Modified unc13a oligonucleotides

EP4720294A2Pending Publication Date: 2026-04-08QURALIS CORP
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-05-31
Publication Date
2026-04-08

AI Technical Summary

Technical Problem

Current treatments lack effective solutions for neurological diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), and related conditions, which progress rapidly and have no known cure or therapeutic prevention.

Method used

Development of modified UNC13A oligonucleotides with spacers that are at least 85% complementary to UNC13A transcripts, designed to target and reduce mis-spliced UNC13A transcripts, thereby increasing full-length UNC13A protein expression and stabilizing its activity.

Benefits of technology

The modified UNC13A oligonucleotides demonstrate a significant increase in full-length UNC13A protein expression and reduction of mis-spliced transcripts, potentially offering a therapeutic approach to treat neurological diseases by modulating UNC13A activity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024031911_05122024_PF_FP_ABST
    Figure US2024031911_05122024_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed herein are UNC13A oligonucleotides with one or more spacers or without a spacer. In various embodiments, UNC13A oligonucleotides with spacer(s) reduce mis-spliced UNC13A transcripts and increase full length UNC13A transcripts, thereby imparting therapeutic efficacy against neurological diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or Alzheimer's disease (AD).
Need to check novelty before this filing date? Find Prior Art

Description

MODIFIED UNC13A OLIGONUCLEOTIDES CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No.63 / 470,722 filed June 2, 2023, the entire disclosure of which is hereby incorporated by reference in its entirety for all purposes. FIELD OF THE DISCLOSURE

[0002] This application relates generally to methods of treating neurological diseases with UNC13A splice-switching antisense oligonucleotides, in particular, UNC13A antisense oligonucleotides with one or more spacers that target an UNC13A transcript. BACKGROUND

[0003] Motor neuron diseases are a class of neurological diseases that result in the degeneration and death of motor neurons – those neurons which coordinate voluntary movement of muscles by the brain. Motor neuron diseases may be sporadic or inherited, and may affect upper motor neurons and / or lower motor neurons. Motor neuron diseases include amyotrophic lateral sclerosis, progressive bulbar palsy, pseudobulbar palsy, primary lateral sclerosis, progressive muscular atrophy, spinal muscular atrophy, and post-polio syndrome.

[0004] Amyotrophic lateral sclerosis (ALS) is a group of motor neuron diseases affecting about 15,000 individuals in the United States of America. ALS is characterized by degeneration and death of upper and lower motor neurons, resulting in loss of voluntary muscle control. Motor neuron death is accompanied by muscle fasciculation and atrophy. Early symptoms of ALS include muscle cramps, muscle spasticity, muscle weakness (for example, affecting an arm, a leg, neck, or diaphragm), slurred and nasal speech, and difficulty chewing or swallowing. Loss of strength and control over movements, including those necessary for speech, eating, and breathing, eventually occur. Disease progression may be accompanied by weight loss, malnourishment, anxiety, depression, increased risk of pneumonia, muscle cramps, neuropathy, and possibly dementia. Most individuals diagnosed with ALS die of respiratory failure within five years of the first appearance of symptoms. Currently, there is no effective treatment for ALS.

[0005] ALS occurs in individuals of all ages, but is most common in individuals between 55 to 75 years of age, with a slightly higher incidence in males. ALS can be characterized as sporadicor familial. Sporadic ALS appears to occur at random and accounts for more than 90% of all incidences of ALS. Familial ALS accounts for 5-10% of all incidences of ALS.

[0006] FTD refers to a spectrum of progressive neurodegenerative diseases caused by loss of neurons in frontal and temporal lobes of the brain. FTD is the third most common form of dementia (following Alzheimer’s disease and dementia with Lewy bodies), and the second most common form of dementia in individuals below 65 years of age. FTD is estimated to affect 50,000 to 60,000 individuals in the United States of America. FTD is characterized by changes in behavior and personality, and language dysfunction. Forms of FTD include behavioral variant FTD (bvFTD), semantic variant primary progressive aphasia (svPPA), and nonfluent variant primary progressive aphasia (nfvPPA). ALS with FTD is characterized by symptoms associated with FTD, along with symptoms of ALS such as muscle weakness, atrophy, fasciculation, spasticity, speech impairment (dysarthria), and inability to swallow (dysphagia). Individuals usually succumb to FTD within 5 to 10 years, while ALS with FTD often results in death within 2 to 3 years of the first disease symptoms appearing.

[0007] Like ALS, there is no known cure for FTD, or ALS with FTD, nor a therapeutic known to prevent or retard either disease’s progression.

[0008] Thus, there is a pressing need to identify compounds and / or compositions capable of preventing, ameliorating, and treating neurological diseases such as: amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, and Limbic-predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, and synaptic diseases like autism. SUMMARY

[0009] Described herein are oligonucleotides comprising one or more spacers and comprising a sequence that is at least 85% complementary to an equal length portion of a UNC13A transcript

[0010] In one aspect, provided herein is a modified UNC13A oligonucleotide consisting of 18 oligonucleotide units comprising at least one spacer.

[0011] In some embodiments, the modified UNC13A oligonucleotide comprises a sequence at least 85% complementary to an equal length portion of any one of SEQ ID NOs: 1-12.

[0012] In some embodiments, 16 of the 18 oligonucleotide units are complementary to an equal length portion of any one of SEQ ID NOs: 1-12.

[0013] In some embodiments, the oligonucleotide comprises a segment with at most 7 linked nucleosides.

[0014] In some embodiments, the oligonucleotide comprises a segment with at most 6, 5, 4, 3, or 2 linked nucleosides.

[0015] In some embodiments, every segment of the oligonucleotide comprises at most 7 linked nucleosides.

[0016] In some embodiments, the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 13 – 1283 or 2571 - 2594.

[0017] In some embodiments, the oligonucleotide comprises two spacers.

[0018] In some embodiments, the oligonucleotide is 100% identical to any one of SEQ ID NOs: 2571 - 2594.

[0019] In some embodiments, the spacer is a nucleoside-replacement group comprising a non- sugar substitute that is incapable of linking to a nucleotide base.

[0020] In some embodiments, the spacer is located between positions 4 and 15 of the oligonucleotide.

[0021] In some embodiments, the oligonucleotide further comprises a second spacer, and the second spacer is located between positions 10 and 15 of the oligonucleotide.

[0022] In some embodiments, the spacer and the second spacer are separated by at least 2 nucleobases, at least 3 nucleobases, at least 5 nucleobases at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases in the oligonucleotide.

[0023] In some embodiments, the spacer is located between positions 4 and 9 of the oligonucleotide, and the second spacer is located between positions 10 and 15 of the oligonucleotide.

[0024] In some embodiments, the spacer is located at position 8 of the oligonucleotide, and the second spacer is located at position 11 of the oligonucleotide.

[0025] In some embodiments, the spacer is located at position 5 of the oligonucleotide, and the second spacer is located at position 13 of the oligonucleotide.

[0026] In some embodiments, the spacer is located at position 6 of the oligonucleotide, and the second spacer is located at position 14 of the oligonucleotide.

[0027] In some embodiments, at least one of the two spacers are adjacent to a guanine nucleobase.

[0028] In some embodiments, each of the at least one of the two spacers immediately precede a guanine nucleobase.

[0029] In some embodiments, each of the first or second spacers is a nucleoside-replacement group comprising a non-sugar substitute wherein the non-sugar substitute does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base.

[0030] In some embodiments, each of the first or second spacers is independently represented by Formula (X), wherein:[ Formula (X)

[0032] Ring A is an optionally substituted 4-8 member monocyclic cycloalkyl group or a 4-8 member monocyclic heterocyclyl group, wherein the heterocyclyl group contains 1 or 2 heteroatoms selected from O, S and N, provided that A is not capable of forming a covalent bond to a nucleobase; and

[0033] thesymbol represents the point of connection to an internucleoside linkage.

[0034] In some embodiments, each of the first or second spacers is independently represented by Formula (Xa), wherein: [Formula (Xa).

[0036] In some embodiments, ring A is an optionally substituted 4-8 member monocyclic cycloalkyl group selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; or a 4-8 member monocyclic heterocyclyl group, selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, 4yrrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl.

[0037] In some embodiments, ring A is tetrahydrofuranyl.

[0038] In some embodiments, ring A is tetrahydropyranyl.

[0039] In some embodiments, each of the first or second spacers is independently represented by Formula I, wherein:

[0040] Formula (I)

[0041] X is selected from -CH2- and -O-; and

[0042] n is 0, 1, 2 or 3.

[0043] In some embodiments, each of the first or second spacers is independently represented by Formula I’, wherein:

[0044] Formula (I’)

[0045] X is selected from -CH2- and -O-; and

[0046] n is 0, 1, 2 or 3.

[0047] In some embodiments, each of the first or second spacers is independently represented by Formula (Ia), wherein:

[0048] Formula (Ia); and

[0049] n is 0, 1, 2 or 3.

[0050] In some embodiments, each of the first or second spacers is independently represented by Formula (Ia’), wherein:

[0051] Formula (Ia’); and

[0052] n is 0, 1, 2 or 3.

[0053] In some embodiments, each of the first or second spacers is independently represented by Formula II, wherein:

[0054] Formula (II); and

[0055] X is selected from -CH2- and -O-.

[0056] In some embodiments, each of the first or second spacers is independently represented by Formula II’, wherein:

[0057] Formula (II’); and

[0058] X is selected from -CH2- and -O-.

[0059] In some embodiments, each of the first or second spacers is independently represented by Formula (Iia), wherein:

[0060] Formula (Iia).

[0061] In some embodiments, each of the first or second spacers is independently represented by Formula (Iia’), wherein:

[0062] Formula (Iia’).

[0063] In some embodiments, each of the first or second spacers is independently represented by Formula (IIi), wherein: [Formula (IIi)

[0065] X is selected from -CH2- and -O-.

[0066] In some embodiments, each of the first or second spacers is independently represented by Formula (IIi’), wherein:

[0067] Formula (IIi’)

[0068] X is selected from -CH2- and -O-.

[0069] In some embodiments, each of the first or second spacers is independently represented by Formula (IIib), wherein: [Formula (IIib).

[0071] In some embodiments, each of the first or second spacers is independently represented by Formula (IIib’), wherein:

[0072] Formula (IIib’).

[0073]

[0074] In some embodiments, each of the first or second spacers is independently represented by Formula III, wherein:

[0075] Formula (III); and

[0076] X is selected from -CH2- and -O-.

[0077] In some embodiments, each of the first or second spacers is independently represented by Formula III’, wherein:

[0078] Formula (III’); and

[0079] X is selected from -CH2- and -O-.

[0080] In some embodiments, each of the first or second spacers is independently represented by Formula (IIIa), wherein:

[0081] Formula (IIIa).

[0082] In some embodiments, each of the first or second spacers is independently represented by Formula (IIIa’), wherein:

[0083] Formula (IIIa’).

[0084] In some embodiments, the oligonucleotide further comprises a locked nucleic acid (LNA).

[0085] In some embodiments, the locked nucleic acid (LNA) is located at one of positions 4, 7, 9, 12, or 13 of the oligonucleotide.

[0086] In some embodiments, the oligonucleotide comprising the spacer has a GC content of at least 10%. In some embodiments, the oligonucleotide comprising the spacer has a GC content of at least 20%. In some embodiments, the oligonucleotide comprising the spacer has a GC content of at least 25%. In some embodiments, the oligonucleotide comprising the spacer has a GC content of at least 30%. In some embodiments, the oligonucleotide comprising the spacer has a GC content of at least 40%. In some embodiments, the oligonucleotide comprising the spacer has a GC content of at least 50%.

[0087] In some embodiments, the oligonucleotide is 18 oligonucleotide units in length.

[0088] In some embodiments, at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, athionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.

[0089] In some embodiments, one or more internucleoside linkage of the oligonucleotide is a modified internucleoside linkage.

[0090] In some embodiments, the modified internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.

[0091] In some embodiments, all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

[0092] In some embodiments, the phosphorothioate linkage is in one of a Rp configuration or a Sp configuration.

[0093] In some embodiments, the oligonucleotide comprises at least one modified sugar moiety.

[0094] In some embodiments, the modified sugar moiety is one of a 2'-OMe modified sugar moiety, bicyclic sugar moiety, 2’-O-(2-methoxyethyl) (2’-MOE), 2'-deoxy-2'-fluoro nucleoside, 2’-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2’-4’-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA).

[0095] In some embodiments, the oligonucleotide exhibits at least a 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length UNC13A protein.

[0096] In some embodiments, the oligonucleotide exhibits at least a 100% increase of full length UNC13A protein.

