Gene editing systems and compositions for treatment of hemoglobinopathies and methods of using the same

Abstract

The present disclosure describes improved LNP-based nucleobase editing systems and therapeutics for use in treating hemoglobinopathies, including sickle cell disease and beta-thalassemia. In particular, the disclosure describes improved LNPs, including novel and improved ionizable lipids for making LNPs, that enhance the targeted delivery of LNP-based nucleobase editing systems and therapeutics to red blood cell progenitor cells, enabling treatment of hemoglobinopathies, in vivo.

Description

GENE EDITING SYSTEMS AND COMPOSITIONS FOR TREATMENT OF HEMOGLOBINOPATHIES AND METHODS OF USING THE SAME RELATED APPLICATIONS

[0001] This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Application Serial No.63 / 502,846, filed May 17, 2023, U.S. Provisional Application Serial No.63 / 584,014, filed September 20, 2023, U.S. Provisional Application Serial No.63 / 593,764, filed October 27, 2023, U.S. Provisional Application Serial No.63 / 557,134, filed February 23, 2024, U.S. Provisional Application Serial No.63 / 570,053, filed March 26, 2024, and U.S. Provisional Application Serial No.63 / 638,004, filed April 24, 2024, each of which are incorporated herein by reference in their entireties.

[0002] The foregoing applications, and all documents cited therein and all documents cited or referenced herein, together with any manufacturer’s instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the disclosed subject matter. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference. TECHNICAL FIELD

[0003] The present disclosure generally relates to the field of in vivo gene editing as a treatment for hemoglobinopathies. More in particular, this disclosure relates to therapeutic compositions comprising a lipid nanoparticle (LNP) composition and a cargo gene editing system that is capable of delivery to a hematopoietic stem cell (HSC) in vivo, wherein the gene editing system, once delivered, is capable of installing one or more edits to a hemoglobin gene or regulatory region thereof in the genome of the HSC such that the hemoglobinopathy, such as sickle cell disease (SCD) or transfusion- dependent beta-thalassemia, is treated. BACKGROUND OF THE DISCLOSURE

[0004] Gene editing therapeutics have enormous potential for treating diseases, such as hemoglobinopathies, including under in vivo conditions, but there remains a need for more effective delivery of such systems to appropriate in situ sites within a patient in order to realize this potential. Hemoglobinopathies are a collection of disorders characterized by abnormal forms of hemoglobin and include, most notably, sickle cell disease (SCD) and beta-thalassemia (e.g., transfusion-dependent beta-thalassemia or TDT).

[0005] Hemoglobin (Hb) carries oxygen from the lungs to tissues in erythrocytes or red blood cells (RBCs). During prenatal development and until shortly after birth, hemoglobin is present in the form of fetal hemoglobin (HbF), a tetrameric protein composed of two alpha (^)-globin chains and two gamma (^)-globin chains. HbF is largely replaced by adult hemoglobin (HbA), a tetrameric protein inwhich the ^-globin chains of HbF are replaced with beta (^)-globin chains, through a process known as globin switching. HbF is more efficient than HbA at carrying oxygen. The average adult makes less than 1% HbF out of total hemoglobin. The ^-hemoglobin gene (HBA) is located on chromosome 16, while the ^-hemoglobin gene (HBB), A gamma (^)-globin chain (HBG1, also known as gamma globin A), and G gamma (^)-globin chain (HBG2, also known as gamma globin G) are located on chromosome 11 within the globin gene cluster (i.e., globin locus).

[0006] Certain hemoglobinopathies, such as SCD and beta-thalassemia, are caused by mutations in HBB. According to the Centers for Disease Control (CDC) as of the time of this filing, SCD affects millions of people throughout the world, including a projected approximately 100,000 Americans. SCD disproportionately affects those whose ancestors came from sub-Saharan Africa; Spanish- speaking regions in the Western Hemisphere (South America, the Caribbean, and Central America); Saudi Arabia; India; and Mediterranean countries such as Turkey, Greece, and Italy. The CDC reports that SCD occurs in the U.S. among about 1 out of every 365 Black or African-American births and among 1 out of every 16,300 Hispanic-American births. SCD is actually a collection of multiple specific forms of the disease which are characterized by different mutations in the HBB gene and with differing levels of severity. Beta-thalassemia, like SCD, is an inherited disease whereby one or mutations in a hemoglobin gene (e.g., mutations in the genes encoding the beta or alpha subunits, or other sites that disrupt hemoglobin levels) result in low hemoglobin levels ranging in levels of severity in a mutation-dependent way.

[0007] Treatments for hemoglobinopathies are limited and are focused generally on management of the symptoms commonly caused by these disorders, including management of pain (in the case of SCD, pain is due to the negative effects of the sickle-shaped red blood cells on blood circulation), infection, and anemia. In the case of SCD, there are at least four FDA-approved treatments to manage various complications from SCD and which have been shown to lengthen the lives of treated patients. However, there are no current curative treatments.

[0008] While at least one gene editing therapy—CASGEVY™ (exagamglogene autotemcel)—has been approved by the FDA in the U.S. for using in treating SCD and TDT by increasing the production of HbF, the treatment is an ex vivo therapy involving removing the patient’s own blood stem cells, editing them outside of the body, and then engrafting the edited cells into the bone marrow. Such cell therapies have many recognized disadvantages, including myeloablative pre- conditioning, neutrophil engraftment failure, delayed platelet engraftment, and hypersensitivity reactions, among other adverse event risks. A gene editing therapy for treating and / or curing hemoglobinopathies in vivo directly in the patient in a safe and effective manner would be a significant advance in the art and would overcome the issues posed by ex vivo alternatives. SUMMARY

[0009] Described herein are compositions, methods, processes, and kits for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based nucleobase editing systems andtherapeutics comprising the same, for the treatment of hemoglobinopathies, including but not limited to sickle cell disease (SCD) and beta-thalassemia (e.g., transfusion-dependent beta-thalassema or TDT). In particular, described herein are compositions, methods, processes, and kits comprising nucleobase editing systems capable of executing one or more edits to the genome of a patient, in vivo, as part of an LNP formulation. Compositions include, but are not limited to, (a) nucleobase editing systems and / or components thereof, (b) DNA molecules encoding the nucleobase editing systems and / or components thereof, (c) RNA molecules encoding the nucleobase editing systems and / or components thereof, (d) RNA components of the nucleobase editing systems, such as guide RNAs or retron non-coding RNAs, (e) cells or cell lines stabling expressing or otherwise containing the nucleobase editing systems described herein, (f) edited cells or edited cell lines that have been edited by a nucleobase editing system described herein, (g) an LNP capable of delivery to an HSC, including an HSC in vivo, (h) ionizable lipids, structural lipids, phospholipids, and PEGylated lipids for preparing LNPs that are capable of delivery to HSCs, including HSCs in vivo, (i) LNPs encapsulated or formulated with a nucleobase editing system described herein, including DNA, RNA, and / or protein components of said nucleobase editing systems, and which LNPs are capable of delivery to HSCs, including HSCs in vivo, (j) cells or cell lines comprising the LNPs described herein, and (k) pharmaceutical compositions comprising the LNPs described herein which are formulated with a nucleobase editing system described herein. Methods described herein include but are not limited to (a) methods of making the lipid components of herein disclosed LNPs, (b) method of making the herein disclosed LNPs, (c) methods of making the nucleobase editing systems described herein, including methods of making any of the individual DNA, RNA, or protein components of the nucleobase editing systems described herein, (d) methods of formulating the LNPs described herein with the nucleobase editing systems disclosed herein, or with any component thereof, (e) methods of delivering the LNP or pharmaceutical composition comprising the LNPs to cell, tissue, or organs in vivo, (f) methods of administering the nucleobase editing systems to cells, tissues, or organs in vivo, and (g) methods of editing one or more HSCs, including HSCs in vivo, in a hemoglobin gene or regulatory region thereof using a nucleobase editing system described herein to treat, including permanently treat, a hemoglobinopathy, including SCD and TDT.

[0010] In one aspect, the present disclosure provides compositions, methods, processes, and kits for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based CRISPR-type II gene editing systems and therapeutics comprising the same, for the treatment of hemoglobinopathies, including but not limited to sickle cell disease (SCD) and beta-thalassemia (e.g., transfusion-dependent beta-thalassema or TDT), by introducing one or more edits into a hemoglobin gene or a regulatory region thereof in an hematopoietic stem cell (HSC) in the body (i.e., in vivo) which results in increased production of fetal hemoglobin (HbF), thereby treating the hemoglobinopathy. Compositions include, but are not limited to, (a) CRISPR-type II gene editing systems and / or components thereof, (b) DNA molecules encoding the CRISPR-type II gene editingsystems and / or components thereof, (c) RNA molecules encoding the CRISPR-type II gene editing systems and / or components thereof, (d) RNA components of the CRISPR-type II gene editing systems, such as guide RNAs, (e) cells or cell lines stabling expressing or otherwise containing the CRISPR-type II gene editing systems described herein, (f) edited cells or edited cell lines that have been edited by a CRISPR-type II gene editing system described herein, (g) an LNP capable of delivery to an HSC, including an HSC in vivo, (h) ionizable lipids, structural lipids, phospholipids, and PEGylated lipids for preparing LNPs that are capable of delivery to HSCs, including HSCs in vivo, (i) LNPs encapsulated or formulated with a CRISPR-type II gene editing system described herein, including DNA, RNA, and / or protein components of said CRISPR-type II gene editing systems, and which LNPs are capable of delivery to HSCs, including HSCs in vivo, (j) cells or cell lines comprising the LNPs described herein, and (k) pharmaceutical compositions comprising the LNPs described herein which are formulated with a CRISPR-type II gene editing system described herein. Methods described herein include but are not limited to (a) methods of making the lipid components of herein disclosed LNPs, (b) method of making the herein disclosed LNPs, (c) methods of making the CRISPR-type II gene editing systems described herein, including methods of making any of the individual DNA, RNA, or protein components of the CRISPR-type II gene editing systems described herein, (d) methods of formulating the LNPs described herein with the CRISPR-type II gene editing systems disclosed herein, or with any component thereof, (e) methods of delivering the LNP or pharmaceutical composition comprising the LNPs to cell, tissue, or organs in vivo, (f) methods of administering the CRISPR-type II gene editing systems to cells, tissues, or organs in vivo, and (g) methods of editing one or more HSCs, including HSCs in vivo, in a hemoglobin gene or regulatory region thereof using a CRISPR-type II gene editing system described herein to treat, including permanently treat, a hemoglobinopathy, including SCD and TDT.

[0011] In another aspect, the present disclosure provides compositions, methods, processes, and kits for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based CRISPR- type V gene editing systems and therapeutics comprising the same, for the treatment of hemoglobinopathies, including but not limited to sickle cell disease (SCD) and beta-thalassemia (e.g., transfusion-dependent beta-thalassema or TDT), by introducing one or more edits into a hemoglobin gene or a regulatory region thereof in an hematopoietic stem cell (HSC) in the body (i.e., in vivo) which results in increased production of fetal hemoglobin (HbF), thereby treating the hemoglobinopathy. Compositions include, but are not limited to, (a) CRISPR-type V gene editing systems and / or components thereof, (b) DNA molecules encoding the CRISPR-type V gene editing systems and / or components thereof, (c) RNA molecules encoding the CRISPR-type V gene editing systems and / or components thereof, (d) RNA components of the CRISPR-type V gene editing systems, such as guide RNAs, (e) cells or cell lines stabling expressing or otherwise containing the CRISPR-type V gene editing systems described herein, (f) edited cells or edited cell lines that have been edited by a CRISPR-type V gene editing system described herein, (g) an LNP capable ofdelivery to an HSC, including an HSC in vivo, (h) ionizable lipids, structural lipids, phospholipids, and PEGylated lipids for preparing LNPs that are capable of delivery to HSCs, including HSCs in vivo, (i) LNPs encapsulated or formulated with a CRISPR-type V gene editing system described herein, including DNA, RNA, and / or protein components of said CRISPR-type V gene editing systems, and which LNPs are capable of delivery to HSCs, including HSCs in vivo, (j) cells or cell lines comprising the LNPs described herein, and (k) pharmaceutical compositions comprising the LNPs described herein which are formulated with a CRISPR-type V gene editing system described herein. Methods described herein include but are not limited to (a) methods of making the lipid components of herein disclosed LNPs, (b) method of making the herein disclosed LNPs, (c) methods of making the CRISPR-type V gene editing systems described herein, including methods of making any of the individual DNA, RNA, or protein components of the CRISPR-type V gene editing systems described herein, (d) methods of formulating the LNPs described herein with the CRISPR-type V gene editing systems disclosed herein, or with any component thereof, (e) methods of delivering the LNP or pharmaceutical composition comprising the LNPs to cell, tissue, or organs in vivo, (f) methods of administering the CRISPR-type V gene editing systems to cells, tissues, or organs in vivo, and (g) methods of editing one or more HSCs, including HSCs in vivo, in a hemoglobin gene or regulatory region thereof using a CRISPR-type V gene editing system described herein to treat, including permanently treat, a hemoglobinopathy, including SCD and TDT.

[0012] In another aspect, the present disclosure provides compositions, methods, processes, and kits for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based retron gene editing systems and therapeutics comprising the same, for the treatment of hemoglobinopathies, including but not limited to sickle cell disease (SCD) and beta-thalassemia (e.g., transfusion- dependent beta-thalassema or TDT), by introducing one or more edits into a hemoglobin gene or a regulatory region thereof in an hematopoietic stem cell (HSC) in the body (i.e., in vivo) which results in increased production of fetal hemoglobin (HbF), thereby treating the hemoglobinopathy. Compositions include, but are not limited to, (a) retron gene editing systems and / or components thereof, (b) DNA molecules encoding the retron gene editing systems and / or components thereof, (c) RNA molecules encoding the retron gene editing systems and / or components thereof, (d) RNA components of the retron gene editing systems, such as guide RNAs, (e) cells or cell lines stabling expressing or otherwise containing the retron gene editing systems described herein, (f) edited cells or edited cell lines that have been edited by a retron gene editing system described herein, (g) an LNP capable of delivery to an HSC, including an HSC in vivo, (h) ionizable lipids, structural lipids, phospholipids, and PEGylated lipids for preparing LNPs that are capable of delivery to HSCs, including HSCs in vivo, (i) LNPs encapsulated or formulated with a retron gene editing system described herein, including DNA, RNA, and / or protein components of said retron gene editing systems, and which LNPs are capable of delivery to HSCs, including HSCs in vivo, (j) cells or cell lines comprising the LNPs described herein, and (k) pharmaceutical compositions comprising theLNPs described herein which are formulated with a retron gene editing system described herein. Methods described herein include but are not limited to (a) methods of making the lipid components of herein disclosed LNPs, (b) method of making the herein disclosed LNPs, (c) methods of making the retron gene editing systems described herein, including methods of making any of the individual DNA, RNA, or protein components of the retron gene editing systems described herein, (d) methods of formulating the LNPs described herein with the retron gene editing systems disclosed herein, or with any component thereof, (e) methods of delivering the LNP or pharmaceutical composition comprising the LNPs to cell, tissue, or organs in vivo, (f) methods of administering the retron gene editing systems to cells, tissues, or organs in vivo, and (g) methods of editing one or more HSCs, including HSCs in vivo, in a hemoglobin gene or regulatory region thereof using a retron gene editing system described herein to treat, including permanently treat, a hemoglobinopathy, including SCD and TDT. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0014] FIG.1 depicts a single lipid nanoparticle (LNP) comprising an RNA cargo, wherein the LNP comprises an ionizable lipid, a helper lipid, a cholesterol, a PEG-lipid, and an optional targeting ligand having specificity for a hematopoietic stem cell (HSC), and the RNA cargo comprise one or elements encoding (e.g., an mRNA encoding a CRISPR type II or type V nuclease) or constituting (e.g., a guide RNA) a gene editing system. In embodiments, the gene editing system is for installing one or more edits in a hemoglobin gene or regulatory region thereof (e.g., such as in accordance with the editing strategies described herein).

[0015] FIG.2A outlines a therapeutic scheme for treating a subject having a hemoglobinopathy, such as sickle cell disease (SCD) or transfusion-dependent ^-thalassemia (TDT), using an LNP composition of the disclosure which comprises in some embodiments a gene editing system, such as a CRISPR type II or type V nuclease, a base editor, or a prime editor, and a suitable guide RNA, wherein said gene editing system is capable of installing one or more edits that result in the production of normal hemoglobin, e.g., normal adult hemoglobin or normal fetal hemoglobin.

[0016] FIG.2B provides an illustrative view of the information in FIG.2A.

[0017] FIG.2C is a schematic, adapted from Dev Comp Immunol.2016 May; 58: 18–29., depicting the lineages of hematopoietic cell types according to two models.

[0018] FIG.3 is a diagram showing the HBB mutations (i.e., mutations in the gene encoding hemoglobin subunit beta) that result in ^-hemoglobinopathies, including sickle cell disease (SCD) and ^-thalassemia.

[0019] FIG.4 illustrates various non-limiting strategies for utilizing gene editing to treat ^- hemoglobinopathies. The upper panel depicts correction of E6V sickle mutation in HBB exon 1 using a CRISPR-Cas9 system that cuts precisely at or proximal to the E6V sickle mutation site followed by contact with an HDR-template that installs the corrected sequence mediated by homology-directed repair. The lower panel, left side, depicts correction of the E6V sickle mutation in HBB exon 1 using a BE strategy (which converts a T to C using an ABE thereby converting a valine residue to an alanine residue (the so called Makassar variant of hemoglobin beta subunit which functions normally). The lower panel, right side, depicts correction of the E6V sickle mutation in HBB exon 1 using a PE strategy (which rewrites the region containing the edit thereby restoring the wildtype sequence and production of a normal hemoglobin beta subunit).

[0020] FIG.5 illustrates four strategies for reactivating ^-globin (aka HBG1 / HBG2 or hemoglobin subunit gamma 1 and 2) production. In the first strategy (top), an HPFH deletion of the genes encoding HBD and HBB is introduced, thereby leading to reactivation of HBG1 and HBG2. This deletion emulates an HPFH (hereditary persistence of fetal hemoglobin mutation – which is a naturally occurring mutation in subjects which results in increased fetal hemoglobin production). In the second strategy (middle), HPFH mutations are introduced by editing into the HBG1 / 2 promoters which activates fetal hemoglobin production – again, emulating the natural effect of these mutations. This includes introducing edits in the HBG1 / 2 promoter which block binding of the BCL11A repressor protein. In the third strategy (lower), the gene encoding BCL11A (or an enhancer required for its transcription) is inactivated by gene editing. In the fourth strategy, editing is used to activate the GATA1 enhancer sequence which activates fetal hemoglobin production.

[0021] FIG.6A illustrates the structure of adult hemoglobin—a quaternary-subunit protein comprising two subunits of hemoglobin subunit beta (^1 and ^2) and two subunits of hemoglobin subunit alpha (^1 and ^2) versus the structure of fetal hemoglobin—which comprises a hemoglobin subunit A-gamma (HBG1) and a subunit G-gamma (HBG2) in place of the two beta subunits. Fetal hemoglobin production is suppressed in normal adults due to the negative regulation of transcription of HBG1 and HBG2 genes which form the two gamma subunits by various molecular regulators, including BCL11A. In healthy humans, a shift from ^-globin to ^-globin gene expression around birth underlies the switch from fetal (^2^2; HbF) to adult (^2^2; HbA) hemoglobin. By 6 months of age the major hemoglobin is HbA.

[0022] FIG.6B illustrates the hemoglobin gene locus on chromosome 11, including various hemoglobin genes (e.g., those encoding the beta, gamma, and alpha subunits), the location of the SCD mutation in the gene encoding the beta subunit, and the ^-LCR transcription regulatory region.

[0023] FIG.7 represents a first strategy that may be achieved using the LNP editing systems disclosed herein. In this strategy, a disclosed editing system is employed to introduce an edit that blocks or disrupts the binding site for BCL11A or LRF (or both) in the HBG1 and HBG2 promoters. BCL11A and LRF are transcriptional repressors that contribute to fetal-to-adult hemoglobinswitching. Restoring HbF expression by inhibiting BCL11A (or LRF) function has been shown to correlate with positive outcomes for sickle cell disease patients. Strategy 1: disrupt the BCL11A binding site in the HBG1 / 2 promoters^reducing BCL11A repression of HBG1 / 2 expression^increased production of HBG1 / 2^ upregulating HbF.

[0024] FIG.8 represents a second strategy that may be achieved using the LNP editing systems disclosed herein. In this strategy, a disclosed editing system is employed to introduce an edit that blocks or disrupts the production of BCL11A (e.g., by inactivating the gene encoding BCL11A in the coding region or in a regulatory region), or by inactivating GATA-1, a transcriptional activator or BLCA11 transcription. BCL11A is a transcriptional repressor that contributes to fetal-to-adult hemoglobin switching. Restoring HbF expression by inhibiting BCL11A function has been shown to correlate with positive outcomes for sickle cell disease patients. Strategy 2: disrupt BCL11A coding region (“X”) or the erythroid-specific enhancer, GATA-1 (“star”) of BCL11A gene^reducing BCL11A (repressor of HbF)^ upregulating HbF.

[0025] FIG.9 represents a third strategy that may be achieved using the LNP editing systems (e.g., a base editor) disclosed herein. In this strategy, a disclosed editing system (e.g., a base editor) is employed to introduce an edit that converts A to G at -113 in the HBG1 / 2 promoters, which activates a GATA-1 binding site, which activates or enhances the expression of HBG1 / 2 subunits, and thus, HbF up-production. Strategy 3: base edit-catalyzed conversion of A to G at -113 in HBG1 / 2 promoters to activate a GATA-1 enhancer binding site, which enhances expression of HBG1 / 2 subunits, and thus, HbF up-production.

[0026] FIG.10 represents a process for improving a programmable nuclease, such as, but not limited to a type V ortholog (e.g., ID405), by introducing one or more arginine residues in place of a naturally-occurring non-arginine residues at positions predicted to have an impact on the interaction between the ID405 amino acid sequence and a guide RNA (prediction based on computational methodology of Example 13). The substitutable positions are then ranked in accordance with the magnitude of stabilizing energetics associated with arginine replacement at any particular position as outline in Example 13. Variant type V editors are then engineered and tested to determine which variants provide for any improvement in editing efficiency. Results are shown in Example 13.

[0027] FIG.11 compares the interaction between Lys292 in ID405-1 with a replaced Arg292 with the guide RNA showing a more favorable interaction with the Arg292 residue, as described in Example 13.

[0028] FIG.12 compares the interaction between Gln492 in ID405-1 with a replaced Arg492 with the guide RNA showing a more favorable interaction with the Arg492 residue, as described in Example 13.

[0029] FIG.13 compares the interaction between Asn770 in ID405-1 with a replaced Arg770 with the guide RNA showing a more favorable interaction with the Arg770 residue, as described in Example 13.

[0030] FIG.14 provides a graph showing the editing efficiency in primary HSPCs of select ID405-1 variants with arginine substitution mutations. WT designated ID405-1. Each variant enzyme, e.g., S972R, designates ID405-1 with a particular arginine substitution (e.g., S972R designates that serine at position 972 relative to ID405-1 has been substituted with an arginine). See Example 13 for details.

[0031] FIG.15 is a schematic of ID405-1 variants comprising one or more NLS and optional linkers to improve ID405-1 editing activity, in accordance with Example 14.

[0032] FIG.16 is a schematic that shows that modified ID405-1 variant containing various linkers and NLSs in various configurations at the N- and / or C-termini improves editing as compared to baseline Construct 1 in primary HSPCs by up to a 5-fold increase. See Example 14 for details.

[0033] FIG.17A is a schematic representation of the selection scheme for ID405 used in Example 15. The ID405 plasmid library was transformed into E. coli cells. The most active variants cut ccdB encoding plasmid which led to its subsequent degradation. This allowed for E. coli to grow on selective media promoting ccdB induction. Cells that receive plasmid with WT or non-functional / less active ID405 mutant died due to activity of ccdB.

[0034] FIG.17B is a schematic of the ID405 containing plasmid pACYCDuet_ID405-HBG1- crRNA-TTR-HDV used for directed evolution.

[0035] FIG.17C is a schematic of the domain structure of ID405. Domains are labeled in the protein schematic. Marked segments above the protein denote regions selected for mutagenesis.

[0036] FIG.18 is a set of photos of test assays evaluating the performance of ID405 constructs against ccdB containing selection plasmids with TCTT and TTGG PAM sequences upstream of the HBG1 target.

[0037] FIG.19A is a scatter plot summarizing variant frequency in N-terminus library under the selection against TCTT PAM. Nucleotide positions denote the amplified sequence used for library preparation.

[0038] FIG.19B is a scatter plot summarizing variant frequency in N-terminus library under the selection against TTGG PAM. Nucleotide positions denote the amplified sequence used for library preparation.

[0039] FIG.19C is a scatter plot summarizing variant frequency in N-terminus library under the selection against TTGG PAM under the presence of 0.1mM IPTG. Nucleotide positions denote the amplified sequence used for library preparation.

[0040] FIG.19D is a scatter plot summarizing variant frequency in C-terminus library under the selection against TCTT PAM. Nucleotide positions denote the amplified sequence used for library preparation.

[0041] FIG.19E is a scatter plot summarizing variant frequency in C-terminus library under the selection against TTGG PAM. Nucleotide positions denote the amplified sequence used for library preparation.

[0042] FIG.19F is a scatter plot summarizing variant frequency in C-terminus library under the selection against TTGG PAM under the presence of 0.1 mM IPTG. Nucleotide positions denote the amplified sequence used for library preparation.

[0043] FIG.19G is a scatter plot summarizing variant frequency in N-2 library under the selection against TCTT PAM. Nucleotide positions denote the amplified sequence used for library preparation.

[0044] FIG.19H is a scatter plot summarizing variant frequency in N-2 library under the selection against TTGG PAM. Nucleotide positions denote the amplified sequence used for library preparation.

[0045] FIG.19I is a scatter plot summarizing variant frequency in N-2 library under the selection against TTGG PAM under the presence of 0.1 mM IPTG. Nucleotide positions denote the amplified sequence used for library preparation.

[0046] FIG.19J is a scatter plot summarizing variant frequency in C-2 library under the selection against TCTT PAM. Nucleotide positions denote the amplified sequence used for library preparation.

[0047] FIG.19K is a scatter plot summarizing variant frequency in C-2 library under the selection against TTGG PAM. Nucleotide positions denote the amplified sequence used for library preparation.

[0048] FIG.19L is a scatter plot summarizing variant frequency in C-2 library under the selection against TTGG PAM under the presence of 0.1 mM IPTG. Nucleotide positions denote the amplified sequence used for library preparation.

[0049] FIG.19M is a scatter plot summarizing variant frequency in a repeated selection of N-2 library under the selection against TTGG PAM using a greater number of E. coli transformants in round 1. Nucleotide positions denote the amplified sequence used for library preparation.

[0050] FIG.19N is a scatter plot summarizing variant frequency in a repeated selection of N-2 library under the selection against TTGG PAM under the presence of 0.1 mM IPTG using a greater number of E. coli transformants in round 1. Nucleotide positions denote the amplified sequence used for library preparation.

[0051] FIG.20A, FIG.20B, and FIG.20C show the computationally predicted optimal 2’-OMe guide modification sites in guide RNA for lbCas12a over the invariant region of nucleotides 1-20 (FIG.20A), in guide RNA for asCas19 over the invariant region of nucleotides 1-19 (FIG.20B), and in guide RNA for fnCas12 over the scaffold region of nucleotides 1-19 (FIG.20C). Lower case letters (boxes with white background fill) denote sites selected by the algorithm that have 2’-OMe modifications. Upper case letters (boxes with grey background fill) denote nucleotides sites that are not modified. Scores next to each sequence (one per row) denote the potential loss of hydrogen bonding interactions were that position to be modified with a 2’-OMe modification. Scores over each nucleotide (one per column) denote the averaged hydrogen bond interaction calculated for that guide nucleotide position. Three exemplary modified guides with varying scores (high; med; low) are also given for each Type V family member (indicated by black stars). The top row guide sequence is modified at every position with 2’-OMe modifications.

[0052] FIG.21A, and FIG.21B show optimal 2-OMe guide modification sites in spacer region at nucleotides 20-39 of the asCas12 guide sequence (FIG.21A) and at nucleotides 20-39 of the fnCas12 guide sequence (FIG.21B). Lower case letters (boxes with white background fill) denote sites selected by the algorithm that may have 2’-OMe modifications. Upper case letters (boxes with grey background fill) denote nucleotides sites that are not modified. Scores next to each sequence (one per row) denote the potential loss of hydrogen bonding interactions due modifications. Scores over each nucleotide (one per column) denote the averaged hydrogen bond interaction calculated for that guide nucleotide. Three-four exemplary modified guides with varying scores are also given for each Type V family member (indicated by black stars).

[0053] FIG.22A and FIG.22B illustrate results of MOE analysis performed with Cas12a guide bound protein structure. Based on MOE structural protocol, nucleotide positions are identified where the 2’-OH of gRNA nucleotide is making contact with Cas12 protein. Dots indicate sum of all interactions at those positions between the 2’OH group of a given nucleotide and either the guide itself or with the protein and represent positions that ought not to be modified.

[0054] FIG. 23A and FIG. 23C illustrate results of MOE analysis performed with Cas12a guidebound protein structure. Based on MOE structural protocol, nucleotide positions are identified where the 2’-OH of gRNA nucleotide is making contact with Cas12 protein. Dots indicate sum of all interactions at those positions between the 2’OH group of a given nucleotide and either the guide itself or with the protein and represent positions that ought not to be modified.

[0055] FIG. 24 illustrates, based on the computation methodology of Example 16, nucleotide sitesalong the length of a type V guide RNA which may permissibly be modified with 2’-OMe modifications.

[0056] FIG.25, seven different chemical modification patterns are designed for gRNA of three different targets (target 1= PCSK9 gene; target 2 = B2M gene; target 3 = BCL11A binding site in the HBG1 / 2 promoters. Targeting this site with a CRISPR-Cas editor and guide RNA can inactivate the binding site of the BCL11A transcriptional repressor, thereby increasing transcription of HBG1 / 2 genes, which results in increased production of HBG1 / 2 subunits, and consequently, increased production of HbF. Each of these three guides have same direct repeat sequence (UGAAUUUCUACUGUUGUAGAU) but have different spacer length for unique DNA targets. In every guide, first two and last two phosphates have been converted to phosphorothioate. According to MOE, position 3 may not be suitable for phosphorothioate modification (FIG.26 and 27) and hence kept unmodified. For this work, it was decided to work with 405-1 gRNA which has UG dinucleotide added before Cas12 guide sequence. For this work, these two nucleotides are assigned with -2 and -1 number. Following nucleotide sequence is identical with Cas12a gRNA direct repeat (AAUUUCUA….) and they are assigned with 1, 2, 3….as nucleotide identification number.

[0057] FIG.26 shows the permissible sites to be modified based on detecting the strength of phosphate interactions for FnCas12a / guide complexes.

[0058] FIG.27 shows the permissible sites to be modified based on detecting the strength of phosphate interactions for Cas12a / guide complexes.

[0059] FIG.28 shows a summary of modified guides tested in vitro in Example 17. The modified guides Mod1, Mod4, Mod5, Mod6, and Mod7 were tested in accordance with the methodology depicted in FIG.29.

[0060] FIG.29 shows Methodology for testing modified guide RNAs as detailed in Example 17.

[0061] FIG.30 shows results showing high editing rates in primary HSCs at a clinically relevant locus (up to 77% editing at hB2M locus) as outlined in Example 17.

[0062] FIG.31 is a schematic showing an RNP complex (based on Cas9) wherein the nuclease component comprises an NLS (PKKKRKV). The complex forms in the nuclease and relocates to the nuclease as facilitated by the NLS.

[0063] FIG.32 depicts the concept of a PNA-NLS probe to couple an NLS directly to a guide RNA. Here, the exemplary PNA is 9 residues in length which is joined through an optional linker to one or more NLS.

[0064] FIG.33 depicts the concept of a PNA-NLS probe to couple an NLS directly to a guide RNA at an additional sequence element added to the guide RNA referred to as the PNA binder element. This may be configured at either end of the guide RNA. Here, the exemplary PNA is 9 residues in length which is joined through an optional linker to one or more NLS.

[0065] FIG.34A shows an exemplary guide RNA targeting TTR gene and having the sequence from 5’ to 3’ of (SEQ ID NO: 751), wherein the bolded sequence hybridizes to the PNA having the nucleic acid sequence AGCCACGAAAA (SEQ ID NO: 753) fused to the NLS peptide PKKKRKV.

[0066] FIG.34B shows an exemplary guide RNA targeting TTR gene and having the sequence from 5’ to 3’ of (SEQ ID NO: 751), wherein the bolded sequence hybridizes to the PNA having the nucleic acid sequence CCACGAAAA fused to the NLS peptide PKKKRKV.

[0067] FIG.34C shows an exemplary guide RNA targeting any gene and having the sequence from 5’ to 3’ of (SEQ ID NO: 752), wherein the bolded sequence hybridizes to the PNA having the nucleic acid sequence AGCCACGAAAA (SEQ ID NO: 753) fused to the NLS peptide PKKKRKV, where in “N” designates any nucleotide and will depend upon the target sequence being targeted by the guide RNA.

[0068] FIG.35 is a graph of % indel formation by 405-1 nuclease with various modified gRNAs in a human HSPC donor. These results show that RNA extensions and DNA extensions can improve editing at the HBG locus 3-10 fold in an all RNA format relative to the mod6 benchmark using the 405-1 nuclease.

[0069] FIG.36 is a graph of % indel formation by 405-1 nuclease with various modified gRNAs in a human HSPC donor. These results show that RNA extensions and DNA extensions do not improve editing at the B2M locus in an all RNA format relative to the mod6 benchmark using the 405-1 nuclease.

[0070] FIG.37 shows a graph of % indel formation by 405-1 nuclease with various modified gRNAs in a human HSPC donor at the HBG locus. These results show that RNA and DNA extensions are not compatible with the Type V mod6 schema but guides modified with mod7 schema can tolerate RNA extensions.

[0071] FIG.38 is modification 6 schema. This figure outlines the positions of 2’-OMe modifications and phosphothiorate modifications in gRNAs with the modification 6 schema. Light grey and uppercase letters = Unmodifed; Dark grey and lowercase letters = modified with phosphothiorate (or in the alternative, indicated below with a post-nt asterisk); White and lowercase letters = modified with 2’-Ome.The sequences of FIG.38 are: • gRNA0260: u*g*AAUuuCUacUguuGuagaUcCUUGUCaagGcUAUUGGU*c*a (SEQ ID NO: 680) (aka “mod 6” guide), wherein A, G, U, C = unmodified RNA nucleotide; a, g, u, c = 2'-O- Methyl-nucleotide; * = Phosphorothioate linkage • gRNA0390: u*g*AAUuuCUacUguuGuaGAucCUUGUCaaggcuAUUGGu*c*a (SEQ ID NO: 681), wherein A, G, U, C = unmodified RNA nucleotide; a, g, u, c = 2'-O-Methyl-nucleotide; * = Phosphorothioate linkage • gRNA0391: u*g*AAUUuCUacUguuGuaGAUcCUUGUCaaggCUAUUGGu*c*a (SEQ ID NO: 682), wherein A, G, U, C = unmodified RNA nucleotide; a, g, u, c = 2'-O-Methyl-nucleotide; * = Phosphorothioate linkage • gRNA0392: u*g*AAUUuCUacUguuGUAGAUcCUUGUCaagGCUAUUGGu*c*a (SEQ ID NO: 683), wherein A, G, U, C = unmodified RNA nucleotide; a, g, u, c = 2'-O-Methyl-nucleotide; * = Phosphorothioate linkage

[0072] FIG.39 shows a graph of % indel formation by 405-1 nuclease with various modified gRNAs in a human HSPC donor at the HBG locus. These results show that decreasing the proportion of modification in a gRNA can increase editing 4-5 fold in vitro in CD34+ human HSPCs.

[0073] FIG.40 shows a graph of % indel formation at the HBG locus in human CD34+ HSPCs by gRNAs with 3’ extensions that create a hairpin with the spacer region of the gRNA. The results show 3’ extensions creating hairpins with a type V spacer (backfolds) increased editing above the mod6 benchmark gRNA at the HBG locus in human HSPCs. gRNA0260 is “mod6” having the sequence and modification scheme of u*g*AAUuuCUacUguuGuagaUcCUUGUCaagGcUAUUGGU*c*a (SEQ ID NO: 680) (aka “mod 6” guide), wherein A, G, U, C = unmodified RNA nucleotide; a, g, u, c = 2'- O-Methyl-nucleotide; * = Phosphorothioate linkage.

[0074] FIG.41 shows a graph of % indel formation by 405-1 with modified gRNAs across three different human HSPC donors at the HBG locus. The results showed that the effect of modified gRNAs on indel formation is consistent across HSPC donors using 405-13x NLS nuclease. For each cluster of graphs, the samples appear in the same ordering of (a) Donor 310, (b) Donor 309, and (c) Donor 308..

