon adding a specific C-terminal peptide tag suchas a DAS4 (or DAS+4) tag. Proteins with this tag are not degraded by the clpXP protease untilthe specificity enhancing chaperone sspB is expressed. sspB induces degradation of DAS4tagged proteins by the clpXP protease. In additional numerous site-specific proteasesystems are well known in the art. Proteins can be engineered to contain a specific targetsite of a given protease and then cleaved after the controlled expression of the protease. Insome aspects, the cleavage can be expected lead to protein inactivation or degradation. Forexample, Schmidt et al(“ClpS is the recognition component for Escherichia coli substrates ofthe N-end rule degradation pathway” Molecular Microbiology March 2009. 72(2), 506–517.doi:10.1111) teaches that an N-terminal sequence can be added to a protein of interest inproviding clpS dependent clpAP degradation. In addition, this sequence can further bemasked by an additional N-terminal sequence, which can be controllably cleaved by, e.g., aULP hydrolase. This allows for controlled N-rule degradation dependent on hydrolaseexpression. It is therefore possible to tag proteins for controlled proteolysis either at the N-terminus or C-terminus. The preference of using an N-terminal vs. C-terminal tag will largelydepend on whether either tag affects protein function prior to the controlled onset ofAtty Docket No.: 49186-155degradation.

[0060] The invention describes the use of controlled protein degradation orproteolysis to provide the control over metabolic fluxes in controlled multi-stagefermentation processes, in E. coli. There are several methodologies known in the art forcontrolled protein degradation in other microbial hosts, including a wide range of gram-negative as well as gram-positive bacteria, yeast, and even archaea. In particular, systemsfor controlled proteolysis can be transferred from a native microbial host and used in a non-native host. For example, Grilly et al, “A synthetic gene network for tuning proteindegradation in Saccharomyces cerevisiae” Molecular Systems Biology 3, Article 127.doi:10.1038, teaches the expression and use of the E. coli clpXP protease in the yeastSaccharomyces cerevisiae. Such approaches can be used to transfer the methodology forsynthetic metabolic valves to any genetically tractable host.

[0061] V. C Synthetic Metabolic Valve Control

[0062] The invention describes the use of synthetic metabolic valves to controlmetabolic fluxes in multi-stage fermentation processes. There are numerous methodologiesknown in the art to induce expression that can be used at the transition between stages inmulti-stage fermentations. These include but are not limited to artificial chemical inducersincluding: tetracycline, anhydrotetracycline, lactose, IPTG (isopropyl-beta-D-1-thiogalactopyranoside), arabinose, raffinose, tryptophan, and numerous others. Systemslinking the use of these well-known inducers to the control of gene expression silencingand / or controlled proteolysis can be integrated into genetically modified microbial systemsto control the transition between growth and production phases in multi-stage fermentationprocesses.

[0063] In addition, it may be desirable to control the transition between growth andproduction in multi-stage fermentations by the depletion of one or more limiting nutrientsthat are consumed during growth. Limiting nutrients can include but are not limited to:phosphate, nitrogen, sulfur, and magnesium. Natural gene expression systems that respondto these nutrient limitations can be used to operably link the control of gene expressionsilencing and / or controlled proteolysis to the transition between growth and productionphases in multi-stage fermentation processes.Atty Docket No.: 49186-155

[0064] VI. Ethanol as carbon source of product production.

[0065] The invention describes chromosomal or plasmid modification of anendogenous adhE gene and an adaptation method in order to obtain a microorganism usefulin a method of product production relying on ethanol as the carbon source for that product.The modification of the endogenous adhE gene is via a chromosomal modification and / orvia a plasmid. In any event, the endogenous adhE is deleted or otherwise modified to renderexpression of the endogenous adhE gene impossible. The term endogenous refers to a nativegene or in other words the copy of an adhE gene one would find in an unmodifiedmicroorganism. In some aspects, the endogenous adhE gene itself is deleted or otherwisemodified, the promotor of an endogenous adhE gene is modified or both modification occur.In one aspect, the endogenous adhE gene promotor is modified to enable constitutiveexpression of a modified adhE gene from the chromosome. In some aspects the endogenousadhE gene is replaced with a mutant adhE gene. Such modification to the microorganismpermit both growth and product production with ethanol as a carbon source. In someaspects, the growth phase occurs in a media comprising ethanol and in some aspects thegrowth phase occurs in a media comprising ethanol that is supplemented with glucose. Theterm growth media refers to media in which any microorganism is undergoing a growthphase. Consequently, production media is media in which a genetetically modifiedmicroorganism is found when it is undergoing or has undergone a transition from a growthphase to a product producing phase, and describes the media in which the microorgansimsundergoes product production. In some aspects the product production phase occurs in amedia where ethanol is the carbon source for the microorganism. In the inventive methods,ethanol serves as the carbon source for the product that is produced from the geneticallymodified microorganim according to aspects of the invention. Aspects of the inventiondescribe use of the genetically modified microorganim in biofermentation methods.