[0097] In some embodiments, the oligonucleotide exhibits at least a 200% increase of full length UNC13A protein.

[0098] In some embodiments, the oligonucleotide exhibits at least a 300% increase of full length UNC13A protein.

[0099] In some embodiments, increase of the full length UNC13A protein is measured in comparison to a reduced level of full length UNC13A protein achieved using a TDP43 antisense oligonucleotide.

[0100] In some embodiments, the oligonucleotide exhibits at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full length UNC13A protein.

[0101] In some embodiments, the oligonucleotide exhibits at least a 50%, 60%, 70%, 80%, or 90% reduction of a mis-spliced UNC13A transcript.

[0102] In another aspect, provided herein is a method of treating a neurological disease and / or a neuropathy in a patient in need thereof, the method comprising administering to the patient an oligonucleotide of any one of claims 1-64.

[0103] In some embodiments, the neurological disease selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, and synaptic diseases like autism.

[0104] In some embodiments, the neurological disease is ALS.

[0105] In some embodiments, the neurological disease is FTD.

[0106] In some embodiments, the neurological disease is ALS with FTD.

[0107] In some embodiments, the neurological disease is AD.

[0108] In some embodiments, the neurological disease is PD.

[0109] In some embodiments, the neuropathy is chemotherapy induced neuropathy. BRIEF DESCRIPTION OF THE DRAWINGS

[0110] Figure 1 shows an example antisense oligonucleotide (AON), a portion of which is complementary to a mRNA transcript or pre-mRNA transcript. Dashed lines indicate positions of the AON which may or may not be occupied by a spacer. DETAILED DESCRIPTION

[0111] The features and other details of the disclosure will now be more particularly described. Certain terms employed in the specification, examples and appended claims are collected here. These definitions should be read in light of the remainder of the disclosure and understood as by a person of skill in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art.

[0112] Disclosed herein are oligonucleotides capable of targeting a region of a transcript transcribed from a gene. In various embodiments, such oligonucleotides target a UNC13A transcript. Additionally disclosed herein are oligonucleotides, including antisense oligonucleotide sequences, and methods for treating neurological diseases, such as amyotrophic lateral sclerosis and frontotemporal dementia, and / or neuropathies such as chemotherapy induced neuropathy, using same. In various embodiments, the oligonucleotides target a sequence of UNC13A transcripts resulting in the reduction of levels of mis-spliced UNC13A transcripts Also disclosed are pharmaceutical compositions comprising UNC13A oligonucleotides that target a region of UNC13A transcripts, for treating neurological diseases and / or neuropathies; and manufacture of medicaments containing a disclosed UNC13A oligonucleotide that targets a region of UNC13A transcripts to be used in treating a neurological disease and / or neuropathy. Definitions

[0113] The terms “treat,” “treatment,” “treating,” and the like are used herein to generally mean obtaining a desired pharmacological and / or physiological effect. The effect may be therapeutic in terms of partially or completely curing a disease and / or adverse effect attributed to the disease. The term “treatment” as used herein covers any treatment of a disease in a mammal, particularly a human, and includes: (a) inhibiting the disease, i.e., preventing the disease from increasing in severity or scope; (b) relieving the disease, i.e., causing partial or complete amelioration of the disease; or (c) preventing relapse of the disease, i.e., preventing the disease from returning to an active state following previous successful treatment of symptoms of the disease or treatment of the disease.

[0114] “Preventing” includes delaying the onset of clinical symptoms, complications, or biochemical indicia of the state, disorder, disease, or condition developing in a subject that may be afflicted with or predisposed to the state, disorder, disease, or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder, disease, or condition. “Preventing” includes prophylactically treating a state, disorder, disease, or condition in or developing in a subject, including prophylactically treating clinical symptoms, complications, or biochemical indicia of the state, disorder, disease, or condition in or developing in a subject.

[0115] The term “pharmaceutically acceptable carrier” or “pharmaceutically acceptable excipient” as used herein interchangeably refers to any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically activesubstances is well known in the art. The compositions may also contain other active compounds providing supplemental, additional, or enhanced therapeutic functions.

[0116] The term “pharmaceutical composition” as used herein refers to a composition comprising at least one biologically active compound, for example, a UNC13A antisense oligonucleotide (AON), as disclosed herein formulated together with one or more pharmaceutically acceptable excipients.

[0117] “Individual,” “patient,” or “subject” are used interchangeably and include any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or non-human primates, and most preferably humans. The compounds of the invention can be administered to a mammal, such as a human, but can also be other mammals such as an animal in need of veterinary treatment, e.g., domestic animals (e.g., dogs, cats, and the like), farm animals (e.g., cows, sheep, pigs, horses, and the like) and laboratory animals (e.g., rats, mice, guinea pigs, non-human primates, and the like). In some embodiments, the mammal treated in the methods of the invention is desirably a mammal in whom modulation of UNC13A expression and / or activity is desired.

[0118] As used herein, “UNC13A” (also known as Unc-13 Homolog A, Munc13-1, KIAA1032, unc-13 homolog A (C. elegans), or Protein Unc-13 Homolog A) refers to the gene or gene products (e.g., protein or mRNA transcript (including pre-mRNA) encoded by the gene) identified by Entrez Gene ID No.23025 and allelic variants thereof, as well as orthologs found in non-human species (e.g., non-human primates or mice).

[0119] The term “UNC13A transcript” refers to a UNC13A transcript which can be a UNC13A pre-mRNA sequence or a UNC13A mature RNA sequence. UNC13A transcript sequences are shown to contain thymine (T), but one of skill in the art will appreciate that thymine (T) can generally be replaced with uracil (U) in RNA sequences.

[0120] The term “UNC13A oligonucleotide,” “UNC13A antisense oligonucleotide,” or “UNC13A AON” refers to an oligonucleotide that is capable of increasing, restoring, or stabilizing full-length UNC13A activity e.g., full length UNC13A expression, for example, full length UNC13A mRNA and / or full length UNC13A protein expression. Generally, a UNC13A oligonucleotide reduces the level of mis-spliced UNC13A transcripts by targeting a UNC13A transcript (e.g., UNC13A pre-mRNA or mis-spliced UNC13A with a target sequence). In various embodiments, a UNC13A oligonucleotide comprises a sequence that is at least 85% complementary to an equal length portion of a transcript comprising a sequence at least 90% identity to SEQ ID NO:1-12. UNC13A target sequences are shown to contain thymine (T), butone of skill in the art will appreciate that thymine (T) can generally be replaced with uracil (U) in RNA sequences.

[0121] In various embodiments, UNC13A oligonucleotides are characterized by having one or more spacers, where each spacer divides up the UNC13A oligonucleotide into segments of linked nucleosides. In various embodiments, UNC13A oligonucleotides have two spacers. In one embodiment, UNC13A oligonucleotides have three segments of linked nucleosides separated by two spacers. In such embodiments, UNC13A oligonucleotides have one segment with at most 7 linked nucleosides. For example, a UNC13A oligonucleotide may have, from the 5’ to the 3’ end, 5 linked nucleosides, followed by a spacer, 7 linked nucleosides, followed by a second spacer, and 4 linked nucleosides. Thus, the second segment of 7 linked nucleosides satisfies the one segment with at most 7 linked nucleosides.

[0122] As used herein, the term “UNC13A oligonucleotide” encompasses a “UNC13A parent oligonucleotide” and a “UNC13A oligonucleotide with one or more spacers” (e.g., UNC13A oligonucleotide with two spacers). Examples of UNC13A oligonucleotides include oligonucleotides comprising a sequence of any one of SEQ ID NOs: 13-1283 or 2571-2594

[0123] The term “UNC13A parent oligonucleotide” refers to an oligonucleotide that targets a UNC13A transcript and is capable of increasing, restoring, or stabilizing full-length UNC13A activity e.g., full length UNC13A expression, for example, full length UNC13A mRNA and / or full length UNC13A protein expression. UNC13A parent oligonucleotides do not include a spacer. Examples of UNC13A parent oligonucleotides include oligonucleotides comprising a sequence of any one of SEQ ID NO: 13-1283. As described hereafter, UNC13A oligonucleotide with spacers are described in relation to a corresponding UNC13A parent oligonucleotide.

[0124] The term “oligonucleotide with one or more spacers” or “oligonucleotide comprising a spacer” refers to an oligonucleotide with at least one spacer. An oligonucleotide with one or more spacers can, in various embodiments, include one spacer, two spacers, three spacers, four spacer, five spacers, six spacers, seven spacers, eight spacers, nine spacers, or ten spacers. In various embodiments, an oligonucleotide comprising one or more spacers includes at least one segment with at most 7 linked nucleosides. For example, as described in a 5’ to 3’ direction, an oligonucleotide comprising a spacer can include a segment with 4 linked nucleosides, followed by a spacer, a second segment with 8 linked nucleosides, followed by a second spacer, and a third segment with 5 linked nucleosides. Here, the first segment of 4 linked nucleosides and the third segment of 5 linked nucleosides each represents segments with at most 7 linked nucleosides. As another example, an oligonucleotide comprising a spacer can include a segment with 7 linkednucleosides, followed by a spacer, a second segment with 2 linked nucleosides, followed by a second spacer, and a third segment with 7 linked nucleosides. Here, the first and third segment of 7 nucleosides, second segment of 2 linked nucleosides represents the segment with at most 7 linked nucleosides. In various embodiments, an oligonucleotide with one or more spacers includes multiple segments with at most 7 linked nucleosides. In various embodiments, every segment of an oligonucleotide with one or more spacers has at most 7 linked nucleosides. For example, the oligonucleotide may be a 18mer and include two spacers that divide the 18mer into three separate segments of 6 linked nucleosides each. Therefore, each segment of the oligonucleotide has at most 6 linked nucleosides.

[0125] Generally, UNC13A oligonucleotides comprising one or more spacers are described in reference to a corresponding UNC13A parent oligonucleotide. Example UNC13A oligonucleotides comprising one or more spacers include any of SEQ ID NO: 2571-2594.

[0126] In various embodiments, one or more spacers may be located at one or more positions of an oligonucleotide. A spacer may be located between a first position and a second position of the oligonucleotide. As used herein, a spacer located between a first position and second position encompasses the spacer being located at the first position, located at the second position, or located at any position of the oligonucleotide sandwiched by the first position and the second position.

[0127] In the present specification, the term “therapeutically effective amount” means the amount of an oligonucleotide that will elicit the biological or medical response of a tissue, system, animal or human that is being sought by the researcher, veterinarian, medical doctor, or other clinician. In one embodiment, the oligonucleotide comprises a sequence that is at least 85% complementary to an equal length portion of a transcript comprising a sequence at least 90% identity to SEQ ID NO: 1284 - 2554. The oligonucleotide is administered in therapeutically effective amounts to treat and / or prevent a disease, condition, disorder, or state, for example, a neurological disease and / or a neuropathy. Alternatively, a therapeutically effective amount of an oligonucleotide is the quantity required to achieve a desired therapeutic and / or prophylactic effect, such as an amount which results in the prevention of or a decrease in the symptoms associated with a disease associated with reduced UNC13A activity in the motor neurons.

[0128] The phrase “a UNC13A oligonucleotide that targets a UNC13A transcript” refers to a UNC13A oligonucleotide that binds to a UNC13A transcript

[0129] The term “pharmaceutically acceptable salt(s)” as used herein refers to salts of acidic or basic groups that may be present in a UNC13A oligonucleotide used in the present compositions.A UNC13A oligonucleotide included in the present compositions that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids. The acids that may be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including but not limited to malate, oxalate, chloride, bromide, iodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pamoate (i.e., 1,1’- methylene-bis-(2-hydroxy-3-naphthoate)) salts. A UNC13A oligonucleotide included in the present compositions that include an amino moiety may form pharmaceutically acceptable salts with various amino acids, in addition to the acids mentioned above. Compounds included in the present compositions that are acidic in nature are capable of forming base salts with various pharmacologically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts and, particularly, calcium, magnesium, sodium, and lithium salts. Pharmaceutically acceptable salts of the disclosure include, for example, pharmaceutically acceptable salts of UNC13A oligonucleotides that include a sequence of any of SEQ ID NO: 13- 1283 or 2571-2594.