[0075] FIG.42 shows a graph of % indel formation at the HBG locus by modified gRNAs across 405-1 protein variants in human hematopoietic stem cells. The results show that the addition of the point mutant K292R and a 3X NLS increased indel formation across all modified gRNAs tested. gRNAs containing a 5’ DNA extension of a 15bp randomized sequence improved indel formation by up to ~8 fold. Other modified gRNAs tested show more modest increases in indel formation. For each cluster of graphs, the samples appear in the same ordering of (a) 405-1, (b) 405-13x NLS, (c) 4051- E1014R + 3xNLS, and (d) 405-1 K292R + 3xNLS.

[0076] FIG.43 comprises two panels: (A) A schematic representation of luciferase mRNA with miRNA target sites (ts) inserted in the 3’ UTR. Luciferase mRNA consists of 5’ cap, 5’UTR, luciferase coding sequence, 3’ UTR followed by a poly A tail. A single copy (x1) or three copies (x3) of miRNA ts were inserted at the 3’ end of the 3’ UTR. An alternative (alt) insertion site is located at the 5’ end of the 3’ UTR, near the luciferase coding sequence. When combining two miRNA target sites in the same UTR, the first miRNA target site is inserted at the ‘alt’ location, and the second miRNA target site is inserted at the 3’ end of the UTR. (B) Incorporation of miR-122 ts into the 3’ UTR of luciferase mRNA results in the suppression of encoded protein in the Huh7 hepatocyte cell line, where miR-122 is expressed. A single copy of the target site at the end of 3’ UTR near the poly A tail is sufficient to suppress luciferase expression by 5-fold compared to the control. Increasing the number of copies to three does not further enhance suppression. However, when the target site is inserted at the 5’ end of the UTR, near the coding sequence, suppression is enhanced to 10-fold. In contrast, insertion of the target site of miR-142, which is not expressed in hepatocyte cell line, has no impact on luciferase expression by itself and does not influence miR-122 mediated suppression when both target sites are inserted together on the same UTR.

[0077] FIG.44 comprises two panels: (A) A schematic structure of luciferase mRNA with miRNA target sites (ts) inserted in the 3’ UTR. Luciferase mRNA consists of 5’ cap, 5’UTR, luciferase coding sequence, 3’ UTR followed by poly A tail. In this structure, three copies of miRNA target site are inserted at the 5’ end of 3’ UTR, near luciferase coding sequence. When combining two miRNA target sites in the same UTR, the first miRNA target site is inserted near the luciferase coding sequence, and the second miRNA target site is inserted at the 3’ end of UTR. (B) Cell type-specific suppression of luciferase expression was achieved by incorporating appropriate miRNA ts in the 3’ UTR. miR-122 ts inserted in the 3’ UTR of luciferase mRNA led to the suppression of protein expression in a hepatocyte cell line, where miR-122 is expressed (left), while no suppression was observed in a monocyte cell line, where miR-122 is not expressed (right). Similarly, miR-142 ts suppressed luciferase expression exclusively in the monocyte cell line, where miR-142 is expressed. Insertion of miR-122 and miR-142 target sites in the same UTR inhibits luciferase expression in both hepatocyte and monocyte cell line.

[0078] FIG.45 shows the miRNAs in Table 1 of Example 22 were evaluated for their target-site mediated suppression in various immune cell lines and CD34+CD38-CD90+CD45RA-Lin- long-termhematopoietic stem cells. While the insertion of liver specific miR-122 or epithelial specific miR- 200b, 200c, 203a and 205 target sites in the 3’ UTR of cargo does not affect its expression in immune cells, hematopoietic miRNAs suppress cargo expression in one or more cell types. miR-142 and let7e effectively suppress cargo expression in all cell lines. miR-223 exhibits mild activity in all cell lines, with the least effect observed in long-term hematopoietic cells. miR-155 demonstrates suppression in the monocyte cell line and in long-term hematopoietic cells, albeit weaker in the latter. miR-342 suppresses expression in both monocyte and T-cell lines. Both miR-1265p and 3p, which are abundantly expressed in endothelial cells, show a substantial suppressive effect in long-term hematopoietic stem cells. DETAILED DESCRIPTION I. Introduction

[0079] Described herein are LNP compositions comprising gene editing systems for use in treating disease (e.g., a hemoglobinopathy) and / or otherwise modifying the sequence and / or expression of target nucleotide sequences, such as a hemoglobin gene or regulatory region thereof. The disclosure provides LNPs capable of delivering a gene editing system to red blood cell precursor cells, including but not limited to hematopoietic stem cells (HSCs). The gene editing systems of the present disclosure are preferably delivered to a patient under in vivo conditions (e.g., administered to a subject in an effective amount).

[0080] The disclosure also provides in various aspects therapeutic or pharmaceutical compositions comprising LNPs comprising gene editing systems or one or more components thereof for use in treating disease (e.g., a beta-hemoglobinopathy) and / or otherwise modifying the sequence and / or expression of target nucleotide sequences. The gene editing systems may comprise DNA components, RNA components, protein components, nucleoprotein components, or combinations thereof. In other aspects, the disclosure provides nucleic acid molecules that encode various componentry of the deliverable gene editing systems contemplated herein. In addition, other aspects of the disclosure provide nucleic acid molecules as components of the herein contemplated gene editing systems, such as, but not limited to plasmids or vectors encoding one or more components of a gene editing system, RNAs encoding one or more components of a gene editing system (e.g., mRNAs coding for a nuclease domain of a gene editing system), and non-coding RNAs (e.g., guide RNAs capable of complexing with and targeting a nucleic acid-programmable DNA binding domain to a specific target nucleotide sequence or a retron ncRNA). The disclosure in other aspects provides for the various protein components of the various gene editing systems contemplated herein, including, but not limited to, user-programmable DNA binding proteins and various effector proteins, such as nucleases, polymerases, reverse transcriptases, recombinases, integrases, endonucleases, exonucleases, transposases, and deaminases. The disclosure also describes nucleoprotein components of the gene editing systems contemplated herein, such as, but not limited to a nuclease-guide RNA complexes. The disclosure also provides methods of modifying the sequence and / or expression levelof a target nucleic acid molecule through the delivery and / or administration of an LNP described herein that comprises a gene editing system or components thereof. Still further, the disclosure provides methods of treating a disease by administering a therapeutically effective amount of an LNP- based gene editing system that results in the modification in the sequence and / or expression level of a target nucleic acid molecule (e.g., a disease-associated gene).

[0081] The LNP compositions and / or gene editing systems described herein may include a variety of coding RNA molecules that code for the various components of gene editors. In various aspects, the coding RNA may be linear mRNA. In other embodiments, the coding RNA may be circular mRNA. In various aspects, the improved LNPs protect linear and / or circular mRNA cargos from degradation and clearance while achieving targeted systemic or local delivery for use as enhanced gene editing platforms and / or therapeutic agents.

[0082] In various other aspects, the LNP compositions and / or gene editing systems described herein may also include a repair template, e.g., an HDR donor single or double stranded DNA.

[0083] Accordingly, the instant specification describes compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based gene editing systems as therapeutic compositions for the treatment of hemoglobinopathies. Further described herein are compositions, methods, processes, kits and devices for the selection, design, preparation, manufacture, formulation, and / or use of LNP-based gene editing therapeutics for the prophylactic and / or therapeutic treatment of one or more diseases or a symptom thereof. The components capable of being encapsulated by or otherwise incorporated by the LNPs described herein may be referred to as LNP “payloads” and may include all of the biological materials described above, including DNA molecules, RNA molecules (coding and / or non-coding), proteins, and nucleoproteins (e.g., Cas / guide RNA complexes).

[0084] In certain embodiments, the LNP compositions selectively and effectively deliver the gene editing payloads to specific cell types that allow for the hemoglobinopathies to be treated. In certain embodiments, the LNPs of the present disclosure deliver to red blood cell progenitor cells. In certain embodiments, the LNPs of the present disclosure deliver to hematopoietic stem cells. II. LNP delivery systems

[0085] The payloads (e.g., linear and circular mRNAs; nucleobase editing systems and / or components thereof) described herein may be encapsulated and delivered by lipid nanoparticles (LNPs) and compositions and / or formulations comprising RNA-encapsulated LNPs.

[0086] Below describes LNPs that may be used as the payload delivery vehicles contemplated herein, as well as the various ionizable lipids, structural lipids, PEGylated lipids, and phospholipids that may be used to make the herein LNPs for delivery payloads to cells. In addition, below describes additional LNP components that are contemplated, such as targeting moieties and other lipid components.A. Lipid Nanoparticle Compositions

[0087] In one aspect, the present disclosure further provides delivery systems for delivery of a therapeutic payload (e.g., the RNA payloads described herein which may encode a polypeptide of interest, e.g., a nucleobase editing system or a therapeutic protein) disclosed herein. In some embodiments, a delivery system suitable for delivery of the therapeutic payload disclosed herein comprises a lipid nanoparticle (LNP) formulation.

[0088] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid, a structural lipid, a PEGylated lipid (aka PEG lipid), and a phospholipid. In alternative embodiments, an LNP comprises an ionizable lipid, a structural lipid, a PEGylated lipid (aka PEG lipid), and a zwitterionic amino acid lipid. In some embodiments, an LNP further comprises a 5th lipid, besides any of the aforementioned lipid components. In some embodiments, the LNP encapsulates one or more elements of the active agent of the present disclosure. In some embodiments, an LNP further comprises a targeting moiety covalently or non-covalently bound to the outer surface of the LNP. In some embodiments, the targeting moiety is a targeting moiety that binds to, or otherwise facilitates uptake by, cells of a particular organ system.

[0089] In some embodiments, an LNP has a diameter of at least about 20nm, 30 nm, 40nm, 50nm, 60nm, 70nm, 80nm, or 90nm. In some embodiments, an LNP has a diameter of less than about 100nm, 110nm, 120nm, 130nm, 140nm, 150nm, or 160nm. In some embodiments, an LNP has a diameter of less than about 100nm. In some embodiments, an LNP has a diameter of less than about 90nm. In some embodiments, an LNP has a diameter of less than about 80nm. In some embodiments, an LNP has a diameter of about 60-100nm. In some embodiments, an LNP has a diameter of about 75-80nm.

[0090] In some embodiments, the lipid nanoparticle compositions of the present disclosure are described according to the respective molar ratios of the component lipids in the formulation. In some embodiments, the mol-% of the ionizable lipid is from about 10 mol-% to about 80 mol-%. In some embodiments, the mol-% of the ionizable lipid is from about 20 mol-% to about 70 mol-%. In some embodiments, the mol-% of the ionizable lipid is from about 30 mol-% to about 60 mol-%. In some embodiments, the mol-% of the ionizable lipid is from about 35 mol-% to about 55 mol-%. In some embodiments, the mol-% of the ionizable lipid is from about 40 mol-% to about 50 mol-%.

[0091] In some embodiments, the mol-% of the phospholipid is from about 1 mol-% to about 50 mol- %. In some embodiments, the mol-% of the phospholipid is from about 2 mol-% to about 45 mol-%. In some embodiments, the mol-% of the phospholipid is from about 3 mol-% to about 40 mol-%. In some embodiments, the mol-% of the phospholipid is from about 4 mol-% to about 35 mol-%. In some embodiments, the mol-% of the phospholipid is from about 5 mol-% to about 30 mol-%. In some embodiments, the mol-% of the phospholipid is from about 10 mol-% to about 20 mol-%. In some embodiments, the mol-% of the phospholipid is from about 5 mol-% to about 20 mol-%. In some embodiments, the mol-% of the phospholipid is from about 20 mol-% to about 60 mol-%. Insome embodiments, the mol-% of the phospholipid is from about 30 mol-% to about 50 mol-%. In some embodiments, the mol-% of the phospholipid is from about 35 mol-% to about 45 mol-%. In some embodiments, the LNP comprises a mixture of two or more phospholipids that cumulatively account for any of the aforementioned mol-%.

[0092] In some embodiments, the mol-% of the structural lipid is from about 10 mol-% to about 80 mol-%. In some embodiments, the mol-% of the structural lipid is from about 20 mol-% to about 70 mol-%. In some embodiments, the mol-% of the structural lipid is from about 30 mol-% to about 60 mol-%. In some embodiments, the mol-% of the structural lipid is from about 35 mol-% to about 55 mol-%. In some embodiments, the mol-% of the structural lipid is from about 40 mol-% to about 50 mol-%.

[0093] In some embodiments, the mol-% of the PEG lipid is from about 0.1 mol-% to about 10 mol- %. In some embodiments, the mol-% of the PEG lipid is from about 0.2 mol-% to about 5 mol-%. In some embodiments, the mol-% of the PEG lipid is from about 0.5 mol-% to about 3 mol-%. In some embodiments, the mol-% of the PEG lipid is from about 1 mol-% to about 2 mol-%. In some embodiments, the mol-% of the PEG lipid is from about 2 mol-% to about 5 mol-%. In some embodiments, the mol-% of the PEG lipid is from about 2 mol-% to about 3 mol-%. In some embodiments, the mol-% of the PEG lipid is about 1.5 mol-%. In some embodiments, the mol-% of the PEG lipid is about 2 mol-%. In some embodiments, the mol-% of the PEG lipid is about 2.5 mol- %. In some embodiments, the mol-% of the PEG lipid is about 3 mol-%. In some embodiments, the mol-% of the PEG lipid is about 3.5 mol-%. i. Ionizable lipids

[0094] In some embodiments, an LNP disclosed herein comprises an ionizable lipid. In some embodiments, an LNP comprises two or more ionizable lipids.

[0095] Described below are a number of exemplary ionizable lipids of the present disclosure.

[0096] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in one of US 2023 / 0053437; US 2019 / 0240354; US 2010 / 0130588; US 2021 / 0087135; WO 2021 / 204179; US 2021 / 0128488; US 2020 / 0121809; US 2017 / 0119904; US 2013 / 0108685; US 2013 / 0195920; US 2015 / 0005363; US 2014 / 0308304; US 2013 / 0053572; WO 2019 / 232095A1; WO 2021 / 077067; WO 2019 / 152557; US 2017 / 0210697; or WO 2019 / 089828A1, each of which is incorporated by reference herein in their entirety.

[0097] In some embodiments, an LNP described herein comprises a lipid, e.g., an ionizable lipid, disclosed in US Application publication US2017 / 0119904, which is incorporated by reference herein, in its entirety.

[0098] In some embodiments, an LNP described herein comprises a lipid, e.g., an ionizable lipid, disclosed in PCT Application publication WO2021 / 204179, which is incorporated by reference herein, in its entirety.

[0099] In some embodiments, an LNP described herein comprises a lipid, e.g., an ionizable lipid, disclosed in PCT Application WO2022 / 251665A1, which is incorporated by reference herein, in its entirety.

[0100] In some embodiments, an LNP described herein comprises an ionizable lipid of Table Z: Table Z – Exemplary Ionizable Lipids

[0101] In some embodiments, the ionizable lipid is MC3. Series “A”

[0102] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Application Publication WO2023044343A1, which is incorporated by reference herein, in its entirety. Formula (VII-A)

[0103] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (VII-A):or a pharmaceutically acceptable salt thereof, wherein: ,X1is optionally substituted C2-C6alkylenyl; R1is -OH, -R1a,Z1is optionally substituted C1-C6 alkyl; Z1ais hydrogen or optionally substituted C1-C6 alkyl; X2and X2aare independently optionally substituted C2-C14 alkylenyl or optionally substituted C2-C14 alkenylenyl; X3is optionally substituted C2-C14alkylenyl or optionally substituted C2-C14alkenylenyl; (i) Y1iswherein the bond marked with an "*" is attached to X2; Y1aiswherein the bond marked with an "*" is attached to X2a; each Z2is independently H or optionally substituted C1-C8alkyl; each Z3is indpendently optionally substituted C1-C6alkylenyl; Q1is -NR2R3, -CH(OR2)(OR3), -CR2=C(R3)(R12), or -C(R2)(R3)(R12); Q1ais -NR2'R3', -CH(OR2')(OR3'), -CR2=C(R3)(R12), or -C(R2')(R3')(R12'); or (ii) Y1iswherein the bond marked with an "*" is attached to X2; Y1aiswherein the bond marked with an "*" is attached to X2a; each Z2is independently H or optionally substituted C1-C8alkyl; each Z3is independently optionally substituted C1-C6 alkylenyl; Q1is -NR2R3; Q1ais -NR2'R3'; R2, R3, and R12are independently hydrogen, optionally substituted C1-C14alkyl, optionally substituted C2-C14alkenylenyl, or -(CH2)m-G-(CH2)nH; R2', R3', and R12'are independently hydrogen, optionally substituted C1-C14alkyl, optionally substituted C2-C14 alkenylenyl, or -(CH2)m-G-(CH2)nH; G is a C3-C8 cycloalkylenyl; each m is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12; each n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12; X3is optionally substituted C2-C14alkylenyl; R4is optionally substituted C4-C14alkyl; L1is C1-C8alkylenyl; R6is C1-C6 alkyl, (hydroxy)C1-C6 alkyl, or (amino)C1-C6 alkyl R7ais -C(=O)N(R'")R7b, -C(=S)N(R'")R7b, -N=C(R7b)(R7c), oralkyl, (hydroxy)C1-C6 alkyl, or (amino)C1-C6 alkyl; R7cis hydrogen or C1-C6 alkyl; R8ais -C(=O)N(R'")R8b, -C(=S)N(R'")R8b, -N=C(R8b)(R8c), or, R8bis C1-C6alkyl, (hydroxy)C1-C6alkyl, or (amino)C1-C6alkyl; R8cis hydrogen or C1-C6 alkyl; R9ais -N=C(R9b)(R9c); R9bis C1-C6 alkyl, (hydroxy)C1-C6 alkyl, or (amino)C1-C6 alkyl;R9cis hydrogen or C1-C6alkyl; R10ais -N=C(R10b)(R10c); R10bis C1-C6 alkyl, (hydroxy)C1-C6 alkyl, or (amino)C1-C6 alkyl; R10cis hydrogen or C1-C6 alkyl; R11ais -OR11b, -N(R")R11b, -OC(=O)R11b, or -N(R")C(=O)R11b; R11bis C1-C6alkyl, (hydroxy)C1-C6alkyl, or (amino)C1-C6alkyl; R' is hydrogen or C1-C6alkyl; R" is hydrogen or C1-C6alkyl; and R'" is hydrogen or C1-C6 alkyl. Formula (VIII-A)

[0104] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (VII-A), wherein the ionizable lipids of the present disclosure have a structure of Formula (VIII-A):or a pharmaceutically acceptable salt thereof. Formula (X)

[0105] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X):or a pharmaceutically acceptable salt thereof, wherein each cc is independently selected from 3 to 9; Rxxis selected from hydrogen and optionally substituted C1-C6 alkyl; and (i) ee is 1, each dd is independently selected from 1 to 4; and each Rwwis independently selected from the group consisting of C4-C14alkyl, branched C4- C12alkenyl, C4-C12alkenyl comprising at least two double bonds, and C9-C12alkenyl, wherein any – (CH2)2- of the C4-C14alkyl can be optionally replaced with C2-C6cycloalkylenyl; (ii) ee is 0, each dd is 1; and each Rwwis linear C4-C12 alkyl.

[0106] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein Rxxis H. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein Rxxis optionally substituted C1-C6 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein Rxxis C1 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein Rxxis C2alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein Rxxis C3alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein Rxxis C4alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein Rxxis C5 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein Rxxis C6 alkyl.

[0107] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis independently selected from the group consisting of C4-C14alkyl, branched C4-C12alkenyl, C4-C12alkenyl comprising at least two double bonds, and C9-C12alkenyl, wherein any –(CH2)2- of the C4-C14alkyl can be optionally replaced with C2-C6cycloalkylenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C4-C14 alkyl, wherein any –(CH2)2- of the C4-C14 alkyl can be optionally replaced with C2-C6 cycloalkylenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C4-C14alkyl, wherein any –(CH2)2- of the C4-C14alkyl can be optionally replaced with cyclopropylene. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis branched C4-C12alkenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C4-C12 alkenyl comprising at least two double bonds. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C9-C12 alkenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis linear C4-C12alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis independently selected from the group consisting of C6- C14alkyl, branched C8-C12alkenyl, C8-C12alkenyl comprising at least two double bonds, and C9-C12alkenyl, wherein any –(CH2)2- of the C6-C14 alkyl can be optionally replaced with cyclopropylene. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C6-C14 alkyl, wherein any –(CH2)2- of the C6-C14 alkyl can be optionally replaced with cyclopropylene. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis branched C8-C12alkenyl, e.g., (linear or branched C3-C5alkylenyl)-(branched C5-C7alkenyl), e.g., (branched C5alkylenyl)-(branched C5alkenyl), e.g.,.

[0108] . In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C8-C12alkenyl comprising at least two double bonds. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C9-C12 alkenyl.

[0109] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis independently selected from the group consisting of C6-C14alkyl (e.g., C6, C8, C9, C10, C11, C13alkyl), wherein any –(CH2)2- of the C6-C14alkyl can be optionally replaced with cyclopropylene.

[0110] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis independently branched C8-C12 alkenyl (e.g., branched C10 alkenyl).

[0111] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis independently C8-C12 alkenyl comprising at least two double bonds (e.g., C9 or C10alkenyl comprising two double bonds).

[0112] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis independently (C1alkylenyl)-(cyclopropylene-C6alkyl) or (C2alkylenyl)- (cyclopropylene-C2 alkyl). In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis independently (C1 alkylenyl)-(cyclopropylene-C6 alkyl). In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis independently (C2alkylenyl)-(cyclopropylene-C2alkyl).

[0113] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C4alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C5alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C6 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C7 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C8alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C9alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C10alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C11 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C12 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C13 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C14alkyl.

[0114] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C9 alkenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C10 alkenyl. In some embodiments, ionizablelipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C11alkenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C12 alkenyl.

[0115] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C8 alkenyl comprising at least two double bonds. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C9alkenyl comprising at least two double bonds. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C10alkenyl comprising at least two double bonds. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C11 alkenyl comprising at least two double bonds. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C12 alkenyl comprising at least two double bonds. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C13alkenyl comprising at least two double bonds. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C14alkenyl comprising at least two double bonds.

[0116] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C9 alkyl, wherein one –(CH2)2- of the C9 alkyl is replaced with C2-C6 cycloalkylenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C9alkyl, wherein one –(CH2)2- of the C9alkyl is replaced with cyclopropylene. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C9alkyl, wherein two –(CH2)2- of the C9alkyl are replaced with C2-C6cycloalkylenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis C9 alkyl, wherein two –(CH2)2- of the C9 alkyl are replaced with cyclopropylene.

[0117] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis linear C4alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis linear C5alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis linear C6 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis linear C7 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis linear C8 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis linear C9alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis linear C10alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis linear C11alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis linear C12 alkyl. In some embodiments, ionizable lipids of the present disclosurehave a structure of Formula (X), wherein each Rwwis linear C13alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis linear C14 alkyl.

[0118] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis branched C8 alkenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis branched C9alkenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis branched C10alkenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis branched C11 alkenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each Rwwis branched C12 alkenyl.

[0119] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each cc is independently selected from 3 to 7. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each cc is 3. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each cc is 4. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each cc is 5. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each cc is 6. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each cc is 7. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each cc is 8. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each cc is 9.

[0120] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each dd is independently selected from 1 to 4. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each dd is 1. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each dd is 2. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each dd is 3. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein each dd is 4.

[0121] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein ee is 1.

[0122] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein ee is 0. Formula (X-A)

[0123] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X), wherein the ionizable lipids of the present disclosure have a structure of Formula (X-A):or a pharmaceutically acceptable salt thereof, wherein each cc is independently selected from 3 to 7; each dd is independently selected from 1 to 4; Rxxis selected from hydrogen and optionally substituted C1-C6 alkyl; and each Rwwis independently selected from the group consisting of C4-C14 alkyl or (linear or branched C3-C5alkylenyl)-(branched C5-C7alkenyl).

[0124] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein Rxxis hydrogen. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein Rxxis C1 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein Rxxis C2 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein Rxxis C3 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein Rxxis C4alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein Rxxis C5alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein Rxxis C6alkyl.

[0125] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each cc is 4, 5, 6, or 7. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each cc is 3. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each cc is 4. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each cc is 5. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each cc is 6. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each cc is 7.

[0126] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each dd is 1 or 3. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each dd is 1. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each dd is 2. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each dd is 3. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each dd is 4.

[0127] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each Rwwis C4-C14alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each Rwwis C4 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each Rwwis C5 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X- A), wherein each Rwwis C6alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each Rwwis C7alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each Rwwis C8alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each Rwwis C9 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each Rwwis C10 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each Rwwis C11 alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each Rwwis C12alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each Rwwis C13alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each Rwwis C14 alkyl.

[0128] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (X-A), wherein each Rwwis (linear or branched C3-C5 alkylenyl)-(branched C5-C7alkenyl), e.g., (branched C5alkylenyl)-(branched C5alkenyl), e.g.,.

[0129] In some embodiments, ionizable lipids of the present disclosure comprise an acyclic core. In some embodiments, ionizable lipids of the present disclosure are selected from any lipid in Table (I) below or a pharmaceutically acceptable salt thereof: Table (I). Non-Limiting Examples of Ionizable Lipids with an Acyclic CoreSeries “CY”

[0130] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Application Publication WO2023044333A1, which is incorporated by reference herein, in its entirety. Formula (CY)

[0131] In some embodiments, an LNP disclosed herein comprises an ionizable lipid of Formula (CY)(CY), or a pharmaceutically acceptable salt thereof, wherein: R1is selected from the group consisting of -OH, -OAc, R1a,Z1is optionally substituted C1-C6alkyl; X1is optionally substituted C2-C6alkylenyl; X2is selected from the group consisting of a bond, -CH2- and -CH2CH2-; X2’is selected from the group consisting of a bond, -CH2- and -CH2CH2-; X3is selected from the group consisting of a bond, -CH2- and -CH2CH2-; X3’is selected from the group consisting of a bond, -CH2- and -CH2CH2-; X4and X5are independently optionally substituted C2-C14alkylenyl or optionally substituted C2-C14alkenylenyl; Y1and Y2are independently selected from the group consisting ofwherein the bond marked with an "*" is attached to X4or X5; each Z2is independently H or optionally substituted C1-C8alkyl; each Z3is indpendently optionally substituted C1-C6alkylenyl; R2is selected from the group consisting of optionally substituted C4-C20 alkyl, optionally substituted C2-C14 alkenyl, and –(CH2)pCH(OR6)(OR7); R3is selected from the group consisting of optionally substituted C4-C20 alkyl, optionally substituted C2-C14alkenyl, or (CH2)qCH(OR8)(OR9); R1ais:R2a, R2b, and R2care independently hydrogen and C1-C6alkyl; R3a, R3b, and R3care independently hydrogen and C1-C6 alkyl; R4a, R4b, and R4care independently hydrogen and C1-C6 alkyl; R5a, R5b, and R5care independently hydrogen and C1-C6 alkyl; R6, R7, R8, and R9are independently optionally substituted C1-C14alkyl, optionally substituted C2-C14alkenyl, or -(CH2)m-A-(CH2)nH; each A is independently a C3-C8cycloalkylenyl; each m is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12; each n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12; p is selected from the group consisting of 0, 1, 2, 3, 4, 5, 6, and 7; and q is selected from the group consisting of 0, 1, 2, 3, 4, 5, 6, and 7. Formulas (CY-I), (CY-II), (CY-III), (CY-IV), (CY-V), (CY-VI), (CY-VII), (CY-VIII), (CY-IX), (CY-IV-a), (CY-IV-b), (CY-IV-c), (CY-IV-d), (CY-IV-e), and (CY-IV-f)

[0132] In some embodiments, the present disclosure comprises a compound of any of the below Formulae:(CY-IV-a) (CY-IV-b) (CY-IV-c) Formula (CY-IV’)

[0133] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYIV’):or a pharmaceutically acceptable salt thereof, wherein R1, R2, R3, X1, X2, X3, X4, X5, Y1, and Y2are as defined in connection with Formula (CY-I’). Formula (CY-VI’)

[0134] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’):or a pharmaceutically acceptable salt thereof, wherein R1, R6, R7, R8, R9, X1, X2, X3, X4, X5, Y1, and Y2are as defined in connection with Formula (CY-I’).

[0135] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein R1is -OH.

[0136] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein X1is C2-C6alkylenyl.

[0137] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein X2is -CH2CH2-.

[0138] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein X4is C2-C6alkylenyl.

[0139] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein X5is C2-C6 alkylenyl.

[0140] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein Y1is:.

[0141] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein Y2is:

[0142] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein each Z3is independently optionally substituted C1-C6 alkylenyl.

[0143] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein each Z3is CH2CH2.

[0144] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein R6is C5-C14 alkyl.

[0145] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein R7is C5-C14 alkyl.

[0146] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein R6is C6-C14alkenyl.

[0147] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein R7is C6-C14alkenyl.

[0148] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein R8is C5-C16 alkyl.

[0149] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein R9is C5-C14alkyl.

[0150] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein R8is C6-C14alkenyl.

[0151] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (CYVI’), or a pharmaceutically acceptable salt thereof, wherein R9is C6-C14 alkenyl.

[0152] In some embodiments, ionizable lipids of the present disclosure comprise a heterocyclic core, wherein the heteroatom is nitrogen. In some embodiments, the heterocyclic core comprises pyrrolidine or a derivative thereof. In some embodiments, the heterocyclic core comprises piperidine or a derivative thereof.R1

[0153] In some embodiments, R1is selected from the group consisting of -OH, -OAc, R1a,and . In some embodiments, R1is -OH or -OAc. In some embodiments, R1is OH. In some emobodiments, R1is -OAc. In some embodiments, R1is R1a. In some embodiments, R1is imidazolyl. In some embodiments, R1is. R2

[0154] In some embodiments, R2is selected from the group consisting of optionally substituted C4- C20alkyl, optionally substituted C2-C14alkenyl, and –(CH2)pCH(OR6)(OR7).

[0155] In some embodiments, R2is optionally substituted C4-C20alkyl. In some embodiments, R2is optionally substituted C8-C17alkyl. In some embodiments, R2is optionally substituted C9-C16alkyl. In some embodiments, R2is optionally substituted C8-C10alkyl. In some embodiments, R2is optionally substituted C11-C13 alkyl. In some embodiments, R2is optionally substituted C14-C16 alkyl. In some embodiments, R2is optionally substituted C9 alkyl. In some embodiments, R2is optionally substituted C10 alkyl. In some embodiments, R2is optionally substituted C11 alkyl. In some embodiments, R2is optionally substituted C12alkyl. In some embodiments, R2is optionally substituted C13alkyl. In some embodiments, R2is optionally substituted C14alkyl. In some embodiments, R2is optionally substituted C15alkyl. In some embodiments, R2is optionally substituted C16alkyl.

[0156] In some embodiments, R2is optionally substituted C2-C14 alkenyl. In some embodiments, R2is optionally substituted C5-C14 alkenyl. In some embodiments, R2is optionally substituted C7-C14 alkenyl. In some embodiments, R2is optionally substituted C9-C14 alkenyl. In some embodiments, R2is optionally substituted C10-C14 alkenyl. In some embodiments, R2is optionally substituted C12-C14 alkenyl.

[0157] In some embodiments, R2is –(CH2)pCH(OR6)(OR7). In some embodiments, R2is – CH(OR6)(OR7). In some embodiments, R2is –CH2CH(OR6)(OR7). In some embodiments, R2is – (CH2)2CH(OR6)(OR7). In some embodiments, R2is –(CH2)3CH(OR6)(OR7). In some embodiments, R2is –(CH2)4CH(OR6)(OR7).

[0158] In some embodiments, R2is selected from the group consisting of

[0160] In some embodiments, R3is selected from the group consisting of optionally substituted C4- C20alkyl, optionally substituted C2-C14alkenyl, and –(CH2)qCH(OR6)(OR7).

[0161] In some embodiments, R3is optionally substituted C4-C20alkyl. In some embodiments, R3is optionally substituted C8-C17 alkyl. In some embodiments, R3is optionally substituted C9-C16 alkyl. In some embodiments, R3is optionally substituted C8-C10 alkyl. In some embodiments, R3is optionally substituted C11-C13 alkyl. In some embodiments, R3is optionally substituted C14-C16 alkyl. In some embodiments, R3is optionally substituted C9 alkyl. In some embodiments, R3is optionally substituted C10alkyl. In some embodiments, R3is optionally substituted C11alkyl. In some embodiments, R3is optionally substituted C12alkyl. In some embodiments, R3is optionally substituted C13alkyl. In some embodiments, R3is optionally substituted C14alkyl. In some embodiments, R3is optionally substituted C15 alkyl. In some embodiments, R3is optionally substituted C16 alkyl.

[0162] In some embodiments, R3is optionally substituted C2-C14 alkenyl. In some embodiments, R3is optionally substituted C5-C14 alkenyl. In some embodiments, R3is optionally substituted C7-C14 alkenyl. In some embodiments, R3is optionally substituted C9-C14alkenyl. In some embodiments, R3is optionally substituted C10-C14alkenyl. In some embodiments, R3is optionally substituted C12-C14alkenyl.

[0163] In some embodiments, R3is (CH2)qCH(OR8)(OR9). In some embodiments, R3is CH(OR8)(OR9). In some embodiments, R3is CH2CH(OR8)(OR9). In some embodiments, R3is (CH2)2CH(OR8)(OR9). In some embodiments, R3is (CH2)3CH(OR8)(OR9). In some embodiments, R3is (CH2)4CH(OR8)(OR9).

[0164] In some embodiments, R3is selected from the group consisting of.

[0165] In some embodiments, R6, R7, R8, and R9are independently optionally substituted C1-C14alkyl, optionally substituted C2-C14alkenyl, or -(CH2)m-A-(CH2)nH. In some embodiments, R6, R7, R8, and R9are independently optionally substituted C1-C14alkyl. In some embodiments, R6, R7, R8, and R9are independently optionally substituted C2-C14 alkenyl. In some embodiments, R6, R7, R8, and R9are independently -(CH2)m-A-(CH2)nH.

[0166] In some embodiments, R6is optionally substituted C1-C14 alkyl, optionally substituted C2-C14 alkenyl, or -(CH2)m-A-(CH2)nH. In some embodiments, R6is optionally substituted C3-C10 alkyl. In some embodiments, R6is optionally substituted C4-C10alkyl. In some embodiments, R6is independently optionally substituted C5-C10alkyl. In some embodiments, R6is optionally substituted C9-C10alkyl. In some embodiments, R6is optionally substituted C1-C14alkyl. In some embodiments, R6is optionally substituted C2-C14 alkenyl. In some embodiments, R6is –(CH2)m-A-(CH2)nH.

[0167] In some embodiments, R7is optionally substituted C1-C14 alkyl, optionally substituted C2-C14 alkenyl, or –(CH2)m-A-(CH2)nH. In some embodiments, R7is optionally substituted C3-C10 alkyl. In some embodiments, R7is optionally substituted C4-C10alkyl. In some embodiments, R7is optionally substituted C5-C10alkyl. In some embodiments, R7is optionally substituted C9-C10alkyl. In some embodiments, R7is optionally substituted C1-C14alkyl. In some embodiments, R7is optionally substituted optionally substituted C2-C14alkenyl. In some embodiments, R7is –(CH2)m-A-(CH2)nH.

[0168] In some embodiments, R8is optionally substituted C1-C14 alkyl, optionally substituted C2-C14 alkenyl, or –(CH2)m-A-(CH2)nH. In some embodiments, R8is optionally substituted C3-C10 alkyl. In some embodiments, R8is optionally substituted C4-C10 alkyl. In some embodiments, R8is optionally substituted C5-C10alkyl. In some embodiments, R8is optionally substituted C9-C10alkyl. In some embodiments, R8is optionally substituted C1-C14alkyl. In some embodiments, R8is optionally substituted C2-C14alkenyl. In some embodiments, R8is –(CH2)m-A-(CH2)nH.

[0169] In some embodiments, R9is optionally substituted C1-C14alkyl, optionally substituted C2-C14alkenyl, or –(CH2)m-A-(CH2)nH. In some embodiments, R9is optionally substituted C3-C10 alkyl. In some embodiments, R9is optionally substituted C4-C10 alkyl. In some embodiments, R9is optionally substituted C5-C10 alkyl. In some embodiments, R9is optionally substituted C9-C10 alkyl. In some embodiments, R9is optionally substituted C1-C14alkyl. In some embodiments, R9is optionally substituted C2-C14alkenyl. In some embodiments, R9is –(CH2)m-A-(CH2)nH.

[0170] In some embodiments, each m is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12. In some embodiments, each m is 0. In some embodiments, each m is 1. In some embodiments, each m is 2. In some embodiments, each m is 3. In some embodiments, each m is 4. In some embodiments, each m is 5. In some embodiments, each m is 6. In some embodiments, each m is 7. In some embodiments, each m is 8. In some embodiments, each m is 9. In some embodiments, each m is 10. In some embodiments, each m is 11. In some embodiments, each m is 12.