[0066] VII. Product produced

[0067] There are no restrictions on the products that can be produced from ethanolas the carbon source as ethanol may be metabolized to acetyl-CoA, acetyl-CoA is thenconverted to pyruvate, from pyruvate cell growth and product formation occurs, as pyruvateis a key glycolysis intermediate. The product may comprise: an amino acid, acetate, acetoin,Atty Docket No.: 49186-155acetone, acrylic, malate, fatty acid ethyl esters, isoprenoids, terpene, glycerol, ethylene glycol,ethylene, propylene, butylene, isobutylene, ethyl acetate, vinyl acetate, 1,4-butanediol, 2,3-butanediol, butanol, isobutanol, sec-butanol, butyrate, isobutyrate, 2-OH-isobutryate, 3-OH-butyrate, ethanol, isopropanol, D-lactate, L-lactate, pyruvate, itaconate, levulinate, glucarate,glutarate, caprolactam, adipic acid, propanol, isopropanol, fused alcohols, 1,2-propanediol,1,3-propanediol, formate, fumaric acid, propionic acid, succinic acid, valeric acid, maleic acid,poly-hydroxybutyrate, citramalate, or any citramalate derivative such as citraconicanhydride, itaconic acid, polyitaconate, itaconic polyester, polyol, a maleimide oligomer, abiscitraconimide monomer, protein linkage monomer, sodium sulfosuccinate esters, amaleic-plant oil derivative, or an alkenylsuccinic anhydride, or phloroglucinol.EXAMPLES

[0068] For the purposes of promoting an understanding of the principles of thepresent disclosure, reference will now be made to specific examples. No limitation of thescope of the claims is thereby intended.Example 1: Adaptation of microorganism strains to ethanol as a carbon source

[0069] Two different microorganism strains had the endogenous adhE gene deleted(DMC_HS_044) and replaced by the adhE A267T / E568K mutant gene. The adhEA267T / E568K mutant gene expression product (i.e., the adhE A267T / E568K mutantpolypeptide) allows E. Coli to use ethanol as the sole carbon source under aerobicconditions. The adhE A267T / E568K mutant gene may be supplied either in plasmid basedformat: (construct including DMC_PID_763; pCOLA backbone; Modified EM7 promoter(EM7*); Gentamicin resistance); or it can be supplied through integration into the E. Coligenome (DMC_HS_1944). The EM7-adhE A267T / E568K gene polynucleotide construct wasintegrated into DMC_HS_044 (F-, λ-, Δ(araD-araB)567, lacZ4787(del)(::rrnB-3) , rph-1,Δ(rhaD-rhaB)568, hsdR514, ΔackA-pta, ΔpoxB, ΔpflB, ΔldhA, EM7-adhE-A267T / E568K, ΔsspB, ΔiclR, ΔarcA, Δcas3::tm-ugpb-sspB-pro [casA*], gltA-das+4::zeoR, zwf-das+4::bsdR).

[0070] Example 1A: Plasmid-based adhE A267T / E568K mutant gene:

[0071] DMC_PID_763 was transformed using electroporation into DMC_HS_044 tocreate DMC_133. Transformants were cultivated at 30C in DMC’s rich media SM10++supplemented with 1 g / L glucose and 10 g / L ethanol, and were propagated to DMC’sAtty Docket No.: 49186-155minimal media FGM10.2_SF supplemented with 1 g / L glucose and 10 g / L ethanol for twopassages. The adapted DMC_133 E. Coli strain was able to grow to higher OD. See FIG 1.