[0130] A UNC13A oligonucleotide of the disclosure may contain one or more chiral centers, groups, linkages, and / or double bonds and, therefore, exist as stereoisomers, such as geometric isomers, enantiomers or diastereomers. The term “stereoisomers” when used herein consist of all geometric isomers, enantiomers or diastereomers. These compounds may be designated by the symbols “R” or “S” (or “Rp” or “Sp”) depending on the configuration of substituents around the stereogenic atom, for example, a stereogenic carbon, phosphorous, or sulfur atom. In some embodiments, one or more linkages of the compound may have a Rp or Sp configuration (e.g., one or more phosphorothioate linkages have either a Rp or Sp configuration). The configuration of each phosphorothioate linkage may be independent of another phosphorothioate linkage (e.g., one phosphorothioate linkage has a Rp configuration and a second phosphorothioate linkage has a Sp configuration). In various embodiments, the UNC13A oligonucleotide can have a mixed configuration of phosphorothioate linkages. For example, the UNC13A oligonucleotide may have five phosphorothioate linkages in a Rp configuration, followed by fifteen phosphorothioate linkages in a Sp configuration, followed by five phosphorothioate linkages in a Rp configuration. The present invention encompasses various stereoisomers of these compounds and mixturesthereof. Stereoisomers include enantiomers and diastereomers. Mixtures of enantiomers or diastereomers may be designated “(±)” in nomenclature, but the skilled artisan will recognize that a structure may denote a chiral center implicitly.

[0131] Individual stereoisomers of a UNC13A oligonucleotide of the present invention can be prepared synthetically from commercially available starting materials that contain asymmetric or stereogenic centers, or by preparation of racemic mixtures followed by resolution methods well known to those of ordinary skill in the art. These methods of resolution are exemplified by (1) attachment of a mixture of enantiomers to a chiral auxiliary, separation of the resulting mixture of diastereomers by recrystallization or chromatography and liberation of the optically pure product from the auxiliary, (2) salt formation employing an optically active resolving agent, or (3) direct separation of the mixture of optical enantiomers on chiral chromatographic columns. Stereoisomeric mixtures can also be resolved into their component stereoisomers by well-known methods, such as chiral-phase gas chromatography, chiral-phase super critical fluid chromatography, chiral-phase simulated moving bed chromatography, chiral-phase high performance liquid chromatography, crystallizing the compound as a chiral salt complex, or crystallizing the compound in a chiral solvent. Stereoisomers can also be obtained from stereomerically-pure intermediates, reagents, and catalysts by well-known asymmetric synthetic methods.

[0132] The UNC13A oligonucleotide disclosed herein can exist in solvated as well as unsolvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the invention embrace both solvated and unsolvated forms.

[0133] The disclosure also embraces fluorescently labeled compounds of the invention. The disclosure also embraces isotopically labeled compounds of the invention (i.e., isotopically labeled UNC13A oligonucleotide) which are identical to those recited herein, except that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number abundantly found in nature. Examples of isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine and chlorine, such as2H,3H,11C,13C,14C,15N,18O,17O,31P,32P,33P,35S,18F, and36Cl, respectively.

[0134] Certain isotopically labeled disclosed compounds (e.g., those labeled with3H,14C, or35S) are useful in compound and / or substrate tissue distribution assays. Tritiated (i.e.,3H), carbon-14 (i.e.,14C) isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with heavier isotopes such as deuterium (i.e.,2H) may affordcertain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and hence may be preferred in some circumstances.

[0135] As used herein, “2’-O-(2-methoxyethyl)” (also 2’-MOE and 2’-O(CH2)2OCH3 and MOE) refers to an O-methoxyethyl modification of the 2’ position of a furanose ring. A 2’-O-(2- methoxyethyl) is used interchangeably as “2’-O-methoxyethyl” in the present disclosure. A sugar moiety in a nucleoside modified with 2’-MOE is a modified sugar.

[0136] As used herein, “2’-MOE nucleoside” (also 2’-O-(2-methoxyethyl) nucleoside) means a nucleoside comprising a 2’-MOE modified sugar moiety.

[0137] As used herein, “2’-substituted nucleoside” means a nucleoside comprising a substituent at the 2’-position of the furanose ring other than H or OH. In certain embodiments, 2’ substituted nucleosides include nucleosides with bicyclic sugar modifications.

[0138] As used herein, “5-methyl cytosine” (5-MeC) means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine (5-MeC) is a modified nucleobase.

[0139] As used herein, “bicyclic sugar” means a furanose ring modified by the bridging of two atoms. A bicyclic sugar is a modified sugar.

[0140] As used herein, “bicyclic nucleoside” (also BNA) means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4’-carbon and the 2’- carbon of the sugar ring.

[0141] As used herein, “cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.

[0142] As used herein, “cEt” or “constrained ethyl” means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4’-carbon and the 2’-carbon, wherein the bridge has the formula: 4’-CH(CH3)—O-2’.

[0143] As used herein, “constrained ethyl nucleoside” (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4’-CH(CH3)—O-2’ bridge. In some embodiments, cEt can be modified. In some embodiments, the cEt can be S-cEt (in an S- constrained ethyl 2’-4’-bridged nucleic acid). In some other embodiments, the cEt can be R-cEt.

[0144] As used herein, “internucleoside linkage” refers to the covalent linkage between adjacent nucleosides in an oligonucleotide. In some embodiments, as used herein, “non-natural linkage” refers to a “modified internucleoside linkage.”

[0145] As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to eachother. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence. As an example to the contrary, two nucleosides separated by a spacer are not contiguous.

[0146] As used herein, “locked nucleic acid” or “LNA” or “LNA nucleosides” means nucleic acid monomers having a bridge (e.g., methylene, ethylene, aminooxy, or oxyimino bridge) connecting two carbon atoms between the 4’ and 2’ position of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugar include, but are not limited to (A) α-L- Methyleneoxy (4’-CH2—O-2’) LNA, (B) β-D-Methyleneoxy (4’-CH2—O-2’) LNA, (C) Ethyleneoxy (4’-(CH2)2—O-2’) LNA, (D) Aminooxy (4’-CH2—O—N(R)-2’) LNA and (E) Oxyamino (4’-CH2—N(R)—O-2’) LNA; wherein R is H, C1-C12alkyl, or a protecting group (see U.S. Pat. No.7,427,672, issued on Sep.23, 2008).

[0147] As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4’ and the 2’ position of the sugar wherein each of the bridges independently comprises 1 or from 2 to 4 linked groups independently selected from — [C(R1)(R2)]n —, —C(R1)=C(R2)—, —C(R1)=N—, —C(=NR1)—, —C(=O)—, —C(=S)—, — O—, —Si(R1)2—, —S(=O)x— and —N(R1) —; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R1 and R2 is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20aryl, a heterocycle radical, a substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O) —H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)- J1); and each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12alkenyl, C2-C12alkynyl, substituted C2-C12alkynyl, C5-C20aryl, substituted C5-C20 aryl, acyl (C(=O) —H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12aminoalkyl, substituted C1-C12aminoalkyl or a protecting group.

[0148] Examples of 4’-2’ bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: —[C(R1)( R2)]n—, — [C(R1)(R2)]n—O—, — C(R1R2)— N(R1)—O— or —C(R1R2)—O—N(R1)—. Furthermore, other bridging groups encompassed with the definition of LNA are 4’-CH2-2’, 4’-(CH2)2-2’, 4’-(CH2)3-2’, 4’-CH2—O-2’, 4’- (CH2)2—O-2’, 4’- CH2—O—N(R1)-2’ and 4’- CH2—N(R1)—O-2’- bridges, wherein each R1and R2 is, independently, H, a protecting group or C1-C12 alkyl.

[0149] Also included within the definition of LNA according to the invention are LNAs in which the 2’-hydroxyl group of the ribosyl sugar ring is connected to the 4’ carbon atom of thesugar ring, thereby forming a bridge to form the bicyclic sugar moiety. The bridge can be a methylene (—CH2—) group connecting the 2’ oxygen atom and the 4’ carbon atom, for which the term methyleneoxy (4’-CH2—O-2’) LNA is used. Furthermore, in the case of the bicyclic sugar moiety having an ethylene bridging group in this position, the term ethyleneoxy (4’- CH2CH2—O-2’) LNA is used.

[0150] As used herein, a “spacer” refers to a nucleoside-replacement group (e.g., a non- nucleoside group that replaces a nucleoside present in a UNC13A parent oligonucleotide). The spacer is characterized by the lack of a nucleotide base and by the replacement of the nucleoside sugar moiety with a non-sugar substitute. The non-sugar substitute group of a spacer lacks an aldehyde, ketone, acetal, ketal, hemiacetal or hemiketal group. The non-sugar substitute group of a spacer is thus capable of connecting to the 3’ and 5’ positions of the nucleosides adjacent to the spacer through an internucleoside linker as described herein, but not capable of forming a covalent bond with a nucleotide base (i.e., not capable of linking a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide). Generally, a UNC13A oligonucleotide with a spacer is described in relation to a UNC13A parent oligonucleotide, wherein the spacer replaces a nucleoside of the UNC13A parent oligonucleotide. In all embodiments of the present disclosure, a spacer cannot hybridize to a nucleoside comprising a nucleobase at the corresponding position of a UNC13A transcript, within the numerical order of the length of the AON oligonucleotide (i.e., if the spacer is positioned after nucleoside 4 of an AON (i.e., at position 5 from the 5’-end), the spacer is not complementary to the nucleoside (A, C, G, or U) at the same corresponding position of the target UNC13A transcript)).

[0151] As used herein, “mismatch” or a “non-complementary group” refers to the case when a group (e.g., nucleobase) of a first nucleic acid is not capable of pairing with the corresponding group (e.g., nucleobase) of a second or target nucleic acid.

[0152] As used herein, “modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside linkage (e.g., a phosphodiester internucleoside bond).

[0153] As used herein, “modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. Examples of a modified nucleobase include 5-methyl cytosine, pseudouridine, or 5-methoxyuridine. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0154] As used herein, a “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and / or modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. Modified nucleosides include abasic nucleosides, which lack a nucleobase. However, modified nucleosides do not include spacers or other groups that are incapable of linking a nucleobase.

[0155] As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked). In various embodiments, an oligonucleotide may have different segments of linked nucleosides connected through a spacer. Here, the spacer (i.e., nucleoside replacement) is not considered a nucleoside and therefore, divides up the oligonucleotide into two segments of linked nucleosides. The oligonucleotide may have a first segment of Y linked nucleosides (e.g., Y nucleosides that are connected in a contiguous sequence), followed by a spacer, and then a second segment of Z linked nucleosides. Here, the Y and Z linked nucleosides is described in either the 5’ to 3’ direction or the 3’ to 5’ direction. In various embodiments, the first segment consists of 7 or fewer linked nucleosides (e.g., Y = 7 or fewer) whereas the second segment comprises 8 or more linked nucleosides (e.g., Z = 8 or more).

[0156] As used herein, “modified oligonucleotide” means an oligonucleotide comprising at least one (i.e., one or more) modified internucleoside linkage, modified sugar, and / or modified nucleobase.

[0157] As used herein, “modified sugar” or “modified sugar moiety” means a modified furanosyl sugar moiety or a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide.

[0158] As used herein, “monomer” means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

[0159] As used herein, “motif” means the pattern of unmodified and modified nucleosides in an antisense compound.

[0160] As used herein, “natural sugar moiety” means a sugar moiety found in DNA (2’-H) or RNA (2’-OH).

[0161] As used herein, “naturally occurring internucleoside linkage” means a 3’ to 5’ phosphodiester linkage.

[0162] As used herein, “non-complementary nucleobases” refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

[0163] As used herein, “nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, non-coding RNA, small interfering ribonucleic acids (siRNA), short-hairpin RNA (shRNA), and microRNAs (miRNA).

[0164] As used herein, “nucleobase” means a heterocyclic moiety capable of base pairing with a base of another nucleic acid.

[0165] As used herein, “nucleobase complementarity” refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a corresponding nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.

[0166] As used herein, “nucleobase sequence” means the order of nucleobases independent of any sugar, linkage, and / or nucleobase modification.

[0167] As used herein, “nucleoside” refers to a nucleobase linked to a sugar. The term “nucleoside” also includes a “modified nucleoside” which has independently, a modified sugar moiety and / or modified nucleobase.

[0168] As used herein, “nucleoside mimetic” includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g., non- furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by a phosphorodiamidate or other non- phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system. “Mimetic” refers to groups that are substituted for a sugar, a nucleobase, and / or internucleosidelinkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.

[0169] As used herein, “nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0170] As used herein, “oligomeric compound” or “oligomer” means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

[0171] As used herein, “oligonucleotide” means a polymer of one or more segments of linked nucleosides each of which can be modified or unmodified, independent one from another.

[0172] As used herein, “hotspot region” is a range of nucleobases on a target nucleic acid amenable to oligomeric compound-mediated modulation of the splicing of the target nucleic acid.

[0173] As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding between complementary nucleobases.