[0171] In some embodiments, each n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12. In some embodiments, each n is 0. In some embodiments, each n is 1. In some embodiments, each n is 2. In some embodiments, each n is 3. In some embodiments, each n is 4. In some embodiments, each n is 5. In some embodiments, each n is 6. In some embodiments, each n is 7. In some embodiments, each n is 8. In some embodiments, each n is 9. In some embodiments, each n is 10. In some embodiments, each n is 11. In some embodiments, each n is 12.

[0172] In some embodiments, each A is independently a C3-C8cycloalkylenyl. In some embodiments, each A is cyclopropylenyl. X1

[0173] In some embodiments, X1is optionally substituted C2-C6 alkylenyl. In some embodiments, X1is optionally substituted C2-C5 alkylenyl. In some embodiments, X1is optionally substituted C2-C4 alkylenyl. In some embodiments, X1is optionally substituted C2-C3 alkylenyl. In some embodiments, X1is optionally substituted C2alkylenyl. In some embodiments, X1is optionally substituted C3alkylenyl. In some embodiments, X1is optionally substituted C4alkylenyl. In some embodiments, X1is optionally substituted C5alkylenyl. In some embodiments, X1is optionally substituted C6alkylenyl. In some embodiments, X1is optionally substituted –(CH2)2-. In some embodiments, X1is optionally substituted –(CH2)3-. In some embodiments, X1is optionally substituted –(CH2)4-. In some embodiments, X1is optionally substituted –(CH2)5-. In some embodiments, X1is optionally substituted –(CH2)6-. X2

[0174] In some embodiments, X2is selected from the group consisting of a bond, -CH2- and - CH2CH2-. In some embodiments, X2is a bond. In some embodiments, X2is -CH2-. In some embodiments, X2is -CH2CH2-. X2’

[0175] In some embodiments, X2’is selected from the group consisting of a bond, -CH2- and - CH2CH2-. In some embodiments, X2’is a bond. In some embodiments, X2’is -CH2-. In some embodiments, X2’is -CH2CH2-. X3

[0176] In some embodiments, X3is selected from the group consisting of a bond, -CH2- and - CH2CH2-. In some embodiments, X3is a bond. In some embodiments, X3is -CH2-. In some embodiments, X3is -CH2CH2-.X3’

[0177] In some embodiments, X3’is selected from the group consisting of a bond, -CH2- and - CH2CH2-. In some embodiments, X3’is a bond. In some embodiments, X3’is -CH2-. In some embodiments, X3’is -CH2CH2-. X4

[0178] In some embodiments, X4is selected from the group consting of optionally substituted C2-C14alkylenyl and optionally substituted C2-C14alkenylenyl. In some embodiments, X4is optionally substituted C2-C14alkylenyl. In some embodiments, X4is optionally substituted C2-C10alkylenyl. In some embodiments, X4is optionally substituted C2-C8 alkylenyl. In some embodiments, X4is optionally substituted C2-C6 alkylenyl. In some embodiments, X4is optionally substituted C3-C6 alkylenyl. In some embodiments, X4is optionally substituted C3 alkylenyl. In some embodiments, X4is optionally substituted C4 alkylenyl. In some embodiments, X4is optionally substituted C5 alkylenyl. In some embodiments, X4is optionally substituted C6alkylenyl. In some embodiments, X4is optionally substituted –(CH2)2-. In some embodiments, X4is optionally substituted –(CH2)3-. In some embodiments, X4is optionally substituted –(CH2)4-. In some embodiments, X4is optionally substituted –(CH2)5-. In some embodiments, X4is optionally substituted –(CH2)6-. X5

[0179] In some embodiments, X5is selected from the group consting of optionally substituted C2-C14 alkylenyl and optionally substituted C2-C14alkenylenyl. In some embodiments, X5is optionally substituted C2-C14alkylenyl. In some embodiments, X5is optionally substituted C2-C10alkylenyl. In some embodiments, X5is optionally substituted C2-C8alkylenyl. In some embodiments, X5is optionally substituted C2-C6alkylenyl. In some embodiments, X5is optionally substituted C3-C6alkylenyl. In some embodiments, X5is optionally substituted C3 alkylenyl. In some embodiments, X5is optionally substituted C4 alkylenyl. In some embodiments, X5is optionally substituted C5 alkylenyl. In some embodiments, X5is optionally substituted C6 alkylenyl. In some embodiments, X5is optionally substituted –(CH2)2-. In some embodiments, X5is optionally substituted –(CH2)3-. In some embodiments, X5is optionally substituted –(CH2)4-. In some embodiments, X5is optionally substituted –(CH2)5-. In some embodiments, X5is optionally substituted –(CH2)6-. Y1

[0180] In some embodiments, Y1is selected from the group consisting of

[0181] In some embodiments, Y1isY2

[0182] In some embodiments, Y2is selected from the group consisting of

[0184] In some embodiments, Lipids of the Present Disclosure are selected from any lipid in Table (II) below or a pharmaceutically acceptable salt thereof: Table (II). Non-Limiting Examples of Ionizable Lipids with a Cyclic CoreStructure #Series “C”

[0185] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Publication WO2023122752A1, which is incorporated by reference herein, in its entirety.

[0186] In one embodiment, the disclosure provides a compound of Formula IA:or a pharmaceutically acceptable salt or solvate thereof, wherein: A is selected from the group consisting of -N(R1a)- and -C(R')-OC(=O)(R8a)-; R1ais -L1-R1; L1is C2-C6 alkylenyl or –(CH2)2-6-OC(=O)-; R1is selected from the group consisting of -OH,R2a, R2b, and R2care independently selected from the group consisting of hydrogen and C1-C6 alkyl; R3a, R3b, and R3care independently selected from the group consisting of hydrogen and C1-C6 alkyl; R4a, R4b, and R4care independently selected from the group consisting of hydrogen and C1-C6 alkyl; R5a, R5b, and R5care independently selected from the group consisting of hydrogen and C1-C6alkyl; R6a, R6b, and R6care independently selected from the group consisting of hydrogen and C1-C6alkyl; or R6aand R6btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; and R6cis selected from the group consisting of hydrogen and C1C6 alkyl; R7a, R7b, and R7care independently selected from the group consisting of hydrogen and C1-C6 alkyl; or R7aand R7btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; and R7cis selected from the group consisting of hydrogen and C1C6 alkyl; R' is selected from the group consisting of hydrogen and C1-C6alkyl; R8ais - L2-R8; L2is C2-C6alkylenyl;R9aand R9bare independently selected from the group consisting of hydrogen and C1-C6 alkyl; or R9aand R9btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; Q1is C1-C20alkylenyl; W1is selected from the group consisting of -C(=O)O-, -OC(=O)-, -C(=O)N(R12a)-, -N(R12a)C(=O)-, - OC(=O)N(R12a)-, - N(R12a)C(=O)O-, and -OC(=O)O-; R12ais selected from the group consisting of hydrogen and C1-C6 alkyl; X1is optionally substituted C1-C15 alkylenyl; or X1is a bond; Y1is selected from the group consisting of -(CH2)m-, -O-, -S-, and -S-S-; m is 0, 1, 2, 3, 4, 5, or 6; Z1is selected from the group consisting of optionally substituted C4-C12cycloalkylenyl,R10is selected from the group consisting of hydrogen, C1-C20 alkyl, and C2-C20 alkenyl; Q2is C1-C20 alkylenyl; W2is selected from the group consisting of -C(=O)O-, -C(=O)N(R12b)-, -OC(=O)N(R12b)-, and - OC(=O)O-; R12bis selected from the group consisting of hydrogen and C1-C6alkyl; X2is optionally substituted C1-C15 alkylenyl; or X2is a bond; Y2is selected from the group consisting of -(CH2)n-, -O-, -S-, and -S-S-; n is 0, 1, 2, 3, 4, 5, or 6; Z2is selected from the group consisting of -(CH2)p-, optionally substituted C4-C12cycloalkylenyl,p is 0 or 1; and R11is selected from the group consisting of hydrogen, C1-C10 alkyl, and C2-C10 alkenyl; wherein one or more methylene linkages of X1, X2, Y1, Y2, Z1, Z2, R10, and R11, are optionally and independently replaced with a group selected from -O-, -CH=CH-, -S- and C3-C6 cycloalkylenyl.

[0187] In one embodiment, the disclosure provides a compound of Formula IB:or a pharmaceutically acceptable salt or solvate thereof, wherein: A is selected from the group consisting of -N(R1a)- and -C(R')-OC(=O)(R8a)-; R1ais -L1-R1; L1is C2-C6alkylenyl or –(CH2)2-6-OC(=O)-; R1is selected from the group consisting of -OH,R2a, R2b, and R2care independently selected from the group consisting of hydrogen and C1-C6alkyl; R3a, R3b, and R3care independently selected from the group consisting of hydrogen and C1-C6alkyl; R4a, R4b, and R4care independently selected from the group consisting of hydrogen and C1-C6 alkyl; R5a, R5b, and R5care independently selected from the group consisting of hydrogen and C1-C6 alkyl; R6a, R6b, and R6care independently selected from the group consisting of hydrogen and C1-C6 alkyl; or R6aand R6btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; and R6cis selected from the group consisting of hydrogen and C1C6alkyl; R7a, R7b, and R7care independently selected from the group consisting of hydrogen and C1-C6alkyl; orR7aand R7btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; and R7cis selected from the group consisting of hydrogen and C1C6alkyl; R' is selected from the group consisting of hydrogen and C1-C6 alkyl; R8ais - L2-R8; L2is C2-C6 alkylenyl;R9aand R9bare independently selected from the group consisting of hydrogen and C1-C6 alkyl; or R9aand R9btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; Q1is C1-C20alkylenyl; W1is selected from the group consisting of -C(=O)O-, -OC(=O)-, -C(=O)N(R12a)-, -N(R12a)C(=O)-, - OC(=O)N(R12a)-, - N(R12a)C(=O)O-, and -OC(=O)O-; R12ais selected from the group consisting of hydrogen and C1-C6alkyl; X1is optionally substituted C1-C15 alkylenyl; or X1is a bond; Y1is selected from the group consisting of -(CH2)m-, -O-, -S-, and -S-S-; m is 0, 1, 2, 3, 4, 5, or 6; Z1is selected from the group consisting of optionally substituted C5-C12bridged cycloalkylenyl,R10is selected from the group consisting of hydrogen, C1-C20 alkyl, and C2-C20 alkenyl; Q2is C1-C20 alkylenyl; W2is selected from the group consisting of -C(=O)O-, -C(=O)N(R12b)-, -OC(=O)N(R12b)-, and - OC(=O)O-; R12bis selected from the group consisting of hydrogen and C1-C6alkyl; X2is optionally substituted C1-C15alkylenyl; or X2is a bond;Y2is selected from the group consisting of -(CH2)n-, -O-, -S-, and -S-S-; n is 0, 1, 2, 3, 4, 5, or 6; Z2is selected from the group consisting of -(CH2)p-, optionally substituted C4-C12 cycloalkylenyl,p is 0 or 1; and R11is selected from the group consisting of hydrogen, C1-C10 alkyl, and C2-C10 alkenyl; wherein one or more methylene linkages of X1, X2, Y1, Y2, Z1, Z2, R10, and R11, are optionally and independently replaced with a group selected from -O-, -CH=CH-, -S- and C3-C6cycloalkylenyl.

[0188] In one embodiment, the disclosure provides a compound of Formula IC:or a pharmaceutically acceptable salt or solvate thereof, wherein: A is selected from the group consisting of -N(R1a)- and -C(R')-OC(=O)(R8a)-; R1ais -L1-R1; L1is C2-C6 alkylenyl or –(CH2)2-6-OC(=O)-; R1is selected from the group consisting of -OH,R2a, R2b, and R2care independently selected from the group consisting of hydrogen and C1-C6 alkyl; R3a, R3b, and R3care independently selected from the group consisting of hydrogen and C1-C6 alkyl; R4a, R4b, and R4care independently selected from the group consisting of hydrogen and C1-C6 alkyl; R5a, R5b, and R5care independently selected from the group consisting of hydrogen and C1-C6alkyl; R6a, R6b, and R6care independently selected from the group consisting of hydrogen and C1-C6alkyl; orR6aand R6btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; and R6cis selected from the group consisting of hydrogen and C1C6alkyl; R7a, R7b, and R7care independently selected from the group consisting of hydrogen and C1-C6 alkyl; or R7aand R7btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; and R7cis selected from the group consisting of hydrogen and C1C6 alkyl; R' is selected from the group consisting of hydrogen and C1-C6alkyl; R8ais - L2-R8; L2is C2-C6alkylenyl; R8is selected from the group consistingR9aand R9bare independently selected from the group consisting of hydrogen and C1-C6alkyl; or R9aand R9btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; Q1is C1-C20alkylenyl; W1is selected from the group consisting of -C(=O)O-, -OC(=O)-, -C(=O)N(R12a)-, -N(R12a)C(=O)-, - OC(=O)N(R12a)-, - N(R12a)C(=O)O-, and -OC(=O)O-; R12ais selected from the group consisting of hydrogen and C1-C6 alkyl; X1is optionally substituted branched C1-C15alkylenyl; or X1is a bond; Y1is selected from the group consisting of -(CH2)m-, -O-, -S-, and -S-S-; m is 0, 1, 2, 3, 4, 5, or 6; Z1is selected from the group consisting of optionally substituted C4-C12 cycloalkylenyl,R10is selected from the group consisting of hydrogen, C1-C20 alkyl, and C2-C20 alkenyl; Q2is C1-C20alkylenyl; W2is selected from the group consisting of -C(=O)O-, -C(=O)N(R12b)-, -OC(=O)N(R12b)-, and - OC(=O)O-;R12bis selected from the group consisting of hydrogen and C1-C6alkyl; X2is optionally substituted C1-C15alkylenyl; or Y2is selected from the group consisting of -(CH2)n-, -O-, -S-, and -S-S-; n is 0, 1, 2, 3, 4, 5, or 6; Z2is of -(CH2)p-; p is 0 or 1; and R11is C1-C20branched alkyl; wherein one or more methylene linkages of X1, X2, Y1, Y2, Z1, Z2, R10, and R11, are optionally and independently replaced with a group selected from -O-, -CH=CH-, -S- and C3-C6 cycloalkylenyl.

[0189] In some embodiments, the disclosure provides a compound of any one of Formulae IA, IB, IC, or a pharmaceutically acceptable salt or solvate thereof, wherein Z1is optionally substituted C5- C12 bridged cycloalkylenyl.

[0190] In some embodiments, the disclosure provides a compound of any one of Formulae IA, IB, IC, or a pharmaceutically acceptable salt or solvate thereof, wherein Z1is not adamantyl.

[0191] In one embodiment, the disclosure provides a compound of Formula ID:or a pharmaceutically acceptable salt or solvate thereof, wherein: A is selected from the group consisting of -N(R1a)- and -C(R')-OC(=O)(R8a)-; R1ais -L1-R1; L1is C2-C6 alkylenyl or –(CH2)2-6-OC(=O)-; R1is selected from the group consisting of -OH,R2a, R2b, and R2care independently selected from the group consisting of hydrogen and C1-C6 alkyl; R3a, R3b, and R3care independently selected from the group consisting of hydrogen and C1-C6 alkyl; R4a, R4b, and R4care independently selected from the group consisting of hydrogen and C1-C6 alkyl;R5a, R5b, and R5care independently selected from the group consisting of hydrogen and C1-C6alkyl; R6a, R6b, and R6care independently selected from the group consisting of hydrogen and C1-C6alkyl; or R6aand R6btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; and R6cis selected from the group consisting of hydrogen and C1C6 alkyl; R7a, R7b, and R7care independently selected from the group consisting of hydrogen and C1-C6 alkyl; or R7aand R7btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; and R7cis selected from the group consisting of hydrogen and C1C6alkyl; R' is selected from the group consisting of hydrogen and C1-C6alkyl; R8ais - L2-R8; L2is C2-C6 alkylenyl; R8is selected from the group consisting of -NR9aR9b,R9aand R9bare independently selected from the group consisting of hydrogen and C1-C6alkyl; or R9aand R9btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; Q1is C1-C20 alkylenyl; W1is selected from the group consisting of -C(=O)O-, -OC(=O)-, -C(=O)N(R12a)-, -N(R12a)C(=O)-, - OC(=O)N(R12a)-, - N(R12a)C(=O)O-, and -OC(=O)O-; R12ais selected from the group consisting of hydrogen and C1-C6alkyl; X1is optionally substituted branched C1-C15alkylenyl; or X1is a bond; Y1is selected from the group consisting of -(CH2)m-, -O-, -S-, and -S-S-; m is 0, 1, 2, 3, 4, 5, or 6; Z1is optionally substituted C5-C12 bridged cycloalkylenyl; R10is selected from the group consisting of hydrogen, C1-C20alkyl, and C2-C20alkenyl; Q2is C1-C20alkylenyl; W2is selected from the group consisting of -C(=O)O-, -C(=O)N(R12b)-, -OC(=O)N(R12b)-, and - OC(=O)O-; R12bis selected from the group consisting of hydrogen and C1-C6 alkyl; X2is optionally substituted C1-C15 alkylenyl; orY2is -(CH2)n-; n is 0, 1, 2, 3, 4, 5, or 6; Z2is of -(CH2)p-; p is 0 or 1; and R11is C1-C20 branched alkyl.

[0192] In some embodiments, the disclosure provides a compound of Formula ID or a pharmaceutically acceptable salt or solvate thereof, wherein Z1is not adamantyl.

[0193] In one embodiment, the disclosure provides a compound of Formula I:or a pharmaceutically acceptable salt or solvate thereof, wherein: A is selected from the group consisting of -N(R1a)- and -C(R')-OC(=O)(R8a)-; R1ais -L1-R1; L1is C2-C6 alkylenyl; R1is selected from the group consisting of -OH,R2a, R2b, and R2care independently selected from the group consisting of hydrogen and C1-C6alkyl; R3a, R3b, and R3care independently selected from the group consisting of hydrogen and C1-C6alkyl; R4a, R4b, and R4care independently selected from the group consisting of hydrogen and C1-C6 alkyl; R5a, R5b, and R5care independently selected from the group consisting of hydrogen and C1-C6 alkyl; R6a, R6b, and R6care independently selected from the group consisting of hydrogen and C1-C6 alkyl; or R6aand R6btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; and R6cis selected from the group consisting of hydrogen and C1C6alkyl; R7a, R7b, and R7care independently selected from the group consisting of hydrogen and C1-C6alkyl; or R7aand R7btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; and R7cis selected from the group consisting of hydrogen and C1C6 alkyl;R' is selected from the group consisting of hydrogen and C1-C6alkyl; R8ais - L2-R8; L2is C2-C6 alkylenyl; R8is -NR9aR9b; R9aand R9bare independently selected from the group consisting of hydrogen and C1-C6 alkyl; or R9aand R9btaken together with the nitrogen atom to which they are attached form a 4-to 8-membered heterocyclo; Q1is C1-C20alkylenyl; W1is selected from the group consisting of -C(=O)O-, -OC(=O)-, -C(=O)N(R12a)-, -N(R12a)C(=O)-, - OC(=O)N(R12a)-, - N(R12a)C(=O)O-, and -OC(=O)O-; R12ais selected from the group consisting of hydrogen and C1-C6 alkyl; X1is C1-C15 alkylenyl; or X1is a bond; Y1is selected from the group consisting of -(CH2)m-, -O-, -S-, and -S-S-; m is 0, 1, 2, 3, 4, 5, or 6; Z1is selected from the group consisting of C4-C12 cycloalkylenyl,R10is selected from the group consisting of hydrogen, C1-C20 alkyl, and C2-C20 alkenyl; Q2is C1-C20 alkylenyl; W2is selected from the group consisting of -C(=O)O-, -C(=O)N(R12b)-, -OC(=O)N(R12b)-, and - OC(=O)O-; R12bis selected from the group consisting of hydrogen and C1-C6alkyl; X2is C1-C15alkylenyl; or X2is a bond; Y2is selected from the group consisting of -(CH2)n-, -O-, -S-, and -S-S-; n is 0, 1, 2, 3, 4, 5, or 6; Z2is selected from the group consisting of -(CH2)p-, C4-C12cycloalkylenyl,R11is selected from the group consisting of hydrogen, C1-C10alkyl, and C2-C10alkenyl.

[0194] In another embodiment, the disclosure provides a compound of Formula II, III, VI, VI’, VI’’, VI’’’, VII, VII’, VII’’, VII’’’, VIII, VIII’, VIII’’, VIII’’’, IX, IX’, IX’’, IX’’’, X, X’, X’’, X’’’, XI, XI’, XI’’, XI’’’, XII, XII’, XII’’, XII’’’, XIII, XIII’, XIII’’, XIII’’’, XIV, XIV’, XIV’’, XIV’’’, XV, XV’, XV’’, XV’’’, XVI, XVI’, XVI’’, XVI’’’, XVII, XVIII, XVIII’, XIX, XX, or XXI, as described in PCT Publication WO2023122752A1:X’wherein each variable is as defined in Formula IA, Formula IB, Formula IC, Formula ID, Formula I, or below. L1

[0195] In another embodiment, L1is selected from the group consisting of -CH2CH2-, -CH2CH2CH2-, and CH2CH2CH2CH2-. In another embodiment, L1is -CH2CH2-. In another embodiment, L1is - CH2CH2CH2-. In another embodiment, L1is CH2CH2CH2CH2-. In certain embodiments, L1is – (CH2)2-6-OC(=O)-. In some embodiments, L1is –(CH2)2-OC(=O)-. R1

[0196] In some embodiments, R1is. In another embodiment, R1is -OH. In some embodiments, R1is -N(R9a)(R9b). In some embodiments, R1is -NMe2. In some embodiments, R1is - NEt2.In another embodiment, R1is. In another embodiment, R1isL2

[0197] In another embodiment, L2is selected from the group consisting of -CH2CH2-, -CH2CH2CH2-, and CH2CH2CH2CH2-. In another embodiment, L2is - CH2CH2-. In another embodiment, L2is - CH2CH2CH2-. In another embodiment, L2is CH2CH2CH2CH2-. R8

[0198] In some embodiments, R8isIn another embodiment, R8is -NR9aR9b. In some embodiments, R8is -NMe2. In some embodiments, R8is -NEt2. In another embodiment, R8is -OH. R9a, R9b

[0199] In another embodiment, R9aand R9bare independently selected from the group consisting of hydrogen and C1-C4alkyl. In another embodiment, R9aand R9bare each methyl. In another embodiment, R9aand R9bare each ethyl. R’

[0200] In another embodiment, R' is hydrogen. In some embodiments, R’ is C1C6 alkyl. Q1

[0201] In another embodiment, Q1is straight chain C1-C20alkylenyl. In another embodiment, Q1is straight chain C1-C10alkylenyl. In another embodiment, Q1is C1-C10alkylenyl. In another embodiment, Q1is C2-C5alkylenyl. Q1is C6-C9alkylenyl. In another embodiment, Q1is selected from the group consisting of -CH2CH2-, CH2CH2CH2-, CH2(CH2)2CH2-, CH2(CH2)3CH2-, CH2(CH2)4CH2-, CH2(CH2)5CH2-, CH2(CH2)6CH2-, CH2(CH2)7CH2-, and CH2(CH2)8CH2-. In another embodiment, Q1is -CH2CH2-. In another embodiment, Q1is CH2CH2CH2-. In another embodiment, Q1is CH2(CH2)2CH2-. In another embodiment, Q1is CH2(CH2)3CH2-. In another embodiment, Q1is - CH2CH2-. In another embodiment, Q1is CH2(CH2)4CH2-. In another embodiment, Q1is CH2(CH2)5CH2-. In another embodiment, Q1is CH2(CH2)6CH2-. In another embodiment, Q1is CH2(CH2)7CH2-. In another embodiment, Q1is CH2(CH2)8.CH2-. W1

[0202] In another embodiment, W1is selected from the group consisting of -C(=O)O-, -OC(=O)-, - C(=O)N(R12a)-, N(R12a)C(=O)-, -OC(=O)N(R12a)-, - N(R12a)C(=O)O-, and -OC(=O)O-. In another embodiment, W1is -C(=O)O-. In another embodiment, W1is -OC(=O)-. In another embodiment, W1is -C(=O)N(R12a)-. In another embodiment, W1is N(R12a)C(=O)-. In another embodiment, W1is -OC(=O)N(R12a)-. In another embodiment, W1is -N(R12a)C(=O)O-. In another embodiment, W1is - OC(=O)O-. X1

[0203] In another embodiment, X2is optionally substituted C1-C15 alkylenyl. In another embodiment, X2is branched C1-C15 alkylenyl. In another embodiment, X1is a bond or C1-C15 alkylenyl. In another embodiment, X1is a bond. In another embodiment, X1is C2-C5alkylenyl. In another embodiment, X1is C6-C9alkylenyl. In another embodiment, X1is -CH2-. In another embodiment, X2is -CH2CH2-. In another embodiment, X2is -CH2CH2CH2-. In another embodiment, X2is -CH2CH2CH2CH2-. In another embodiment, X2is -CH2CH2CH2CH2CH2-. Y1

[0204] In another embodiment, Y1is selected from the group consisting of -(CH2)m-, -O-, -S-, and -S- S-. In another embodiment, Y1is -(CH2)m-. In some embodiments, Y1is -O-. In some embodiments, Y1is -S-. In another embodiment, Y1is -CH2-. In another embodiment, Y2is -CH2CH2-. m

[0205] In another embodiment, m is 0. In another embodiment, m is 1. In another embodiment, m is 2. In another embodiment, m is 3. In another embodiment, m is 4. In another embodiment, m is 5. In another embodiment, m is 6. n

[0206] In another embodiment, n is 0. In another embodiment, n is 1. In another embodiment, n is 2. In another embodiment, n is 3. In another embodiment, n is 4. In another embodiment, n is 5. In another embodiment, n is 6. p

[0207] In another embodiment, p is 0. In another embodiment, p is 1. Z1

[0208] In another embodiment, Z1is selected from the group consisting of C4-C12 cycloalkylenyl,certain embodiments, Z1is optionally subtituted.

[0209] In another embodiment, Z1is

[0210] In another embodiment, Z1is C4-C12cycloalkylenyl. In another embodiment, Z1is a monocyclic C4-C8cycloalkylenyl. In another embodiment, Z1is a monocyclic C4-C6cycloalkylenyl. In another embodiment, Z1is a monocyclic C4 cycloalkylenyl. In another embodiment, Z1is a monocyclic C5 cycloalkylenyl. In another embodiment, Z1is a monocyclic C6 cycloalkylenyl.

[0211] In another emobdiment, Z1is an optionally substituted bridged bicyclic or multicyclic cycloalkylenyl. In some embodiments, Z1is optionally substituted C5-C12bridged cycloalkylenyl. In some embodiments, Z1is optionally substituted C6-C10bridged cycloalkylenyl. In some embodiments, Z1is a optionally substituted C5-C10bridged cycloalkylenyl. selected from the group consisting of adamantyl, cubanyl, bicyclo[2.2.1]heptyl, bicyclo[2.2.2]octyl, bicyclo[1.1.1]pentyl, bicyclo[3.2.1]octyl, and bicyclo[3.1.1]heptyl.

[0212] In another embodiment, Z1is selected from the group consisting of:

[0213] In another embodiment, Z1is selected from the group consisting of:

[0214] In another embodiment, R10is hydrogen.

[0215] In another embodiment, R10is C1C10alkyl. In another embodiment, R10is C3C7alkyl. In another embodiment, R10is C4C6 alkyl. In another embodiment, R10is C4. In another embodiment, R10is C5. In another embodiment, R10is C6.

[0216] In another embodiment, R10is C2-C12 alkenyl. In another embodiment, R10is C6-C12 alkenyl. In another embodiment, R10is C2-C8alkenyl. R11

[0217] In another embodiment, R11is C1-C10alkyl. In another embodiment, R11is optionally substituted C1-C20 alkyl. In another embodiment, R11is optionally substituted branched C1-C20 alkyl. In another embodiment, R11is optionally substituted C1-C15 alkyl. In another embodiment, R11is optionally substituted C1-C15 branched alkyl. In another embodiment, R11is optionally substituted C10-C15alkyl. In another embodiment, R11is optionally substituted C10-C15branched alkyl. In another embodiment, R11is selected from the group consisting of CH3, -CH2CH3, and -CH2CH2CH3. In another embodiment, R11is selected from the group consisting of CH2(CH2)2CH3, CH2(CH2)3CH3, CH2(CH2)4CH3, -CH2(CH2)5CH3, -CH2(CH2)6CH3, CH2(CH2)7CH3, and -CH2(CH2)8CH3. In another embodiment, R11is CH3. In another embodiment, R11is -CH2CH3. In another embodiment, R11is - CH2CH2CH3. In another embodiment, R11is CH2(CH2)2CH3. In another embodiment, R11is CH2(CH2)3CH3. In another embodiment, R11is CH2(CH2)4CH3. In another embodiment, R11is - CH2(CH2)5CH3. In another embodiment, R11is CH2(CH2)6CH3. In another embodiment, R11is CH2(CH2)7CH3. In another embodiment, R11is -CH2(CH2)8CH3.

[0218] In another embodiment, R11is C2-C10 alkenyl. In another embodiment, R11is C2-C12 alkenyl. In another embodiment, R11is C6-C12 alkenyl. In another embodiment, R11is C2-C8 alkenyl.

[0219] In another embodiment, the disclosure provides a compound of any one of Formulae IA, IB, IC, or I-XXI or a pharmaceutically acceptable salt or solvate thereof, wherein R11is hydrogen. Q2

[0220] In another embodiment, Q2is straight chain C1-C20alkylenyl. In another embodiment, Q2is straight chain C1-C10 alkylenyl. In another embodiment, Q2is C2-C10 alkylenyl. In another embodiment, Q2is selected from the group consisting of -CH2CH2-, CH2CH2CH2-, CH2(CH2)2CH2-, CH2(CH2)3CH2-, CH2(CH2)4CH2-, CH2(CH2)5CH2-, CH2(CH2)6CH2-, CH2(CH2)7CH2-, and CH2(CH2)8.CH2-. In another embodiment, Q2is -CH2CH2-. In another embodiment, Q2is CH2CH2CH2-. In another embodiment, Q2is CH2(CH2)3CH2-. In another embodiment, Q2is CH2(CH2)4CH2-. In another embodiment, Q2is CH2(CH2)5CH2-. In another embodiment, Q2is CH2(CH2)6CH2-. In another embodiment, Q2is CH2(CH2)7CH2-. In another embodiment, Q2is CH2(CH2)8.CH2-. W2

[0221] In another embodiment, W2is selected from the group consisting of -C(=O)O- and -OC(=O)-. In another embodiment, W2is -C(=O)O-. In another embodiment, W2is -OC(=O)-. X2

[0222] In another embodiment, X2is optionally substituted C1-C15alkylenyl. In another embodiment, X2is C1-C15 branched alkylenyl. In another embodiment, X2is C1-C6 alkylenyl or a bond. In another embodiment, X2is C2-C4 alkylenyl. In another embodiment, X2is C3-C5 alkylenyl. In another embodiment, X2is selected from the group consisting of -CH2CH2-, CH2CH2CH2-, CH2(CH2)2CH2-, CH2(CH2)3CH2-, and CH2(CH2)4CH2-. In another embodiment, X2is -CH2-. In another embodiment, X2is a bond. In another embodiment, X2is branched C1-C15alkylenyl, wherein one or more methylene linkages of X2are optionally and independently replaced with a group selected from -O-, -CH=CH-, -S- and C3-C6cycloalkylenyl. Y2

[0223] In another embodiment, Y2is selected from the group consisting of -(CH2)m- and -S-. In another embodiment, Y2is -(CH2)m-. In another embodiment, Y2is -S-. Z2

[0224] In another embodiment, Z2is -(CH2)p-. In another embodiment, Z2is -CH2-. In another embodiment, Z2is -CH2CH2-. In another embodiment, Z2is C4-C12 cycloalkylenyl. In another embodiment, Z2is a monocyclic C4-C8cycloalkylenyl. In certain embodiments, Z2is optionally subtituted.

[0225] In another emobdiment, Z2is an optionally substituted bridged bicyclic or multicyclic cycloalkylenyl. In some embodiments, Z2is optionally substituted C5-C12 bridged cycloalkylenyl. In some embodiments, Z2is optionally substituted C6-C10 bridged cycloalkylenyl. In some embodiments, Z2is an optionally substituted C5-C10 bridged cycloalkylenyl. selected from the group consisting of adamantyl, cubanyl, bicyclo[2.2.1]heptyl, bicyclo[2.2.2]octyl, bicyclo[1.1.1]pentyl, bicyclo[3.2.1]octyl, and bicyclo[3.1.1]heptyl.

[0226] In another embodiment, Z2is selected from the group consisting of:

[0227] In another embodiment, Z2is selected from the group consisting of:

[0228] In another embodiment, the disclosure provides a compound selected from any one of more of the compounds of Table (III), or a pharmaceutically acceptable salt or solvate thereof.Table (III). Non-Limiting Examples of Ionizable Lipids with a Constrained ArmSeries “CX”

[0230] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Publication WO2023196931A1, which is incorporated by reference herein, in its entirety.

[0231] In some embodiments, lipids of the present disclosure comprise a heterocyclic core, wherein the heteroatom is nitrogen. In some embodiments, the heterocyclic core comprises pyrrolidine or a derivative thereof. In some embodiments, the heterocyclic core comprises piperidine or a derivative thereof.

[0232] In some embodiments, a compound of the present disclosure is represented by Formula (CX- I):or a pharmaceutically acceptable salt thereof, whereineach Y is independently selected from the group consisting ofR2is optionally substituted C1-C36alkyl or optionally substituted C2-C36alkenyl, wherein 1-6 methylene units of R2are optionally replaced with a group each independently selected from cyclopropylene, -O-, -OC(O)-, and -C(O)O-; R2’is optionally substituted C1-C36 alkyl or optionally substituted C2-C36 alkenyl, wherein 1-6 methylene units of R2are optionally replaced with a group each independently selected from cyclopropylene, -O-, -OC(O)-, and -C(O)O-;each Rais independently optionally substituted C1-C6 alkyl; or two Raare taken together, with the nitrogen on which they are attached, to form an optionally substituted 4-7 membered heterocyclyl ring; m is 0, 1, or 2; n is 1 or 2; and p is 1 or 2.

[0233] In some embodiments, a compound of the present disclosure is represented by Formula (CX- i):or a pharmaceutically acceptable salt thereof, whereineach Y is independently selected from the group consisting of , ,R2is optionally substituted C1-C36alkyl or optionally substituted C2-C36alkenyl, wherein 1-6 methylene units of R2are optionally replaced with a group each independently selected from cyclopropylene, -O-, -OC(O)-, and -C(O)O-; each Rais independently optionally substituted C1-C6 alkyl; or two Raare taken together, with the nitrogen on which they are attached, to form an optionally substituted 4-7 membered heterocyclyl ring; m is 0, 1, or 2; n is 1 or 2; and p is 1 or 2.

[0234] In some embodiments, the present disclosure comprises a compound selected from any lipid in Table (IV) below or a pharmaceutically acceptable salt thereof: Table (IV). Non-Limiting Examples of Ionizable Lipids

[0235] In some embodiments, lipids of the present disclosure comprise a heterocyclic core, wherein the heteroatom is nitrogen. In some embodiments, the heterocyclic core comprises pyrrolidine or a derivative thereof. In some embodiments, the heterocyclic core comprises piperidine or a derivative thereof. Series “CZ”

[0236] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Publication WO2023196931A1, which is incorporated by reference herein, in its entirety.

[0237] In some embodiments, a compound of the present disclosure is represented by Formula (CZ- I)or a pharmaceutically acceptable salt thereof, wherein Z is selected from the group consisting of a bond,, , , ,each Y is independently selected from the group consisting of , H , , andeach R2is independently optionally substituted C1-C36alkyl or optionally substituted C2-C36alkenyl, wherein 1-6 methylene units of R2are optionally replaced with a group each independently selected from cyclopropylene, -O-, -OC(O)-, and -C(O)O-; each Rais independently optionally substituted C1-C6 alkyl; or two Raare taken together, with the nitrogen on which they are attached, to form an optionally substituted 4-7 membered heterocyclyl ring; m is 0, 1, or 2; n is 1 or 2; and p is 1 or 2.

[0238] In some embodiments, the present disclosure comprises a compound selected from any lipid in Table (V) below or a pharmaceutically acceptable salt thereof: Table (V). Non-Limiting Examples of Ionizable LipidsSeries “S”

[0239] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Application PCT / US2024 / 019990, which is incorporated by reference herein, in its entirety.

[0240] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I):or a pharmaceutically acceptable salt thereof, wherein:X is N or CH; Y is a bond,, , , wherein bond marked with an “**” is attached to X; each Z is independently selected from the group consisting of:wherein the bond marked with an "*" is attached to L; each L is independently C2-C10alkylenyl; ,each R is independently -H or C1-C6aliphatic; each R2is independently selected from optionally substituted C2-14alkyl and C2-14alkenyl, wherein any –(CH2)2- of the C2-C14 alkyl can be optionally replaced with C3-C6 cycloalkylenyl; each R3independently selected from is H and C1-6 alkyl; n is selected from 1 to 6; and each p is independently selected from 1 to 6. X

[0241] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein X is N. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein X is CH. Y

[0242] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein Y is a bond. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein Y is , wherein bond marked with an “**” is attached to X. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein Y is , wherein bond marked with an “**” is attached to X. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein Y , wherein bond marked with an “**” is attached to X.