[0072] Example 1B: Chromosome-based adhE A267T / E568K mutant gene:

[0073] A single colony of DMC_HS_1944 was inoculated into DMC rich media(SM10++) supplemented with 1 g / L glucose and 10 g / L ethanol and cultivated at 30Covernight (OD >4). The culture was used to inoculate (1%) 20 mL of DMC minimal media(FGM10.2_SF) supplemented with 1 g / L glucose and 10 g / L ethanol and cultivated at 30C(propagation 1). Every 24 hours, the OD was measured, and 100 uL of 200 proof ethanolwas added to the culture to account for the evaporation. Once the OD reached ~ 4 or more(~6 days), the culture was used to inoculate another flask of (FGM10.2_SF) supplementedwith 1 g / L glucose and 10 g / L ethanol and cultivated at 30C (propagation 2). Once the ODreached ~ 4 or more (~3 days), the culture was used to inoculate another flask of(FGM10.2_SF) supplemented with 0 g / L glucose and 10 g / L ethanol and cultivated at 30C(propagation 3). This culture reached OD ~ 4 or more in 2 days and is now adapted to growin ethanol only media. See FIG 2.

[0074] Example 1C: Transformation of plasmids into ethanol adapted strains

[0075] For either the plasmid-based or chromosome-based ethanol growth strains.

[0076] Grow cells to OD 0.5-1.0 in ethanol minimal media and make competent bywashing 3X in 10 % glycerol. Electroporate plasmid(s) into cells. Recover 3 hrs in 800 uLSM10++ 1 g / L glucose 10 g / L ethanol. Pellet cells.

[0077] Method 1: Resuspend in FGM10.2_SF 1 g / L glucose 10 g / L ethanol withantibiotics and inoculate 20 mL FGM10.2_SF 1 g / L glucose 10 g / L ethanol and begin ethanolonly adaption growth process from first FGM10.2_SF step 1 g / L glucose 10 g / L ethanol. Insome cases, the SM10++ recovery culture was added directly to FGM10.2_SF 1 g / L glucose10 g / L ethanol.

[0078] Method 2: Resuspend in SM10++ 1 g / L glucose 10 g / L ethanol with antibioticsand inoculate 20 mL SM10++ 1 g / L glucose 10 g / L ethanol and begin ethanol only adaptiongrowth process from SM10++ 1 g / L glucose 10 g / L ethanol step. In some cases, the SM10++recovery culture was added directly to SM10++ 1 g / L glucose 10 g / L ethanol.Example 2: Growth Characterization of Ethanol Adapted StrainsAtty Docket No.: 49186-155

[0079] For either the plasmid-based or chromosome-based ethanol growth straincharacterization was done at 30 and 37C . OD data is collected using the BioLector. Prepareminimal media with 1 g / L glucose and 10, 20, and 30 g / L ethanol as well as no glucose and10, 20, and 30 g / L ethanol. 760 uL of media + antibiotics in each well then, each well isinoculated with 40 uL of glycerol stock. 30 and 37C 1300 rpm runs for several days. See FIG3.Example 3: Production of a desired product

[0080] The same protocol is used for both chromosomal and plasmid-based ethanolgrowth strains. Starting from propagation 3 in the adaption process (media FGM10.2_SF 0g / L glucose and 10 g / L ethanol) the strains were grown until OD > 5. 4 OD of cells wereremoved from the flask, washed twice with production media and then brought to a finalvolume of 10-20 mL in a shake flask. The flask with 4 OD of cells in production media wasthen incubated at 30 or 37C for 72 hours with time points being taken every 24 hours.Ethanol (50 uL for every 10 mL of media) was added every 24 hours to the shake flasks toaccount for evaporation. To take the timepoints, 1 mL of culture was removed andtransferred to microtube. The OD was measured, and the cells were pelleted bycentrifugation and the supernatant was measured for the production of the desired finalproduct in triplicate for each timepoint. This procedure was demonstrated for multipleproducts including citramalate and phloroglucinol.

Claims

Atty Docket No.: 49186-155CLAIMS:

1. A multi-stage biofermentation process for producing a product from a geneticallymodified microorganism, comprising:(A) providing a genetically modified microorganism that:(1) is adapted to grow in a growth media comprising ethanol; and(2) comprises:(a) a production pathway comprising at least one productionenzyme for biosynthesis of the product;(b) a mutation of the endogenous adhE gene and of theendogenous adhE gene promotor; and(c) one or more synthetic metabolic valves for reducing oreliminating flux through multiple metabolic pathways within thegenetically modified microorganism when the synthetic metabolicvalves are induced;(B) growing the genetically modified microorganism in a media comprisingethanol in a growth phase; and(C) transitioning to a productive stationary phase, the transitioning comprising:(1) depleting a limiting nutrient;(2) inducing the one or more synthetic metabolic valves; and(3) activating the production pathway.Atty Docket No.: 49186-1552. The method of claim 1, wherein the mutation of the endogenous adhE genecomprises chromosomal deletion of the endogenous adhE gene and replacement with adhEA267T / E568K mutant gene.