[0174] As used herein, “increasing the amount of activity” refers to more transcriptional expression, more accurate splicing resulting in full length mature mRNA and / or protein expression, and / or more activity relative to the transcriptional expression or activity in an untreated or control sample. Antisense Therapeutics

[0175] Antisense therapeutics are a class of nucleic acid-based compounds that can be used to modulate a transcript, such as mRNA. In various embodiments, antisense therapeutics comprise one or more spacers and can be used to modulate a transcript that is transcribed from a gene, such as a UNC13A pre-mRNA.

[0176] Antisense therapeutics may be single- or double-stranded deoxyribonucleic acid (DNA)- based, ribonucleic acid (RNA)-based, or DNA / RNA chemical analogue compounds. In general, antisense therapeutics are designed to include a sequence that is complementary or nearly complementary to an mRNA or pre-mRNA sequence transcribed from a given gene in order to promote binding between the antisense therapeutic and the pre-mRNA or mRNA. In certain embodiments, antisense therapeutics act by binding to an mRNA or pre-mRNA, thereby inhibiting protein translation, altering pre-mRNA splicing into mature mRNA (e.g., by preventing appropriate proteins such as splicing activator proteins from binding), and / or causing destruction of mRNA. In certain embodiments, the antisense therapeutic sequence iscomplementary to a portion of a targeted gene’s or mRNA’s sense sequence. In certain embodiments, antisense therapeutics described herein are oligonucleotide-based compounds that include an oligonucleotide sequence complementary to a pre-mRNA sense, or a portion thereof, and one or more spacers. In certain embodiments, antisense therapeutics described herein can also be nucleotide chemical analog-based compounds.

[0177] In certain embodiments, an oligonucleotide, such as disclosed herein, may be an oligonucleotide sequence 18 oligonucleotide units in length. As used herein, an “oligonucleotide unit” refers to either a nucleoside (e.g., a nucleoside which includes a sugar and / or a nucleobase) or a nucleoside-replacement group (e.g., a spacer) of the oligonucleotide. In various embodiments, the oligonucleotides are 18 oligonucleotide units in length.

[0178] In certain embodiments, AONs may include chemically modified nucleosides (for example, 2’-O-methylated nucleosides or 2’-O-(2-methoxyethyl) nucleosides) as well as modified internucleoside linkages (for example, phosphorothioate linkages). In certain embodiments, AONs described herein include oligonucleotide sequences that are complementary to RNA sequences, such as UNC13A mRNA sequences. In certain embodiments, AONs described herein can include chemically modified nucleosides and modified internucleoside linkages (for example, phosphorothioate linkages). In particular embodiments, AONs described herein include one or more spacers.

[0179] In various embodiments, the oligonucleotides comprise one or more spacers. In various embodiments, the oligonucleotides comprise two spacers. For example, the oligonucleotide includes 18 oligonucleotide units with 16 nucleobases and two nucleoside replacement groups (e.g., two spacers). Further embodiments of oligonucleotides with one spacer and oligonucleotides with two spacers are described herein.

[0180] In some embodiments, an antisense oligonucleotide can be, but is not limited to, inhibitors of a gene transcript (for example, shRNAs, siRNAs, PNAs, LNAs, 2’-O-methyl (2’OMe) antisense oligonucleotide (AON), 2’-O-(2-methoxyethyl) (MOE) AON, or morpholino oligomers (e.g., phosphorodiamidate morpholino (PMO))), or compositions that include such compounds. In some embodiments an oligonucleotide is an antisense oligonucleotide (AON) comprising 2’OMe (e.g., a AON comprising one or more 2’OMe modified sugar), MOE (e.g., a AON comprising one or more MOE modified sugar), peptide nucleic acids (e.g., a AON comprising one or more N-(2-aminoethyl)-glycine units linked by amide bonds or carbonyl methylene linkage as repeating units in place of a sugar-phosphate backbone), locked nucleic acids (e.g., a AON comprising one or more locked ribose, and can be a mixture of 2’-deoxynucleotides or 2’OMe nucleotides), c-ET (e.g., a AON comprising one or more cET sugar), constrained methoxyethyl (cMOE) (e.g., a AON comprising one or more cMOE sugar), morpholino oligomer (e.g., a AON comprising a backbone comprising one or more PMO), deoxy-2’-fluoro nucleoside (e.g., a AON comprising one or more 2’-fluoro-β-D- arabinonucleoside), tricyclo-DNAs (tcDNA) (e.g., a AON comprising one or more tcDNA modified sugar), 2’-O,4’-C-Ethylene-bridged nucleic acid (ENA) (e.g., a AON comprising one or more ENA modified sugar), or hexitol nucleic acids (HNA) (e.g., a AON comprising one or more HNA modified sugar). In some embodiments, a AON comprises one or more internucleoside linkage independently selected from a phosphorothioate linkage, phosphodiester linkage, phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, phosphorodiamidate morpholino (PMO) (morpholino) linkage, PNA linkage, or any combination of phosphorothioate linkage, phosphodiester linkage, a phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, a phosphoramidothioate linkage, thiophosphorodiamidate linkage, phosphorodiamidate morpholino (PMO) (morpholino) linkage, and PNA linkage. In some embodiments, a UNC13A AON comprises one or more phosphorothioate linkage, phosphodiester linkage, or a combination of phosphorothioate and phosphodiester linkages.

[0181] Peptide nucleic acids (PNAs) are short, artificially synthesized polymers with a structure that mimics DNA or RNA. PNAs include a backbone composed of repeating N-(2-aminoethyl)- glycine units linked by peptide bonds. In certain embodiments, PNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity and increase, restore, and / or stabilize levels (e.g., full length UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, for example, UNC13A activity).

[0182] Locked nucleic acids (LNAs) are oligonucleotide sequences that include one or more modified RNA nucleotides in which the ribose moiety is modified with an extra bridge connecting the 2’ oxygen and 4’ carbon. LNAs are believed to have higher Tm’s than analogous oligonucleotide sequences. In certain embodiments, LNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity. For example, LNAs can bind to UNC13A pre-mRNA and prevent mis-splicing of UNC13A pre-mRNA, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, for example, UNC13A activity).

[0183] Morpholino oligomers are oligonucleotide compounds that include DNA bases attached to a backbone of methylenemorpholine rings linked through phosphorodiamidate groups. Incertain embodiments, morpholino oligomers of the present invention can be designed to bind to specific pre-mRNA sequence of interest. For example, morpholino oligomers bind to UNC13A pre-mRNA thereby preventing mis-splicing of the pre-mRNA, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, for example, UNC13A activity). In certain embodiments, UNC13A morpholino oligomers described herein can be used as antisense therapeutics that bind to UNC13A pre-mRNA sequences with high specificity and prevent mis-splicing of UNC13A pre- mRNA, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, for example, UNC13A activity). In certain embodiments, UNC13A morpholino oligomers described herein can also be used to bind UNC13A pre-mRNA sequences, altering UNC13A pre-mRNA splicing and UNC13A gene expression, and increase, restore, and / or stabilize UNC13A levels (e.g., UNC13A mRNA or protein levels) and / or activity (e.g., biological activity, for example, UNC13A activity). UNC13A Oligonucleotides Complementary to UNC13A Transcript

[0184] In some embodiments, a UNC13A AON includes a sequence that is at least % complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a UNC13A transcript (e.g., SEQ ID NO: 1 - 12). In some embodiments, a UNC13A AON includes a sequence that is between 90-95% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a UNC13A transcript (e.g., SEQ ID NO: 1 - 12). In particular embodiments, a UNC13A AON includes a sequence that is at least 85% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a UNC13A transcript (e.g., SEQ ID NO: 1 - 12). In particular embodiments, a UNC13A AON includes a sequence that is between 84% to 88% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a UNC13A transcript (e.g., SEQ ID NO: 5057-5065 or SEQ ID NOs: 1- 12). In particular embodiments, a UNC13A AON includes a sequence that is between 89% to 92% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a mis-spliced UNC13A transcript (e.g., SEQ ID NO: 1 - 12). In particular embodiments, a UNC13A AON includes a sequence that is between 94% to 96% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a UNC13A transcript (e.g., SEQ ID NO: 1 - 12).

[0185] In various embodiments, a UNC13A AON comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NO: 13 – 1283 or 2571 - 2594. In various embodiments, a UNC13A AON comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NO: 2571 - 2594.

[0186] In some embodiments, the UNC13A AON comprises a spacer and has a segment having at most 7 linked nucleosides. In some embodiments, the UNC13A AON comprises a spacer and has a segment having at most 7, 6, 5, 4, or 3, linked nucleosides.

[0187] UNC13A AON binding specificity can be assessed via measurement of parameters such as dissociation constant, melting temperature, or other criteria such as changes in protein or RNA expression levels or other assays that measure UNC13A activity or expression.

[0188] In some embodiments, a UNC13A AON can include a non-duplexed oligonucleotide. In some embodiments, a UNC13A AON can include a duplex of two oligonucleotides where the first oligonucleotide includes a nucleobase sequence that is completely or almost completely complementary to a UNC13A pre-mRNA sequence and the second oligonucleotide includes a nucleobase sequence that is complementary to the nucleobase sequence of the first oligonucleotide.

[0189] In some embodiments, a UNC13A AON can target UNC13A pre-mRNAs produced from UNC13A genes of one or more species. For example, a UNC13A AON can target a UNC13A pre-mRNA of a mammalian UNC13A gene, for example, a human (i.e., Homo sapiens) UNC13A gene. In particular embodiments, the UNC13A AON targets a human UNC13A pre- mRNA. In some embodiments, the UNC13A AON includes a nucleobase sequence that is complementary to a nucleobase sequence of a UNC13A gene or a UNC13A pre-mRNA or a portion thereof.

[0190] UNC13A AONs described herein include antisense oligonucleotides comprising the oligonucleotide sequences listed in Table 1 below: Table 1. Example UNC13A AON Sequences.* At least one (i.e., one or more) nucleoside linkage of the oligonucleotide sequence is independently selected from a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. UNC13A Transcript

[0191] In various embodiments, an UNC13A mRNA transcript comprises the sequence provided as SEQ ID NO: 1.

[0192] In various embodiments, an UNC13A mRNA transcript comprises the sequence provided as SEQ ID NO: 2.CCTCTTGGAGAAAACCCTCCTTCCTTCCCCTCAGGACTTTCCCAGCCACCGTCTCTCCTCCAGTCCAGCC TGATGCCATGGGACTGGGGGTTTCTCTGTCCAGCTCTGTTTCTCCCAGACTGGGGTCTGAGGACTCTCAG GACCCCCAACTTTACCTAGCACAGGCTGGGCACAAGTGGGTGACAGGGAGTCTACGCCTAGTGGAATTAT GTATTGGGGCAGGGTCAGTGTGAGAATACACATCCGCATGCATGTCTGTCCATGTCTGTCCGTACCAACC TTCCCCTTCCACACGGACCTGGGCACATAGGAGGTGTCTGAGCCTGACACATGGGACAGAGAGTGGACAT GGCTGAGACACGGACAGAGAAAAGACAAGGAGTCCAGGGGGCTGAAAGCCTTTTGAAATCAGGAAGTTCC TGTATTGGCAGAACAAAGCCCAGAGAGGAGCAGGGCTTTCCTCAACGCCACCCAGCAAGTGGACACAGAG CCCGGCCTTGGATGACACCTCCAGGGTTCTGAACCCTGGACCTCGCTTTATGCAAGGAGCTGGCCCCACA TTTCCATGAATCGGGGAAACAGCACAAGAAGGTTGGCCTGTGGCAGGGCAAGGGTTAAAGGGGTGACATT GAGGGATGCCTCAGAGTCAAAGTCCCCTGACCAAGAGGAATAGAGTAGAAAACACAGAGACAGAGGGTGA GATCACGCCCCGATGAGGACGGAGAGAGACAGAGATGGAGAGAGACATAGAGGTGGAAATATACAGAGAA AGATAAATGCAGAGACCAAGGCAGGGAGTGTCGGGGGAAGTAAAGAGGGTGTCCTGAAGAAAGAAGGATC TGTTCACTCTTACCAGTCTGTCCTCGAATGATTTGCATAAAATGAGGAGGTGCCTGTCCACACCCCCAAT TCCTCTCTCAGGCCCCAGAGCCTGAGACCTCACCATGCCCCCATCAGAGATGCAAAAAACTAAACACCCAACTAGAAATCCTTGGGACCTCTCTCGGCTGGGATCTCAGAGCCTTTCTGTCCCCTACCCCTACCCCATGTGCTGTCGATTTTGCAGATGGGGACAACCTGGGGCCTCCCGGAACTCTGCCACCCTGGGGAAGTTGGGGGA GGGCCTTAGTCCCGGATCACAACCCCGTCTGCTCCCCAGAATCCTTTCCTAAGAATCGTTGAGGACCAAA GTTGTCTTTGCTGACACGTGTTGCTTTTCTCTTTGCCTTTTATTGTTTCAGAGAAAAATCAAGTTGACTG TGTCAAGTAACACCCCACCCCTTACCCCCGTCCAGCCATAGTGGCTCTCTGGAGACACAGGTCACAGGCG GAGGGTCCCCTGATCATCCCCAACCACACAGCCAGGGGGACTTGACCCCTGTCCACCCCTGTCTCGTGCT CCCTCAGACCCCCACAAACCGGCCAAGCAGTCCGGGGAGGCTTCCCCTCCACACAACTCTTAGCATGTGA TTGCAGATGTGAAATCAAAACGTTGTTTGTTTTTTGTTTTGTTTTGATTCTACCCCGTCGGTCCAGTGTC TGCACAGACGCCTTCATTTCTCTGTAAATATGTGACTTGGAACAAATGTTTAACACAAACGAGAAGTGGT CATGAATGCATGGTGTTGAGATGTTTTGCACTATTCTGACTTTTTGGTCTCTGTAAAAATATTTTATTAA CAGCAGACATTAAAAAAAGAAAAACCACACACA (SEQ ID NO: 2 (SOURCE NCBI Reference Sequence NM_001387021.1)).