[0243] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein Z is, wherein bond marked with an “*” is attached to X. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein Z is, wherein bond marked with an “*” is attached to X. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein Z iswherein bond marked with an “*” is attached to X. In some embodiments, ionizable lipids of the presentdisclosure have a structure of Formula (S-I), wherein Z is , wherein bond marked with an “*” is attached to X. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein Z is, wherein bond marked with an “*” is attached to X. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein Z is, wherein bond marked with an “*” is attached to X. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein Z is, wherein bond marked with an “*” is attached to X. L

[0244] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein L is C2-C10 alkylenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein L is C5-C8alkylenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein L is C5alkylenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein L is C6 alkylenyl. In some embodiments, ionizable lipids of the present disclosure have a structure ofFormula (S-I), wherein L is C7alkylenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein L is C8alkylenyl. R1

[0245] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein R1is OH. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein R1is N(R3)2. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein R1is. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein R1iswherein each R is independently -H or C1-C6aliphatic. In certain embodiments, R1is

[0246] In some embodiments, ionizable lipids of the present disclosure have a structure of Formulaor a pharmaceutically acceptable salt thereof, wherein: each R2is independently selected from optionally substituted C2-14alkyl and C2-14alkenyl, wherein any –(CH2)2- of the C2-C14 alkyl can be optionally replaced with C3-C6 cycloalkylenyl; n is selected from 1 to 4; each m is independently selected from 2 to 10; and each p is independently selected from 2 to 6.

[0247] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-Ib):or a pharmaceutically acceptable salt thereof, wherein: each R2is independently selected from optionally substituted C2-14alkyl and C2-14alkenyl, wherein any –(CH2)2- of the C2-C14alkyl can be optionally replaced with C3-C6cycloalkylenyl; each R3independently selected from is H and C1-6alkylene; n is selected from 1 to 4; each m is independently selected from 2 to 10; and each p is independently selected from 2 to 6. R2

[0248] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein R2is optionally substituted C2-14alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S- Ia), or Formula (S-Ib), wherein R2is optionally substituted C7-12alkyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein R2is independently selected from the group consisting of:,

[0249] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein R2is. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S- Ia), or Formula (S-Ib), wherein R2is. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), whereinsome embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein R2is. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein R2is optionally substituted C2-14alkenyl. In someembodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S- Ia), or Formula (S-Ib), wherein R2is independently selected from:. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein R2is.

[0250] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein R2is optionally substituted C8-9alkenyl. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S- Ia), or Formula (S-Ib), wherein R2is. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein R2is. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein R2is. R3

[0251] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I) or Formula (S-Ib), wherein R3is hydrogen.

[0252] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein R3is C1-6alkylene. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein each R3is C1alkyl, C2alkyl, C3alkyl, C4alkyl, C5alkyl, or C6alkyl. n

[0253] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein n is 3. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein n is 4. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein n is 1, 2, 5, or 6. m

[0254] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-Ia), or Formula (S-Ib), wherein m is selected from 5 to 8. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-Ia), or Formula (S-Ib), wherein m is 5. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-Ia) or Formula (S-Ib), wherein m is 6. In some embodiments, ionizable lipids of the present disclosure havea structure of Formula (S-Ia) or Formula (S-Ib), wherein m is 7. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-Ia) or Formula (S-Ib), wherein m is 8. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-Ia), or Formula (S-Ib), wherein m is 2, 3, 4, 9, or 10. p

[0255] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein p is independently selected from 2 to 4. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S- Ia), or Formula (S-Ib), wherein p is 2. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein p is 3. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S- Ia), or Formula (S-Ib), wherein p is 4. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), Formula (S-Ia), or Formula (S-Ib), wherein p is 5 or 6. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein p is 1.

[0256] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-M):or a pharmaceutically acceptable salt thereof, wherein: X is N or CH;Y is a bond, , , or , wherein bond marked with an “**” is attached to X; each Z is independently selected from the group consisting of:wherein the bond marked with an "*" is attached to L; each L is independently C2-C10 alkylenyl;each R is independently -H or C1-C6aliphatic; each R3independently selected from is H and C1-6alkyl; R4is -CH(SR6)(SR7); R5is -CH(OR8)(OR9); -CH(SR8)(SR9); -CH(R8)(R9) or optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or - C(O)O-; R6and R7are each independently optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-; and R8and R9are each independently optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-; n is selected from 1 to 6; and each p is independently selected from 1 to 6.

[0257] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-Ma)or a pharmaceutically acceptable salt thereof, wherein: n is selected from 1 to 4; each m is independently selected from 2 to 10; and each p is independently selected from 2 to 6.

[0258] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-Mb)or a pharmaceutically acceptable salt thereof, wherein: each R3independently selected from is H and C1-6 alkyl; n is selected from 1 to 4; each m is independently selected from 2 to 10; and each p is independently selected from 2 to 6. R1

[0259] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-M), wherein R1is OH. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-I), wherein R1is N(R3)2. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-M), wherein R1is. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-M), wherein R1is, wherein each R is independently -H or C1-C6 aliphatic. In certain embodiments, R1isn

[0260] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-M), Formula (S-Ma), or Formula (S-Mb), wherein n is 3. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-M), Formula (S-Ma), or Formula (S-Mb), wherein n is 4. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-M), Formula (S-Ma), or Formula (S-Mb), wherein n is 1, 2, 5, or 6. p

[0261] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-M), Formula (S-Ma), or Formula (S-Mb), wherein p is independently selected from 2 to 4. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-M), Formula (S-Ma), or Formula (S-Mb), wherein p is 2. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-M), Formula (S-Ma), or Formula (S-Mb), wherein p is 3. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S- M), Formula (S-Ma), or Formula (S-Mb), wherein p is 4. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-M), Formula (S-Ma), or Formula (S-Mb), wherein p is 5 or 6. In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (S-M), wherein p is 1. R5

[0262] As disclosed in Formula (S-M), in certain embodiments, R5is -CH(OR8)(OR9); - CH(SR8)(SR9); -CH(R8)(R9) or optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R5is optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S- , -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R5is optionally substituted C1-C14aliphatic. In certain embodiments, R5is -CH(OR8)(OR9) . In certain embodiments, R5is -CH(R8)(R9). In certain embodiments, R5is -CH(SR8)(SR9). In certain embodiments, R4and R5are the same. In certain embodiments, R4and R5are different.

[0263] In certain embodiments, R5is selected from,. R6and R7

[0264] As disclosed in Formula (S-M), in certain embodiments, R6and R7are each independently optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)- , -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R6and R7are the same. In certain embodiments, R6and R7are different.

[0265] In certain embodiments, R6is optionally substituted C1-C14 aliphatic. In certain embodiments, R6is optionally substituted C1-C14alkylene. In certain embodiments, R6is optionally substituted C1- C14branched alkylene. In certain embodiments, R6is optionally substituted C1-C14straight chain alkylene. In certain embodiments, R6is optionally substituted C1-C14alkenylene. In certain embodiments, R6is optionally substituted C1-C14 branched alkenylene. In certain embodiments, R6is optionally substituted C1-C14 straight chain alkenylene. In certain embodiments, R6is optionally substituted C6-C10 alkylene. In certain embodiments, R6is optionally substituted –(CH2)5CH3. In certain embodiments, R6is optionally substituted –(CH2)6CH3. In certain embodiments, R6is optionally substituted –(CH2)7CH3. In certain embodiments, R6is optionally substituted –(CH2)8CH3. In certain embodiments, R6is optionally substituted –(CH2)9CH3.

[0266] In certain embodiments, one of the methylene linkages of R6is replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12 cycloalkylenyl is selected from:

[0267] In certain embodiments, R7is optionally substituted C1-C14aliphatic. In certain embodiments, R7is optionally substituted C1-C14alkylene. In certain embodiments, R7is optionally substituted C1- C14 branched alkylene. In certain embodiments, R7is optionally substituted C1-C14 straight chain alkylene. In certain embodiments, R7is optionally substituted C1-C14 alkenylene. In certain embodiments, R7is optionally substituted C1-C14 branched alkenylene. In certain embodiments, R7is optionally substituted C1-C14straight chain alkenylene. In certain embodiments, R7is optionally substituted C6-C10alkylene. In certain embodiments, R7is optionally substituted –(CH2)5CH3. In certain embodiments, R7is optionally substituted –(CH2)6CH3. In certain embodiments, R7is optionally substituted –(CH2)7CH3. In certain embodiments, R7is optionally substituted –(CH2)8CH3. In certain embodiments, R6is optionally substituted –(CH2)9CH3.

[0268] In certain embodiments, one of the methylene linkages of R7is replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0269] In certain embodiments, R6and R7are selected from,

[0270] . In certain embodiments, each R6and R7are each independently selected from an optionally substituted bridged bicyclic C5-C12cycloalkylenyl. In certain embodiments, R6is an optionally substituted bridged multicyclic C5-C12 cycloalkylenyl. In certain embodiments, R7is an optionally substituted bridged bicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is selected from adamantyl, bicyclo[2.2.2]octyl, cubanyl, bicyclo[1.1.1]pentyl, bicyclo[2.2.1]heptyl, bicyclo[3.1.1]heptyl, and bicyclo[3.2.1]octyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl is selected from:. In certain embodiments, the substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is a structure selected from, , , , ,, wherein one or more C-H bonds are substituted.

[0271] In certain embodiments, R6and R7taken together form an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl is selected from:, ,R8and R9

[0272] As disclosed in Formula (S-M), in certain embodiments, R8and R9are each independently optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)- , -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-.

[0273] In certain embodiments, R8and R9are the same. In certain embodiments, R8and R9are different.

[0274] In certain embodiments, R8is optionally substituted C1-C14aliphatic. In certain embodiments, R8is optionally substituted C1-C14alkylene. In certain embodiments, R8is optionally substituted C1- C14 branched alkylene. In certain embodiments, R8is optionally substituted C1-C14 straight chain alkylene. In certain embodiments, R8is optionally substituted C1-C14 alkenylene. In certain embodiments, R8is optionally substituted C1-C14 branched alkenylene. In certain embodiments, R8is optionally substituted C1-C14straight chain alkenylene. In certain embodiments, R8is optionally substituted C6-C10alkylene. In certain embodiments, R8is optionally substituted –(CH2)5CH3. In certain embodiments, R8is optionally substituted –(CH2)6CH3. In certain embodiments, R8is optionally substituted –(CH2)7CH3. In certain embodiments, R8is optionally substituted –(CH2)8CH3. In certain embodiments, R8is optionally substituted –(CH2)9CH3.

[0275] In certain embodiments, one of the methylene linkages of R8is replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0276] In certain embodiments, R9is optionally substituted C1-C14aliphatic. In certain embodiments, R9is optionally substituted C1-C14 alkylene. In certain embodiments, R9is optionally substituted C1- C14 branched alkylene. In certain embodiments, R9is optionally substituted C1-C14 straight chain alkylene. In certain embodiments, R9is optionally substituted C1-C14 alkenylene. In certain embodiments, R9is optionally substituted C1-C14branched alkenylene. In certain embodiments, R9is optionally substituted C1-C14straight chain alkenylene. In certain embodiments, R9is optionally substituted C6-C10alkylene. In certain embodiments, R9is optionally substituted –(CH2)5CH3. In certain embodiments, R9is optionally substituted –(CH2)6CH3. In certain embodiments, R9is optionally substituted –(CH2)7CH3. In certain embodiments, R9is optionally substituted –(CH2)8CH3. In certain embodiments, R9is optionally substituted –(CH2)9CH3.

[0277] In certain embodiments, one of the methylene linkages of R9is replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0278] In certain embodiments, R8and R9are selected from,

[0279] In some embodiments, R8and R9taken together form an optionally substituted bridged bicyclic or multicyclic C4-C14 cycloalkyl or optionally substituted bridged bicyclic or multicyclic 4-14 membered heterocyclyl.

[0280] In certain embodiments, each R8and R9are each independently selected from an optionally substituted bridged bicyclic C5-C12cycloalkylenyl. In certain embodiments, R8is an optionally substituted bridged multicyclic C5-C12cycloalkylenyl. In certain embodiments, R9is an optionally substituted bridged bicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is selected from adamantyl, bicyclo[2.2.2]octyl, cubanyl, bicyclo[1.1.1]pentyl, bicyclo[2.2.1]heptyl, bicyclo[3.1.1]heptyl, and bicyclo[3.2.1]octyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is selected from:. In certain embodiments, the substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl is a structure selected from,, wherein one or more C-H bonds are substituted.

[0281] In certain embodiments, R8and R9taken together form an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is selected from:, ,

[0282] In some embodiments, ionizable lipids of the present disclosure comprise an acyclic core. In some embodiments, ionizable lipids of the present disclosure are selected from any lipid in Table (VI) below or a pharmaceutically acceptable salt thereof: Table (VI). Non-Limiting Examples of Ionizable LipidsSeries “AT”

[0283] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Application PCT / US2024 / 019990, which is incorporated by reference herein, in its entirety.

[0284] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (AT)or a pharmaceutically acceptable salt thereof, wherein: i) A is N; Z is a bond; X1is optionally substituted C1-C6 aliphatic, wherein the optional substituent is not oxo when X1is C1aliphatic; and R1is selected from the group consisting of:X1is a bond or optionally substituted C1-C6 aliphatic; R1is selected from the group consisting of:X4is a bond or optionally substituted C1-C6 aliphatic; RZis NR2 or OH; each R is independently -H or C1-C6aliphatic;X2and X3are each independently optionally substituted C1-C12aliphatic; Y1and Y2are independently selected from the group consisting ofwherein the bond marked with an "*" is attached to X2for Y1or X3for Y2; R2is optionally substituted C1-C6 aliphatic; R3is optionally substituted C1-C6aliphatic; R4is -CH(OR6)(OR7), -CH(SR6)(SR7), -CH(R6)(R7), or optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or - C(O)O-; R5is -CH(OR8)(OR9), -CH(SR8)(SR9), -CH(R8)(R9), or optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or - C(O)O-; R6and R7are each independently optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-; and R8and R9are each independently optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-.

[0285] In certain embodiments, ionizable lipids of the present disclosure have a structure of Formula (AT), wherein the ionizable lipids of the present disclosure have a structure of Formula (AT-E’):or a pharmaceutically acceptable salt thereof, wherein R1, R, X1, Z, X2, X3, X4, RZ, Y1, Y2, R2, R3, R6, R7, R8, and R9are as described in Formula (AT) or as otherwise described in any embodiments below.

[0286] In certain embodiments, ionizable lipids of the present disclosure have a structure of Formula (AT), wherein the ionizable lipids of the present disclosure have a structure of Formula (AT-F’’’):

[0287] or a pharmaceutically acceptable salt thereof, wherein R1, R, X1, Z, X2, X3, X4, RZ, R2, R3, R6, R7, R8, and R9are as described in Formula (AT) or as otherwise described in any embodiments below.

[0288] In certain embodiments, ionizable lipids of the present disclosure have a structure of Formula (AT), wherein the ionizable lipids of the present disclosure have a structure of Formula (AT-M):or a pharmaceutically acceptable salt thereof, wherein R1, R, X2, X3, X4, RZ, Y1, Y2, R2, R3, R4, R5, R6, R7, R8, and R9are as described in Formula (AT) or as otherwise described in any embodiments below.

[0289] In certain embodiments, ionizable lipids of the present disclosure have a structure of Formula (AT), wherein the ionizable lipids of the present disclosure have a structure of Formula (AT-N’):or a pharmaceutically acceptable salt thereof, wherein R1, R, X1, X2, X3, X4, RZ, R2, R3, R4, R5, R6, R7, R8, and R9are as described in Formula (AT) or as otherwise described in any embodiments below.

[0290] In certain embodiments, ionizable lipids of the present disclosure have a structure of Formula (AT), wherein the ionizable lipids of the present disclosure have a structure of Formula (AT-O’):or a pharmaceutically acceptable salt thereof, wherein R1, R, X1, X2, X3, Y1, Y2, X4, RZ, R2, R3, R6, R7, R8, and R9are as described in Formula (AT) or as otherwise described in any embodiments below.

[0291] In certain embodiments, ionizable lipids of the present disclosure have a structure of Formula (AT), wherein the ionizable lipids of the present disclosure have a structure of Formula (AT-P’’’):or a pharmaceutically acceptable salt thereof, wherein R1, R, X1, X2, X3, R2, R3, X4, RZ, R6, R7, R8, and R9are as described in Formula (AT) or as otherwise described in any embodiments below.

[0292] As disclosed in Formula (AT), in certain embodiments, A is CH or N. In certain embodiments, A is CH. In certain embodiments, A is N. Z

[0293] As disclosed in Formula (AT), in certain embodiments wherein A is CH, Z is,certain embodiments wherein A is CH, Z is. In certain embodiments, Z is. In certain embodiments, Z is. In certain embodiments, Z is In certain embodiments, Z is . In certain embodiments, Z is .In certain embodiments, Z isIn certain embodiments, Z isIn certain embodiments, Z is. In certain embodiments, Z is. In certain embodiments, Z is. In certain embodiments, Z is. As disclosed in Formula (AT), in certain embodiments wherein A is N, Z is a bond. X1

[0294] As disclosed in Formula (AT), in certain embodiments wherein A is N, X1is optionally substituted C1-C6aliphatic. In certain embodiments wherein A is N, X1is unsubstituted C1-C6aliphatic. In certain embodiments, X1is optionally substituted C1-C6 alkylene. In certain embodiments, X1is unsubstituted C1-C6 alkylene. In certain embodiments, X1is unsubstituted C2-C6 alkylene. In certain embodiments, X1is optionally substituted methylene. In certain embodiments, R2is optionally substituted C2 alkylene. In certain embodiments, X1is optionally substituted C3 alkylene. In certain embodiments, X1is optionally substituted C4alkylene. In certain embodiments, X1is optionally substituted C5alkylene. In certain embodiments, X1is optionally substituted C6alkylene. In certain embodiments, X1is –(CH2)-. In certain embodiments, X1is –(CH2)2-. In certain embodiments, X1is –(CH2)3-. In certain embodiments, X1is –(CH2)4-. In certain embodiments, X1is – (CH2)5-. In certain embodiments, X1is –(CH2)6-.

[0295] As disclosed in Formula (AT), in certain embodiments wherein A is CH, X1is a bond or optionally substituted C1-C6aliphatic. In certain embodiments, X1is a bond. In certain embodiments, X1is optionally substituted C1-C6alkylene. In certain embodiments, X1is unsubstituted C1-C6alkylene. In certain embodiments, X1is unsubstituted C2-C6alkylene. In certain embodiments, X1is optionally substituted methylene. In certain embodiments, R2is optionally substituted C2alkylene. In certain embodiments, X1is optionally substituted C3 alkylene. In certain embodiments, X1is optionally substituted C4 alkylene. In certain embodiments, X1is optionally substituted C5 alkylene. In certain embodiments, X1is optionally substituted C6 alkylene. In certain embodiments, X1is – (CH2)-. In certain embodiments, X1is –(CH2)2-. In certain embodiments, X1is –(CH2)3-. In certainembodiments, X1is –(CH2)4-. In certain embodiments, X1is –(CH2)5-. In certain embodiments, X1is – (CH2)6-. R1

[0296] As disclosed in Formula (AT), in certain embodiments wherein A is N, R1is selected from the group consisting ofAs disclosed in Formula (AT), in certain embodiments wherein A is CH, R1is selected from the group consisting o, a d .

[0297] In certain embodiments, R1is . In1certain embodiments, R iscertain embodiments,certain embodiments,certain embodiments,certain embodiments,certainembodiments,certain embodiments,embodiments,

[0298] In certain embodiments, R1is. In certain embodiments,certain embodiments,certain embodiments, R1is. X2and X3

[0299] As disclosed in Formula (AT), in certain embodiments, X2and X3are each independently optionally substituted C1-C12 aliphatic. In certain embodiments, X2and X3are the same. In certain embodiments, X2and X3are different.

[0300] In certain embodiments, X2is an optionally substituted C1-C12alkylene. In certain embodiments, X2is an optionally substituted C1-C12alkenylene. In certain embodiments, X2is an optionally substituted C1-C10aliphatic. In certain embodiments, X2is an optionally substituted C1-C10alkylene. In certain embodiments, X2is an optionally substituted C1-C10 alkenylene. In certain embodiments, X2is an optionally substituted C1-C8 aliphatic. In certain embodiments, X2is an optionally substituted C1-C8 alkylene. In certain embodiments, X2is an optionally substituted C1-C8 alkenylene. In certain embodiments, X2is an optionally substituted C1-C6aliphatic. In certain embodiments, X2is an optionally substituted C1-C6alkylene. In certain embodiments, X2is an optionally substituted C1-C6alkenylene. In certain embodiments, X2is an optionally substituted C2- C12 aliphatic. In certain embodiments, X2is an optionally substituted C2-C12 alkylene. In certain embodiments, X2is an optionally substituted C2-C12 alkenylene. In certain embodiments, X2is an optionally substituted C4-C12 aliphatic. In certain embodiments, X2is an optionally substituted C4-C12 alkylene. In certain embodiments, X2is an optionally substituted C4-C12 alkenylene. In certain embodiments, X2is an optionally substituted C4-C10aliphatic. In certain embodiments, X2is an optionally substituted C4-C10alkylene. In certain embodiments, X2is an optionally substituted C4-C10alkenylene. In certain embodiments, X2is an optionally substituted C6-C8aliphatic. In certain embodiments, X2is an optionally substituted C6-C8 alkylene. In certain embodiments, X2is an optionally substituted C6-C8 alkenylene. In certain embodiments, X2is –(CH2)-. In certainembodiments, X2is –(CH2)2-. In certain embodiments, X2is –(CH2)3-. In certain embodiments, X2is – (CH2)4-. In certain embodiments, X2is –(CH2)5-. In certain embodiments, X2is –(CH2)6-. In certain embodiments, X2is –(CH2)7-. In certain embodiments, X2is –(CH2)8-. In certain embodiments, X2is – (CH2)9-. In certain embodiments, X2is –(CH2)10-.

[0301] In certain embodiments, X3is an optionally substituted C1-C12 alkylene. In certain embodiments, X3is an optionally substituted C1-C12alkenylene. In certain embodiments, X3is an optionally substituted C1-C10aliphatic. In certain embodiments, X3is an optionally substituted C1-C10alkylene. In certain embodiments, X3is an optionally substituted C1-C10alkenylene. In certain embodiments, X3is an optionally substituted C1-C8 aliphatic. In certain embodiments, X3is an optionally substituted C1-C8 alkylene. In certain embodiments, X3is an optionally substituted C1-C8 alkenylene. In certain embodiments, X3is an optionally substituted C1-C6 aliphatic. In certain embodiments, X3is an optionally substituted C1-C6 alkylene. In certain embodiments, X3is an optionally substituted C1-C6alkenylene. In certain embodiments, X3is an optionally substituted C2- C12aliphatic. In certain embodiments, X3is an optionally substituted C2-C12alkylene. In certain embodiments, X3is an optionally substituted C2-C12alkenylene. In certain embodiments, X3is an optionally substituted C4-C12 aliphatic. In certain embodiments, X3is an optionally substituted C4-C12 alkylene. In certain embodiments, X3is an optionally substituted C4-C12 alkenylene. In certain embodiments, X3is an optionally substituted C4-C10 aliphatic. In certain embodiments, X3is an optionally substituted C4-C10alkylene. In certain embodiments, X3is an optionally substituted C4-C10alkenylene. In certain embodiments, X3is an optionally substituted C6-C8aliphatic. In certain embodiments, X3is an optionally substituted C6-C8alkylene. In certain embodiments, X3is an optionally substituted C6-C8alkenylene. In certain embodiments, X3is –(CH2)-. In certain embodiments, X3is –(CH2)2-. In certain embodiments, X3is –(CH2)3-. In certain embodiments, X3is – (CH2)4-. In certain embodiments, X3is –(CH2)5-. In certain embodiments, X3is –(CH2)6-. In certain embodiments, X3is –(CH2)7-. In certain embodiments, X3is –(CH2)8-. In certain embodiments, X3is – (CH2)9-. In certain embodiments, X3is –(CH2)10-.

[0302] In certain embodiments, X2and X3are both –(CH2)8-. In certain embodiments, X2and X3are both –(CH2)6-. X4

[0303] As disclosed in Formula (AT), in certain embodiments, X4is a bond or C2-C6 aliphatic. In certain embodiments, X4is a bond. In certain embodiments, X4is C2-C6 aliphatic. In certain embodiments, X4is C2 aliphatic. In certain embodiments, X4is C3 aliphatic. In certain embodiments, X4is C4aliphatic. In certain embodiments, X4is C5aliphatic. In certain embodiments, X4is C6aliphatic. Y1and Y2

[0304] As disclosed in Formula (AT), in certain embodiments, Y1and Y2are each independently, wherein the bond marked with an "*" is attached to X2for Y1or X3for Y2. In certain embodiments, Y1and Y2are the same. In certain embodiments, Y1and Y2are different.

[0305] In certain embodiments, Y1and Y2are each independently, , ,In certain embodiments, Y1and Y2are each independentlyIn certain embodiments, Y1isIn certain embodiments, Y1isIn certain embodiments, Y1is. In certain embodiments, Y1is. In certain embodiments, Y1is. In certain embodiments, Y1is In certain embodiments, Y1is . In ce1rtain embodiments, Y isIn certain embodiments, Y2is. In certain embodiments, Y. In certain embodiments, Y2is. In certain embodiments, Y2is. In certain bodiments, Y2em is. In certain embodiments, Y2is . In certain embodiments, Y2is. In certain embodiments, Y2is. In certain embodiments, Y1and Y2are both. In certain embodiments, Y1and Y2are both. R2

[0306] As disclosed in Formula (AT), in certain embodiments, R2is optionally substituted C1-C6aliphatic. In certain embodiments, R2is optionally substituted C1-C6alkylene. In certain embodiments, R2is optionally substituted methylene. In certain embodiments, R2is optionally substituted C2 alkylene. In certain embodiments, R2is optionally substituted C3 alkylene. In certain embodiments, R2is optionally substituted C4 alkylene. In certain embodiments, R2is optionally substituted C5alkylene. In certain embodiments, R2is optionally substituted C6alkylene. In certain embodiments, R2is –(CH2)-. In certain embodiments, R2is –(CH2)2-. In certain embodiments, R2is – (CH2)3-. In certain embodiments, R2is –(CH2)4-. In certain embodiments, R2is –(CH2)5-. In certain embodiments, R2is –(CH2)6-. R3

[0307] As disclosed in Formula (AT), in certain embodiments, R3is optionally substituted C1-C6 aliphatic. In certain embodiments, R3is optionally substituted C1-C6 alkylene. In certain embodiments, R3is optionally substituted methylene. In certain embodiments, R3is optionally substituted C2alkylene. In certain embodiments, R3is optionally substituted C3alkylene. In certain embodiments, R3is optionally substituted C4alkylene. In certain embodiments, R3is optionally substituted C5 alkylene. In certain embodiments, R3is optionally substituted C6 alkylene. In certain embodiments, R3is –(CH2)-. In certain embodiments, R3is –(CH2)2-. In certain embodiments, R3is – (CH2)3-. In certain embodiments, R3is –(CH2)4-. In certain embodiments, R3is –(CH2)5-. In certain embodiments, R3is –(CH2)6-.

[0308] In certain embodiments, R2and R3are the same. In certain embodiments, R2and R3are different. R4

[0309] As disclosed in Formula (AT), in certain embodiments, R4is -CH(OR6)(OR7), - CH(SR6)(SR7), -CH(R6)(R7), or optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R4is optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, phenyl, -O-, -NH-, -S- , -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R4is optionally substituted C1-C14 aliphatic. In certain embodiments, R4is -CH(OR6)(OR7) . In certain embodiments, R4is -CH(R6)(R7). In certain embodiments, R4is -CH(SR6)(SR7).

[0310] In certain embodiments, one of the methylene linkages of R4is replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12 cycloalkylenyl is selected from:, , a d .

[0311] In certain embodiments, R4is selected from is selected from.

[0312] In certain embodiments, R4is selected from is selected from

[0313] As disclosed in Formula (AT), in certain embodiments, R5is -CH(OR8)(OR9), - CH(SR8)(SR9), -CH(R8)(R9), or optionally substituted C1-C14aliphatic, wherein one or moremethylene linkages are each optionally and independently replaced with an optionally substituted C3- C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R5is optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S- , -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R5is optionally substituted C1-C14aliphatic. In certain embodiments, R5is -CH(OR8)(OR9) . In certain embodiments, R5is -CH(R8)(R9). In certain embodiments, R5is -CH(SR8)(SR9).

[0314] In certain embodiments, one of the methylene linkages of R5is replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0315] In certain embodiments, R4and R5are the same. In certain embodiments, R4and R5are different.

[0316] In certain embodiments, R5is selected from,

[0317] In certain embodiments, R5is selected from is selected fromR6and R7

[0318] As disclosed in Formula (AT), in certain embodiments, R6and R7are each independently optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)- , -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-.

[0319] In certain embodiments, R6and R7are the same. In certain embodiments, R6and R7are different.

[0320] In certain embodiments, R6is optionally substituted C1-C14aliphatic. In certain embodiments, R6is optionally substituted C1-C14 alkyl. In certain embodiments, R6is optionally substituted C1-C14 branched alkyl. In certain embodiments, R6is optionally substituted C1-C14 straight chain alkyl. In certain embodiments, R6is optionally substituted C1-C14 alkenylene. In certain embodiments, R6is optionally substituted C1-C14branched alkenyl. In certain embodiments, R6is optionally substituted C1-C14straight chain alkenyl. In certain embodiments, R6is optionally substituted C6-C10alkyl. In certain embodiments, R6is optionally substituted –(CH2)5CH3. In certain embodiments, R6is optionally substituted –(CH2)6CH3. In certain embodiments, R6is optionally substituted –(CH2)7CH3. In certain embodiments, R6is optionally substituted –(CH2)8CH3. In certain embodiments, R6is optionally substituted –(CH2)9CH3.

[0321] In certain embodiments, one of the methylene linkages of R6is replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0322] In certain embodiments, R7is optionally substituted C1-C14aliphatic. In certain embodiments, R7is optionally substituted C1-C14alkyl. In certain embodiments, R7is optionally substituted C1-C14branched alkyl. In certain embodiments, R7is optionally substituted C1-C14 straight chain alkyl. In certain embodiments, R7is optionally substituted C1-C14 alkenylene. In certain embodiments, R7is optionally substituted C1-C14 branched alkenyl. In certain embodiments, R7is optionally substituted C1-C14straight chain alkenyl. In certain embodiments, R7is optionally substituted C6-C10alkyl. In certain embodiments, R7is optionally substituted –(CH2)5CH3. In certain embodiments, R7is optionally substituted –(CH2)6CH3. In certain embodiments, R7is optionally substituted –(CH2)7CH3. In certain embodiments, R7is optionally substituted –(CH2)8CH3. In certain embodiments, R6is optionally substituted –(CH2)9CH3.

[0323] In certain embodiments, one of the methylene linkages of R7is replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:, ,

[0324] In certain embodiments, each R6and R7are selected from

[0325] In certain embodiments, each R6and R7are each independently selected from an optionally substituted bridged bicyclic C5-C12cycloalkylenyl. In certain embodiments, R6is an optionally substituted bridged multicyclic C5-C12 cycloalkylenyl. In certain embodiments, R7is an optionally substituted bridged bicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is selected from adamantyl, bicyclo[2.2.2]octyl, cubanyl, bicyclo[1.1.1]pentyl, bicyclo[2.2.1]heptyl, bicyclo[3.1.1]heptyl, and bicyclo[3.2.1]octyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl is selected from:. In certain embodiments, the substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is a structure selected from, , , , ,, wherein one or more C-H bonds are substituted.

[0326] In certain embodiments, R6and R7taken together form an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl is selected from:, ,R8and R9

[0327] As disclosed in Formula (AT), in certain embodiments, R8and R9are each independently optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)- , -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-.

[0328] In certain embodiments, R8and R9are the same. In certain embodiments, R8and R9are different.

[0329] In certain embodiments, R8is optionally substituted C1-C14aliphatic. In certain embodiments, R8is optionally substituted C1-C14alkyl. In certain embodiments, R8is optionally substituted C1-C14branched alkyl. In certain embodiments, R8is optionally substituted C1-C14 straight chain alkyl. In certain embodiments, R8is optionally substituted C1-C14 alkenyl. In certain embodiments, R8is optionally substituted C1-C14 branched alkenyl. In certain embodiments, R8is optionally substituted C1-C14straight chain alkenyl. In certain embodiments, R8is optionally substituted C6-C10alkyl. In certain embodiments, R8is optionally substituted –(CH2)5CH3. In certain embodiments, R8is optionally substituted –(CH2)6CH3. In certain embodiments, R8is optionally substituted –(CH2)7CH3. In certain embodiments, R8is optionally substituted –(CH2)8CH3. In certain embodiments, R8is optionally substituted –(CH2)9CH3.

[0330] In certain embodiments, one of the methylene linkages of R8is replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0331] In certain embodiments, R9is optionally substituted C1-C14aliphatic. In certain embodiments, R9is optionally substituted C1-C14 alkyl. In certain embodiments, R9is optionally substituted C1-C14 branched alkyl. In certain embodiments, R9is optionally substituted C1-C14 straight chain alkyl. In certain embodiments, R9is optionally substituted C1-C14 alkenyl. In certain embodiments, R9is optionally substituted C1-C14branched alkenyl. In certain embodiments, R9is optionally substituted C1-C14straight chain alkenyl. In certain embodiments, R9is optionally substituted C6-C10alkyl. In certain embodiments, R9is optionally substituted –(CH2)5CH3. In certain embodiments, R9is optionally substituted –(CH2)6CH3. In certain embodiments, R9is optionally substituted –(CH2)7CH3. In certain embodiments, R9is optionally substituted –(CH2)8CH3. In certain embodiments, R9is optionally substituted –(CH2)9CH3.

[0332] In certain embodiments, one of the methylene linkages of R9is replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0333] In certain embodiments, each R8and R9are selected from,

[0334] In some embodiments, R8and R9taken together form an optionally substituted bridged bicyclic or multicyclic C4-C14 cycloalkyl or optionally substituted bridged bicyclic or multicyclic 4-14 membered heterocyclyl.

[0335] In certain embodiments, each R8and R9are each independently selected from an optionally substituted bridged bicyclic C5-C12cycloalkylenyl. In certain embodiments, R8is an optionally substituted bridged multicyclic C5-C12cycloalkylenyl. In certain embodiments, R9is an optionally substituted bridged bicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is selected from adamantyl, bicyclo[2.2.2]octyl, cubanyl, bicyclo[1.1.1]pentyl, bicyclo[2.2.1]heptyl, bicyclo[3.1.1]heptyl, and bicyclo[3.2.1]octyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is selected from:. In certain embodiments, the substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl is a structure selected from,, wherein one or more C-H bonds are substituted.

[0336] In certain embodiments, R8and R9taken together form an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is selected from:, ,

[0337] In some embodiments, Lipids of the Present Disclosure are selected from any lipid in Table (VII) below or a pharmaceutically acceptable salt thereof: Table (VII). Non-Limiting Examples of Ionizable Lipids of the Present DisclosureSeries “AC”

[0338] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Application PCT / US2024 / 019990, which is incorporated by reference herein, in its entirety.

[0339] In some embodiments, ionizable lipids of the present disclosure have a structure of Formula (AC)or a pharmaceutically acceptable salt thereof, wherein: R1is selected from the group consisting of -NR2,each R is independently -H or C1-C6aliphatic; X1is a bond or optionally substituted C2-C6aliphatic;wherein the bond marked with an "*" is attached to X1; X2and X3are each independently optionally substituted C1-C12 aliphatic; X4is a bond or C2-C6aliphatic; Y1and Y2are independently selected from the group consisting ofwherein the bond marked with an "*" is attached to X2for Y1or X3for Y2; R2is optionally substituted C1-C6 aliphatic; R3is optionally substituted C1-C6 aliphatic; R4is -CH(OR6)(OR7); R5is -CH(OR8)(OR9), -CH(R8)(R9), or optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-; R6and R7are each independently optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-; and

[0340] R8and R9are each independently optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. Additional Formulae

[0341] In certain embodiments, ionizable lipids of the present disclosure have a structure of Formula (AC), wherein the ionizable lipids of the present disclosure have a structure of Formula (AC-A), (AC- B), (AC-C), (AC-D), (AC-D1), (AC-D2), (AC-E), (AC-F), (AC-G), (AC-H), or (AC-I):(AC-D1), (AC-D2),(AC-I), or a pharmaceutically acceptable salt thereof, wherein R1, R, X1, Z, X2, X3, Y1, Y2, R2, R3, R4, R5, R6, R7, R8, and R9are as described in Formula (AC) or as otherwise described in any embodiments below. R1

[0342] In certain embodiments, R1is selected from the group consisting o

[0343] In certain embodiments, R1is selected from the group consisting.