3. The method of claim 1, wherein the mutation of the endogenous adhE genecomprises chromosomal deletion of the endogenous adhE gene and transformation of themicroorganism with a plasmid encoding A267T / E568K adhE mutant gene.

4. The method of claim 1, wherein the growth or production media comprising ethanolcomprises at least 10g / L ethanol and no added glucose.

5. The method of claim 2, wherein the endogenous adhE gene promotor is replaced bya constitutive promotor for constitutive expression of the adhE mutant gene.

6. The method of claim 1, wherein the one or more synthetic metabolic valvescomprises: a) at least one silencing synthetic metabolic valve that silences gene expressionof a gene selected from: fabI, gltA, lpd, zwf, and udhA, or b) at least one proteolyticsynthetic metabolic valve that controls proteolysis of a proteolyzable enzyme selectedfrom: fabI, gltA, lpd, zwf, and udhA.

7. The method of claim 1, wherein the product comprises: an amino acid, acetate,acetoin, acetone, acrylic, malate, fatty acid ethyl esters, isoprenoids, glycerol, ethyleneglycol, ethylene, propylene, butylene, isobutylene, ethyl acetate, vinyl acetate, 1,4-butanediol, 2,3-butanediol, butanol, isobutanol, sec-butanol, butyrate, isobutyrate, 2-OH-Atty Docket No.: 49186-155isobutryate, 3-OH-butyrate, ethanol, isopropanol, D-lactate, L-lactate, pyruvate, itaconate,levulinate, glucarate, glutarate, caprolactam, adipic acid, propanol, isopropanol, fusedalcohols, 1,2-propanediol, 1,3-propanediol, formate, fumaric acid, propionic acid, succinicacid, valeric acid, maleic acid, poly-hydroxybutyrate, citramalate or phloroglucinol.

8. A method of adapting a genetically modified E. coli microorganism comprisingsynthetic metabolic valves to grow aerobically in a growth medium comprising ethanol, themethod comprising:providing a microorganism with a deletion of endogenous adhE gene, a mutation ofthe endogenous adhE gene promotor, and replacement with adhE A267T / E568K mutantgene and a constitutive promotor;growing the microorganism in an ethanol minimal media;modifying the microorgansism with plasmids encoding synthetic metabolic valves;andpropagating the modified microorganism in a growth process in a media comprisingSM10++ or FGM10.2_SF 1 g / L glucose and 10 g / L ethanol for at least three propagations.

9. The method of claim 8, the genetically modified E. coli further comprisingchromosomal modifications that complement the portion of the synthetic metabolic valveencoded by the plasmid.Atty Docket No.: 49186-15510. The method of claim 9, wherein the chromosomal modification of the geneticallymodified E. coli includes introduction into the chromosome of a proteolytic syntheticmetabolic valve that controls proteolysis of an enzyme.

11. A genetically modified E. coli microorganism comprising a production pathwaycomprising:at least one production enzyme for biosynthesis of the product;a mutation of the endogenous adhE gene and a mutation of the endogenous adhEgene promotor; andone or more synthetic metabolic valves for reducing or eliminating flux throughmultiple metabolic pathways within the genetically modified microorganism when thesynthetic metabolic valves are induced.

12. The microorganism of claim 11, wherein the mutation of the endogenous adhE genecomprises chromosomal deletion of an endogenous adhE gene and replacement ofendogenous adhE gene with adhE A267T / E568K mutant gene.

13. The microorganism of claim 11, wherein the mutation of the endogenous adhE genecomprises chromosomal deletion of an endogenous adhE gene and transformation of themicroorganism with a plasmid encoding adhE A267T / E568K mutant gene.

14. The method of claim 12, wherein the endogenous adhE gene promotor is replacedby a constitutive promotor for constitutive expression of the adhE mutant geneAtty Docket No.: 49186-15515. The microorganism of claim 11, wherein the microorganism grows in a growth orproduction media comprising ethanol at a concentration of at least 10g / L ethanol and noglucose.

16. The microorganism of claim 11, wherein the one or more synthetic metabolic valvescomprises: a) at least one silencing synthetic metabolic valve that silences gene expressionof a gene selected from: fabI, gltA, lpd, zwf, and udhA, or b) at least one proteolyticsynthetic metabolic valve that controls proteolysis of a proteolyzable enzyme selectedfrom: fabI, gltA, lpd, zwf, and udhA.

Images