[0193] In various embodiments, an UNC13A mRNA transcript comprises the sequence provided as SEQ ID NO: 3. GCCCCCGGTGCTGAACCAAGATGGCCGGTGGCGGCCGGGCCCCGGCGTGAGCCAAGCGCGGGCTGCAGCC GGGAGATGCCCCAGCCCAGCGGCCGCTGAGCCCGACCCGACAGAGCCGGCCCGGCCGCCTCCGGCCCACC TGCGAGCTCGGAGACATGTCTCTGCTTTGCGTTGGAGTCAAAAAAGCCAAGTTTGATGGTGCCCAAGAGA AATTCAACACGTACGTGACCCTGAAAGTGCAGAATGTCAAGAGCACGACCATCGCGGTGCGGGGCAGCCA GCCCAGCTGGGAGCAGGATTTCATGTTCGAGATTAACCGTCTGGATTTGGGACTGACGGTGGAGGTGTGG AATAAGGGTCTCATCTGGGACACAATGGTGGGCACTGTGTGGATCCCACTGAGGACCATCCGCCAGTCCA ATGAGGAGGGCCCTGGAGAGTGGCTGACGCTGGACTCCCAGGTCATCATGGCAGACAGTGAGATCTGTGG CACCAAGGACCCCACCTTCCACCGCATCCTCCTGGACACGCGCTTTGAGCTACCCTTAGACATTCCTGAA GAGGAGGCTCGCTACTGGGCCAAGAAGCTGGAGCAGCTCAATGCTATGCGGGACCAGGATGAATATTCGT TCCAAGATGAGCAAGACAAGCCTCTGCCTGTCCCCAGCAACCAGTGCTGCAACTGGAATTATTTTGGCTG GGGTGAGCAGCACAACGATGACCCCGACAGTGCAGTGGATGATCGTGACAGTGACTACCGCAGTGAAACG AGCAACAGCATCCCGCCGCCCTATTATACTACGTCACAACCCAACGCCTCAGTCCACCAATATTCTGTTC GCCCACCACCCCTGGGCTCCCGGGAGTCCTACAGTGACTCCATGCACAGTTACGAGGAGTTCTCTGAGCC ACAAGCCCTCAGCCCCACGGGTAGCAGCCGCTATGCCTCTTCCGGGGAGCTGAGCCAGGGAAGCTCTCAG CTGAGCGAGGACTTCGACCCTGACGAGCACAGCCTGCAGGGCTCCGACATGGAGGATGAGCGGGACCGGG ACTCCTACCACTCCTGCCACAGCTCGGTCAGCTACCACAAAGACTCGCCTCGCTGGGACCAGGATGAGGA AGAGCTGGAGGAGGACCTGGAGGACTTCCTGGAGGAGGAGGAGCTGCCTGAAGATGAGGAGGAGCTGGAG GAGGAGGAGGAGGAGGTGCCTGACGATTTGGGCAGCTATGCCCAGCGTGAAGACGTAGCTGTGGCTGAGC CCAAAGACTTCAAACGCATCAGCCTCCCGCCAGCTGCCCCAGGGAAGGAGGACAAGGCCCCAGTGGCACC CACCGAGGCCCCCGACATGGCCAAGGTGGCCCCCAAGCCAGCCACGCCCGACAAGGTGCCTGCAGCTGAG CAGATCCCTGAGGCTGAGCCACCCAAGGACGAGGAGAGTTTCAGGCCGAGAGAGGATGAGGAAGGCCAGGAGGGGCAGGACTCCATGTCCAGGGCCAAGGCCAACTGGCTGCGTGCCTTCAACAAGGTGCGGATGCAGCTGCAGGAGGCCCGGGGAGAAGGAGAGATGTCTAAATCCCTATGGTTCAAAGGCGGCCCAGGGGGCGGTCTC ATCATCATCGACAGCATGCCAGACATCCGCAAGAGGAAACCTATCCCACTCGTGAGCGACTTGTCCCTGG TCCAGTCCAGGAAAGCGGGCATCACCTCGGCCTTGGCCTCCAGCACGTTGAACAACGAGGAGCTGAAAAA CCACGTTTACAAGAAGACCCTGCAAGCCTTAATCTACCCCATCTCGTGCACGACGCCACACAACTTCGAA GTGTGGACGGCCACCACGCCCACCTACTGCTACGAGTGCGAGGGGCTGCTGTGGGGCATCGCGAGGCAGG GCATGCGCTGCACCGAGTGCGGTGTCAAGTGCCACGAGAAGTGCCAGGACCTGCTCAACGCCGACTGCCT GCAGCGGGCTGCGGAGAAGAGCTCCAAGCACGGGGCGGAGGACCGGACACAGAACATCATCATGGTGCTC AAGGACCGCATGAAGATCCGGGAGCGCAACAAGCCCGAGATCTTCGAGCTCATCCAGGAGATCTTCGCGG TGACCAAGACGGCGCACACGCAGCAGATGAAGGCGGTCAAGCAGAGCGTGCTGGACGGCACGTCCAAGTG

[0194] In various embodiments, an UNC13A mRNA transcript comprises the sequence provided as SEQ ID NO: 4.

[0195] In various embodiments, an UNC13A mRNA transcript comprises the sequence provided as SEQ ID NO: 5.CTCCTGCCACAGCTCGGTCAGCTACCACAAAGACTCGCCTCGCTGGGACCAGGATGAGGAAGAGCTGGAG GAGGACCTGGAGGACTTCCTGGAGGAGGAGGAGCTGCCTGAAGATGAGGAGGAGCTGGAGGAGGAGGAGG AGGAGGTGCCTGACGATTTGGGCAGCTATGCCCAGCGTGAAGACGTAGCTGTGGCTGAGCCCAAAGACTT CAAACGCATCAGCCTCCCGCCAGCTGCCCCAGGGAAGGAGGACAAGGCCCCAGTGGCACCCACCGAGGCC CCCGACATGGCCAAGGTGGCCCCCAAGCCAGCCACGCCCGACAAGGTGCCTGCAGCTGAGCAGATCCCTG AGGCTGAGCCACCCAAGGACGAGGAGAGTTTCAGGCCGAGAGAGGATGAGGAAGGCCAGGAGGGGCAGGA CTCCATGTCCAGGGCCAAGGCCAACTGGCTGCGTGCCTTCAACAAGGTGCGGATGCAGCTGCAGGAGGCC CGGGGAGAAGGAGAGATGTCTAAATCCCTATGGTTCAAAGGCGGCCCAGGGGGCGGTCTCATCATCATCG ACAGCATGCCAGACATCCGCAAGAGGAAACCTATCCCACTCGTGAGCGACTTGGCCATGTCCCTGGTCCA GTCCAGGAAAGCGGGCATCACCTCGGCCTTGGCCTCCAGCACGTTGAACAACGAGGAGCTGAAAAACCAC GTTTACAAGAAGACCCTGCAAGCCTTAATCTACCCCATCTCGTGCACGACGCCACACAACTTCGAAGTGT GGACGGCCACCACGCCCACCTACTGCTACGAGTGCGAGGGGCTGCTGTGGGGCATCGCGAGGCAGGGCAT GCGCTGCACCGAGTGCGGTGTCAAGTGCCACGAGAAGTGCCAGGACCTGCTCAACGCCGACTGCCTGCAG CGGGCTGCGGAGAAGAGCTCCAAGCACGGGGCGGAGGACCGGACACAGAACATCATCATGGTGCTCAAGGACCGCATGAAGATCCGGGAGCGCAACAAGCCCGAGATCTTCGAGCTCATCCAGGAGATCTTCGCGGTGACCAAGACGGCGCACACGCAGCAGATGAAGGCGGTCAAGCAGAGCGTGCTGGACGGCACGTCCAAGTGGTCC GCCAAGATCAGCATCACCGTGGTCTGCGCCCAGGGCTTGCAGGCAAAGGACAAGACAGGATCCAGTGACC CCTATGTCACCGTCCAGGTCGGGAAGACCAAGAAACGGACAAAAACCATCTATGGGAACCTCAACCCGGT GTGGGAGGAGAATTTCCACTTTGAATGTCACAATTCCTCCGACCGCATCAAGGTGCGCGTCTGGGACGAG GATGACGACATCAAATCCCGCGTGAAACAGAGGTTCAAGAGGGAATCTGACGATTTCCTGGGGCAGACGA TCATTGAGGTGCGGACGCTCAGCGGCGAGATGGACGTGTGGTACAACCTGGACAAGCGAACTGACAAATC TGCCGTGTCGGGTGCCATCCGGCTCCACATCAGTGTGGAGATCAAAGGCGAGGAGAAGGTGGCCCCGTAC CATGTCCAGTACACCTGTCTGCATGAGAACCTGTTCCACTTCGTGACCGACGTGCAGAACAATGGGGTCG TGAAGATCCCAGATGCCAAGGGTGACGATGCCTGGAAGGTTTACTACGATGAGACAGCCCAGGAGATTGT GGACGAGTTTGCCATGCGCTACGGCGTCGAGTCCATCTACCAAGCCATGACCCACTTTGCCTGCCTCTCC TCCAAGTATATGTGCCCAGGGGTGCCTGCCGTCATGAGCACCCTGCTCGCCAACATCAATGCCTACTACG CACACACCACCGCCTCCACCAACGTGTCTGCCTCCGACCGCTTCGCCGCCTCCAACTTTGGGAAAGAGCG CTTCGTGAAACTCCTGGACCAGCTGCATAACTCCCTGCGGATTGACCTCTCCATGTACCGGAATAACTTC CCAGCCAGCAGCCCGGAGAGACTCCAGGACCTCAAATCCACTGTGGACCTTCTCACCAGCATCACCTTCT TTCGGATGAAGGTACAAGAACTCCAGAGCCCGCCCCGAGCCAGCCAGGTGGTAAAGGACTGTGTGAAAGC CTGCCTTAATTCTACCTACGAGTACATCTTCAATAACTGCCATGAACTGTACAGCCGGGAGTACCAGACA GACCCGGCCAAGAAGGGGGAAGTTCTCCCAGAGGAACAGGGGCCCAGCATCAAGAACCTCGACTTCTGGT CCAAGCTGATTACCCTCATAGTGTCCATCATTGAGGAAGACAAGAATTCCTACACTCCCTGCCTCAACCA GTTTCCCCAGGAGCTGAATGTGGGTAAAATCAGCGCTGAAGTGATGTGGAATCTGTTTGCCCAAGACATGAAGTACGCCATGGAGGAGCACGACAAGCATCGTCTATGCAAGAGTGCCGACTACATGAACCTCCACTTCAAGGTGAAATGGCTCTACAATGAGTATGTGACGGAACTTCCCGCCTTCAAGGACCGCGTGCCTGAGTACCC TGCATGGTTTGAACCCTTCGTCATCCAGTGGCTGGATGAGAATGAGGAGGTGTCCCGGGATTTCCTGCAC GGTGCCCTGGAGCGAGACAAGAAGGATGGGTTCCAGCAGACCTCAGAGCATGCCCTATTCTCCTGCTCCG TGGTGGATGTTTTCTCCCAACTCAACCAGAGCTTTGAAATCATCAAGAAACTCGAGTGTCCCGACCCTCA GATCGTGGGGCACTACATGAGGCGCTTTGCCAAGACCATCAGTAATGTGCTCCTCCAGTATGCAGACATC ATCTCCAAGGACTTTGCCTCCTACTGCTCCAAGGAGAAGGAGAAACCCTGCATTCTCATGAATAACACTC AACAGCTACGAGTTCAGCTGGAGAAGATGTTCGAAGCCATGGGAGGAAAGGAGCTGGATGCTGAAGCCAG TGACATCCTGAAGGAGCTTCAGGTGAAACTCAATAACGTCTTGGATGAGCTCAGCCGGGTGTTTGCTACC AGCTTCCAGCCGCACATTGAAGAGTGTGTCAAACAGATGGGTGACATCCTTAGCCAGGTTAAGGGCACAG GCAATGTGCCAGCCAGTGCCTGCAGCAGCGTGGCCCAGGACGCGGACAATGTGTTGCAGCCCATCATGGA CCTGCTGGACAGCAACCTGACCCTCTTTGCCAAAATCTGTGAGAAGACTGTGCTGAAGCGAGTGCTGAAG GAGCTGTGGAAGCTGGTTATGAACACCATGGAGAAAACCATCGTCCTGCCGCCCCTCACTGACCAGACGA TGATCGGGAACCTCTTGAGAAAACATGGCAAGGGATTAGAAAAGGGCAGGGTGAAATTGCCAAGCCACTC AGACGGAACCCAGATGATCTTCAATGCAGCCAAGGAGCTGGGTCAGCTGTCCAAACTCAAGGATCACATG GTACGAGAAGAAGCCAAGAGCTTGACCCCAAAGCAGTGCGCGGTTGTTGAGTTGGCCCTGGACACCATCA AGCAATATTTCCACGCGGGTGGCGTGGGCCTCAAGAAGACCTTCCTGGAGAAGAGCCCGGACCTGCAATC CTTGCGCTATGCCCTGTCGCTCTACACGCAGGCCACCGACCTGCTAATCAAGACCTTTGTACAGACGCAA TCGGCCCAGGGCTTGGGTGTAGAAGACCCTGTGGGTGAAGTCTCTGTCCATGTTGAGCTGTTCACTCATC CAGGAACTGGGGAACACAAGGTCACAGTGAAAGTGGTGGCTGCCAATGACCTCAAGTGGCAGACTTCTGGCATCTTCCGGCCGTTCATCGAGGTCAACATCATTGGGCCCCAGCTCAGCGACAAGAAACGCAAGTTTGCGACCAAATCCAAGAACAATAGCTGGGCTCCCAAGTACAATGAGAGCTTCCAGTTCACGCTGAGCGCCGACG CGGGTCCCGAGTGCTATGAGCTGCAGGTGTGCGTCAAGGACTACTGCTTCGCGCGCGAGGACCGCACGGT GGGGCTGGCCGTGCTGCAGCTGCGTGAGCTGGCCCAGCGCGGGAGCGCCGCCTGCTGGCTGCCGCTCGGC CGCCGCATCCACATGGACGACACGGGCCTCACGGTGCTGCGAATCCTCTCGCAGCGCAGCAACGACGAGG TGGCCAAGGAGTTCGTGAAGCTCAAGTCGGACACGCGCTCCGCCGAGGAGGGCGGTGCCGCGCCTGCGCC TTAGCGCGGGCGGTCGGCCGAGCGGCACTGCGCCTGCGCGGAGGGCGCTGGGCGGGGAGGGACGGGGCTT(SEQ ID NO: 7 (SOURCE NCBI Reference Sequence XM_011527811.2)).