[0344] In certain embodiments, R1is -NR2. In certain embodiments,certain embodiments, R1is. In certain embodiments,certain embodiments,certain embodiments,certain embodiments, R1is In cert1 1ain embodiments, R isIn certain embodiments, R is. In certain embodiments, R1isIn certain embodiments, R1is In certain embodiments, R1is. In certain embodiments, R1is selected from thegroup consisting of -N(Et)2, -N(Me)(Et),1In certain embodiments, R is -N(Et)2. In certain embodiments, R1is -N(Me)2. In certain embodiments, R1is -N(Me)(Et In certain embodiments, R1is -NH2. In certain embodiments, R1is -N(nPr)2. In certain embodiments, R1is - 11N(iPr)2. In certain embodiments, R is -N(Me)(Et). In certain embodiments, R is . In certain embodiments,certain embodiments, R1isX1

[0345] In certain embodiments, X1is optionally substituted C2-C6aliphatic. In certain embodiments, X1is optionally substituted C2-C6alkylene. In certain embodiments, R2is optionally substituted C2alkylene. In certain embodiments, X1is optionally substituted C3alkylene. In certain embodiments, X1is optionally substituted C4 alkylene. In certain embodiments, X1is optionally substituted C5 alkylene. In certain embodiments, X1is optionally substituted C6 alkylene. In certain embodiments, X1is –(CH2)2-. In certain embodiments, X1is –(CH2)3-. In certain embodiments, X1is –(CH2)4-. In certain embodiments, X1is –(CH2)5-. In certain embodiments, X1is –(CH2)6-. In certain embodiments, X1is a bond. Z

[0346] In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC), (AC-A),with an "*" is attached to X1. In certain embodiments, Lipids of the Disclosure have a structure ofFormula (AC), (AC-A), (AC-B), (AC-E), (AC-F), or (AC-I), Z is. In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC), (AC-A), (AC-B), (AC-E), (AC-F), or (AC- I), Z is. In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC), (AC-A), (AC-B), (AC-E), (AC-F), or (AC-I), Z is. In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC), (AC-A), (AC-B), (AC-E), (AC-F), or (AC-I), Z is. In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC), (AC-A), (AC-B), (AC-E), (AC-F), or (AC-I), Z isIn certain embodiments, Lipids of the Disclosure have a structure of Formula (AC), (AC-A), (AC-B), (AC-E), (AC-F), or (AC-I), Y1is . In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC), (AC-A), (AC-B), (AC-E), (AC-F), or (AC-I), Z is. In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC), (AC-A), (AC-B), (AC-E), (AC-F), or (AC-I), Z is. X2and X3

[0347] In certain embodiments, X2and X3are each independently optionally substituted C1-C12 aliphatic. In certain embodiments, X2and X3are the same. In certain embodiments, X2and X3are different.

[0348] In certain embodiments, X2is an optionally substituted C1-C12alkylene. In certain embodiments, X2is an optionally substituted C1-C12 alkenylene. I In certain embodiments, X2is an optionally substituted C1-C10 aliphatic. In certain embodiments, X2is an optionally substituted C1-C10 alkylene. In certain embodiments, X2is an optionally substituted C1-C10 alkenylene. In certain embodiments, X2is an optionally substituted C1-C8 aliphatic. In certain embodiments, X2is an optionally substituted C1-C8alkylene. In certain embodiments, X2is an optionally substituted C1-C8alkenylene. In certain embodiments, X2is an optionally substituted C1-C6aliphatic. In certain embodiments, X2is an optionally substituted C1-C6alkylene. In certain embodiments, X2is an optionally substituted C1-C6 alkenylene. In certain embodiments, X2is an optionally substituted C2-C12aliphatic. In certain embodiments, X2is an optionally substituted C2-C12alkylene. In certain embodiments, X2is an optionally substituted C2-C12alkenylene. In certain embodiments, X2is an optionally substituted C4-C12 aliphatic. In certain embodiments, X2is an optionally substituted C4-C12 alkylene. In certain embodiments, X2is an optionally substituted C4-C12 alkenylene. In certain embodiments, X2is an optionally substituted C4-C10 aliphatic. In certain embodiments, X2is an optionally substituted C4-C10alkylene. In certain embodiments, X2is an optionally substituted C4-C10alkenylene. In certain embodiments, X2is an optionally substituted C6-C8aliphatic. In certain embodiments, X2is an optionally substituted C6-C8alkylene. In certain embodiments, X2is an optionally substituted C6-C8 alkenylene. In certain embodiments, X2is –(CH2)-. In certain embodiments, X2is –(CH2)2-. In certain embodiments, X2is –(CH2)3-. In certain embodiments, X2is – (CH2)4-. In certain embodiments, X2is –(CH2)5-. In certain embodiments, X2is –(CH2)6-. In certain embodiments, X2is –(CH2)7-. In certain embodiments, X2is –(CH2)8-. In certain embodiments, X2is – (CH2)9-. In certain embodiments, X2is –(CH2)10-.

[0349] In certain embodiments, X3is an optionally substituted C1-C12alkylene. In certain embodiments, X3is an optionally substituted C1-C12alkenylene. In certain embodiments, X3is an optionally substituted C1-C10 aliphatic. In certain embodiments, X3is an optionally substituted C1-C10 alkylene. In certain embodiments, X3is an optionally substituted C1-C10 alkenylene. In certain embodiments, X3is an optionally substituted C1-C8 aliphatic. In certain embodiments, X3is an optionally substituted C1-C8alkylene. In certain embodiments, X3is an optionally substituted C1-C8alkenylene. In certain embodiments, X3is an optionally substituted C1-C6aliphatic. In certain embodiments, X3is an optionally substituted C1-C6alkylene. In certain embodiments, X3is an optionally substituted C1-C6alkenylene. In certain embodiments, X3is an optionally substituted C2- C12 aliphatic. In certain embodiments, X3is an optionally substituted C2-C12 alkylene. In certain embodiments, X3is an optionally substituted C2-C12 alkenylene. In certain embodiments, X3is an optionally substituted C4-C12 aliphatic. In certain embodiments, X3is an optionally substituted C4-C12 alkylene. In certain embodiments, X3is an optionally substituted C4-C12alkenylene. In certain embodiments, X3is an optionally substituted C4-C10aliphatic. In certain embodiments, X3is an optionally substituted C4-C10alkylene. In certain embodiments, X3is an optionally substituted C4-C10alkenylene. In certain embodiments, X3is an optionally substituted C6-C8 aliphatic. In certain embodiments, X3is an optionally substituted C6-C8 alkylene. In certain embodiments, X3is an optionally substituted C6-C8 alkenylene. In certain embodiments, X3is –(CH2)-. In certain embodiments, X3is –(CH2)2-. In certain embodiments, X3is –(CH2)3-. In certain embodiments, X3is – (CH2)4-. In certain embodiments, X3is –(CH2)5-. In certain embodiments, X3is –(CH2)6-. In certain embodiments, X3is –(CH2)7-. In certain embodiments, X3is –(CH2)8-. In certain embodiments, X3is – (CH2)9-. In certain embodiments, X3is –(CH2)10-.

[0350] In certain embodiments, X2and X3are both –(CH2)8-. In certain embodiments, X2and X3are both –(CH2)6-.X4

[0351] In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC) or (AC-I), wherein X4is a bond or C2-C6 aliphatic. In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC) or (AC-I), wherein X4is a bond. In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC) or (AC-I), wherein X4is C2-C6 aliphatic. In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC) or (AC-I), wherein X4is C2aliphatic. In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC) or (AC- I), wherein X4is C3aliphatic. In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC) or (AC-I), wherein X4is C4 aliphatic. In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC) or (AC-I), wherein X4is C5 aliphatic. In certain embodiments, Lipids of the Disclosure have a structure of Formula (AC) or (AC-I), wherein X4is C6 aliphatic. Y1and Y2

[0352] In certain embodiments, Y1and Y2are each independently, , ,, , , , , wherein the bond marked with an "*" is attached to X2for Y1or X3for Y2.. In certain embodiments, Y1and Y2are the same. In certain embodiments, Y1and Y2are different.

[0353] In certain embodiments, Y1isIn certain embodiments, Y1isIn certain embodiments, Y1is. In certain embodiments, Y1. In certain embodiments, Y1is. In certain embodiments, Y1. In certain embodiments, In cert1 2ain embodiments, Y isIn certain embodiments, Y is 22. In certain embodiments, Y isIn certain embodiments, Y is. In certain embodiments, Y2is. In certain embodiments, Y2is. In certain embodiments, Y2is. In certain embodiments, Y2is. In certain embodiments,. In certain embodiments, Y1and Y2are both. In certain embodiments, Y1and Y2are both. R2

[0354] In certain embodiments, R2is optionally substituted C1-C6aliphatic. In certain embodiments, R2is optionally substituted C1-C6alkylene. In certain embodiments, R2is optionally substituted methylene. In certain embodiments, R2is optionally substituted C2alkylene. In certain embodiments, R2is optionally substituted C3alkylene. In certain embodiments, R2is optionally substituted C4alkylene. In certain embodiments, R2is optionally substituted C5 alkylene. In certain embodiments, R2is optionally substituted C6 alkylene. In certain embodiments, R2is –(CH2)-. In certain embodiments, R2is –(CH2)2-. In certain embodiments, R2is –(CH2)3-. In certain embodiments, R2is – (CH2)4-. In certain embodiments, R2is –(CH2)5-. In certain embodiments, R2is –(CH2)6-. R3

[0355] In certain embodiments, R3is optionally substituted C1-C6aliphatic. In certain embodiments, R3is optionally substituted C1-C6alkylene. In certain embodiments, R3is optionally substituted methylene. In certain embodiments, R3is optionally substituted C2 alkylene. In certain embodiments, R3is optionally substituted C3 alkylene. In certain embodiments, R3is optionally substituted C4 alkylene. In certain embodiments, R3is optionally substituted C5 alkylene. In certain embodiments, R3is optionally substituted C6alkylene. In certain embodiments, R3is –(CH2)-. In certain embodiments, R3is –(CH2)2-. In certain embodiments, R3is –(CH2)3-. In certain embodiments, R3is – (CH2)4-. In certain embodiments, R3is –(CH2)5-. In certain embodiments, R3is –(CH2)6-.

[0356] In certain embodiments, R2and R3are the same. In certain embodiments, R2and R3are different. R4

[0357] In certain embodiments, R4is -CH(OR6)(OR7).

[0358] In certain embodiments, R4is selected from,R5

[0359] In certain embodiments, R5is optionally substituted C1-C14aliphatic, -CH(OR8)(OR9); or - CH(R8)(R9). In certain embodiments, R5is optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R5is optionally substituted C1-C14aliphatic. In certain embodiments, R5is - CH(OR8)(OR9) . In certain embodiments, R5is -CH(R8)(R9).

[0360] In certain embodiments, one of the methylene linkages of R5is replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12 cycloalkylenyl is selected from:

[0362] In certain embodiments, R4and R5are the same. In certain embodiments, R4and R5are different.

[0363] In certain embodiments, R5is selected from,

[0364] In certain embodiments, R5is selected from,. R6and R7

[0365] In certain embodiments, R6and R7are each independently optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, - NHC(O)- or -C(O)O-.

[0366] In certain embodiments, R6and R7are the same. In certain embodiments, R6and R7are different.

[0367] In certain embodiments, R6is optionally substituted C1-C14 aliphatic. In certain embodiments, R6is optionally substituted C1-C14alkylene. In certain embodiments, R6is optionally substituted C1- C14branched alkylene. In certain embodiments, R6is optionally substituted C1-C14straight chain alkylene. In certain embodiments, R6is optionally substituted C1-C14alkenylene. In certain embodiments, R6is optionally substituted C1-C14 branched alkenylene. In certain embodiments, R6is optionally substituted C1-C14 straight chain alkenylene. In certain embodiments, R6is optionally substituted C6-C10 alkylene. In certain embodiments, R6is optionally substituted –(CH2)5CH3. In certain embodiments, R6is optionally substituted –(CH2)6CH3. In certain embodiments, R6is optionally substituted –(CH2)7CH3. In certain embodiments, R6is optionally substituted –(CH2)8CH3. In certain embodiments, R6is optionally substituted –(CH2)9CH3.

[0368] In certain embodiments, one of the methylene linkages of R6is replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12 cycloalkylenyl is selected from:

[0369] In certain embodiments, R7is optionally substituted C1-C14aliphatic. In certain embodiments, R7is optionally substituted C1-C14alkylene. In certain embodiments, R7is optionally substituted C1- C14 branched alkylene. In certain embodiments, R7is optionally substituted C1-C14 straight chain alkylene. In certain embodiments, R7is optionally substituted C1-C14 alkenylene. In certain embodiments, R7is optionally substituted C1-C14 branched alkenylene. In certain embodiments, R7is optionally substituted C1-C14straight chain alkenylene. In certain embodiments, R7is optionally substituted C6-C10alkylene. In certain embodiments, R7is optionally substituted –(CH2)5CH3. In certain embodiments, R7is optionally substituted –(CH2)6CH3. In certain embodiments, R7is optionally substituted –(CH2)7CH3. In certain embodiments, R7is optionally substituted –(CH2)8CH3. In certain embodiments, R6is optionally substituted –(CH2)9CH3.

[0370] In certain embodiments, one of the methylene linkages of R7is replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0371] In certain embodiments, R6and R7are selected from,R8and R9

[0372] In certain embodiments, R8and R9are each independently optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, - NHC(O)- or -C(O)O-.

[0373] In certain embodiments, R8and R9are the same. In certain embodiments, R8and R9are different.

[0374] In certain embodiments, R8is optionally substituted C1-C14 aliphatic. In certain embodiments, R8is optionally substituted C1-C14 alkylene. In certain embodiments, R8is optionally substituted C1- C14 branched alkylene. In certain embodiments, R8is optionally substituted C1-C14 straight chain alkylene. In certain embodiments, R8is optionally substituted C1-C14 alkenylene. In certain embodiments, R8is optionally substituted C1-C14branched alkenylene. In certain embodiments, R8is optionally substituted C1-C14straight chain alkenylene. In certain embodiments, R8is optionally substituted C6-C10alkylene. In certain embodiments, R8is optionally substituted –(CH2)5CH3. In certain embodiments, R8is optionally substituted –(CH2)6CH3. In certain embodiments, R8is optionally substituted –(CH2)7CH3. In certain embodiments, R8is optionally substituted –(CH2)8CH3. In certain embodiments, R8is optionally substituted –(CH2)9CH3.

[0375] In certain embodiments, one of the methylene linkages of R8is replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0376] In certain embodiments, R9is optionally substituted C1-C14 aliphatic. In certain embodiments, R9is optionally substituted C1-C14 alkylene. In certain embodiments, R9is optionally substituted C1- C14 branched alkylene. In certain embodiments, R9is optionally substituted C1-C14 straight chain alkylene. In certain embodiments, R9is optionally substituted C1-C14alkenylene. In certain embodiments, R9is optionally substituted C1-C14branched alkenylene. In certain embodiments, R9is optionally substituted C1-C14straight chain alkenylene. In certain embodiments, R9is optionally substituted C6-C10alkylene. In certain embodiments, R9is optionally substituted –(CH2)5CH3. Incertain embodiments, R9is optionally substituted –(CH2)6CH3. In certain embodiments, R9is optionally substituted –(CH2)7CH3. In certain embodiments, R9is optionally substituted –(CH2)8CH3. In certain embodiments, R9is optionally substituted –(CH2)9CH3.

[0377] In certain embodiments, one of the methylene linkages of R9is replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0378] In certain embodiments, R8and R9are selected from,

[0379] In some embodiments, Lipids of the Present Disclosure are selected from any lipid in Table (VIII) below or a pharmaceutically acceptable salt thereof: Table (VIII). Non-Limiting Examples of Ionizable Lipids of the Present DisclosureSeries “CO”

[0380] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Application PCT / US2024 / 019990, which is incorporated by reference herein, in its entirety.

[0381] The present disclosure provides compound of Formula (CO):or a pharmaceutically acceptable salt thereof, wherein: R1is selected from the group consisting of -NR2,each R is independently -H or C1-C6 aliphatic; X1is optionally substituted C2-C6aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, - NHC(O)- or -C(O)O-; X2is selected from the group consisting of a bond, -CH2- and -CH2CH2-; X3is selected from the group consisting of a bond, -CH2- and -CH2CH2-; X4and X5are each independently optionally substituted C1-C10 aliphatic; Y1and Y2are each independentlywherein the bond marked with an "*" is attached to X4or X5; R2is optionally substituted C1-C6 aliphatic; R3is optionally substituted C1-C6 aliphatic; R4is -CH(OR6)(OR7); -CH(SR6)(SR7); -CH(R6)(R7); or optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or - C(O)O-;R5is -CH(OR8)(OR9); -CH(SR8)(SR9); -CH(R8)(R9) or optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or - C(O)O-; R6and R7are each independently optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-; and R8and R9are each independently optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. Additional Formulae

[0382] In certain embodiments, the compound of Formula (CO) is a compound of any of the below Formulae:(CO-E), (CO-F),or a pharmaceutically acceptable salt thereof, wherein R1, R, X1, X2, X3, X4, X5, Y1, Y2, R2, R3, R4, R5, R6, R7, R8, and R9are as described in Formula (CO) or as otherwise described in any embodiments below. R1

[0383] As disclosed in Formula (CO), in certain embodiments, R1is selected from the group

[0384] In certain embodiments, R1is -NR2. In certain embodiments,certain embodiments, R1is. In certain embodiments,certain embodiments,certain embodiments,certain embodiments, In certain embodiments, R1is . In1certain embodiments, R is In certain1 1embodiments, R is. In certain embodiments, R is In certain embodiments, R1is

[0385] In certain embodiments, R1is -N(Et)2. In certain embodiments, R1is -N(Me)2. In certain embodiments, R1is -NH2. In certain embodiments, R1is -N(nPr)2. In certain embodiments, R1is - N(iPr)2. In certain embodiments, R1is -N(Me)(Et). In certain embodiments, R1is. X1

[0386] As disclosed in Formula (CO), in certain embodiments, X1is optionally substituted C2-C6aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -NHC(O)- or -C(O)O-. In certain embodiments, X1is optionally substituted C2-C6 aliphatic. In certain embodiments, X1is optionally substituted C2-C6 alkylene. In certain embodiments, X1is optionally substituted C2 alkylene. In certain embodiments, X1is optionally substituted C3alkylene. In certain embodiments, X1is optionally substituted C4alkylene. In certain embodiments, X1is optionally substituted C5alkylene. In certain embodiments, X1is optionally substituted C6alkylene. In certain embodiments, X1is –(CH2)2-. In certain embodiments, X1is –(CH2)3-. In certain embodiments, X1is –(CH2)4-. In certain embodiments, X1is – (CH2)5-. In certain embodiments, X1is –(CH2)6-. X2

[0387] As disclosed in Formula (CO), in certain embodiments, X2is selected from the group consisting of a bond, -CH2- and -CH2CH2-. In certain embodiments, X2is a bond. In certain embodiments, X2is -CH2-. In certain embodiments, X2is -CH2CH2-. X3

[0388] As disclosed in Formula (CO), in certain embodiments, X3is selected from the group consisting of a bond, -CH2- and -CH2CH2-. In certain embodiments, X3is a bond. In certain embodiments, X3is -CH2-. In certain embodiments, X3is -CH2CH2-. In certain embodiments, both X2and X3are -CH2-. In certain embodiments, both X2and X3are -CH2CH2-. In certain embodiments, X2is a bond and X3is -CH2-. In certain embodiments, X2is a bond and X3is - CH2CH2-. In certain embodiments, X3is a bond and X2is -CH2-. In certain embodiments, X3is a bond and X2is - CH2CH2-. X4and X5

[0389] As disclosed in Formula (CO), in certain embodiments, X4and X5are each independently optionally substituted C1-C10 aliphatic. In certain embodiments, X4and X5are the same. In certain embodiments, X4and X5are different.

[0390] In certain embodiments, X4is an optionally substituted C1-C10alkylene. In certain embodiments, X4is an optionally substituted C1-C10alkenylene. In certain embodiments, X4is an optionally substituted C1-C6 alkylene. In certain embodiments, X4is an optionally substituted C1-C6 alkenylene. In certain embodiments, X4is –(CH2)-. In certain embodiments, X4is –(CH2)2-. In certain embodiments, X4is –(CH2)3-. In certain embodiments, X4is –(CH2)4-. In certain embodiments, X4is – (CH2)5-. In certain embodiments, X4is –(CH2)6-.

[0391] In certain embodiments, X5is an optionally substituted C1-C10alkylene. In certain embodiments, X5is an optionally substituted C1-C10alkenylene. In certain embodiments, X5is an optionally substituted C1-C6 alkylene. In certain embodiments, X5is an optionally substituted C1-C6 alkenylene. In certain embodiments, X5is –(CH2)-. In certain embodiments, X5is –(CH2)2-. In certain embodiments, X5is –(CH2)3-. In certain embodiments, X5is –(CH2)4-. In certain embodiments, X5is – (CH2)5-. In certain embodiments, X5is –(CH2)6-.

[0392] In certain embodiments, X4and X5are both –(CH2)-. In certain embodiments, X4and X5are both –(CH2)2-. Y1and Y2

[0393] As disclosed in Formula (CO), in certain embodiments, Y1and Y2are each independently, wherein the bond marked with an "*" is attached to X4or X5. In certain embodiments, Y1and Y2are the same. In certain embodiments, Y1and Y2are different.

[0394] In certain embodiments, Y1is In certain embo1diments, Y isIn certain embodiments, Y1is. In certain embodiments, Y1. In certain embodiments, Y1is. In certain embodiments, Y1is. In certain embodiments, In certai1 2n embodiments, Y is. In certain embodiments, Y is In certain embodiments, Y2is In cert2ain embodiments, Y is . In certain embodiments, Y2is. In certain embodiments, Y2is. In certain embodiments, Y2is . In certain embodiments, Y2is. In certain embodiments,. In certain embodiments, Y1and Y2are both. In certain embodiments, Y1and Y2are both. R2

[0395] As disclosed in Formula (CO), in certain embodiments, R2is optionally substituted C1-C6aliphatic. In certain embodiments, R2is optionally substituted C1-C6alkylene. In certain embodiments, R2is optionally substituted methylene. In certain embodiments, R2is optionally substituted C2alkylene. In certain embodiments, R2is optionally substituted C3alkylene. In certain embodiments, R2is optionally substituted C4 alkylene. In certain embodiments, R2is optionally substituted C5 alkylene. In certain embodiments, R2is optionally substituted C6 alkylene. In certain embodiments, R2is –(CH2)-. In certain embodiments, R2is –(CH2)2-. In certain embodiments, R2is – (CH2)3-. In certain embodiments, R2is –(CH2)4-. In certain embodiments, R2is –(CH2)5-. In certain embodiments, R2is –(CH2)6-. R3

[0396] As disclosed in Formula (CO), in certain embodiments, R3is optionally substituted C1-C6aliphatic. In certain embodiments, R3is optionally substituted C1-C6 alkylene. In certain embodiments, R3is optionally substituted methylene. In certain embodiments, R3is optionally substituted C2 alkylene. In certain embodiments, R3is optionally substituted C3 alkylene. In certain embodiments, R3is optionally substituted C4alkylene. In certain embodiments, R3is optionally substituted C5alkylene. In certain embodiments, R3is optionally substituted C6alkylene. In certain embodiments, R3is –(CH2)-. In certain embodiments, R3is –(CH2)2-. In certain embodiments, R3is – (CH2)3-. In certain embodiments, R3is –(CH2)4-. In certain embodiments, R3is –(CH2)5-. In certain embodiments, R3is –(CH2)6-.

[0397] In certain embodiments, R2and R3are the same. In certain embodiments, R2and R3are different. In certain embodiments, R2and R3are both –(CH2)2-. R4

[0398] As disclosed in Formula (CO), in certain embodiments, R4is -CH(OR6)(OR7); - CH(SR6)(SR7); -CH(R6)(R7); or optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R4is optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S- , -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R4is optionallysubstituted C1-C14aliphatic. In certain embodiments, R4is -CH(OR6)(OR7). In certain embodiments, R4is -CH(R6)(R7). In certain embodiments, R4is -CH(SR6)(SR7).

[0399] In certain embodiments, R4is selected from,.

[0400] In certain embodiments, R4is selected from

[0401] As disclosed in Formula (CO), in certain embodiments, R5is -CH(OR8)(OR9); - CH(SR8)(SR9); -CH(R8)(R9) or optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl,phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R5is optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, phenyl, -O-, -NH-, -S- , -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R5is optionally substituted C1-C14aliphatic. In certain embodiments, R5is -CH(OR8)(OR9) . In certain embodiments, R5is -CH(R8)(R9). In certain embodiments, R5is -CH(SR8)(SR9).

[0402] In certain embodiments, R4and R5are the same. In certain embodiments, R4and R5are different.

[0403] In certain embodiments, R5is selected from,

[0404] In certain embodiments, R5is selected from

[0405] As disclosed in Formula (CO), in certain embodiments, R6and R7are each independently optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)- , -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-.

[0406] In certain embodiments, R6and R7are the same. In certain embodiments, R6and R7are different.

[0407] In certain embodiments, R6is optionally substituted C1-C14 aliphatic. In certain embodiments, R6is optionally substituted C1-C14 alkyl. In certain embodiments, R6is optionally substituted C1-C14 branched alkyl. In certain embodiments, R6is optionally substituted C1-C14 straight chain alkyl. In certain embodiments, R6is optionally substituted C1-C14alkenyl. In certain embodiments, R6is optionally substituted C1-C14branched alkenyl. In certain embodiments, R6is optionally substituted C1-C14straight chain alkenyl. In certain embodiments, R6is optionally substituted C6-C10alkyl. In certain embodiments, R6is optionally substituted –(CH2)5CH3. In certain embodiments, R6is optionally substituted –(CH2)6CH3. In certain embodiments, R6is optionally substituted –(CH2)7CH3. In certain embodiments, R6is optionally substituted –(CH2)8CH3. In certain embodiments, R6is optionally substituted –(CH2)9CH3.

[0408] In certain embodiments, one of the methylene linkages of R6is replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12 cycloalkylenyl is selected from:

[0409] In certain embodiments, R7is optionally substituted C1-C14aliphatic. In certain embodiments, R7is optionally substituted C1-C14alkyl. In certain embodiments, R7is optionally substituted C1-C14branched alkyl. In certain embodiments, R7is optionally substituted C1-C14 straight chain alkyl. In certain embodiments, R7is optionally substituted C1-C14 alkenyl. In certain embodiments, R7is optionally substituted C1-C14 branched alkenyl. In certain embodiments, R7is optionally substituted C1-C14straight chain alkenyl. In certain embodiments, R7is optionally substituted C6-C10alkyl. In certain embodiments, R7is optionally substituted –(CH2)5CH3. In certain embodiments, R7is optionally substituted –(CH2)6CH3. In certain embodiments, R7is optionally substituted –(CH2)7CH3. In certain embodiments, R7is optionally substituted –(CH2)8CH3. In certain embodiments, R6is optionally substituted –(CH2)9CH3.

[0410] In certain embodiments, one of the methylene linkages of R7is replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0411] In certain embodiments, R6and R7are selected from,

[0412] In certain embodiments, each R6and R7are each independently selected from an optionally substituted bridged bicyclic C5-C12cycloalkylenyl. In certain embodiments, R6is an optionally substituted bridged multicyclic C5-C12 cycloalkylenyl. In certain embodiments, R7is an optionally substituted bridged bicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is selected from adamantyl, bicyclo[2.2.2]octyl, cubanyl, bicyclo[1.1.1]pentyl, bicyclo[2.2.1]heptyl, bicyclo[3.1.1]heptyl, and bicyclo[3.2.1]octyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl is selected from:. In certain embodiments, the substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is a structure selected from, , , , ,, wherein one or more C-H bonds are substituted.

[0413] In certain embodiments, R6and R7taken together form an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl is selected from:, ,R8and R9

[0414] As disclosed in Formula (CO), in certain embodiments, R8and R9are each independently optionally substituted C1-C14 aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)- , -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-.

[0415] In certain embodiments, R8and R9are the same. In certain embodiments, R8and R9are different.

[0416] In certain embodiments, R8is optionally substituted C1-C14aliphatic. In certain embodiments, R8is optionally substituted C1-C14alkyl. In certain embodiments, R8is optionally substituted C1-C14branched alkyl. In certain embodiments, R8is optionally substituted C1-C14 straight chain alkyl. In certain embodiments, R8is optionally substituted C1-C14 alkenyl. In certain embodiments, R8is optionally substituted C1-C14 branched alkenyl. In certain embodiments, R8is optionally substituted C1-C14straight chain alkenyl. In certain embodiments, R8is optionally substituted C6-C10alkyl. In certain embodiments, R8is optionally substituted –(CH2)5CH3. In certain embodiments, R8is optionally substituted –(CH2)6CH3. In certain embodiments, R8is optionally substituted –(CH2)7CH3. In certain embodiments, R8is optionally substituted –(CH2)8CH3. In certain embodiments, R8is optionally substituted –(CH2)9CH3.

[0417] In certain embodiments, one of the methylene linkages of R8is replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0418] In certain embodiments, R9is optionally substituted C1-C14aliphatic. In certain embodiments, R9is optionally substituted C1-C14 alkyl. In certain embodiments, R9is optionally substituted C1-C14 branched alkyl. In certain embodiments, R9is optionally substituted C1-C14 straight chain alkyl. In certain embodiments, R9is optionally substituted C1-C14 alkenyl. In certain embodiments, R9is optionally substituted C1-C14branched alkenyl. In certain embodiments, R9is optionally substituted C1-C14straight chain alkenyl. In certain embodiments, R9is optionally substituted C6-C10alkyl. In certain embodiments, R9is optionally substituted –(CH2)5CH3. In certain embodiments, R9is optionally substituted –(CH2)6CH3. In certain embodiments, R9is optionally substituted –(CH2)7CH3. In certain embodiments, R9is optionally substituted –(CH2)8CH3. In certain embodiments, R9is optionally substituted –(CH2)9CH3.

[0419] In certain embodiments, one of the methylene linkages of R9is replaced with an optionally substituted C3-C8cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5- C12cycloalkylenyl is selected from:

[0420] In certain embodiments, R8and R9are selected from,

[0421] In some embodiments, R8and R9taken together form an optionally substituted bridged bicyclic or multicyclic C4-C14 cycloalkyl or optionally substituted bridged bicyclic or multicyclic 4-14 membered heterocyclyl.

[0422] In certain embodiments, each R8and R9are each independently selected from an optionally substituted bridged bicyclic C5-C12cycloalkylenyl. In certain embodiments, R8is an optionally substituted bridged multicyclic C5-C12cycloalkylenyl. In certain embodiments, R9is an optionally substituted bridged bicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is selected from adamantyl, bicyclo[2.2.2]octyl, cubanyl, bicyclo[1.1.1]pentyl, bicyclo[2.2.1]heptyl, bicyclo[3.1.1]heptyl, and bicyclo[3.2.1]octyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is selected from:. In certain embodiments, the substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl is a structure selected from,, wherein one or more C-H bonds are substituted.

[0423] In certain embodiments, R8and R9taken together form an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is selected from:, ,

[0424] In some embodiments, Lipids of the Present Disclosure are selected from any lipid in Table (IX) below or a pharmaceutically acceptable salt thereof: Table (IX). Non-Limiting Examples of Ionizable Lipids of the Present DisclosureSeries “CC”

[0425] In some embodiments, an LNP of the present disclosure comprises an ionizable lipid disclosed in PCT Application PCT / US2024 / 019990, which is incorporated by reference herein, in its entirety.

[0426] The present disclosure provides compound of Formula (CC)or a pharmaceutically acceptable salt thereof, wherein: R1is selected from the group consisting of -OH, -OAc, -NR2,each R is independently -H or C1-C6aliphatic; X1is optionally substituted C2-C6aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, - NHC(O)- or -C(O)O-; X2is selected from the group consisting of a bond, -CH2- and -CH2CH2-; X2’is selected from the group consisting of a bond, -CH2- and -CH2CH2-; X3is selected from the group consisting of a bond, -CH2- and -CH2CH2-; X3’is selected from the group consisting of a bond, -CH2- and -CH2CH2-; X4and X5are independently optionally substituted C1-C10aliphatic; Y1and Y2are independently selected from the group consisting ofwherein the bond marked with an "*" is attached to X4or X5; R2is optionally substituted C1-C6aliphatic; R3is optionally substituted C1-C6aliphatic; R4is -CH(OR6)(OR7); -CH(SR6)(SR7); -CH(SR8)(SR9); -CH(R6)(R7); -R10; or optionally substituted C1-C14 aliphatic-R10wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, - OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-;R5is -CH(OR8)(OR9); -CH(SR8)(SR9); -CH(R8)(R9); optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, - NHC(O)- or -C(O)O-; -R11; or optionally substituted C1-C14 aliphatic-R11, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-; R6and R7are each independently -R10; optionally substituted -C1-C14aliphatic-R10; wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, - NHC(O)- or -C(O)O-; R8and R9are each independently -R11; optionally substituted -C1-C14 aliphatic wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3- C8cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-; or optionally substituted -C1-C14aliphatic-R11wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, phenyl, - O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-; and each R10and R11is independently an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, or two R10or two R11taken together form an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl; or each R10and R11is independently an optionally substituted cyclic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic C4-C14cycloalkyl or optionally substituted cyclic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic 4-14 membered heterocyclyl, or two R10or two R11taken together form an optionally substituted bridged bicyclic or multicyclic C4-C14 cycloalkyl or optionally substituted bridged bicyclic or multicyclic 4-14 membered heterocyclyl. Additional Formulae

[0427] In certain embodiments, the compound of Formula (CC) is a compound of any one of the Formulae below:(CC-L), (CC-M), or a pharmaceutically acceptable salt thereof, wherein R1, R, X1, X4, X5, Y1, Y2, R2, R3, R4, R5, R6, R7, R8, R9,R10, R11,are as described in Formula (CC) or (CC’) or as otherwise described in any embodiments below.

[0428] R1

[0429] As disclosed in Formula (CC), in certain embodiments, R1is selected from the group

[0430] In certain embodiments, R1is -OH. In certain embodiments, R1is -OAc. In certain embodiments, R1is -NR2. In certain embodiments,certain embodiments, . In certain e1 1mbodiments, R is. In certain embodiments, R is . In certain embodiments, R1is . In cert1ain embodiments, R is. certain embodiments,certain embodiments,embodiments, R1is. In certain embodiments, R1isIn certain embodiments,

[0431] In certain embodiments, R1is -N(Et)2. In certain embodiments, R1is -N(Me)2. In certain embodiments, R1is -NH2. In certain embodiments, R1is -N(nPr)2. In certain embodiments, R1is - N(iPr)2. In certain embodiments, R1is -N(Me)(Et). In certain embodiments, R1is OH. In certain embodiments,X1

[0432] As disclosed in Formula (CC), in certain embodiments, X1is optionally substituted C2-C6aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -NHC(O)- or -C(O)O-. In certain embodiments, X1is optionally substituted C2-C6 aliphatic. In certain embodiments, X1is optionally substituted C2-C6 alkylene. In certain embodiments, X1is optionally substituted C2 alkylene. In certain embodiments, X1is optionally substituted C3alkylene. In certain embodiments, X1is optionally substituted C4alkylene. In certain embodiments, X1is optionally substituted C5alkylene. In certain embodiments,X1is optionally substituted C6alkylene. In certain embodiments, X1is –(CH2)2-. In certain embodiments, X1is –(CH2)3-. In certain embodiments, X1is –(CH2)4-. In certain embodiments, X1is – (CH2)5-. In certain embodiments, X1is –(CH2)6-. X2

[0433] As disclosed in Formula (CC), in certain embodiments, X2is selected from the group consisting of a bond, -CH2- and -CH2CH2-. In certain embodiments, X2is a bond. In certain embodiments, X2is -CH2-. In certain embodiments, X2is -CH2CH2-. X2’

[0434] As disclosed in Formula (CC), in certain embodiments, X2’is selected from the group consisting of a bond, -CH2- and -CH2CH2-. In certain embodiments, X2’is a bond. In certain embodiments, X2’is -CH2-. In certain embodiments, X2’is -CH2CH2-. X3

[0435] As disclosed in Formula (CC), in certain embodiments, X3is selected from the group consisting of a bond, -CH2- and -CH2CH2-. In certain embodiments, X3is a bond. In certain embodiments, X3is -CH2-. In certain embodiments, X3is -CH2CH2-. X3’

[0436] As disclosed in Formula (CC), in certain embodiments, X3’is selected from the group consisting of a bond, -CH2- and -CH2CH2-. In certain embodiments, X3’is a bond. In certain embodiments, X3’is -CH2-. In certain embodiments, X3’is -CH2CH2-.

[0437] In certain embodiments, each of X2, X2’, X3and X3’are each -CH2-. In certain embodiments, both X2and X3are each -CH2-; X3’is a bond, and X2’is -CH2CH2-. X4and X5

[0438] As disclosed in Formula (CC), in certain embodiments, X4and X5are each independently optionally substituted C1-C10 aliphatic. In certain embodiments, X4and X5are the same. In certain embodiments, X4and X5are different.