[0198] In various embodiments, a UNC13A transcript is a pre-mRNA UNC13A transcript. In various embodiments, a UNC13A pre-mRNA transcript comprises a sequence provided as SEQ ID NO: 8.(SEQ ID NO: 8 (SOURCE NCBI Reference Sequence NG_052872.1)).

[0199] In various embodiments, a UNC13A transcript is a pre-mRNA UNC13A transcript. In various embodiments, a UNC13A pre-mRNA transcript comprises a sequence provided as SEQ ID NO: 9. NCBI Reference Sequence NC_000019.10 Reference GRCh38.p13 Primary Assembly is SEQ ID NO: 9. UNC13A Transcript with a Cryptic Exon

[0200] In some embodiments, an UNC13A AON targets a region of an UNC13A transcript comprising a cryptic exon sequence, the UNC13A mRNA transcript comprising the sequence provided as SEQ ID NO: 10.

[0201] In some embodiments, a cryptic exon sequence within the UNC13A mRNA transcript is provided as SEQ ID NO: 11.UNC13A Oligonucleotides Targeting Regions of the UNC13A Transcript

[0203] In various embodiments, UNC13A AON disclosed herein are complementary to specific regions of UNC13A transcripts (for example, a UNC13A pre-mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1 - 12. In some embodiments, a UNC13A AON comprises a sequence that is complementary to a specific region of the UNC13A transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1 - 12. In some embodiments, a UNC13A AON comprises a sequence that is at least 85% complementary to a specific region of the UNC13A transcript. In some embodiments, a UNC13A AON comprises a sequence that is at least 86%, atleast 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to a specific region of the UNC13A transcript. In some embodiments, a UNC13A AON comprises a sequence that is 90 to 99% complementary to a specific region of the UNC13A transcript. In some embodiments, a UNC13A AON comprises a sequence that is 90 to 95% complementary to a specific region of the UNC13A transcript. In some embodiments, a UNC13A AON comprises a sequence that is 95 to 99% complementary to a specific region of the UNC13A transcript.

[0204] In some embodiments, the UNC13A AON (e.g., UNC13A AON) has a segment that has, at most, 7 linked nucleosides. In some embodiments, the UNC13A AON has a segment that has, at most, 6, 5, 4, 3, or 2 linked nucleosides. The segments of the UNC13A AON may be separated from other segments of the UNC13A AON through a spacer. The segment of the UNC13A AON is complementary to a specific region of the UNC13A transcript (for example, a UNC13A transcript) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1-7 or 10-12, or an UNC13A pre-mRNA transcript transcribed from SEQ ID NOs: 8 – 9. Antisense Oligonucleotides with One or more Spacers

[0205] In various embodiments, antisense oligonucleotides comprise one or more spacers. In particular embodiments, an antisense oligonucleotide includes two spacers. Generally, a spacer refers to a nucleoside-replacement group lacking a nucleotide base and wherein the nucleoside sugar moiety is replaced by a non-sugar substitute group. The non-sugar substitute group is not capable of linking to a nucleobase, but is capable of linking with the 3’ and 5’ positions of nucleosides adjacent to the spacer through an internucleoside linking group.

[0206] As used herein, an “oligonucleotide unit” refers to either a nucleoside (e.g., a nucleoside which includes a sugar and / or a nucleobase) or a nucleoside-replacement group (e.g., a spacer) of the oligonucleotide.

[0207] In particular embodiments, oligonucleotides with one or more spacers are 18 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 18 oligonucleotide units in length.

[0208] In various embodiments, a UNC13A AON comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 13-1283 or 2571-2594.

[0209] In some embodiments, the spacer is of Formula (X):wherein ring A is as defined herein.

[0210] In some embodiments, the spacer is of Formula (Xa):wherein ring A is as defined herein and the -CH2-O- group is on a ring A atom adjacent to the - O- group.

[0211] As generally defined herein, ring A of formulae (X) and (Xa), is an optionally substituted 4-8 member monocyclic cycloalkyl group (e.g. ring A is cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl) or a 4-8 member monocyclic heterocyclyl group, wherein the heterocyclyl group contains 1 or 2 heteroatoms selected from O, S and N (e.g. ring A is oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, azepanyl). In some embodiments, ring A is tetrahydrofuranyl. In some embodiments, ring A is tetrahydropyranyl. In some embodiments, ring A is pyrrolidinyl. In some embodiments, ring A is cyclopentyl. In some embodiments, the monocyclic cycloalkyl or monocyclic heterocyclyl is not further substituted. In some embodiments, the cycloalkyl or heterocyclyl is further substituted with 0, 1, 2 or 3 substituents selected from halo (e.g., -F, -Cl), - OMe, -OEt -O(CH2)OMe, -O(CH2)2OMe and CN.

[0212] In some embodiments, tetrahydrofuranyl is substituted with 1 or 2 substituents selected from halo (e.g., -F, -Cl), -OMe, -OEt -O(CH2)OMe, -O(CH2)2OMe and CN. In some embodiments, tetrahydrofuranyl is substituted with 2 substituents selected from halo (e.g., -F, - Cl), -OMe, -OEt -O(CH2)OMe, -O(CH2)2OMe and CN. In some embodiments, tetrahydrofuranyl is substituted with 1 substituent selected from halo (e.g., -F, -Cl), -OMe, -OEt -O(CH2)OMe, - O(CH2)2OMe and CN. In some embodiments, tetrahydrofuranyl is substituted with - O(CH2)2OMe.

[0213] In some embodiments, the spacer is represented by Formula (I), wherein:Formula (I) X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.

[0214] In some embodiments, the spacer is represented by Formula (I’), wherein:Formula (I’) X is selected from -CH2-and -O-; and n is 0, 1, 2 or 3.

[0215] In some embodiments, the spacer is represented by Formula (Ia), wherein:Formula (Ia) and n is 0, 1, 2 or 3.

[0216] In some embodiments, the spacer is represented by Formula (Ia’), wherein:Formula (Ia’) and n is 0, 1, 2 or 3.

[0217] As generally defined herein, X is selected from -CH2- and -O-. In some embodiments, X is -CH2-. In other embodiments, X is -O-.

[0218] As generally defined herein, n is 0, 1, 2 or 3. In some embodiments, n is 0. In some embodiments, n is 1 or 2. In some embodiments, n is 1. In other embodiments, n is 2. In certain embodiments, n is 3.

[0219] In some embodiments, the spacer is represented by Formula (II), wherein:Formula (II) X is selected from -CH2- and -O-.

[0220] In some embodiments, the spacer is represented by Formula (II’), wherein:Formula (II’) X is selected from -CH2-and -O.

[0221] In some embodiments, the spacer is represented by Formula (Iia), wherein:Formula (Iia).

[0222] In some embodiments, the spacer is represented by Formula (Iia’), wherein:Formula (Iia’).

[0223] In some embodiments, the spacer is represented by Formula (IIi), wherein:Formula (IIi) X is selected from -CH2- and -O-.

[0224] In some embodiments, the spacer is represented by Formula (IIi’), wherein:Formula (IIi’) X is selected from -CH2-and -O.

[0225] In some embodiments, the spacer is represented by Formula (IIib), wherein:Formula (IIib).

[0226] In some embodiments, the spacer is represented by Formula (IIib’), wherein:Formula (IIib’).

[0227] In some embodiments, the spacer is represented by Formula (IIic), wherein:(Formula IIic).

[0228] In some embodiments, the spacer is represented by Formula (IIic’), wherein:

[0229] In some embodiments, the spacer is represented by Formula (III), wherein:Formula (III) X is selected from -CH2- and -O-.

[0230] In some embodiments, the spacer is represented by Formula (III’), wherein:Formula (III’) X is selected from -CH2-and -O.

[0231] In some embodiments, the spacer is represented by Formula (IIIa), wherein:Formula (IIIa).

[0232] In some embodiments, the spacer is represented by Formula (IIIa’), wherein:Formula (IIIa’).

[0233] In some embodiments, the open positions of Formulae (I), (I’), (Ia), (Ia’), (II), (II’), (Iia), (Iia’), (III), (III’), (IIIa) and (IIIa’) (i.e., the positions not specifically depicted as bearing exclusively hydrogen atoms, including the -CH2- group of X) are further substituted with 0-3substituents independently selected from halo (e.g., -F, -Cl), - OMe, -OEt -O(CH2)OMe, - O(CH2)2OMe and CN. In some embodiments, Formulae (I), (I’), (Ia), (Ia’), (II), (II’), (Iia), (Iia’), (III), (III’), (IIIa) and (IIIa’) are not further substituted.

[0234] As described further below, a UNC13A oligonucleotide with one or more spacers is described in reference to a corresponding UNC13A parent oligonucleotide. In various embodiments, a UNC13A oligonucleotide with a spacer differs from a UNC13A parent oligonucleotide in that the spacer replaces a nucleoside in the UNC13A parent oligonucleotide. As used hereafter, the “position” of the UNC13A oligonucleotide refers to a particular location as counted from the 5’ end of the UNC13A oligonucleotide. In various embodiments, the spacer replaces a nucleoside at any one of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 of the UNC13A parent oligonucleotide. In particular embodiments, a spacer replaces a nucleoside at one of positions 5, 6, 7, 8, 11, 13, or 14 of the UNC13A parent oligonucleotide.