[0439] In certain embodiments, X4is an optionally substituted C1-C10alkylene. In certain embodiments, X4is an optionally substituted C1-C10alkenylene. In certain embodiments, X4is an optionally substituted C1-C6alkylene. In certain embodiments, X4is an optionally substituted C1-C6alkenylene. In certain embodiments, X4is –(CH2)-. In certain embodiments, X4is –(CH2)2-. In certain embodiments, X4is –(CH2)3-. In certain embodiments, X4is –(CH2)4-. In certain embodiments, X4is – (CH2)5-. In certain embodiments, X4is –(CH2)6-.

[0440] In certain embodiments, X5is an optionally substituted C1-C10 alkylene. In certain embodiments, X5is an optionally substituted C1-C10alkenylene. In certain embodiments, X5is an optionally substituted C1-C6alkylene. In certain embodiments, X5is an optionally substituted C1-C6alkenylene. In certain embodiments, X5is –(CH2)-. In certain embodiments, X5is –(CH2)2-. In certain embodiments, X5is –(CH2)3-. In certain embodiments, X5is –(CH2)4-. In certain embodiments, X5is – (CH2)5-. In certain embodiments, X5is –(CH2)6-.

[0441] In certain embodiments, X4and X5are both –(CH2)-. In certain embodiments, X4and X5are both –(CH2)2-. Y1and Y2

[0442] As disclosed in Formula (CC), in certain embodiments, Y1and Y2are each independently, wherein the bond marked with an "*" is attached to X4or X5. In certain embodiments, Y1and Y2are the same. In certain embodiments, Y1and Y2are different.

[0443] In certain embodiments, Y1is. In certain embodiments, Y1is. In certain embodiments, Y1is. In certain embodiments, Y1is. In certain embodiments, Y1is. In certain embodiments, Y1is . In certain embodiments,. In certain embodiments, Y1is. In certain embodiments, Y2is. In certain embodiments, Y2is. In certain embodiments, Y2is. In certain embodiments, Y2is. In certain embodiments, Y2is. In certain diments, Y2embo is . In certain embodiments, Y2is . In certain embodiments,. In certain embodiments, Y1and Y2are both. In certain embodiments, Y1and Y2are both. R2

[0444] As disclosed in Formula (CC), in certain embodiments, R2is optionally substituted C1-C6 aliphatic. In certain embodiments, R2is optionally substituted C1-C6 alkylene. In certain embodiments, R2is optionally substituted methylene. In certain embodiments, R2is optionally substituted C2 alkylene. In certain embodiments, R2is optionally substituted C3 alkylene. In certainembodiments, R2is optionally substituted C4alkylene. In certain embodiments, R2is optionally substituted C5alkylene. In certain embodiments, R2is optionally substituted C6alkylene. In certain embodiments, R2is –(CH2)-. In certain embodiments, R2is –(CH2)2-. In certain embodiments, R2is – (CH2)3-. In certain embodiments, R2is –(CH2)4-. In certain embodiments, R2is –(CH2)5-. In certain embodiments, R2is –(CH2)6-. R3

[0445] As disclosed in Formula (CC), in certain embodiments, R3is optionally substituted C1-C6aliphatic. In certain embodiments, R3is optionally substituted C1-C6alkylene. In certain embodiments, R3is optionally substituted methylene. In certain embodiments, R3is optionally substituted C2 alkylene. In certain embodiments, R3is optionally substituted C3 alkylene. In certain embodiments, R3is optionally substituted C4 alkylene. In certain embodiments, R3is optionally substituted C5 alkylene. In certain embodiments, R3is optionally substituted C6 alkylene. In certain embodiments, R3is –(CH2)-. In certain embodiments, R3is –(CH2)2-. In certain embodiments, R3is – (CH2)3-. In certain embodiments, R3is –(CH2)4-. In certain embodiments, R3is –(CH2)5-. In certain embodiments, R3is –(CH2)6-.

[0446] In certain embodiments, R2and R3are the same. In certain embodiments, R2and R3are different. In certain embodiments, R2and R3are both –(CH2)2-. R4

[0447] As disclosed in Formula (CC), in certain embodiments, R4is -CH(OR6)(OR7); - CH(SR6)(SR7); -CH(SR8)(SR9); -CH(R6)(R7); -R10; or optionally substituted C1-C14aliphatic-R10wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)- , -NHC(O)- or -C(O)O-. In certain embodiments, R4is optionally substituted C1-C14 aliphatic-R10, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or - C(O)O-. In certain embodiments, R4is optionally substituted C1-C14aliphatic-R10. In certain embodiments, R4is -CH(OR6)(OR7). In certain embodiments, R4is -CH(R6)(R7). In certain embodiments, R4is -CH(SR6)(SR7). In certain embodiments, R4is -CH(SR8)(SR9). In certain embodiments, R4is R10.

[0448] In certain embodiments, R4is selected from

[0449] In certain embodiments, R4is selected from

[0450] As disclosed in Formula (CC), in certain embodiments, R5is -CH(OR8)(OR9); - CH(SR8)(SR9); -CH(R8)(R9); optionally substituted C1-C14aliphatic, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-; - R11; or optionally substituted C1-C14 aliphatic-R11, wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, phenyl, - O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-. In certain embodiments, R5is optionally substituted C1-C14aliphatic. In certain embodiments, R5is -CH(OR8)(OR9) . In certain embodiments, R5is -CH(R8)(R9). In certain embodiments, R5is -CH(SR8)(SR9). In certain embodiments, R5is R11.

[0451] In certain embodiments, R4and R5are the same. In certain embodiments, R4and R5are different.

[0452] In certain embodiments, R5is selected from,, d

[0453] In certain embodiments, R5is selected fromR6and R7

[0454] As disclosed in Formula (CC), in certain embodiments, R6and R7are each independently - R10; optionally substituted -C1-C14aliphatic-R10; wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, phenyl, - O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-.

[0455] In certain embodiments, R6and R7are the same. In certain embodiments, R6and R7are different.

[0456] In certain embodiments, R6is R10. In certain embodiments, R6is optionally substituted C1-C14aliphatic-R10. In certain embodiments, R6is optionally substituted C1-C14alkyl-R10. In certain embodiments, R6is optionally substituted C1-C14branched alkyl-R10. In certain embodiments, R6is optionally substituted C1-C14 straight chain alkyl-R10. In certain embodiments, R6is optionally substituted C1-C14 alkenyl-R10. In certain embodiments, R6is optionally substituted C1-C14 branched alkenyl-R10. In certain embodiments, R6is optionally substituted C1-C14 straight chain alkenyl-R10. Incertain embodiments, R6is optionally substituted C1-C5alkyl-R10. In certain embodiments, R6is optionally substituted –(CH2)-R10. In certain embodiments, R6is optionally substituted –(CH2)2-R10. In certain embodiments, R6is optionally substituted –(CH2)3-R10. In certain embodiments, R6is optionally substituted –(CH2)4-R10. In certain embodiments, R6is optionally substituted –(CH2)5-R10.

[0457] In certain embodiments, R7is R10. In certain embodiments, R7is optionally substituted C1-C14 aliphatic-R10. In certain embodiments, R7is optionally substituted C1-C14alkyl-R10. In certain embodiments, R7is optionally substituted C1-C14branched alkyl-R10. In certain embodiments, R7is optionally substituted C1-C14straight chain alkyl-R10. In certain embodiments, R7is optionally substituted C1-C14 alkenyl-R10. In certain embodiments, R7is optionally substituted C1-C14 branched alkenyl-R10. In certain embodiments, R7is optionally substituted C1-C14 straight chain alkenyl-R10. In certain embodiments, R7is optionally substituted C1-C5 alkyl-R10. In certain embodiments, R7is optionally substituted –(CH2)-R10. In certain embodiments, R7is optionally substituted –(CH2)2-R10. In certain embodiments, R7is optionally substituted –(CH2)3-R10. In certain embodiments, R7is optionally substituted –(CH2)4-R10. In certain embodiments, R7is optionally substituted –(CH2)5-R10.

[0458] In certain embodiments, R6and R7are selected from. R8and R9

[0459] As disclosed in Formula (CC), in certain embodiments, R8and R9are each independently R11; optionally substituted -C1-C14 aliphatic wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8 cycloalkylenyl, phenyl, -O-, -NH-, - S-, -SS-, -C(O)-, -OC(O)O-, -OC(O)-, -NHC(O)- or -C(O)O-; or optionally substituted -C1-C14 aliphatic-R11wherein one or more methylene linkages are each optionally and independently replaced with an optionally substituted C3-C8cycloalkylenyl, phenyl, -O-, -NH-, -S-, -SS-, -C(O)-, -OC(O)O-, - OC(O)-, -NHC(O)- or -C(O)O-.

[0460] In certain embodiments, R8and R9are the same. In certain embodiments, R8and R9are different.

[0461] In certain embodiments, R8is R11. In certain embodiments, R8is optionally substituted C1-C14 aliphatic. In certain embodiments, R8is optionally substituted C1-C14 alkyl. In certain embodiments, R8is optionally substituted C1-C14branched alkyl. In certain embodiments, R8is optionally substituted C1-C14straight chain alkyl. In certain embodiments, R8is optionally substituted C1-C14alkenyl. In certain embodiments, R8is optionally substituted C1-C14branched alkenyl. In certain embodiments, R8is optionally substituted C1-C14 straight chain alkenyl. In certain embodiments, R8is optionally substituted C6-C10 alkyl. In certain embodiments, R8is optionally substituted –(CH2)5CH3. In certain embodiments, R8is optionally substituted –(CH2)6CH3. In certain embodiments, R8is optionally substituted –(CH2)7CH3. In certain embodiments, R8is optionally substituted –(CH2)8CH3. In certain embodiments, R8is optionally substituted –(CH2)9CH3.

[0462] In certain embodiments, R8is optionally substituted C1-C14aliphatic-R11. In certain embodiments, R8is optionally substituted C1-C14alkylene-R11. In certain embodiments, R8is optionally substituted C1-C14 branched alkylene-R11. In certain embodiments, R8is optionally substituted C1-C14 straight chain alkylene-R11. In certain embodiments, R8is optionally substituted C1- C14 alkenylene-R11. In certain embodiments, R8is optionally substituted C1-C14 branched alkenylene- R11. In certain embodiments, R8is optionally substituted C1-C14straight chain alkenylene-R11. In certain embodiments, R8is optionally substituted C1-C5alkylene-R11. In certain embodiments, R8is optionally substituted –(CH2)-R11. In certain embodiments, R8is optionally substituted –(CH2)2-R11. In certain embodiments, R8is optionally substituted –(CH2)3-R11. In certain embodiments, R8is optionally substituted –(CH2)4-R11. In certain embodiments, R8is optionally substituted –(CH2)5-R11.

[0463] In certain embodiments, R9is R11. In certain embodiments, R9is optionally substituted C1-C14 aliphatic. In certain embodiments, R9is optionally substituted C1-C14 alkyl. In certain embodiments, R9is optionally substituted C1-C14branched alkyl. In certain embodiments, R9is optionally substituted C1-C14straight chain alkyl. In certain embodiments, R9is optionally substituted C1-C14alkenyl. In certain embodiments, R9is optionally substituted C1-C14branched alkenyl. In certain embodiments, R9is optionally substituted C1-C14 straight chain alkenyl. In certain embodiments, R9is optionally substituted C6-C10 alkyl. In certain embodiments, R9is optionally substituted –(CH2)5CH3. In certain embodiments, R9is optionally substituted –(CH2)6CH3. In certain embodiments, R9is optionally substituted –(CH2)7CH3. In certain embodiments, R9is optionally substituted –(CH2)8CH3. In certain embodiments, R9is optionally substituted –(CH2)9CH3.

[0464] In certain embodiments, R9is optionally substituted C1-C14aliphatic-R11. In certain embodiments, R9is optionally substituted C1-C14alkylene-R11. In certain embodiments, R9is optionally substituted C1-C14 branched alkylene-R11. In certain embodiments, R9is optionally substituted C1-C14 straight chain alkylene-R11. In certain embodiments, R9is optionally substituted C1- C14 alkenylene-R11. In certain embodiments, R9is optionally substituted C1-C14 branched alkenylene- R11. In certain embodiments, R9is optionally substituted C1-C14straight chain alkenylene-R11. In certain embodiments, R9is optionally substituted C1-C5alkylene-R11. In certain embodiments, R9is optionally substituted –(CH2)-R11. In certain embodiments, R9is optionally substituted –(CH2)2-R11. In certain embodiments, R9is optionally substituted –(CH2)3-R11. In certain embodiments, R9is optionally substituted –(CH2)4-R11. In certain embodiments, R9is optionally substituted –(CH2)5-R11.

[0465] In certain embodiments, R8and R9are selected from,d In certain embodiments, R8and R9are selected from

[0466] R10and R11

[0467] As disclosed in Formula (CC), in certain embodiments, each R10and R11are an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl, or two R10or two R11taken together form an optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl.

[0468] In certain embodiments, each R10and R11are the same. In certain embodiments, each R10and R11are different.

[0469] In some embodiments, each R10and R11is independently an optionally substituted cyclic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic C4-C14 cycloalkyl or optionally substituted cyclic, bicyclic, bridged bicyclic, multicyclic or bridged multicyclic 4-14 membered heterocyclyl, or two R10or two R11taken together form an optionally substituted bridged bicyclic or multicyclic C4-C14cycloalkyl or optionally substituted bridged bicyclic or multicyclic 4-14 membered heterocyclyl.

[0470] In certain embodiments, each R10is an optionally substituted bridged bicyclic C5-C12cycloalkylenyl. In certain embodiments, each R10is an optionally substituted bridged multicyclic C5- C12 cycloalkylenyl. In certain embodiments, each R11is an optionally substituted bridged bicyclic C5- C12 cycloalkylenyl. In certain embodiments, each R11is an optionally substituted bridged multicyclic C5-C12cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl is selected from adamantyl, bicyclo[2.2.2]octyl, cubanyl, bicyclo[1.1.1]pentyl, bicyclo[2.2.1]heptyl, bicyclo[3.1.1]heptyl, and bicyclo[3.2.1]octyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl is selected from:. In certain embodiments, the substituted bridged bicyclic or multicyclic C5-C12cycloalkylenyl is a structure selected from,, wherein one or more C-H bonds are substituted.

[0471] In certain embodiments, two R10taken together form an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, two R11taken together form an optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl. In certain embodiments, the optionally substituted bridged bicyclic or multicyclic C5-C12 cycloalkylenyl is

[0472] In some embodiments, Lipids of the Present Disclosure are selected from any lipid in Table (X) below or a pharmaceutically acceptable salt thereof: Table (X). Non-Limiting Examples of Ionizable Lipids of the Present Disclosureii. Structural lipids

[0473] In some embodiments, an LNP comprises a structural lipid. Structural lipids can be selected from the group consisting of, but are not limited to, cholesterol, fecosterol, fucosterol, beta sitosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, cholic acid, sitostanol, litocholic acid, tomatine, ursolic acid, alpha-tocopherol, Vitamin D3, Vitamin D2, Calcipotriol, botulin, lupeol, oleanolic acid, beta-sitosterol-acetate and mixtures thereof. In some embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid is a cholesterol analogue disclosed by Patel, et al., Nat Commun., 11, 983 (2020), which is incorporated herein by reference in its entirety. In some embodiments, the structural lipid includes cholesterol and a corticosteroid (such as prednisolone, dexamethasone, prednisone, and hydrocortisone), or any combinations thereof. In some embodiments, a structural lipid is described in international patent application WO2019152557A1, which is incorporated herein by reference in its entirety.

[0474] In some embodiments, a structural lipid is a cholesterol analog. Using a cholesterol analog may enhance endosomal escape as described in Patel et al., Naturally-occurring cholesterol analogues in lipid nanoparticles induce polymorphic shape and enhance intracellular delivery of mRNA, Nature Communications (2020), which is incorporated herein by reference.

[0475] In some embodiments, a structural lipid is a phytosterol. Using a phytosterol may enhance endosomal escape as described in Herrera et al., Illuminating endosomal escape of polymorphic lipid nanoparticles that boost mRNA delivery, Biomaterials Science (2020), which is incorporated herein by reference.

[0476] In some embodiments, a structural lipid contains plant sterol mimetics for enhanced endosomal release. iii. PEGylated lipids

[0477] A PEGylated lipid is a lipid modified with polyethylene glycol. The term “PEGylated lipid” is used interchangeably herein with the shortened term “PEG lipid”.

[0478] In some embodiments, an LNP comprises one, two or more PEGylated lipid or PEG-modified lipid. A PEGylated lipid may be selected from the non-limiting group consisting of PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG- modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixturesthereof. For example, a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.

[0479] In some embodiments, the PEGylated lipid is selected from (R)-2,3-bis(octadecyloxy)propyl- 1-(methoxypoly(ethyleneglycol)2000)propylcarbamate, PEG-S-DSG, PEG-S-DMG, PEG-PE, PEG- PAA, PEG-OH DSPE C18, PEG-DSPE, PEG-DSG, PEG-DPG, PEG-DOMG, PEG-DMPE Na, PEG- DMPE, PEG-DMG2000, PEG-DMG C14, PEG-DMG 2000, PEG-DMG, PEG-DMA, PEG-Ceramide C16, PEG-C-DOMG, PEG-c-DMOG, PEG-c-DMA, PEG-cDMA, PEGA, PEG750-C-DMA, PEG400, PEG2k-DMG, PEG2k-C11, PEG2000-PE, PEG2000P, PEG2000-DSPE, PEG2000-DOMG, PEG2000-DMG, PEG2000-C-DMA, PEG2000, PEG200, PEG(2k)-DMG, PEG DSPE C18, PEG DMPE C14, PEG DLPE C12, PEG Click DMG C14, PEG Click C12, PEG Click C10, N(Carbonyl- methoxypolyethylenglycol-2000)-l,2-distearoyl-sn-glycero3-phosphoethanolamine, Myrj52, mPEG- PLA, MPEG-DSPE, mPEG3000-DMPE, MPEG-2000-DSPE, MPEG2000-DSPE, mPEG2000-DPPE, mPEG2000-DMPE, mPEG2000-DMG, mDPPE-PEG2000, l,2-distearoyl-sn-glycero-3- phosphoethanolamine-PEG2000, HPEG-2K-LIPD, Folate PEG-DSPE, DSPE-PEGMA 500, DSPE- PEGMA, DSPE-PEG6000, DSPE-PEG5000, DSPE-PEG2K-NAG, DSPE-PEG2k, DSPE- PEG2000maleimide, DSPE-PEG2000, DSPE-PEG, DSG-PEGMA, DSG-PEG5000, DPPE-PEG-2K, DPPE-PEG, DPPE-mPEG2000, DPPE-mPEG, DPG-PEGMA, DOPE-PEG2000, DMPE-PEGMA, DMPE-PEG2000, DMPE-Peg, DMPE-mPEG2000, DMG-PEGMA, DMG-PEG2000, DMG-PEG, distearoyl-glycerol-polyethyleneglycol, Cl8PEG750, CI8PEG5000, CI8PEG3000, CI8PEG2000, CI6PEG2000, CI4PEG2000, C18-PEG5000, C18PEG, C16PEG, C16 mPEG (polyethylene glycol) 2000 Ceramide, C14-PEG-DSPE200, C14-PEG2000, C14PEG2000, C14-PEG 2000, C14-PEG, C14PEG, 14:0-PEG2KPE, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-PEG2000, (R)-2,3- bis(octadecyloxy)propyl-1-(methoxypoly(ethyleneglycol)2000)propylcarbamate, (PEG)-C-DOMG, PEG-C-DMA, and DSPE-PEG-X.

[0480] In some embodiments, the LNP comprises a PEGylated lipid disclosed in one of US 2019 / 0240354; US 2010 / 0130588; US 2021 / 0087135; WO 2021 / 204179; US 2021 / 0128488; US 2020 / 0121809; US 2017 / 0119904; US 2013 / 0108685; US 2013 / 0195920; US 2015 / 0005363; US 2014 / 0308304; US 2013 / 0053572; WO 2019 / 232095A1; WO 2021 / 077067; WO 2019 / 152557; US 2015 / 0203446; US 2017 / 0210697; US 2014 / 0200257; or WO 2019 / 089828A1, each of which is incorporated by reference herein in their entirety.

[0481] In some embodiments, the LNP comprises a PEGylated lipid substitute in place of the PEGylated lipid. All embodiments disclosed herein that contemplate a PEGylated lipid should be understood to also apply to PEGylated lipid substitutes. In some embodiments, the LNP comprises a polysarcosine-lipid conjugate, such as those disclosed in US 2022 / 0001025 A1, which is incorporated by reference herein in its entirety. In some embodiments the LNP comprises a polyoxazoline-lipid conjugate, such as those disclosed in US 2022 / 0249695 A1, which is incorporated by reference herein in its entirety.

[0482] In some embodiments, the LNP comprises a PEGylated lipid disclosed and described in PCT Application WO2024044728A1, which is incorporated by reference herein, in its entirety. In certain embodiments, the PEGylated lipid is a lipid of any one of formulas PL-I’, PL-I’’, PL-I, PL-Ia, PL-Ib, PL-Iaa, PL-Iab, PL-Iac, PL-Iad, PL-Iae, PL-Iaf, PL-Iag, PL-Iah, PL-Iba, PL-Ibb, PL-Ibc, PL-Ibd, PL- Ibe, PL-Ibf, PL-Ibg, PL-Ibh, PL-Ica, PL-Icb, PL-Icc, PL-Icd, PL-Id PL-Ie, PL-If, PL-Ig, PL-Ih, PL-Ii, PL-Iha, PL-Ihb, PL-Ihc, PL-Ihd, PL-Iia, PL-Iib, PL-Iic, PL-Iid, PL-Ij, PL-Ik, L-Il, PL-Im, PL-In, PL- Io, PL-Ip, PL-Iq, PL-Ioa, PL-Iob, PL-Ioc, PL-Iod, PL-Ioe, PL-Iof, PL-Iog, PL-Ioh, PL-Ipa, PL-Ipb, PL-Ipc, PL-Ipd, PL-Ipe, PL-Ipf, PL-Ipg, PL-Iph, PL-Iqa, PL-Iqb, PL-Iqc, PL-Iqd, PL-Ir, PL-Is, PL-It, PL-Iu, PL-Iv, PL-Iw, PL-Iva, PL-Ivb, PL-Ivc, PL-Ivd, PL-Iwa, PL-Iwb, PL-Iwc, PL-Iwd, PL-Ix, PL- Ixx, PL-Iy, PL-Iyy, PL-Iyyy, PL-Iz, PL-Izz, PL-Izzz, PL-II’, PL-II’’, PL-II, PL-IIc, PL-IId, PL-IIe, PL-IIf, PL-IIg, PL-IIh, PL-IIa, PL-IIb, PL-IIk, PL-IIm or PL-IIn.

[0483] In some embodiments, the PEGylated lipid is a compound of formula PL-I’:or a pharmaceutically acceptable salt thereof, wherein: A1is a saturated 5-6 membered carbocyclic ring or a saturated 5-6 membered heterocyclic ring containing 1 or 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, wherein the carbocyclic ring and heterocyclic ring are substituted with t occurrences of R4; X1is -N(H)-, -N(C1-6 alkyl)-, -C1-6 aliphatic-N(H)-, -C1-6 aliphatic-N(C1-6 alkyl)-, -O- or -C1-6 aliphatic-O-; L1is -C(O)(C1-6 aliphatic)C(O)-N(R)-, -C(O)(C1-6 aliphatic)-N(R)C(O)-, -C(O)(C1-6 aliphatic)C(O)O-, -C(O)(C1-6 aliphatic)C(O)-, -C(O)(C1-6 aliphatic)C(O)OCH2-, -C(O)(C1-6 aliphatic)-, -C(O)(C1-6 aliphatic)-N(R)-, or -C(O)-; L2and L3are independently a covalent bond or C1-6alkylene wherein one methylene unit of the C1-6alkylene is optionally replaced with -O-, -NR-, -S-, -S-S-, -S(O)-, -S(O)2-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(R)-, -N(R)C(O)O-, -C(O)N(R)-, -N(R)C(O)-, -N(R)C(O)N(R)-, -C(R5)=N-, or - C(R5)=N-O-; R1is H, C1-6 alkyl, -(C1-6 alkyl)-N3, -(C1-6 alkyl)-SH, or C3-8 alkynyl; R2and R3are independently a straight or branched C6-30 alkyl, straight or branched C6-30 alkenyl, or straight or branched C6-30alkynyl; wherein 1, 2, or 3 methylene units are independently and optionally replaced by a saturated or partially unsaturated C3-6carbocyclic ring or phenylene; wherein the alkyl, alkenyl, and alkynyl and any carbocyclic ring or phenylene is substituted with m instances of Rx; R4is C1-4 alkyl; R5is C1-6 alkyl or C2-14 alkenyl;each R is independently hydrogen or an optionally substituted group selected from C1-6aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur; each Rxis independently halogen, -CN, -OR, -SR, -C(O)R, -C(O)OR, or -OC(O)OR; n is an integer from 10-75, inclusive; m is 0, 1, 2, 3, or 4; and t is 0, 1, or 2.

[0484] In some embodiments, the PEGylated lipid is a compound of formula PL-II’:or a pharmaceutically acceptable salt thereof, wherein: X1is -N(H)-, -N(C1-6 alkyl)-, -C1-6 aliphatic-N(H)-, -C1-6 aliphatic-N(C1-6 alkyl)-, -O- or -C1-6 aliphatic-O-; L1is -C(O)(C1-6aliphatic)C(O)-, -C(O)(C1-6aliphatic)-, or -C(O)-; L2and L3are a covalent bond or C1-6alkylene wherein one methylene unit of the C1-6alkylene is optionally replaced with -O-, -NR-, -S-, -S-S-, -S(O)-, -S(O)2-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(R)-, -N(R)C(O)O-, -C(O)N(R)-, -N(R)C(O)-, -N(R)C(O)N(R)-, -C(R6)=N-, or -C(R6)=N- O-; R1is H, C1-6 alkyl, -(C1-6 alkyl)-N3, -(C1-6 alkyl)-SH, or C3-8 alkynyl; R2and R3are independently straight or branched C6-30 alkyl, straight or branched C6-30 alkenyl, or straight or branched C6-30alkynyl; wherein 1, 2, or 3 methylene units are independently and optionally replaced by a saturated or partially unsaturated C3-6carbocyclic ring or phenylene; wherein the alkyl, alkenyl, and alkynyl and any carbocyclic ring or phenylene is substituted with m instances of Rx; R6is C1-6alkyl or C2-14alkenyl; each R is independently hydrogen or an optionally substituted group selected from C1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected fromnitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur; each Rxis independently halogen, -CN, -OR, -SR, -C(O)R, -C(O)OR, or OC(O)OR; n is an integer from 10-75, inclusive; and m is 0, 1, 2, 3, or 4.

[0485] In some embodiments, the PEGylated lipid compound is one of those shown in Table XI, or a pharmaceutically acceptable salt thereof. Table XI. Exemplary PEGylated Compoundsiv. Phospholipids

[0486] In some embodiments, an LNP of the present disclosure comprises a phospholipid. Phospholipids useful in the compositions and methods may be selected from the non-limiting group consisting of 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2- dimyristoyl-sn-glycero-phosphocholine (DMPC), 1.2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocho line (POPC), 1,2-di-O-octadecenyl-sn- glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuc cinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2- dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoylsn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn- glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2- dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sodium (S)-2-ammonio-3- ((((R)-2-(oleoyloxy)-3-(stearoyloxy)propoxy)oxidophosphoryl)oxy)propanoate (L-^- phosphatidylserine; Brain PS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoylphosphatidylglycerol (DMPG), dioleoyl- phosphatidylethanolamine4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dioleoylphosphatidylglycerol (DOPG), 1,2-dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), acell- fusogenicphospholipid (DPhPE), dipalmitoylphosphatidylethanolamine (DPPE), 1,2-Dielaidoyl-sn- phosphatidylethanolamine (DEPE), dipalmitoylphosphatidylglycerol (DPPG), dipalmitoylphosphatidylserine (DPPS), distearoylphosphatidylcholine (DSPC), distearoyl- phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamineimidazole (DSPEI), 1,2- diundecanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), 1,2-dioleoyl-sn- glycero-3-phosphate (18:1 PA; DOPA), ammonium bis((S)-2-hydroxy-3-(oleoyloxy)propyl) phosphate (18:1 DMP; LBPA), 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol) (DOPI; 18:1 PI), 1,2-distearoyl-sn-glycero-3-phospho-L-serine (18:0 PS), 1,2-dilinoleoyl-sn-glycero-3-phospho-L- serine (18:2 PS), 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (16:0-18:1 PS; POPS), 1- stearoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (18:0-18:1 PS), 1-stearoyl-2-linoleoyl-sn-glycero-3- phospho-L-serine (18:0-18:2 PS), 1-oleoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:1 Lyso PS), 1-stearoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:0 Lyso PS), and sphingomyelin. In some embodiments, an LNP includes DSPC. In certain embodiments, an LNP includes DOPE. In some embodiments, an LNP includes both DSPC and DOPE.

[0487] In some embodiments, an LNP comprises a phospholipid selected from 1-pentadecanoyl-2- oleoyl-sn-glycero-3-phosphocholine, 1-myristoyl-2-palmitoyl-sn-glycero-3-phosphocholine, 1- myristoyl-2-stearoyl-sn-glycero-3-phosphocholine, 1-palmitoyl-2-myristoyl-sn-glycero-3- phosphocholine, 1-palmitoyl-2-stearoyl-sn-glycero-3-phosphocholine, 1-palmitoyl-2-oleoyl-glycero- 3-phosphocholine, 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphocholine, 1-palmitoyl-2-arachidonoyl- sn-glycero-3-phosphocholine, 1-palmitoyl-2-docosahexaenoyl-sn-glycero-3-phosphocholine, 1- stearoyl-2-myristoyl-sn-glycero-3-phosphocholine, 1-stearoyl-2-palmitoyl-sn-glycero-3- phosphocholine, 1-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine, 1-stearoyl-2-linoleoyl-sn-glycero- 3-phosphocholine, 1-stearoyl-2-arachidonoyl-sn-glycero-3-phosphocholine, 1-stearoyl-2- docosahexaenoyl-sn-glycero-3-phosphocholine, 1-oleoyl-2-myristoyl-sn-glycero-3-phosphocholine, 1-oleoyl-2-palmitoyl-sn-glycero-3-phosphocholine, 1-oleoyl-2-stearoyl-sn-glycero-3-phosphocholine,1-palmitoyl-2-acetyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo- inositol-3’,4’-bisphosphate), 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol-3’,5’-bisphosphate), 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol-4’,5’-bisphosphate), 1,2-dioleoyl-sn-glycero-3- phospho-(1'-myo-inositol-3',4',5'-trisphosphate), 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol- 3’-phosphate), 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol-4’-phosphate), 1,2-dioleoyl-sn- glycero-3-phospho-(1'-myo-inositol-5'-phosphate), 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo- inositol), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine, and 1-(8Z-octadecenoyl)-2-palmitoyl-sn- glycero-3-phosphocholine.

[0488] In some embodiments, the LNP comprises a phospholipid selected from DSPS (Distearoylphosphatidylserine), DSPG (1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), DSPA (1,2-Distearoyl-sn-glycero-3-phosphate), diPhyPC (1,2-diphytanoyl-sn-glycero-3-phosphocholine), diPhy-diether-PC (1,2-di-O-phytanyl-sn-glycero-3-phosphocholine), diPhyPE (1,2-diphytanoyl-sn- glycero-3-phosphoethanolamine), diPhy-diether-PE (1,2-di-O-phytanyl-sn-glycero-3- phosphoethanolamine), diPhyPS (1,2-diphytanoyl-sn-glycero-3-phospho-L-serine), diPhyPG (1,2- diphytanoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), diPhyPA (1,2-diphytanoyl-sn-glycero-3- phosphate), Egg PA (L-^-phosphatidic acid), and Soy PA (L-^-phosphatidic acid).

[0489] In some embodiments, the LNP comprises a phospholipid selected from 18:1 (^9-Cis) PE (DOPE), 18:0-18:1 PE (SOPE), C16-18:1 PE, 16:0-18:1 PE (POPE), 18:1 BMP (S,R), 18:0-18:1 PC (SOPC), 16:0-18:1 PC (POPC), 4ME 16:0 Diether PE (4Me), 18:1 (^9-Trans) PE (DEPE), 16:1 PE (DPPE), and CL. In certain embodiments, the LNP comprises a phospholipid described or disclosed in Alvarez-Benedicto, et al. (Biomater. Sci., 2022, 10, 549) and Li, et al. (Asian Journal of Pharmaceutical Sciences, 2015, 10, 81-98).

[0490] In certain embodiments, the phospholipid is a sphingoid lipid or sphingolipid, such as, but not limited to sphingomyelin. As used herein, the terms “sphingoid lipid” and “sphingolipid” are meant to refer to a class of lipids containing a backbone comprising a sphingoid base. An exemplary sphingoid base is sphingosine. In certain embodiments, the LNP comprises a sphingolipid selected from Egg Sphingomyelin (Egg SM / ESM / (2S,3R,E)-3-hydroxy-2-palmitamidooctadec-4-en-1-yl (2- (trimethylammonio)ethyl) phosphate), Brain or Porcine Sphingomyelin (Brain SM / (2S,3R,E)-3- hydroxy-2-stearamidooctadec-4-en-1-yl (2-(trimethylammonio)ethyl) phosphate), Milk or Bovine Sphingomyelin (Milk SM / (2S,3R,E)-3-hydroxy-2-tricosanamidooctadec-4-en-1-yl (2- (trimethylammonio)ethyl) phosphate), 28:0 SM (N-octacosanoyl-D-erythro- sphingosylphosphorylcholine), 14:0 SM (N-myristoyl-D-erythro-sphingosylphosphorylcholine), 16:1 SM (N-palmitoleoyl-D-erythro-sphingosylphosphorylcholine), 12:0 Dihydro SM (N-lauroyl-D- erythro-sphinganylphosphorylcholine), Lyso SM (Sphingosylphosphorylcholine), Lyso SM (Sphingosylphosphorylcholine), Lyso SM (dihydro) (Sphinganine Phosphorylcholine), 24:1 SM (N- nervonoyl-D-erythro-sphingosylphosphorylcholine), 24:0 SM (N-lignoceroyl-D-erythro- sphingosylphosphorylcholine), 18:1 SM (N-oleoyl-D-erythro-sphingosylphosphorylcholine), 18:0 SM(N-stearoyl-D-erythro-sphingosylphosphorylcholine), 17:0 SM (N-heptadecanoyl-D-erythro- sphingosylphosphorylcholine), 16:0 SM (N-palmitoyl-D-erythro-sphingosylphosphorylcholine), 12:0 SM (N-lauroyl-D-erythro-sphingosylphosphorylcholine), 06:0 SM (N-hexanoyl-D-erythro- sphingosylphosphorylcholine), 02:0 SM (N-acetyl-D-erythro-sphingosylphosphorylcholine), 3-O- methyl Lyso SM (3-O-methyl-spingosylphosphorylcholine), 3-O-methyl-N-methyl Lyso SM (3-O- methyl-N-methyl-spingosylphosphorylcholine), and 3-N-methyl Lyso SM (3-N-methyl- spingosylphosphorylcholine).

[0491] In some embodiments, the LNP comprises a phospholipid comprising at least one constrained tail, such as those described by Gan, et al. (Bioeng Transl Med.2020 Sep; 5(3): e10161.). In certain embodiments, the phospholipid is one selected from:.

[0492] In some embodiments, the LNP comprises a phospholipid comprising a ceramide analogue having a triazole linkage, such as those described by Kim et al., Bioorg. Med. Chem. Lett., 17(16), 2007, 4584-4587.

[0493] In some embodiments, the LNP comprises a phospholipid disclosed in WO 2023 / 141470, which is incorporated by reference herein, in its entirety. In certain embodiments, the phospholipid is

[0494] In some embodiments, the LNP comprises a phospholipid disclosed in WO2022040641A2, which is incorporated by reference herein, in its entirety.

[0495] In some embodiments, a phospholipid tail may be modified in order to promote endosomal escape as described in U.S. Application Publication 2021 / 0121411, which is incorporated herein by reference.

[0496] In some embodiments, the LNP comprises a phospholipid disclosed in one of US 2019 / 0240354; US 2010 / 0130588; US 2021 / 0087135; WO 2021 / 204179; US 2021 / 0128488; US 2020 / 0121809; US 2017 / 0119904; US 2013 / 0108685; US 2013 / 0195920; US 2015 / 0005363; US 2014 / 0308304; US 2013 / 0053572; WO 2019 / 232095A1; WO 2021 / 077067; WO 2019 / 152557; US2017 / 0210697; or WO 2019 / 089828A1, each of which is incorporated by reference herein in their entirety.