[0235] In various embodiments, a UNC13A oligonucleotide includes two spacers that each replace a nucleoside in the UNC13A oligonucleotide (e.g., two spacers replace two separate nucleosides of the UNC13A oligonucleotide). In various embodiments, a first spacer and a second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases.. In particular embodiments, a first spacer and a second spacer are separated by at least 2 nucleobases, at least 3 nucleobases, at least 4 nucleobases, at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases. In particular embodiments, the first spacer and the second spacer are not adjacent to one another in the oligonucleotide.

[0236] In particular embodiments, the first spacer replaces a nucleoside between positions 4 and 9 of the UNC13A oligonucleotide. In various embodiments, the second spacer replaces a nucleoside between positions 10 and 15 of the UNC13A oligonucleotide.

[0237] In preferred embodiments, the first spacer replaces a nucleoside at position 8 of the UNC13A oligonucleotide and the second spacer replaces a nucleoside at position 11 of the UNC13A oligonucleotide. In preferred embodiments, the first spacer replaces a nucleoside at position 5 of the UNC13A oligonucleotide and the second spacer replaces a nucleoside at position 13 of the UNC13A oligonucleotide. In preferred embodiments, the first spacer replaces a nucleoside at position 6 of the UNC13A oligonucleotide and the second spacer replaces a nucleoside at position 14 of the UNC13A oligonucleotide.

[0238] In various embodiments, the one or more spacers are positioned in the oligonucleotide to replace one or more adenosine or thymine nucleosides (as opposed to guanine or cytosine nucleosides). For example, the one or more spacers can replace one, two, three, four, five, six,seven, eight, or nine adenosine or thymine nucleosides in the oligonucleotide. In various embodiments, the one or more spacers are positioned in the oligonucleotide to replace one or more guanine or cytosine nucleosides (as opposed to adenosine or thymine nucleosides). For example, the one or more spacers can replace one, two, three, four, five, six, seven, eight, or nine guanine or cytosine nucleosides in the oligonucleotide. In various embodiments, the spacers are positioned in the oligonucleotide to replace an equal number of adenosine / thymine nucleosides and guanine / cytosine nucleosides. For example, a first spacer in the oligonucleotide may replace an adenosine / thymine nucleoside and a second spacer in the oligonucleotide may replace a guanine / cytosine nucleoside.

[0239] In various embodiments, the one or more spacers are positioned in the oligonucleotide to control the sequence content in the oligonucleotide. For example, the two spacers are positioned such that at least one of the spacers is located adjacent to a guanine group. In various embodiments, an oligonucleotide with spacers can include one spacer adjacent to a guanine group, or two spacers adjacent to guanine groups. In one embodiment, if counting from the 5’ end of the oligonucleotide, a spacer immediately precedes a guanine group in the sequence. Thus, in various embodiments, an oligonucleotide with spacers can include one spacer that immediately precedes a guanine group, or two spacers that each immediately precede a guanine group. In one embodiment, if counting from the 5’ end of the oligonucleotide, a guanine group is immediately succeeded by a spacer. Thus, in various embodiments, an oligonucleotide with spacers can include one spacer that immediately succeeds a guanine group, or two spacers that each immediately succeed a guanine group. In various embodiments, the spacers in the oligonucleotide can be positioned to maximize the number of spacers adjacent to guanine groups.

[0240] In various embodiments, the one or more spacers are positioned in the oligonucleotide to replace one or more adenosine or thymine nucleosides such that the one or more spacers are located adjacent to guanine groups. For example, two spacers can replace adenosine or thymine nucleosides in the oligonucleotide, each of the two spacers being located adjacent to a guanine group.

[0241] In various embodiments, the UNC13A oligonucleotide with one or more spacers has a particular GC content. As used herein, GC content (or guanine-cytosine content) is the percentage of nitrogenous bases in the oligonucleotide that are either guanine (G) or cytosine (C). In various embodiments, the UNC13A oligonucleotide with one or more spacers has at least 10% GC content, at least 20% GC content, at least 25% GC content, at least 30% GC content, at least 35% GC content, at least 40% GC content, at least 45% GC content, at least 50% GC content, atleast 55% GC content, at least 60% GC content, at least 65% GC content, at least 75% GC content, at least 80% GC content, at least 85% GC content, at least 90% GC content, or at least 95% GC content. In particular embodiments, the UNC13A oligonucleotide with one or more spacers has at least 30% GC content. In particular embodiments, the UNC13A oligonucleotide with one or more spacers has at least 40% GC content. In various embodiments, the one or more spacers are positioned in the UNC13A oligonucleotide to maximize GC content. For example, instead of selecting a guanine or cytosine for replacement by a spacer in the UNC13A oligonucleotide, a thymine or adenine can be selected for replacement by a spacer.

[0242] In various embodiments, a UNC13A oligonucleotide with spacers is designed such that 1) each segment of the UNC13A oligonucleotide has at most 7 linked nucleosides and 2) at least two spacers are positioned adjacent to a guanine group. In some embodiments, a UNC13A oligonucleotide with spacers is designed such that 1) each segment of the UNC13A oligonucleotide has at most 7 linked nucleosides and 2) each of two spacers precede a guanine group.

[0243] In various embodiments, the inclusion of one or more spacers in the UNC13A oligonucleotide does not decrease the effectiveness of the UNC13A oligonucleotide with the spacers in restoring full length UNC13A protein or full length UNC13A mRNA in comparison to the effect of a corresponding control oligonucleotide. In various embodiments, the inclusion of one or more spacers in the UNC13A oligonucleotide increases the effectiveness of the UNC13A oligonucleotide with the spacers in restoring full length UNC13A protein or full length UNC13A mRNA in comparison to the effect of a control oligonucleotide. In various embodiments, the inclusion of one or more spacers in the UNC13A oligonucleotide does not decrease the effectiveness of the UNC13A oligonucleotide with the spacers in reducing quantity of UNC13A transcripts in comparison to the effect of a control oligonucleotide. In various embodiments, the inclusion of one or more spacers in the UNC13A oligonucleotide increases the effectiveness of the UNC13A oligonucleotide with the spacers in reducing quantity of UNC13A transcripts in comparison to the effect of a control oligonucleotide.

[0244] Table 2 documents example UNC13A oligonucleotides with one or more spacers and their relation to corresponding UNC13A parent oligonucleotides. Each UNC13A oligonucleotide is assigned a sequence name. As used hereafter, the nomenclature of the sequence name is expressed as “X_spA_spB” (for a UNC13A AON with two spacers). Here, “X” refers to the length of the UNC13A AON, “A” refers to the position in the UNC13A AONwhere the first spacer is located, and “B” refers to the position in the UNC13A AON where the second spacer is located.

[0245] In various embodiments, UNC13A oligonucleotides include two spacers. In various embodiments, the inclusion of a spacer divides up the UNC13A oligonucleotide into three separate segments, where at least one of the segments is at most 7 linked nucleosides in length. Example UNC13A AONs with two spacers are documented below in Table 2. Table 2: Identification of UNC13A AONs with two spacers. Here, each UNC13A AON has 3 segments, where at least one of the segments has at most 7 linked nucleosides.* At least one nucleoside linkage of the nucleobase sequence is selected from a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.

[0246] In some embodiments, an antisense oligonucleotide disclosed herein (e.g., UNC13A parent oligonucleotides) comprise one or more spacers as well as one or more locked nucleic acids (LNAs). In some embodiments, an antisense oligonucleotide disclosed herein comprises two spacers and two LNAs. In some embodiments, an antisense oligonucleotide disclosed herein comprises two spacers and three LNAs.

[0247] In various embodiments, a spacer and a LNA are located adjacent to one another in an antisense oligonucleotide. For example, if counting from 5’ to 3’, a LNA can be located at a 4thposition of the antisense oligonucleotide and a spacer can be located at a 5thposition of the antisense oligonucleotide. As another example, if counting from 5’ to 3’, a LNA can be located at a 5thposition of the antisense oligonucleotide and a spacer can be located at a 6thposition of the antisense oligonucleotide. As another example, if counting from 5’ to 3’, a LNA can be located at a 7thposition of the antisense oligonucleotide and a spacer can be located at a 8thposition of the antisense oligonucleotide. As another example, if counting from 5’ to 3’, a LNA can be located at a 10thposition of the antisense oligonucleotide and a spacer can be located at a 11thposition of the antisense oligonucleotide. As another example, if counting from 5’ to 3’, a LNA can be located at a 12thposition of the antisense oligonucleotide and a spacer can be located at a13thposition of the antisense oligonucleotide. As another example, if counting from 5’ to 3’, a LNA can be located at a 13thposition of the antisense oligonucleotide and a spacer can be located at a 14thposition of the antisense oligonucleotide.

[0248] In particular embodiments, a first spacer is located adjacent to a first LNA and a second spacer is located adjacent to a second LNA in an antisense oligonucleotide. For example, if counting from 5’ to 3’, a first LNA can be located at a 4thposition of the antisense oligonucleotide, a first spacer can be located at a 5thposition of the antisense oligonucleotide, a second LNA can be located at a 12thposition of the antisense oligonucleotide, and a second spacer can be located at a 13thposition of the antisense oligonucleotide. As another example, if counting from 5’ to 3’, a first LNA can be located at a 7thposition of the antisense oligonucleotide, a first spacer can be located at a 8thposition of the antisense oligonucleotide, a second LNA can be located at a 10thposition of the antisense oligonucleotide, and a second spacer can be located at a 11thposition of the antisense oligonucleotide. As another example, if counting from 5’ to 3’, a first LNA can be located at a 5thposition of the antisense oligonucleotide, a first spacer can be located at a 6thposition of the antisense oligonucleotide, a second LNA can be located at a 13thposition of the antisense oligonucleotide, and a second spacer can be located at a 14thposition of the antisense oligonucleotide. Performance of UNC13A Oligonucleotides

[0249] Generally, UNC13A oligonucleotides and / or UNC13A parent oligonucleotides (e.g., UNC13A oligonucleotides with sequences of any of SEQ ID NOs: 13-1283 or 2571-2594 target UNC13A transcripts (for example, a UNC13A pre-mRNA) comprising a sequence that shares at least 85% identity to SEQ ID NOs: 1284-2554 in order to increase, restore, rescue, or stabilize levels of expression of UNC13A mRNA that is capable of translation to produce a functional UNC13A protein (e.g., full length UNC13A). In various embodiments, UNC13A AONs can exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length UNC13A mRNA. In various embodiments, UNC13A AONs can exhibit at least a 100%, 200%, 300%, or 400% increase of full length UNC13A mRNA. In various embodiments, UNC13A AONs can exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% reduction of mis-spliced UNC13A mRNA. In various embodiments, UNC13A AONs can exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length UNC13A protein. In various embodiments, UNC13A AONs can exhibit at least a 100%, 200%, 300%, or 400% increase of full length UNC13A protein. In some embodiments, the percent increase of the full lengthUNC13A protein is an increase in comparison to a reduced level of full length UNC13A protein achieved using a TDP43 antisense oligonucleotide. For example, a TDP43 antisense oligonucleotide can be used to deplete full length UNC13A protein followed by increase of the full length UNC13A protein using a UNC13A AON.

[0250] In some embodiments, UNC13A AONs can exhibit at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full length UNC13A protein. In some embodiments, the percent rescue of full length UNC13A refers to the % of full length UNC13A following depletion using a TDP43 antisense oligonucleotide and a treatment using UNC13A AONs in comparison to a negative control (e.g., cells that did not undergo depletion or treatment or cells that were treated with a vehicle solution).

[0251] In various embodiments, UNC13A AONs can exhibit at least a 30%, 40%, 50%, 60%, 70%, 80%, or 90% reduction of an UNC13A transcript with a cryptic exon. In various embodiments, UNC13A AONs can exhibit at least a 100% reduction of an UNC13A transcript with a cryptic exon. In various embodiments, reduction of an UNC13A transcript with a cryptic exon is measured in comparison to a level of UNC13A transcript with a cryptic exon detected using a TDP43 antisense oligonucleotide. In various embodiments, UNC13A AONs can exhibit at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction of an UNC13A transcript with a cryptic exon. Modifications

[0252] A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2’, 3’ or 5’ hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

[0253] Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased activity.

[0254] Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides. Modified Internucleoside Linkages

[0255] The naturally occurring internucleoside linkage of RNA and DNA is a 3’ to 5’ phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

[0256] Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous- containing linkages are well known.