[0497] In some embodiments, phospholipids disclosed in US 2020 / 0121809 have the following structure:wherein R1 and R2 are each independently a branched or straight, saturated or unsaturated carbon chain (e.g., alkyl, alkenyl, alkynyl). vi. Targeting moieties

[0498] In some embodiments, the lipid nanoparticle further comprises a targeting moiety. The targeting moiety may be an antibody or a fragment thereof. The targeting moiety may be capable of binding to a target antigen. In certain embodiments, the lipid nanoparticle comprises more than one targeting moiety. In certain embodiments, the lipid nanoparticle comprises more than one targeting moiety, wherein the targeting moieties target at least two different receptors, and in some embodiments, the at least two different receptors are prevalent on different types of cells or tissues.

[0499] In some embodiments, the pharmaceutical composition comprises a targeting moiety that is operably connected to a lipid nanoparticle. In some embodiments, the targeting moiety is capable of binding to a target antigen. In some embodiments, the target antigen is expressed in a target organ. In some embodiments, the target antigen is expressed more in the target organ than it is in the liver.

[0500] In some embodiments, the targeting moiety is an antibody as described in WO2016189532A1, which is incorporated herein by reference. For example, in some embodiments, the targeted particles are conjugated to a specific anti-CD38 monoclonal antibody (mAb), which allows specific delivery of the siRNAs encapsulated within the particles at a greater percentage to B- cell lymphocytes malignancies (such as MCL) than to other subtypes of leukocytes.

[0501] In some embodiments, the targeting moiety targets a receptor selected from CD20, CCR7, CD3, CD4, CD5, CD8, CD16, CD19, CD20, CD21, CD22, CD25, CD28, CD35, CD40, CD45RA, CD45RO, CD52, CD62L, CD80, CD95, CD127, and CD137. In some embodiments, the targeting moiety targets a receptor selected from CD1, CD2, CD3, CD5, CD7, CD8, CD16, CD25, CD26, CD27, CD28, CD30, CD38, CD39, CD40L, CD44, CD45, CD62L, CD69, CD73, CD80, CD83, CD86, CD95, CD103, CD119, CD126, CD150, CD153, CD154, CD161, CD183, CD223, CD254, CD275, CD45RA, CXCR3, CXCR5, FasL, IL18R1, CTLA-4, 0X40, GITR, LAG3, ICOS, PD-1, leu-12, TCR, TLR1, TLR2, TLR3, TLR4, TLR6, NKG2D, CCR, CCR1, CCR2, CCR4, CCR6, and CCR7. In some embodiments, the targeting moiety targets a receptor selected from CD2, CD3, CD5 and CD7. In some embodiments, the targeting moiety targets a receptor selected from CD2, CD3, CD5, CD7, CD8, CD4, beta 7 integrin, beta 2 integrin, and C1q. In some embodiments, the targeting moiety targets CD117. In some embodiments, the targeting moiety targets CD90. In some embodiments, the targeting moiety targets a receptor selected from a mannose receptor, CD206 and C1q. In some embodiments, the targeting moiety is selected from T-cell receptor motif antibodies, T- cell ^ chain antibodies, T-cell ^ chain antibodies, T-cell ^ chain antibodies, T-cell ^ chain antibodies, CCR7 antibodies, CD3 antibodies, CD4 antibodies, CD5 antibodies, CD7 antibodies, CD8 antibodies, CD11b antibodies, CD11c antibodies, CD16 antibodies, CD19 antibodies, CD20 antibodies, CD21 antibodies, CD22 antibodies, CD25 antibodies, CD28 antibodies, CD34 antibodies, CD35 antibodies, CD40 antibodies, CD45RA antibodies, CD45RO antibodies, CD52 antibodies, CD56 antibodies, CD62L antibodies, CD68 antibodies, CD80 antibodies, CD95 antibodies, CD117 antibodies, CD127 antibodies, CD133 antibodies, CD137 (4-1BB) antibodies, CD163 antibodies, F4 / 80 antibodies, IL- 4R^ antibodies, Sca-1 antibodies, CTLA-4 antibodies, GITR antibodies GARP antibodies, LAP antibodies, granzyme B antibodies, LFA-1 antibodies, transferrin receptor antibodies, and fragments thereof. In certain embodiments, the targeting moiety is any one described or contemplated in US20230312713A1, US20230203538A1, US20230320995A1, US20160145348, and US20110038941, each of which is incorporated by reference herein in its entirety.

[0502] In some embodiments, the targeting moiety is a small molecule. In some embodiments, the small molecule binds to an ectoenzyme on an immune cell, wherein the ectoenzyme is selected from the group consisting of CD38, CD73, adenosine 2a receptor, and adenosine 2b receptor. In some embodiments, the small molecule is mannose, a lectin, acivicin, biotin, or digoxigenin.

[0503] In some embodiments, the lipid nanoparticles may be targeted when conjugated / attached / associated with a targeting moiety such as an antibody, or a fragment thereof. vii. Zwitterionic amino lipids

[0504] In some embodiments, an LNP comprises a zwitterionic lipid. In some embodiments, an LNP comprising a zwitterionic lipid does not comprise a phospholipid.

[0505] Zwitterionic amino lipids have been shown to be able to self-assemble into LNPs without phospholipids to load, stabilize, and release mRNAs intracellularly as described in U.S. Patent Application 20210121411, which is incorporated herein by reference in its entirety. Zwitterionic, ionizable cationic and permanently cationic helper lipids enable tissue-selective mRNA delivery and CRISPR-Cas9 gene editing in spleen, liver and lungs as described in Liu et al., Membrane- destablizing ionizable phospholipids for organ-selective mRNA delivery and CRISPR-Cas gene editing, Nat Mater. (2021), which is incorporated herein by reference in its entirety.

[0506] The zwitterionic lipids may have head groups containing a cationic amine and an anionic carboxylate as described in Walsh et al., Synthesis, Characterization and Evaluation of IonizableLysine-Based Lipids for siRNA Delivery, Bioconjug Chem. (2013), which is incorporated herein by reference in its entirety. Ionizable lysine-based lipids containing a lysine head group linked to a long- chain dialkylamine through an amide linkage at the lysine ^-amine may reduce immunogenicity as described in Walsh et al., Synthesis, Characterization and Evaluation of Ionizable Lysine-Based Lipids for siRNA Delivery, Bioconjug Chem. (2013). viii. Additional lipid components

[0507] In some embodiments, the LNP compositions of the present disclosure further comprise one or more additional lipid components capable of influencing the tropism of the LNP. In some embodiments, the LNP further comprises at least one lipid selected from DDAB, EPC, 14PA, 18BMP, DODAP, DOTAP, and C12-200 (see Cheng, et al. Nat Nanotechnol.2020 April; 15(4): 313– 320.; Dillard, et al. PNAS 2021 Vol.118 No.52.).

[0508] In some embodiments, the LNP compositions of the present disclosure comprise, or further comprise one or more lipids selected from 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine (18:3 PC), Acylcarnosine (AC), 1- hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), N-oleoyl-sphingomyelin (SPM) (C18:l), N- lignoceryl SPM (C24:0), N-nervonoylshphingomyelin (C24:l), Cardiolipin (CL), l,2-bis(tricosa- 10,12-diynoyl)-sn-glycero-3-phosphocholine (DC8-9PC), dicetyl phosphate (DCP), dihexadecyl phosphate (DCP1), 1,2-Dipalmitoylglycerol-3-hemisuccinate (DGSucc), short-chain bis-n- heptadecanoyl phosphatidylcholine (DHPC), dihexadecoyl-phosphoethanolamine (DHPE), 1,2- dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), l,2-dilauroyl-sn-glycero-3-PE (DLPE), dimyristoyl glycerol hemisuccinate (DMGS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoylphosphatidylglycerol (DMPG), dioleyloxybenzylalcohol (DOBA), 1,2-dioleoylglyceryl-3-hemisuccinate (DOGHEMS), N-[2-(2-{2-[2-(2,3-Bis-octadec-9- enyloxy-propoxy)-ethoxy]-ethoxy}-ethoxy)-ethyl]-3-(3,4,5-1rihydroxy-6-hydroxymethyl-1etrahydro- pyran-2-ylsulfanyl)-propionamide (DOGP4^Man), dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylethanolamine (DOPE), dioleoyl-phosphatidylethanolamine4-(N- maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dioleoylphosphatidylglycerol (DOPG), 1,2-dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), acell-fusogenicphospholipid (DPhPE), dipalmitoylphosphatidylethanolamine (DPPE), dipalmitoylphosphatidylglycerol (DPPG), dipalmitoylphosphatidylserine (DPPS), distearoylphosphatidylcholine (DSPC), distearoyl- phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamineimidazole (DSPEI), 1,2- diundecanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), histaminedistearoylglycerol (HDSG), 1,2-Dipalmitoylglycerol-hemisuccinate-N^-Histidinyl- Hemisuccinate (HistSuccDG), N-(5'-hydroxy-3'-oxypentyl)-10-12-pentacosadiynamide (h-Pegi- PCDA), 2-[l-hexyloxyethyl]-2-devinylpyropheophorbide-a (HPPH), hydrogenatedsoybeanphosphatidylcholine (HSPC), 1,2-Dipalmitoylglycerol-O-^-histidinyl-N^- hemisuccinate (IsohistsuccDG), mannosialized dipalmitoylphosphatidylethanolamine (ManDOG), l,2-Dioleoyl-sn-Glycero-3-Phosphoethanolamine-N-[4-(p-maleimidomethyl)cyclohexane-carboxamide] (MCC-PE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16:0 PE), 1-myristoyl-2- hydroxy-sn-glycero-phosphocholine (MHPC), a thiol-reactive maleimide headgroup lipid e.g.1,2- dioleoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p-maleimidophenyl)but-yramid (MPB-PE), Nervonic Acid (NA), sodium cholate (NaChol), l,2-dioleoyl-sn-glycero-3-[phosphoethanolamine-N- dodecanoyl (NC12-DOPE), 1-oleoyl-2-cholesteryl hemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), phosphatidylethanolamine lipid (PE), PE lipid conjugated with polyethylene glycol(PEG) (e.g., polyethylene glycol-distearoylphosphatidylethanolamine lipid (PEG-PE)), phosphatidylglycerol (PG), partially hydrogenated soy phosphatidylchloline (PHSPC), phosphatidylinositol lipid (PI), phosphotidylinositol-4-phosphate (PIP), palmitoyloleoylphosphatidylcholine (POPC), phosphatidylethanolamine (POPE), palmitoyloleyolphosphatidylglycerol (POPG), phosphatidylserine (PS), lissamine rhodamine B- phosphatidylethanolamine lipid (Rh-PE), purified soy-derived mixture of phospholipids (SIOO), phosphatidylcholine (SM), 18-1-trans-PE,1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), soybean phosphatidylcholine (SPC), sphingomyelins (SPM), alpha,alpha-trehalose-6,6'-dibehenate (TDB), l,2-dielaidoyl-sn-glycero-3-phophoethanolamine (transDOPE), ((23S,5R)-3- (bis(hexadecyloxy)methoxy)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran- 2-yl)methylmethylphosphate, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl- sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3- phosphocholine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dioleyl-sn-glycero-3-phosphoethanolamine, 1,2-distearoyl-sn-glycero-3- phosphoethanolamine, 16-O-monomethyl PE, 16-O-dimethyl PE, and dioleylphosphatidylethanolamine. B. Exemplary LNP Compositions

[0509] In some embodiments, provided herein are LNPs comprising (a): at least one ionizable lipid; (b) at least one PEG lipid; (c) at least one structural lipid; and (d) at least one non-ionizable lipid and / or a zwitterionic lipid. In some embodiments, the LNPs further comprise an additional ionizable lipid, besides a compound disclosed herein. In some embodiments, the LNPs further comprise an additional lipid component, of any class, besides a compound disclosed herein.

[0510] In some embodiments, the PEG-lipid is selected from the group consisting of PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, and PEG-DSPE.

[0511] In some embodiments, the structural lipid is selected from the group consisting of cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, an alpha-tocopherol.

[0512] In some embodiments, the non-ionizable lipid is a phospholipid selected from the group consisting of 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2- dimyristoyl-sn-glycero-phosphocholine (DMPC), 1.2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocho line (POPC), 1,2-di-O-octadecenyl-sn- glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuc cinoyl-sn-glycero-3- phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2- dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoylsn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn- glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2- dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sodium (S)-2-ammonio-3- ((((R)-2-(oleoyloxy)-3-(stearoyloxy)propoxy)oxidophosphoryl)oxy)propanoate (L-^- phosphatidylserine; Brain PS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoylphosphatidylglycerol (DMPG), dioleoyl- phosphatidylethanolamine4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dioleoylphosphatidylglycerol (DOPG), 1,2-dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), acell- fusogenicphospholipid (DPhPE), dipalmitoylphosphatidylethanolamine (DPPE), dipalmitoylphosphatidylglycerol (DPPG), dipalmitoylphosphatidylserine (DPPS), distearoylphosphatidylcholine (DSPC), distearoyl-phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamineimidazole (DSPEI), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), 1,2-dioleoyl-sn-glycero-3-phosphate (18:1 PA; DOPA), ammonium bis((S)-2-hydroxy-3-(oleoyloxy)propyl) phosphate (18:1 DMP; LBPA), 1,2-dioleoyl-sn-glycero-3- phospho-(1’-myo-inositol) (DOPI; 18:1 PI), 1,2-distearoyl-sn-glycero-3-phospho-L-serine (18:0 PS), 1,2-dilinoleoyl-sn-glycero-3-phospho-L-serine (18:2 PS), 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho- L-serine (16:0-18:1 PS; POPS), 1-stearoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (18:0-18:1 PS), 1- stearoyl-2-linoleoyl-sn-glycero-3-phospho-L-serine (18:0-18:2 PS), 1-oleoyl-2-hydroxy-sn-glycero-3- phospho-L-serine (18:1 Lyso PS), 1-stearoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:0 Lyso PS), and sphingomyelin.

[0513] In some embodiments, the non-ionizable lipid is a phospholipid selected from the group consisting of Egg Sphingomyelin (Egg SM / ESM / (2S,3R,E)-3-hydroxy-2-palmitamidooctadec-4- en-1-yl (2-(trimethylammonio)ethyl) phosphate), Brain or Porcine Sphingomyelin (Brain SM / (2S,3R,E)-3-hydroxy-2-stearamidooctadec-4-en-1-yl (2-(trimethylammonio)ethyl) phosphate), Milk or Bovine Sphingomyelin (Milk SM / (2S,3R,E)-3-hydroxy-2-tricosanamidooctadec-4-en-1-yl (2- (trimethylammonio)ethyl) phosphate), 28:0 SM (N-octacosanoyl-D-erythro-sphingosylphosphorylcholine), 14:0 SM (N-myristoyl-D-erythro-sphingosylphosphorylcholine), 16:1 SM (N-palmitoleoyl-D-erythro-sphingosylphosphorylcholine), 12:0 Dihydro SM (N-lauroyl-D- erythro-sphinganylphosphorylcholine), Lyso SM (Sphingosylphosphorylcholine), Lyso SM (Sphingosylphosphorylcholine), Lyso SM (dihydro) (Sphinganine Phosphorylcholine), 24:1 SM (N- nervonoyl-D-erythro-sphingosylphosphorylcholine), 24:0 SM (N-lignoceroyl-D-erythro- sphingosylphosphorylcholine), 18:1 SM (N-oleoyl-D-erythro-sphingosylphosphorylcholine), 18:0 SM (N-stearoyl-D-erythro-sphingosylphosphorylcholine), 17:0 SM (N-heptadecanoyl-D-erythro- sphingosylphosphorylcholine), 16:0 SM (N-palmitoyl-D-erythro-sphingosylphosphorylcholine), 12:0 SM (N-lauroyl-D-erythro-sphingosylphosphorylcholine), 06:0 SM (N-hexanoyl-D-erythro- sphingosylphosphorylcholine), 02:0 SM (N-acetyl-D-erythro-sphingosylphosphorylcholine), 3-O- methyl Lyso SM (3-O-methyl-spingosylphosphorylcholine), 3-O-methyl-N-methyl Lyso SM (3-O- methyl-N-methyl-spingosylphosphorylcholine), and 3-N-methyl Lyso SM (3-N-methyl- spingosylphosphorylcholine).

[0514] In some embodiments, (a) the PEG lipid is PEG2k-DMG or PEG2k-DSPE or a mixture thereof; (b) the structural lipid is cholesterol; and (c) the phospholipid, non-ionizable lipid or zwitterionic lipid is a sphingolipid or DSPC or a mixture thereof.

[0515] In some embodiments, the lipid component of the nanoparticle comprises: (a) about 0 mol% to about 10 mol% of PEG lipid; (b) about 0 mol% to about 30 mol% structural lipid; (c) about 20 mol% to about 45 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and (d) about 30 mol% to about 60 mol% of an ionizable lipid.

[0516] In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1 mol% to about 2 mol% of PEG lipid; (b) about 25 mol% to about 40 mol% structural lipid; (c) about 20 mol% to about 45 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and (d) about 30 mol% to about 60 mol% of an ionizable lipid.

[0517] In some embodiments, the lipid component of the nanoparticle comprises: (a) about 2 mol% of PEG lipid; (b) about 25 mol% structural lipid; (c) about 40 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and (d) about 33 mol% of an ionizable lipid.

[0518] In some embodiments, the lipid component of the nanoparticle comprises: (a) about 2.5 mol% of PEG lipid; (b) about 39 mol% structural lipid; (c) about 10 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and (d) about 48.5 mol% of an ionizable lipid.

[0519] In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1.5 mol% of PEG lipid; (b) about 40 mol% structural lipid; (c) about 10 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and (d) about 48.5 mol% of an ionizable lipid.

[0520] In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1 mol% to about 3 mol% of PEG lipid; (b) about 15 mol% to about 35 mol% structural lipid; (c) about 30 mol% to about 60 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and (d) about 25 mol% to about 45 mol% of an ionizable lipid. In some embodiments, the lipid component of thenanoparticle comprises: (a) about 1 mol% to about 3 mol% of PEG lipid; (b) about 20 mol% to about 30 mol% structural lipid; (c) about 35 mol% to about 45 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and (d) about 28 mol% to about 40 mol% of an ionizable lipid. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1.5 mol% to about 2.5 mol% of PEG lipid; (b) about 20 mol% to about 30 mol% structural lipid; (c) about 35 mol% to about 45 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and (d) about 28 mol% to about 40 mol% of an ionizable lipid. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1 mol% to about 3 mol% of PEG lipid; (b) about 20 mol% to about 30 mol% structural lipid; (c) about 35 mol% to about 45 mol% phospholipid, non-ionizable lipid or zwitterionic lipid; and (d) about 28 mol% to about 40 mol% of an ionizable lipid; wherein the about 35 mol% to about 45 mol% phospholipid, non-ionizable lipid or zwitterionic lipid comprises two or more phospholipids, non-ionizable lipids or zwitterionic lipids. In some embodiments, the two or more phospholipids, non-ionizable lipids or zwitterionic lipids comprise at least one sphingolipid and at least one phosphatidycholine lipid. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1 mol% to about 3 mol% of PEG lipid; (b) about 20 mol% to about 30 mol% structural lipid; (c) about 35 mol% to about 45 mol% phospholipid; and (d) about 28 mol% to about 40 mol% of an ionizable lipid; wherein the about 35 mol% to about 45 mol% phospholipid comprises a mixture of phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingoid lipids. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1 mol% to about 3 mol% of PEG lipid; (b) about 20 mol% to about 30 mol% structural lipid; (c) about 35 mol% to about 45 mol% phospholipid; and (d) about 28 mol% to about 40 mol% of an ionizable lipid; wherein the about 35 mol% to about 45 mol% phospholipid comprises a mixture of phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingoid lipids, such that no single phospholipid makes up more than 25 mol% of the total lipid content of the nanoparticle. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1 mol% to about 3 mol% of PEG lipid; (b) about 20 mol% to about 30 mol% structural lipid; (c) about 35 mol% to about 45 mol% phospholipid; and (d) about 28 mol% to about 40 mol% of an ionizable lipid; wherein the about 35 mol% to about 45 mol% phospholipid comprises a mixture of phosphatidylcholine and sphingoid lipids, such that no single phospholipid makes up more than 25 mol% of the total lipid content of the nanoparticle. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1 mol% to about 3 mol% of PEG lipid; (b) about 15 mol% to about 35 mol% structural lipid; (c) about 30 mol% to about 60 mol% phospholipid; and (d) about 25 mol% to about 45 mol% of an ionizable lipid; wherein the about 30 mol% to about 60 mol% phospholipid comprises a mixture of phosphatidylcholine and sphingoid lipids, such that no single phospholipid makes up more than 30 mol% of the total lipid content of the nanoparticle. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1 mol% to about 3 mol% of PEG2k-DMG; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% phospholipid; and (d) about 25 mol% to about 45mol% of an ionizable lipid; wherein the about 30 mol% to about 60 mol% phospholipid comprises a mixture of phosphatidylcholine and sphingoid lipids, such that no single phospholipid makes up more than 30 mol% of the total lipid content of the nanoparticle. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1 mol% to about 3 mol% of PEG2k-DMG; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% phospholipid; and (d) about 25 mol% to about 45 mol% of an ionizable lipid; wherein the about 30 mol% to about 60 mol% phospholipid comprises a mixture of DSPC and sphingomyelin, such that the mol% of DPSC is not greater than 30 mol% of the total lipid content and the mol% of sphingomyelin is not greater than 30 mol% of the total lipid content. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1 mol% to about 3 mol% of PEG2k-DMG; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% phospholipid; and (d) about 28 mol% to about 40 mol% of an ionizable lipid; wherein the about 35 mol% to about 45 mol% phospholipid comprises a mixture of DSPC and sphingomyelin, such that the mol% of DPSC is not greater than 25 mol% of the total lipid content and the mol% of sphingomyelin is not greater than 25 mol% of the total lipid content.

[0521] In some embodiments, the lipid component of the nanoparticle comprises: (a) about 2 mol% PEG lipid; (b) about 25 mol% structural lipid; (c) about 40 mol% phospholipid; and (d) about 33 mol% of an ionizable lipid. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1 mol% PEG lipid; (b) about 26 mol% structural lipid; (c) about 40 mol% phospholipid; and (d) about 33 mol% of an ionizable lipid. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 1.5 mol% PEG lipid; (b) about 25.5 mol% structural lipid; (c) about 40 mol% phospholipid; and (d) about 33 mol% of an ionizable lipid. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 2 mol% PEG lipid; (b) about 20 mol% structural lipid; (c) about 35 mol% phospholipid; and (d) about 43 mol% of an ionizable lipid. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 2 mol% PEG lipid; (b) about 15 mol% structural lipid; (c) about 34.5 mol% phospholipid; and (d) about 48.5 mol% of an ionizable lipid. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 2 mol% PEG lipid; (b) about 10 mol% structural lipid; (c) about 39.5 mol% phospholipid; and (d) about 48.5 mol% of an ionizable lipid. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 2 mol% PEG lipid; (b) about 30 mol% structural lipid; (c) about 35 mol% phospholipid; and (d) about 33 mol% of an ionizable lipid. In some embodiments, the lipid component of the nanoparticle comprises: (a) about 2.3 mol% PEG lipid; (b) about 25 mol% structural lipid; (c) about 38.2 mol% phospholipid; and (d) about 34.5 mol% of an ionizable lipid. In some embodiments, the lipid nanoparticle is any one of the aforementioned embodiments in this paragraph, wherein the PEG lipid is PEG2k-DMG. In some embodiments, the lipid nanoparticle is any one of the aforementioned embodiments in this paragraph, wherein the structural lipid is cholesterol. In some embodiments, the lipid nanoparticle is any one of theaforementioned embodiments in this paragraph, wherein the phospholipid content comprises a phosphatidylcholine lipid, a sphingoid lipid or combinations thereof.

[0522] In some embodiments, the payloads are encapsulated in nanoparticles (e.g., LNPs) for delivery. In embodiments, a nanoparticle can comprise an ionizable lipid, a phospholipid, a PEG lipid, and a structural lipid. In certain embodiments, the lipid component of the nanoparticle composition comprises about 30 mol % to about 60 mol % ionizable lipid, about 0 mol % to about 30 mol % phospholipid, about 18.5 mol % to about 48.5 mol % structural lipid, and about 0 mol% to about 10 mol% of PEG lipid, provided that the total mol % does not exceed 100%. In certain embodiments, the lipid component of the nanoparticle composition comprises about 20 mol % to about 45 mol % ionizable lipid, about 30 mol % to about 60 mol % phospholipid, about 10 mol % to about 30 mol % structural lipid, and about 0 mol% to about 10 mol% of PEG lipid, provided that the total mol % does not exceed 100%. In some embodiments, the lipid component of the nanoparticle composition comprises about 35 mol % to about 55 mol % ionizable lipid, about 5 mol % to about 25 mol % phospholipid, about 30 mol % to about 40 mol % structural lipid, and about 0 mol % to about 10 mol % of PEG lipid, provided that the total mol % does not exceed 100%. In some embodiments, the lipid component of the nanoparticle composition comprises about 30 mol % to about 40 mol % ionizable lipid, about 35 mol % to about 45 mol % phospholipid, about 20 mol % to about 30 mol % structural lipid, and about 0.5 mol % to about 5 mol % of PEG lipid, provided that the total mol % does not exceed 100%. In a particular embodiment, the lipid component comprises about 50 mol % ionizable lipid, about 10 mol % phospholipid, about 38.5 mol % structural lipid, and about 1.5 mol% of PEG lipid. In another particular embodiment, the lipid component comprises about 40 mol % ionizable lipid, about 20 mol % phospholipid, about 38.5 mol % structural lipid, and about 1.5 mol % of PEG lipid. In another particular embodiment, the lipid component comprises about 48.5 mol % ionizable lipid, about 10 mol % phospholipid, about 40 mol % structural lipid, and about 1.5 mol % of PEG lipid. In another particular embodiment, the lipid component comprises about 48.5 mol % ionizable lipid, about 10 mol % phospholipid, about 39 mol % structural lipid, and about 2.5 mol % of PEG lipid. In another particular embodiment, the lipid component comprises about 48.5 mol % ionizable lipid, about 10 mol % phospholipid, about 38.5 mol % structural lipid, and about 3 mol % of PEG lipid. In another particular embodiment, the lipid component comprises about 48.5 mol % ionizable lipid, about 10 mol % phospholipid, about 38 mol % structural lipid, and about 3.5 mol % of PEG lipid. In another particular embodiment, the lipid component comprises about 33 mol % ionizable lipid, about 40 mol % phospholipid, about 25 mol % structural lipid, and about 2 mol % of PEG lipid. In some embodiments, the phospholipid is DOPE or DSPC. In some embodiments, the phospholipid is DSPC. In some embodiments, the phospholipid is a sphingolipid. In some embodiments, the phospholipid is a sphingomyelin. In other embodiments, the PEG lipid is PEG-DMG (eg. PEG2K- DMG). In other embodiments, the PEG lipid is PEG-DSPE (eg. PEG2K-DSPE). In other embodiments, the PEG lipid is PEG-DMPE (eg. PEG2K-DMPE). In other embodiments, the PEGlipid is PEG-DPPE (eg. PEG2K-DPPE). In other embodiments, the structural lipid is cholesterol. In other embodiments, the PEG lipid is PEG-DMG and / or the structural lipid is cholesterol. In some embodiments, the PEG lipids is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is DSPC. In some embodiments, the PEG lipids is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is sphingomyelin.

[0523] In some embodiments, the PEG lipids is PEG-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of DSPC and sphingomyelin. In certain embodiments, the LNP comprises about 33mol% ionizable lipid (eg. at least one ionizable lipid of a Formula described herein), about 40mol% of a sphingolipid, about 25mol% cholesterol and about 2mol% PEG2K-DMG. In some embodiments, the PEG lipids is PEG2K-DSPE, the structural lipid is cholesterol, and the phospholipid is DSPC. In some embodiments, the PEG lipids is PEG2K-DSPE, the structural lipid is cholesterol, and the phospholipid is sphingomyelin. In some embodiments, the PEG lipids is PEG-DSPE, the structural lipid is cholesterol, and the phospholipid is a mixture of DSPC and sphingomyelin. In some embodiments, the PEG lipids is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is DOPE. In some embodiments, the PEG lipids is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is DOPC. In some embodiments, the PEG lipids is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is DLPC. In some embodiments, the PEG lipids is PEG2K-DMG, the structural lipid is cholesterol, and the phospholipid is DOPS. In some embodiments, the PEG lipids is PEG-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of a phosphatidylcholine lipid and a sphingolipid. In some embodiments, the PEG lipids is PEG-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of a phosphatidylcholine lipid and phosphatidylserine lipid. In some embodiments, the PEG lipids is PEG-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of a phosphatidylcholine lipid and a phosphoethanolamine lipid. In some embodiments, the PEG lipids is PEG-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of a sphingolipid and phosphatidylserine lipid. In some embodiments, the PEG lipids is PEG-DMG, the structural lipid is cholesterol, and the phospholipid is a mixture of a sphingolipid and a phosphoethanolamine lipid. In certain embodiments, the LNP comprises about 33mol% ionizable lipid, about 20mol% of a sphingolipid, about 20mol% of a non-sphingolipid phospholipid, about 25mol% cholesterol and about 2mol% of a PEGylated lipid. In certain embodiments, the LNP comprises about 33mol% ionizable lipid, about 10mol% of a sphingolipid, about 30mol% of a non-sphingolipid phospholipid, about 25mol% cholesterol and about 2mol% of a PEGylated lipid. In certain embodiments, the LNP comprises about 33mol% ionizable lipid, about 30mol% of a sphingolipid, about 10mol% of a non- sphingolipid phospholipid, about 25mol% cholesterol and about 2mol% of a PEGylated lipid. In certain embodiments, the LNP comprises about 33mol% ionizable lipid, about 20mol% sphingomyelin, about 20mol% of a DSPC, about 25mol% cholesterol and about 2mol% of a PEGylated lipid. In certain embodiments, the LNP comprises about 33mol% ionizable lipid, about10mol% sphingomyelin, about 30mol% of a DSPC, about 25mol% cholesterol and about 2mol% of a PEGylated lipid. In certain embodiments, the LNP comprises about 33mol% ionizable lipid, about 30mol% sphingomyelin, about 10mol% of a DSPC, about 25mol% cholesterol and about 2mol% of a PEGylated lipid. In certain embodiments, the LNP comprises about 33mol% ionizable lipid, about 25mol% cholesterol, about 2mol% of a PEGylated lipid, and about 40% of a mixture of phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingoid lipids. In certain embodiments, the LNP comprises about 33mol% ionizable lipid, about 25mol% cholesterol, about 2mol% of a PEGylated lipid, and about 40% of a mixture of phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingoid lipids, wherein each of the phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingoid lipids is present in an amount less than 30 mol% of the total lipid component of the LNP. In certain embodiments, the LNP comprises about 33mol% ionizable lipid, about 25mol% cholesterol, about 2mol% of a PEGylated lipid, and about 40% of a mixture of phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingoid lipids, wherein each of the phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingoid lipids is present in an amount less than 25 mol% of the total lipid component of the LNP. In certain embodiments, LNP is any one of the aforementioned in this paragraph wherein the PEG lipid is PEG2k-DMG. In certain embodiments, LNP is any one of the aforementioned in this paragraph wherein the PEG lipid is PEG2k-DSPE.

[0524]

[0525] In another particular embodiment, LNP comprises about 33 mol % ionizable lipid, about 40 mol % DSPC, about 25 mol % cholesterol, and about 2 mol % of PEG lipid. In another particular embodiment, LNP comprises about 33 mol % ionizable lipid, about 40 mol % sphingomyelin, about 25 mol % cholesterol, and about 2 mol % of PEG lipid. In another particular embodiment, LNP comprises about 33 mol % ionizable lipid, about 40 mol % DOPE, about 25 mol % cholesterol, and about 2 mol % of PEG lipid. In another particular embodiment, LNP comprises about 33 mol % ionizable lipid, about 40 mol % DOPC, about 25 mol % cholesterol, and about 2 mol % of PEG lipid. In another particular embodiment, LNP comprises about 33 mol % ionizable lipid, about 40 mol % DLPC, about 25 mol % cholesterol, and about 2 mol % of PEG lipid. In another particular embodiment, LNP comprises about 33 mol % ionizable lipid, about 40 mol % DOPS, about 25 mol % cholesterol, and about 2 mol % of PEG lipid. In another particular embodiment, LNP comprises about 33 mol % ionizable lipid, about 40 mol % phospholipid, about 25 mol % cholesterol, and about 2 mol % of PEG lipid. In another particular embodiment, LNP comprises about 33 mol % ionizable lipid, about 20 mol % sphingomyelin, about 20 mol% DSPC, about 25 mol % cholesterol, and about 2 mol % of PEG lipid. In certain embodiments, LNP is any one of the aforementioned in this paragraph wherein the PEG lipid is PEG2k-DMG. In certain embodiments, LNP is any one of the aforementioned in this paragraph wherein the PEG lipid is PEG2k-DSPE.

[0526] In certain embodiments, the LNP comprises about 43mol% ionizable lipid, about 15mol% of a sphingolipid, about 15mol% of a non-sphingolipid phospholipid, about 25mol% cholesterol and about 2mol% of a PEGylated lipid. In certain embodiments, the LNP comprises about 33mol% ionizable lipid, about 25mol% of a sphingolipid, about 15mol% of a non-sphingolipid phospholipid, about 25mol% cholesterol and about 2mol% of a PEGylated lipid. In certain embodiments, the LNP comprises about 33mol% ionizable lipid, about 15mol% of a sphingolipid, about 25mol% of a non- sphingolipid phospholipid, about 25mol% cholesterol and about 2mol% of a PEGylated lipid. In some embodiments, the PEG lipid is PEG2K-DSPE, the structural lipid is cholesterol, and the phospholipid is a mixture of DSPC and sphingomyelin. In some embod...

Claims

CLAIMS 1. A lipid nanoparticle comprising: a) a cargo comprising one or more nucleic acid molecules encoding and / or constituting a gene editing system capable of installing an edit in a hemoglobin gene or regulatory region thereof; b) one or more ionizable lipids; c) one or more phospholipids, in an amount of about 20 mol% to about 60 mol% of the total lipid content of the lipid nanoparticle; d) one or more structural lipids; and e) one or more PEG lipids.

2. The lipid nanoparticle of claim 1, wherein the lipid nanoparticle does not comprise a targeting moiety.

3. The lipid nanoparticle of any one of claims 1-2, wherein the one or more nucleic acid molecules are DNA and / or RNA molecules.

4. The lipid nanoparticle of any one of claims 1-3, wherein the one or more nucleic acid molecules are RNA molecules.

5. The lipid nanoparticle of any one of claims 1-4, wherein the gene editing system comprises (i) a zinc finger protein, (ii) a TALEN protein, or (iii) a nucleic acid programmable nuclease.

6. The lipid nanoparticle of any one of claims 1-4, wherein the gene editing system is a CRISPR- type II gene editing system, a CRISPR-type V gene editing system, or a retron gene editing system.

7. The lipid nanoparticle of claim 6, wherein the CRISPR-type II gene editing system comprises a CRISPR-type II nuclease or functional variant or ortholog thereof and a guide RNA.

8. The lipid nanoparticle of claim 6, wherein the CRISPR-type V gene editing system comprises a CRISPR-type V nuclease or functional variant or ortholog thereof and a guide RNA.

9. The lipid nanoparticle of claim 6, wherein the retron gene editing system comprises a CRISPR- type II or type V nuclease or functional variant or ortholog thereof, a retron non-coding RNA (ncRNA), and a guide RNA.

10. The lipid nanoparticle of any one of claims 1-4, wherein the gene editing system is a base editor comprising a CRISPR-type II or type V nuclease or functional variant or ortholog thereof, a deaminase or functional variant or ortholog thereof, and a guide RNA.

11. The lipid nanoparticle of any one of claims 1-4, wherein the gene editing system is a prime editor comprising a CRISPR-type II or type V nuclease or functional variant or ortholog thereof, a reverse transcriptase or functional variant or ortholog thereof, and a prime editing guide RNA (pegRNA).

12. The lipid nanoparticle of any one of claims 7-11, wherein the guide RNA or pegRNA comprises a spacer sequence that is complementary to a target sequence.

13. The lipid nanoparticle of claim 12, wherein the target sequence is a hemoglobin gene or regulatory region thereof.

14. The lipid nanoparticle of claim 13, wherein the hemoglobin gene or regulatory region thereof is the gene encoding hemoglobin beta subunit.

15. The lipid nanoparticle of claim 13, wherein the hemoglobin gene or regulatory region thereof is the BCL11A binding site in the HBG1 / 2 promoter.

16. The lipid nanoparticle of claim 13, wherein the hemoglobin gene or regulatory region thereof is the enhancer sequence of the gene encoding BCL11A.

17. The lipid nanoparticle of claim 13, wherein the hemoglobin gene or regulatory region thereof is the binding site of the GATA-1 activator in the HBG1 / 2 promoter.

18. The lipid nanoparticle of any one of claims 6 and 8-17, wherein the guide RNA comprises a sequence selected from: (a) SEQ ID NO: 51; (b) SEQ ID NOs: 207-218; (c) SEQ ID NOs: 220-537; and (d) SEQ ID NOs: 680-720; or any portion thereof or a sequence having at least 80%, or 85% or 90%, or 95%, or 99%, or up to 100% sequence identity with any of the aforementioned sequences.

19. The lipid nanoparticle of any one of claims 6 and 8-17, wherein the guide RNA comprises miRNA sequences selected from: (a) SEQ ID NO: 721-735; (b) SEQ ID NOs: 721; and (c) SEQ ID NOs: 723; or any portion thereof or a sequence having at least 80%, or 85% or 90%, or 95%, or 99%, or up to 100% sequence identity with any of the aforementioned sequences.

20. The lipid nanoparticle of any one of claims 6 and 8-17, wherein the CRISPR-type V nuclease comprises SEQ ID NOs: 52, 53, 57-80, 84-93, 96-126, 754-792 or any amino acid sequence having at least 80%, or 85% or 90%, or 95%, or 99%, or up to 100% sequence identity with any of the aforementioned sequences.

21. The lipid nanoparticle of any one of claims 1-20, wherein the gene editing system comprises one or more additional accessory proteins.

22. The lipid nanoparticle of claim 21, wherein the one or more accessory proteins comprises a nuclease, reverse transcriptase, recombinase, transposase, integrase, DNA binding protein, transcription factor, a CRISPR Cas protein, or an anti-CRISPR inhibitor protein.

23. The lipid nanoparticle of claim 22, wherein the CRISPR Cas protein is Cas1, Cas2, Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas10d, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (Cas14 or C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, Cas13x.1, Cse1, Cse2, Csy1, Csy2, Csy3, Csm2, Cmr5, Csx10, Csf1, Csn2, C2c4, C2c8, or C2c9.

24. The lipid nanoparticle of any one of claims 21-23, wherein the one or more accessory proteins may be provided in trans or may be coupled to one or more components of the gene editing system.

25. The lipid nanoparticle of any one of claims 21-23, wherein the one or more accessory proteins is coupled to one or more components of the gene editing system by a linker.

26. The lipid nanoparticle of claim 25, wherein the linker has an amino acid sequence of any one of SEQ ID NOs: 33-37 and 81-83.

27. The lipid nanoparticle of any one of claims 1-26, wherein the N:P ratio is from about 5:1 to about 8:

1.

28. The lipid nanoparticle of any one of claims 1-27, wherein the lipid nanoparticle comprises about 25 mol% to about 45 mol% of the one or more ionizable lipids, as a proportion of the total lipid content of the lipid nanoparticle.

29. The lipid nanoparticle of any one of claims 1-28, wherein the lipid nanoparticle comprises about 15 mol% to about 35 mol% of the one or more structural lipids, as a proportion of the total lipid content of the lipid nanoparticle.

30. The lipid nanoparticle of any one of claims 1-29, wherein the lipid nanoparticle comprises about 1 mol% to about 3 mol% of the one or more PEG lipids, as a proportion of the total lipid content of the lipid nanoparticle.

31. The lipid nanoparticle of any one of claims 1-27, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of the one or more PEG lipids; (b) about 15 mol% to about 35 mol% of the one or more structural lipids; (c) about 30 mol% to about 60 mol% of the one or more phospholipids; and (d) about 25 mol% to about 45 mol% of the one or more ionizable lipids.

32. The lipid nanoparticle of any one of claims 1-27, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of the one or more PEG lipids; (b) about 20 mol% to about 30 mol% of the one or more structural lipids; (c) about 35 mol% to about 45 mol% of the one or more phospholipids; and (d) about 28 mol% to about 40 mol% of the one or more ionizable lipids.

33. The lipid nanoparticle of any one of claims 1-32, wherein the ionizable lipid is selected from any one of the compounds described in Tables I-X.

34. The lipid nanoparticle of any one of claims 1-33, wherein the phospholipid is selected from 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine(DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero- phosphocholine (DMPC), 1.2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn- glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2- oleoyl-sn-glycero-3-phosphocho line (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuc cinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1- hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoylsn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3- phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3- phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl- sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sodium (S)-2-ammonio-3-((((R)-2-(oleoyloxy)-3- (stearoyloxy)propoxy)oxidophosphoryl)oxy)propanoate (L-^-phosphatidylserine; Brain PS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoylphosphatidylglycerol (DMPG), dioleoyl-phosphatidylethanolamine4-(N-maleimidomethyl)- cyclohexane-1-carboxylate (DOPE-mal), dioleoylphosphatidylglycerol (DOPG), 1,2-dioleoyl-sn-glycero- 3-(phospho-L-serine) (DOPS), acell-fusogenicphospholipid (DPhPE), dipalmitoylphosphatidylethanolamine (DPPE), 1,2-Dielaidoyl-sn-phosphatidylethanolamine (DEPE), dipalmitoylphosphatidylglycerol (DPPG), dipalmitoylphosphatidylserine (DPPS), distearoylphosphatidylcholine (DSPC), distearoyl-phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamineimidazole (DSPEI), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), 1,2-dioleoyl-sn-glycero-3-phosphate (18:1 PA; DOPA), ammonium bis((S)- 2-hydroxy-3-(oleoyloxy)propyl) phosphate (18:1 DMP; LBPA), 1,2-dioleoyl-sn-glycero-3-phospho-(1’- myo-inositol) (DOPI; 18:1 PI), 1,2-distearoyl-sn-glycero-3-phospho-L-serine (18:0 PS), 1,2-dilinoleoyl- sn-glycero-3-phospho-L-serine (18:2 PS), 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (16:0- 18:1 PS; POPS), 1-stearoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (18:0-18:1 PS), 1-stearoyl-2- linoleoyl-sn-glycero-3-phospho-L-serine (18:0-18:2 PS), 1-oleoyl-2-hydroxy-sn-glycero-3-phospho-L- serine (18:1 Lyso PS), 1-stearoyl-2-hydroxy-sn-glycero-3-phospho-L-serine (18:0 Lyso PS), and sphingomyelin, or combinations of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of the above phospholipids.

35. The lipid nanoparticle of any one of claims 1-34, wherein the structural lipid is selected from cholesterol, fecosterol, fucosterol, beta sitosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, cholic acid, sitostanol, litocholic acid, tomatine, ursolic acid, alpha-tocopherol, Vitamin D3, Vitamin D2, Calcipotriol, botulin, lupeol, oleanolic acid, beta-sitosterol-acetate and any combinations thereof.

36. The lipid nanoparticle of any one of claims 1-35, wherein the PEG lipid is selected from (R)-2,3- bis(octadecyloxy)propyl-1-(methoxypoly(ethyleneglycol)2000)propylcarbamate, PEG-S-DSG, PEG-S- DMG, PEG-PE, PEG-PAA, PEG-OH DSPE C18, PEG-DSPE, PEG-DSG, PEG-DPG, PEG-DOMG, PEG-DMPE Na, PEG-DMPE, PEG-DMG2000, PEG-DMG C14, PEG-DMG 2000, PEG-DMG, PEG- DMA, PEG-Ceramide C16, PEG-C-DOMG, PEG-c-DMOG, PEG-c-DMA, PEG-cDMA, PEGA, PEG750-C-DMA, PEG400, PEG2k-DMG, PEG2k-C11, PEG2000-PE, PEG2000P, PEG2000-DSPE, PEG2000-DOMG, PEG2000-DMG, PEG2000-C-DMA, PEG2000, PEG200, PEG(2k)-DMG, PEG DSPE C18, PEG DMPE C14, PEG DLPE C12, PEG Click DMG C14, PEG Click C12, PEG Click C10, N(Carbonyl-methoxypolyethylenglycol-2000)-l,2-distearoyl-sn-glycero3-phosphoethanolamine, Myrj52, mPEG-PLA, MPEG-DSPE, mPEG3000-DMPE, MPEG-2000-DSPE, MPEG2000-DSPE, mPEG2000- DPPE, mPEG2000-DMPE, mPEG2000-DMG, mDPPE-PEG2000, l,2-distearoyl-sn-glycero-3- phosphoethanolamine-PEG2000, HPEG-2K-LIPD, Folate PEG-DSPE, DSPE-PEGMA 500, DSPE- PEGMA, DSPE-PEG6000, DSPE-PEG5000, DSPE-PEG2K-NAG, DSPE-PEG2k, DSPE- PEG2000maleimide, DSPE-PEG2000, DSPE-PEG, DSG-PEGMA, DSG-PEG5000, DPPE-PEG-2K, DPPE-PEG, DPPE-mPEG2000, DPPE-mPEG, DPG-PEGMA, DOPE-PEG2000, DMPE-PEGMA, DMPE-PEG2000, DMPE-Peg, DMPE-mPEG2000, DMG-PEGMA, DMG-PEG2000, DMG-PEG, distearoyl-glycerol-polyethyleneglycol, Cl8PEG750, CI8PEG5000, CI8PEG3000, CI8PEG2000, CI6PEG2000, CI4PEG2000, C18-PEG5000, C18PEG, C16PEG, C16 mPEG (polyethylene glycol) 2000 Ceramide, C14-PEG-DSPE200, C14-PEG2000, C14PEG2000, C14-PEG 2000, C14-PEG, C14PEG, 14:0-PEG2KPE, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-PEG2000, (R)-2,3- bis(octadecyloxy)propyl-1-(methoxypoly(ethyleneglycol)2000)propylcarbamate, (PEG)-C-DOMG, PEG- C-DMA, and DSPE-PEG-X, and any combinations thereof.

37. The lipid nanoparticle of any one of claims 1-36, wherein the one or more phospholipids comprises one or more selected from phosphatidylcholine, phosphatidylserine, phosphoethanolamine, and sphingoid lipids or a combination thereof.

38. The lipid nanoparticle of any one of claims 1-37, wherein the one or more phospholipids comprises 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), sphingomyelin or a combination thereof.

39. The lipid nanoparticle of any one of claims 1-38, wherein the one or more phospholipids comprises two or more phospholipids, such that no single phospholipid makes up more than 30 mol% of the total lipid content of the nanoparticle.

40. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises about 40 mol% 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

41. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises about 40 mol% sphingomyelin.

42. The lipid nanoparticle of any one of claims 1-38, wherein the phospholipid is sphingomyelin, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG2k.

43. The lipid nanoparticle of any one of claims 1-38, wherein the ionizable lipid is any compound from Tables I-X, the phospholipid is sphingomyelin, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG2k.

44. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of DMG-PEG2k; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% sphingomyelin; and (d) about 25 mol% to about 45 mol% of the one or more ionizable lipids.

45. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of DMG-PEG2k; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% sphingomyelin; and (d) about 25 mol% to about 45 mol% of an ionizable lipid selected from those in Tables I-X, or any combinations thereof.

46. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of DMG-PEG2k; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% sphingomyelin; and (d) about 28 mol% to about 40 mol% of the one or more ionizable lipids.

47. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of DMG-PEG2k; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% sphingomyelin; and (d) about 28 mol% to about 40 mol% of an ionizable lipid selected from those in Tables I-X, or any combinations thereof.

48. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 2 mol% of DMG-PEG2k; (b) about 25 mol% cholesterol; (c) about 40 mol% sphingomyelin; and (d) about 33 mol% of an ionizable lipid selected from those in Tables I-X, or any combinations thereof.

49. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 2 mol% of DMG-PEG2k; (b) about 25 mol% cholesterol; (c) about 40 mol% sphingomyelin; and (d) about 33 mol% of the one or more ionizable lipids.

50. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of DMG-PEG2k; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% DSPC; and (d) about 25 mol% to about 45 mol% of the one or more ionizable lipids.

51. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of DMG-PEG2k; (b) about 15 mol% to about 35 mol% cholesterol; (c)about 30 mol% to about 60 mol% DSPC; and (d) about 25 mol% to about 45 mol% of an ionizable lipid selected from those in Tables I-X, or any combinations thereof.

52. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of DMG-PEG2k; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% DSPC; and (d) about 28 mol% to about 40 mol% of the one or more ionizable lipids.

53. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of DMG-PEG2k; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% DSPC; and (d) about 28 mol% to about 40 mol% of an ionizable lipid selected from those in Tables I-X, or any combinations thereof.

54. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 2 mol% of DMG-PEG2k; (b) about 25 mol% cholesterol; (c) about 40 mol% DSPC; and (d) about 33 mol% of an ionizable lipid selected from those in Tables I-X, or any combinations thereof.

55. The lipid nanoparticle of any one of claims 1-38, wherein the one or more phospholipids comprises a mixture of sphingomyelin and DSPC, the structural lipid is cholesterol, and the PEG lipid is DMG -PEG2k.

56. The lipid nanoparticle of any one of claims 1-38, wherein the ionizable lipid is any compound from Tables I-X, the one or more phospholipids comprise a mixture of sphingomyelin and DSPC, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG2k.

57. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of DMG-PEG2k; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% of a combination of sphingomyelin and DSPC; and (d) about 25 mol% to about 45 mol% of the one or more ionizable lipids.

58. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 1 mol% to about 3 mol% of DMG-PEG2k; (b) about 15 mol% to about 35 mol% cholesterol; (c) about 30 mol% to about 60 mol% of a combination of sphingomyelin and DSPC; and (d) about 25 mol% to about 45 mol% of an ionizable lipid selected from those in Tables I-X, or any combinations thereof.

59. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of DMG-PEG2k; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% of a combination of sphingomyelin and DSPC; and (d) about 28 mol% to about 40 mol% of the one or more ionizable lipids.

60. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 1.5 mol% to about 2.5 mol% of DMG-PEG2k; (b) about 20 mol% to about 30 mol% cholesterol; (c) about 35 mol% to about 45 mol% of a combination of sphingomyelin and DSPC; and (d) about 28mol% to about 40 mol% of an ionizable lipid selected from those in Tables I-X, or any combinations thereof.

61. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 2 mol% of DMG-PEG2k; (b) about 25 mol% cholesterol; (c) about 40 mol% of a combination of sphingomyelin and DSPC; and (d) about 33 mol% of an ionizable lipid selected from those in Tables I-X, or any combinations thereof.

62. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises (a) about 2 mol% of DMG-PEG2k; (b) about 25 mol% cholesterol; (c) about 40 mol% of a combination of sphingomyelin and DSPC; and (d) about 33 mol% of the one or more ionizable lipids.

63. The lipid nanoparticle of any one of claims 1-38, wherein the lipid nanoparticle comprises about 20 mol% 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and about 20 mol% sphingomyelin.

64. The lipid nanoparticle of any one of claims 1-63, wherein the lipid nanoparticle further comprises at least one additional lipid component selected from 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine (18:3 PC), Acylcarnosine (AC), 1- hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), N-oleoyl-sphingomyelin (SPM) (C18:l), N- lignoceryl SPM (C24:0), N-nervonoylshphingomyelin (C24:l), Cardiolipin (CL), l,2-bis(tricosa-10,12- diynoyl)-sn-glycero-3-phosphocholine (DC8-9PC), dicetyl phosphate (DCP), dihexadecyl phosphate (DCP1), 1,2-Dipalmitoylglycerol-3-hemisuccinate (DGSucc), short-chain bis-n-heptadecanoyl phosphatidylcholine (DHPC), dihexadecoyl-phosphoethanolamine (DHPE), 1,2-dilinoleoyl-sn-glycero-3- phosphocholine (DLPC), l,2-dilauroyl-sn-glycero-3-PE (DLPE), dimyristoyl glycerol hemisuccinate (DMGS), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphoethanolamine (DMPE), dimyristoylphosphatidylglycerol (DMPG), dioleyloxybenzylalcohol (DOBA), 1,2-dioleoylglyceryl-3- hemisuccinate (DOGHEMS), N-[2-(2-{2-[2-(2,3-Bis-octadec-9-enyloxy-propoxy)-ethoxy]-ethoxy}- ethoxy)-ethyl]-3-(3,4,5-1rihydroxy-6-hydroxymethyl-1etrahydro-pyran-2-ylsulfanyl)-propionamide (DOGP4^Man), dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylethanolamine (DOPE), dioleoyl-phosphatidylethanolamine4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dioleoylphosphatidylglycerol (DOPG), 1,2-dioleoyl-sn-glycero-3-(phospho-L-serine) (DOPS), acell- fusogenicphospholipid (DPhPE), dipalmitoylphosphatidylethanolamine (DPPE), dipalmitoylphosphatidylglycerol (DPPG), dipalmitoylphosphatidylserine (DPPS), distearoylphosphatidylcholine (DSPC), distearoyl-phosphatidyl-ethanolamine (DSPE), distearoyl phosphoethanolamineimidazole (DSPEI), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), egg phosphatidylcholine (EPC), histaminedistearoylglycerol (HDSG), 1,2-Dipalmitoylglycerol- hemisuccinate-N^-Histidinyl-Hemisuccinate (HistSuccDG), N-(5'-hydroxy-3'-oxypentyl)-10-12- pentacosadiynamide (h-Pegi-PCDA), 2-[l-hexyloxyethyl]-2-devinylpyropheophorbide-a (HPPH),hydrogenatedsoybeanphosphatidylcholine (HSPC), 1,2-Dipalmitoylglycerol-O-^-histidinyl-N^- hemisuccinate (IsohistsuccDG), mannosialized dipalmitoylphosphatidylethanolamine (ManDOG), l,2- Dioleoyl-sn-Glycero-3-Phosphoethanolamine-N-[4-(p-maleimidomethyl)cyclohexane-carboxamide] (MCC-PE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16:0 PE), 1-myristoyl-2-hydroxy- sn-glycero-phosphocholine (MHPC), a thiol-reactive maleimide headgroup lipid e.g.1,2-dioleoyl-sn- glycero-3-phosphoethanolamine-N-[4-(p-maleimidophenyl)but-yramid (MPB-PE), Nervonic Acid (NA), sodium cholate (NaChol), l,2-dioleoyl-sn-glycero-3-[phosphoethanolamine-N-dodecanoyl (NC12- DOPE), 1-oleoyl-2-cholesteryl hemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), phosphatidylethanolamine lipid (PE), PE lipid conjugated with polyethylene glycol(PEG) (e.g., polyethylene glycol-distearoylphosphatidylethanolamine lipid (PEG-PE)), phosphatidylglycerol (PG), partially hydrogenated soy phosphatidylchloline (PHSPC), phosphatidylinositol lipid (PI), phosphotidylinositol-4-phosphate (PIP), palmitoyloleoylphosphatidylcholine (POPC), phosphatidylethanolamine (POPE), palmitoyloleyolphosphatidylglycerol (POPG), phosphatidylserine (PS), lissamine rhodamineB-phosphatidylethanolamine lipid (Rh-PE), purifiedsoy- derivedmixtureofphospholipids (SIOO), phosphatidylcholine (SM), 18-1-trans-PE,1-stearoyl-2-oleoyl- phosphatidyethanolamine (SOPE), soybean phosphatidylcholine (SPC), sphingomyelins (SPM), alpha,alpha-trehalose-6,6'-dibehenate (TDB), l,2-dielaidoyl-sn-glycero-3-phophoethanolamine (transDOPE), ((23S,5R)-3-(bis(hexadecyloxy)methoxy)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin- 1(2H)-yl)tetrahydrofuran-2-yl)methylmethylphosphate, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3- phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero- 3-phosphocholine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dioleyl-sn-glycero-3-phosphoethanolamine, 1,2-distearoyl-sn-glycero-3- phosphoethanolamine, 16-O-monomethyl PE, 16-O-dimethyl PE, and dioleylphosphatidylethanolamine.

65. The lipid nanoparticle of any one of claims 1-66, wherein the lipid nanoparticle further comprising a targeting moiety.

66. The lipid nanoparticle of claim 65, wherein the targeting moiety has affinity for an HSC or surface protein thereof.

67. The lipid nanoparticle of claim 66, wherein the HSC surface protein is selected from the group consisting of: CD2; 2B4 / CD244 / SLAMF4; ABCG2; Aldehyde Dehydrogenase 1-A1 / ALDH1A1; BMI-1; C1qR1 / CD93; CD34; CD38; CD44; CD45; CD48 / SLAMF2; CD90 / Thy1; CD117 / c-kit; CD133; CDCP1; CXCR4; Endoglin / CD105; EPCR; Erythropoietin R; ESAM; EVI-1;Flt-3 / Flk-2; GATA-2; GFI-1; Hematopoietic Lineage Marker; Hematopoietic Stem Cells; Integrin alpha 6 / CD49f; Mcl-1; MYB; PLZF;Podocalyxin; Prominin 2; PTEN; PU.1 / Spi-1; Sca-1 / Ly6; SLAM / CD150; Spi-B; STAT5a / b; STAT5a; STAT5b; VCAM-1 / CD106; and VEGFR2 / KDR / Flk-1.

68. The lipid nanoparticle of claim 66, wherein the HSC surface protein is selected from the group consisting of: CD2; CD90; and CD117.

69. The lipid nanoparticle of claim 65, wherein the targeting moiety comprises an antibody or antigen-binding fragment thereof selected from IgG2k clone A3C6E2 antibody and IgG2k clone 104D2 antibody.

70. A pharmaceutical composition comprising a lipid nanoparticle of any one of claims 1-69 and one or more pharmaceutically acceptable excipients.

71. A cell comprising a lipid nanoparticle or pharmaceutical composition of any one of claims 1-70.

72. A cell comprising an edit in a hemoglobin gene or regulatory region thereof installed by a gene editing system of any lipid nanoparticle or pharmaceutical composition of any one of claims 1-70.

73. The pharmaceutical composition of claim 70 for use as a medicament in treatment of a hemoglobinopathy.

74. The pharmaceutical composition of claim 73, wherein the hemoglobinopathy is sickle cell disease (SCD) of transfusion-dependent ^-thalassemia (TDT).

75. The pharmaceutical composition of claim 73, wherein the hemoglobinopathy is treated by increasing the production of fetal hemoglobin.

76. The pharmaceutical composition of claim 75, wherein the production of fetal hemoglobin is increased by disrupting the BCL11A binding site in the HBG1 / 2 promoters.

77. The pharmaceutical composition of claim 75, wherein the production of fetal hemoglobin is increased by disrupting the enhancer sequence of the gene encoding BCL11A.

78. A method of treating a hemoglobinopathy in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition of any one of claims 73-77.

79. A method of treating a hemoglobinopathy in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a lipid nanoparticle comprising: a) a cargo comprising one or more nucleic acid molecules encoding a type V gene editing system which is capable of installing an edit in a hemoglobin or hemoglobin-associated gene or regulatory region which results in an increased production of fetal hemoglobin; b) one or more ionizable lipids; c) one or more phospholipids, in an amount of about 20 mol% to about 60 mol% of the total lipid content of the lipid nanoparticle;d) one or more structural lipids; and e) one or more PEG lipids.

80. The method of claim any one of claims 78 and 79, wherein the therapeutically effective amount of the pharmaceutical composition is a dosage regimen capable of affecting the edit to the hemoglobin or hemoglobin-associated gene or regulatory region in at least 25% of long-term hematopoietic stem cells in a bone marrow sample collected from the subject 28 days after administration.

81. The method of claim 79, wherein the one or more nucleic acid molecules are DNA and / or RNA molecules.

82. The method of claim 79, wherein the one or more nucleic acid molecules are RNA molecules.

83. The method of claim 79, wherein the gene editing system comprises (i) a zinc finger protein, (ii) a TALEN protein, or (iii) a nucleic acid programmable nuclease and a guide RNA.

84. The method of claim 79, wherein the gene editing system is a CRISPR-type II gene editing system, a CRISPR-type V gene editing system, or a retron gene editing system.

85. The method of claim 84, wherein the retron gene editing system comprises a CRISPR-type II or type V nuclease or functional variant or ortholog thereof, a retron non-coding RNA (ncRNA), and a guide RNA.

86. The method of claim 83 or 85, wherein the guide RNA comprises a spacer sequence that is complementary to a target sequence.

87. The method of claim 86, wherein the target sequence is a hemoglobin gene or regulatory region thereof.

88. The method of claim 87, wherein the hemoglobin gene or regulatory region thereof is the gene encoding hemoglobin beta subunit.

89. The method of claim 87, wherein the hemoglobin gene or regulatory region thereof is the BCL11A binding site in the HBG1 / 2 promoter.

90. The method of claim 87, wherein the hemoglobin gene or regulatory region thereof is the enhancer sequence of the gene encoding BCL11A.

91. The method of claim 87, wherein the hemoglobin gene or regulatory region thereof is the binding site of the GATA-1 activator in the HBG1 / 2 promoter.

92. The method of claims 83 or 85, wherein the guide RNA comprises a sequence selected from: (a) SEQ ID NO: 51; (b) SEQ ID NOs: 207-218; (c) SEQ ID NOs: 220-537; and (d) SEQ ID NOs: 680-720;or any portion thereof or a sequence having at least 80%, or 85% or 90%, or 95%, or 99%, or up to 100% sequence identity with any of the aforementioned sequences.

93. The method of claims 83 or 85, wherein the guide RNA comprises miRNA sequences selected from: (a) SEQ ID NO: 721-735; (b) SEQ ID NOs: 721; and (c) SEQ ID NOs: 723; or any portion thereof or a sequence having at least 80%, or 85% or 90%, or 95%, or 99%, or up to 100% sequence identity with any of the aforementioned sequences.

94. The method of claim 84, wherein the CRISPR-type V nuclease comprises SEQ ID NOs: 52, 53, 57-80, 84-93, 96-126, 754-792 or any amino acid sequence having at least 80%, or 85% or 90%, or 95%, or 99%, or up to 100% sequence identity with any of the aforementioned sequences.

95. A lipid nanoparticle comprising: a) a cargo comprising one or more nucleic acid molecules encoding and / or constituting a gene editing system capable of installing an edit in a hemoglobin gene or regulatory region thereof which results in an increased production of fetal hemoglobin; b) one or more ionizable lipids in an amount of about 25 mol% to about 45 mol%; c) one or more phospholipids in an amount of about 30 mol% to about 60 mol%; d) one or more structural lipids in an amount of about 15 mol% to about 35 mol%; and e) one or more PEG lipids in an amount of about 1 mol% to about 3 mol%; wherein the amount of each lipid component is as a proportion of the total lipid content of the lipid nanoparticle.

96. The lipid nanoparticle of claim 95, wherein the lipid nanoparticle does not comprise a targeting moiety.

97. The lipid nanoparticle of any one of claims 95-96, wherein the one or more nucleic acid molecules are DNA and / or RNA molecules.

98. The lipid nanoparticle of any one of claims 95-97, wherein the one or more nucleic acid molecules are RNA molecules.

99. The lipid nanoparticle of any one of claims 95-98, wherein the gene editing system is a CRISPR- type II gene editing system, a CRISPR-type V gene editing system, or a retron gene editing system.

100. The lipid nanoparticle of claim 99, wherein the CRISPR-type II gene editing system comprises a CRISPR-type II nuclease or functional variant or ortholog thereof and a guide RNA.

101. The lipid nanoparticle of claim 99, where the CRISPR-type V gene editing system comprises a CRISPR-type V nuclease or functional variant or ortholog thereof and a guide RNA.

102. The lipid nanoparticle of any one of claims 100 and 101, wherein the guide RNA comprises a spacer sequence that is complementary to a target sequence.

103. The lipid nanoparticle of claim 102, wherein the target sequence is a hemoglobin gene or regulatory region thereof.

104. The lipid nanoparticle of any one of claims 95-103, wherein the hemoglobin gene or regulatory region thereof is the gene encoding hemoglobin beta subunit.

105. The lipid nanoparticle of any one of claims 95-103, wherein the hemoglobin gene or regulatory region thereof is the BCL11A binding site in the HBG1 / 2 promoter.

106. The lipid nanoparticle of any one of claims 95-103, wherein the hemoglobin gene or regulatory region thereof is the enhancer sequence of the gene encoding BCL11A.

107. The lipid nanoparticle of any one of claims 95-103, wherein the hemoglobin gene or regulatory region thereof is the binding site of the GATA-1 activator in the HBG1 / 2 promoter.

108. The lipid nanoparticle any one of claims 101-107, wherein the type V guide RNA comprises a sequence selected from SEQ ID NOs: 51, 207-218, or any portion thereof or a sequence having at least 80%, or 85% or 90%, or 95%, or 99%, or up to 100% sequence identity with any of the aforementioned sequences.

109. The lipid nanoparticle of any one of claims 101-107, wherein the guide RNA comprises SEQ ID NOs: 220-537 and 680-720, or any portion thereof or a sequence having at least 80%, or 85% or 90%, or 95%, or 99%, or up to 100% sequence identity with any of the aforementioned sequences.

110. The lipid nanoparticle of any one of claims 101-107, wherein the CRISPR-type V nuclease comprises SEQ ID NOs: 52, 53, 57-80, 84-93, 96-126, 754-792 or any amino acid sequence having at least 80%, or 85% or 90%, or 95%, or 99%, or up to 100% sequence identity with any of the aforementioned sequences.

111. The lipid nanoparticle of any one of claims 95-110, wherein the gene editing system comprises one or more additional accessory proteins.

112. The lipid nanoparticle of claim 111, wherein the one or more accessory proteins comprises a nuclease, reverse transcriptase, recombinase, transposase, integrase, DNA binding protein, transcription factor, a CRISPR Cas protein, or an anti-CRISPR inhibitor protein.

113. The lipid nanoparticle of claim 112, wherein the CRISPR Cas protein is Cas1, Cas2, Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas10d, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (Cas14 or C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, Cas13x.1, Cse1, Cse2, Csy1, Csy2, Csy3, Csm2, Cmr5, Csx10, Csf1, Csn2, C2c4, C2c8, or C2c9.

114. The lipid nanoparticle of any one of claims 111-113, wherein the one or more accessory proteins may be provided in trans or may be coupled to one or more components of the gene editing system.

115. The lipid nanoparticle of any one of claims 111-113, wherein the one or more accessory proteins is coupled to one or more components of the gene editing system by a linker.

116. The lipid nanoparticle of claim 115, wherein the linker has an amino acid sequence of SEQ ID NOs: 33-37 and 81-83.

117. The lipid nanoparticle of any one of claims 95-117, wherein the N:P ratio is from about 5:1 to about 8:

1.

118. A pharmaceutical composition comprising a lipid nanoparticle of any one of claims 111-113, and one or more pharmaceutical excipients.

119. A cell comprising a lipid nanoparticle of claims 95-117 or a pharmaceutical composition of claim 118.

120. A cell comprising an edit in a hemoglobin gene or regulatory region thereof installed by a gene editing system of any lipid nanoparticle of claims 95-117 or a pharmaceutical composition of claim 118.

121. The pharmaceutical composition of claim 118 for use as a medicament in treatment of a hemoglobinopathy.

122. The pharmaceutical composition of claim 121, wherein the hemoglobinopathy is sickle cell disease (SCD) of transfusion-dependent ^-thalassemia (TDT).

123. The pharmaceutical composition of claim 121, wherein the hemoglobinopathy is treated by increasing the production of fetal hemoglobin.

124. The pharmaceutical composition of claim 123, wherein the production of fetal hemoglobin is increased by disrupting the BCL11A binding site in the HBG1 / 2 promoters.

125. The pharmaceutical composition of claim 123, wherein the production of fetal hemoglobin is increased by disrupting the enhancer sequence of the gene encoding BCL11A.

126. A method of treating a hemoglobinopathy in a subject in need thereof, the method comprising administering to a subject a therapeutically effective amount of a pharmaceutical composition of any one of claims 121-125.

127. A lipid nanoparticle for delivery of a nucleic acid cargo to a hematopoietic stem cell in vivo to treat a hemoglobinopathy, the lipid nanoparticle comprising: a) a cargo comprising one or more nucleic acid molecules encoding a type V gene editing system which is capable of installing an edit in a hemoglobin or hemoglobin-associated gene or regulatory region which results in an increased production of fetal hemoglobin; b) one or more ionizable lipids selected from any of the compounds of Tables (I)-(X) in an amount of about 33 mol%;c) one or more phospholipids in an amount of about 40 mol%; d) one or more structural lipids in an amount of about 25 mol%; and e) one or more PEG lipids in an amount of about 2 mol%; wherein the amount of each lipid component is as a proportion of the total lipid content of the lipid nanoparticle.

128. The lipid nanoparticle of claim 127, wherein the lipid nanoparticle does not comprise a targeting moiety.

129. The lipid nanoparticle of claim any one of claims 127-128, wherein the lipid nanoparticle passively delivers to hematopoietic stem cells in vivo.

130. The lipid nanoparticle of any one of claims 127-129, wherein the one or more nucleic acid molecules are DNA and / or RNA molecules.

131. The lipid nanoparticle of any one of claims 127-130, wherein the one or more nucleic acid molecules are RNA molecules.

132. The lipid nanoparticle of any one of claims 127-131, wherein the CRISPR-type V gene editing system comprises a CRISPR-type V nuclease or functional variant or ortholog thereof and a guide RNA.

133. The lipid nanoparticle of claim 132, wherein the guide RNA comprises a spacer sequence that is complementary to a target sequence.

134. The lipid nanoparticle of any one of claims 127-133, wherein the target sequence is a hemoglobin gene or regulatory region thereof.

135. The lipid nanoparticle of any one of claims 127-134, wherein the hemoglobin gene or regulatory region thereof is the BCL11A binding site in the HBG1 / 2 promoter.

136. The lipid nanoparticle of any one of claims 127-134, wherein the hemoglobin gene or regulatory region thereof is the enhancer sequence of the gene encoding BCL11A.

137. The lipid nanoparticle of any one of claims 132-136, wherein the type V guide RNA comprises a sequence selected from: (a) SEQ ID NO: 51; (b) SEQ ID NOs: 207-218; (c) SEQ ID NOs: 220-537; and (d) SEQ ID NOs: 680-720; or any portion thereof or a sequence having at least 80%, or 85% or 90%, or 95%, or 99%, or up to 100% sequence identity with any of the aforementioned sequences.

138. The lipid nanoparticle of any one of claims 132-136, wherein the guide RNA comprises miRNA sequences selected from: (a) SEQ ID NO: 721-735;(b) SEQ ID NOs: 721; and (c) SEQ ID NOs: 723; or any portion thereof a sequence having at least 80%, or 85% or 90%, or 95%, or 99%, or up to 100% sequence identity with any of the aforementioned sequences 139. The lipid nanoparticle of any one of claims 132-136, wherein the CRISPR-type V nuclease comprises SEQ ID NOs: 52, 53, 57-80, 84-93, 96-126, 754-792 or any amino acid sequence having at least 80%, or 85% or 90%, or 95%, or 99%, or up to 100% sequence identity with any of the aforementioned sequences.

140. The lipid nanoparticle of any one of claims 127-139, wherein the N:P ratio is from about 5:1 to about 8:

1.

141. The lipid nanoparticle of any one of claims 127-140, further comprising a targeting moiety.

142. The lipid nanoparticle of claim 141, wherein the targeting moiety has affinity for an HSC or surface protein thereof.

143. The lipid nanoparticle of claim 142, wherein the HSC surface protein is selected from the group consisting of: CD2; 2B4 / CD244 / SLAMF4; ABCG2; Aldehyde Dehydrogenase 1-A1 / ALDH1A1; BMI-1; C1qR1 / CD93; CD34; CD38; CD44; CD45; CD48 / SLAMF2; CD90 / Thy1; CD117 / c-kit; CD133; CDCP1; CXCR4; Endoglin / CD105; EPCR; Erythropoietin R; ESAM; EVI-1;Flt-3 / Flk-2; GATA-2; GFI-1; Hematopoietic Lineage Marker; Hematopoietic Stem Cells; Integrin alpha 6 / CD49f; Mcl-1; MYB; PLZF; Podocalyxin; Prominin 2; PTEN; PU.1 / Spi-1; Sca-1 / Ly6; SLAM / CD150; Spi-B; STAT5a / b; STAT5a; STAT5b; VCAM-1 / CD106; and VEGFR2 / KDR / Flk-1.

144. The lipid nanoparticle of claim 142, wherein the HSC surface protein is selected from the group consisting of: CD2; CD90; and CD117.

145. A pharmaceutical composition comprising a lipid nanoparticle of any one of claims 127-144 and one or more pharmaceutical excipients.

146. A cell comprising a lipid nanoparticle of claims 127-145 or a pharmaceutical composition of claim 146.

147. A cell comprising an edit in a hemoglobin gene or regulatory region thereof installed by a gene editing system of any lipid nanoparticle of claims 127-145 or a pharmaceutical composition of claim 146.

148. The pharmaceutical composition of claim 146 for use as a medicament in treatment of a hemoglobinopathy.

149. The pharmaceutical composition of claim 148, wherein the hemoglobinopathy is sickle cell disease (SCD) of transfusion-dependent ^-thalassemia (TDT).

150. The pharmaceutical composition of any one of claims 148-149, wherein the hemoglobinopathy is treated by increasing the production of fetal hemoglobin.

151. The pharmaceutical composition of claim 150, wherein the production of fetal hemoglobin is increased by disrupting the BCL11A binding site in the HBG1 / 2 promoters.

152. The pharmaceutical composition of claim 150, wherein the production of fetal hemoglobin is increased by disrupting the enhancer sequence of the gene encoding BCL11A.

153. A method of treating a hemoglobinopathy, the method comprising administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition of any one of claims 148-152. ^

Images