[0257] In certain embodiments, antisense compounds targeted to a UNC13A nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are interspersed throughout the antisense compound. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage. In certain embodiments, the antisense compounds targeted to a UNC13A nucleic acid comprise at least one phosphodiester linkage and at least one phosphorothioate linkage. Modified Sugar Moieties

[0258] Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substituent groups (including 5’ and 2’ substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atomwith S, N(R), or C(R1)(R2) (R, R1and R2are each independently H, C1-C12alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2’-F-5’- methyl substituted nucleoside (see PCT International Application WO 2008 / 101157 Published on Aug.21, 2008 for other disclosed 5’,2’-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2’-position (see published U.S. Patent Application US2005-0130923, published on Jun.16, 2005) or alternatively 5’-substitution of a BNA (see PCT International Application WO 2007 / 134181 Published on Nov.22, 2007 wherein LNA is substituted with for example a 5’-methyl or a 5’-vinyl group).

[0259] Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5’-vinyl, 5’-methyl (R or 5), 4’-S, 2’-F, 2’-OCH3, 2’-OCH2CH3, 2’-O CH2 CH2F and 2’-O(CH2)2OCH3 substituent groups. The substituent at the 2’ position can also be selected from allyl, amino, azido, thio, O-allyl, O—C1-C10alkyl, OCF3, OCH2F, O(CH2)2S CH3, O(CH2)2—O—N(Rm)(Rn), O—CH2—C(=O)—N(Rm)(Rn), and O—CH2—C(=O)—N(R1)—( CH2)2—N(Rm)(Rn)- , where each Rl, Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl.

[0260] Additional examples of modified sugar moieties include a 2’-OMe modified sugar moiety, bicyclic sugar moiety, 2’-O-(2-methoxyethyl) (2’-MOE), 2’-deoxy-2’-fluoro nucleoside, 2’-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2’-4’-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA).

[0261] As used herein, “bicyclic nucleosides” refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4’ and the 2’ ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4’ to 2’ bridge. Examples of such 4’ to 2’ bridged bicyclic nucleosides, include but are not limited to one of the formulae: 4’-(CH2)—O-2’ (LNA); 4’-(CH2)—S-2’; 4’-(CH2)2—O-2’ (ENA); 4’- CH(CH3)—O-2’ and 4’-CH(CH2OCH3)—O-2’ (and analogs thereof see U.S. Pat. No.7,399,845, issued on Jul.15, 2008); 4’-C(CH3)(CH3)—O-2’ (and analogs thereof see published International Application WO / 2009 / 006478, published Jan.8, 2009); 4’-CH2—N(OCH3)-2’ (and analogs thereof see published International Application WO / 2008 / 150729, published Dec.11, 2008); 4’- CH2—O—N(CH3)-2’ (see published U.S. Patent Application US2004-0171570, published Sep. 2, 2004); 4’- CH2—N(R)—O-2’, wherein R is H, C1-C12alkyl, or a protecting group (see U.S. Pat. No.7,427,672, issued on Sep.23, 2008); 4’-CH2—C(H)(CH3)-2’ (see Chattopadhyaya et al.,J. Org. Chem., 2009, 74, 118-134); and 4’-CH2—C—(=CH2)-2’ (and analogs thereof see published International Application WO 2008 / 154401, published on Dec.8, 2008).

[0262] Further reports related to bicyclic nucleosides can also be found in published literature (see for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos.6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication No. US2008-0039618; US2009-0012281; U.S. Patent Ser. No. 60 / 989,574; 61 / 026,995; 61 / 026,998; 61 / 056,564; 61 / 086,231; 61 / 097,787; and 61 / 099,844; Published PCT International applications WO 1994 / 014226; WO 2004 / 106356; WO 2005 / 021570; WO 2007 / 134181; WO 2008 / 150729; WO 2008 / 154401; and WO 2009 / 006478. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT / DK98 / 00393, published on Mar.25, 1999 as WO 99 / 14226).

[0263] In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4’ and the 2’ position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from —[C(Ra)(Rb)]n—, —C(Ra)=C(Rb)—, —C(Ra)=N—, —C(=O)—, —C(=NRa)—, —C(=S) —, —O—, —Si(Ra)2—, —S(=O)x—, and —N(Ra)—; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1- C12alkyl, C2-C12alkenyl, substituted C2-C12alkenyl, C2-C12alkynyl, substituted C2-C12alkynyl, C5-C20aryl, substituted C5-C20aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)—H), substituted acyl, CN, sulfonyl (S(=O)2- J1), or sulfoxyl (S(=O)-J1); and each J1and J2is, independently, H, C1-C12alkyl, substituted C1-C12alkyl, C2-C12alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substitutedC5-C20aryl, acyl (C(=O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.

[0264] In certain embodiments, the bridge of a bicyclic sugar moiety is —[C(Ra)(Rb)]n—, —[— [C(Ra)(Rb)]n—O—, —C(RaRb)—N(R)—O— or —C(RaRb)—O—N(R)—. In certain embodiments, the bridge is 4’-CH2-2’, 4’-(CH2)2-2’, 4’-(CH2)3-2’, 4’-CH2—O-2’, 4’-(CH2)2—O- 2’, 4’-CH2—O—N(R)-2’ and 4’-CH2—N(R)—O-2’- wherein each R is, independently, H, a protecting group or C1-C12 alkyl, each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12alkyl, substituted C1-C12alkyl, C2-C12alkenyl, substituted C2-C12alkenyl, C2- C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)—H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); each J1and J2is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group; and R is H, C1-C12 alkyl, or a protecting group (see U.S. Pat. No.7,427,672, issued on Sep.23, 2008).

[0265] In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4’-2’ methylene-oxy bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4’-CH2—O-2’) BNA’s have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0266] In certain embodiments, bicyclic nucleosides include, but are not limited to, α-L- methyleneoxy (4’-CH2—O-2’) BNA, β-D-methyleneoxy (4’-CH2—O-2’) BNA, ethyleneoxy (4’- (CH2)2—O-2) BNA, aminooxy (4’-CH2—O—N(R)-2’) BNA, oxyamino (4’-CH2—N(R)—O-2’) BNA, methyl(methyleneoxy) (4’-CH(CH3)—O-2’) BNA, methylene-thio (4’-CH2—S-2’) BNA, methylene-amino (4’-CH2—N(R)-2’) BNA, methyl carbocyclic (4’-CH2—CH(CH3)-2’) BNA, and propylene carbocyclic (4’-(CH2)3-2’) BNA; wherein R is H, C1-C12alkyl, or a protecting group (see U.S. Pat. No.7,427,672, issued on Sep.23, 2008).

[0267] The present disclosure provide, in some embodiments, methods for treating, ameliorating, or preventing a neurological disease and / or a neuropathy further include methods of administering, to a patient, a pharmaceutically acceptable composition, for example, a pharmaceutically acceptable formulation that includes one or more UNC13A oligonucleotides.UNC13A oligonucleotides can increase, restore, or stabilize UNC13A activity, for example, UNC13A activity, and / or levels of UNC13A expression, for example, UNC13A mRNA and / or protein expression.

[0268] The present disclosure also provides pharmaceutical compositions comprising a UNC13A oligonucleotide formulated together with one or more pharmaceutically or cosmetically acceptable excipients. These formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal), or for topical use, e.g., as part of a composition suitable for applying topically to skin and / or mucous membrane, for example, a composition in the form of a gel, a paste, a wax, a cream, a spray, a liquid, a foam, a lotion, an ointment, a topical solution, a transdermal patch, a powder, a vapor, or a tincture. Although the most suitable form of administration in any given case will depend on the degree and severity of the condition being treated and on the nature of the particular UNC13A oligonucleotide being used.

[0269] The present disclosure also provides a pharmaceutical composition comprising a UNC13A oligonucleotide or a pharmaceutically acceptable salt thereof (for example, a UNC13A AON that includes a sequence of any of SEQ ID NOs: 2571 - 2594.

[0270] The present disclosure also provides methods that include the use of pharmaceutical compositions comprising a UNC13A AON is formulated together with one or more pharmaceutically acceptable excipients. Exemplary compositions provided herein include compositions comprising a UNC13A AON, and one or more pharmaceutically acceptable excipients. Formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal), or for topical use. The most suitable form of administration in any given case will depend on the clinical symptoms, complications, or biochemical indicia of the state, disorder, disease, or condition that one is trying to prevent in a subject; the state, disorder, disease, or condition one is trying to prevent in a subject; and / or on the nature of the particular compound and / or the composition being used.Additional Chemically Modified UNC13A Oligonucleotides

[0271] UNC13A AONs described herein, can include chemically modified nucleosides, including modified ribonucleosides and modified deoxyribonucleosides. Chemically modified nucleosides include, but are not limited to, uracine, uridine, 2’-O-(2-methoxyethyl) modifications, for example, 2’-O-(2-methoxyethyl)guanosine, 2’-O-(2-methoxyethyl)adenosine, 2’-O-(2-methoxyethyl)cytosine, and 2’-O-(2-methoxyethyl)thymidine. In certain embodiments, mixed modalities, e.g., a combination of a UNC13A peptide nucleic acid (PNA) and a UNC13A locked nucleic acid (LNA). Chemically modified nucleosides also include, but are not limited to, locked nucleic acids (LNAs), 2’-O-methyl, 2’-fluoro, and 2’-fluoro-β-D-arabinonucleotide (FANA), and Fluoro Cyclohexenyl nucleic acid (F-CeNA) modifications. Chemically modified nucleosides that can be included in UNC13A AONs described herein are described in Johannes and Lucchino, (2018) “Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs” Nucleic Acid Ther.28(3): 178–93; Rettig and Behlke, (2012) “Progress toward in vivo use of siRNAs-II” Mol Ther 20:483–512; and Khvorova and Watts, (2017) “The chemical evolution of oligonucleotide therapies of clinical utility” Nat Biotechnol., 35(3):238-48, the contents of each of which are incorporated by reference herein.

[0272] UNC13A AONs described herein can include chemical modifications that promote stabilization of an oligonucleotide’s terminal 5’-phosphate and phosphatase-resistant analogs of 5′-phosphate. Chemical modifications that promote oligonucleotide terminal 5’-phosphate stabilization or which are phosphatase-resistant analogs of 5′-phosphate include, but are not limited to, 5′-methyl phosphonate, 5′-methylenephosphonate, 5′-methylenephosphonate analogs, 5′-E-vinyl phosphonate (5′-E-VP), 5′-phosphorothioate, and 5′-C-methyl analogs. Chemical modifications that promote AON terminal 5’-phosphate stabilization and phosphatase-resistant analogues of 5′-phosphate are described in Khvorova and Watts, (2017) “The chemical evolution of oligonucleotide therapies of clinical utility” Nat Biotechnol., 35(3):238-48, the contents of which are incorporated by reference herein.

[0273] In some embodiments described herein, UNC13A AONs described herein can include chemically modified nucleosides, for example, 2’ O-methyl ribonucleosides, for example, 2’ O- methyl cytidine, 2’ O-methyl guanosine, 2’ O-methyl uridine, and / or 2’ O-methyl adenosine. UNC13A AONs described herein can include one or more chemically modified bases, including a 5-methylpyrimidine, for example, 5-methylcytosine, and / or a 5-methylpurine, for example, 5- methylguanine. Chemically modified nucleosides can further include pseudo-uridine or 5’methoxyuridine. UNC13A AONs described herein can include any of the followingchemically modified nucleosides: 5-methyl-2’-O-methylcytidine, 5-methyl-2’-O- methylthymidine, 5-methylcytidine, 5-methyluridine, and / or 5-methyl 2’-deoxycytidine.

[0274] UNC13A AONs described herein can include a phosphate backbone where one or more of the oligonucleoside linkages is a phosphate linkage. UNC13A AONs described herein may include a modified oligonucleotide backbone, where one or more of the nucleoside linkages of the sequence is selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. In some embodiments of UNC13A AONs described herein, at least one (i.e., one or more) internucleoside linkage of the oligonucleotide is a phosphorothioate linkage. For example, in some embodiments of UNC13A AONs described herein, one, two, three, or more internucleoside linkages of the oligonucleotide is a phosphorothioate linkage. In preferred embodiments of UNC13A AONs described herein, all internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Thus, in some embodiments, all of the nucleotide linkages of a UNC13A AON of any of SEQ ID NOs: 13 – 1283 or 2571 – 2594 phosphorothioate linkages. In some embodiments, one or more of the nucleotide linkages of a UNC13A AON of any of SEQ ID NOs: 13 – 1283 or 2571 – 2594 are phosphorothioate linkages.

[0275] In various embodiments, nucleotide linkages of UNC13A AON described herein such as any of SEQ ID NOs: 13 – 1283 or 2571 – 2594 include a mix of phosphodiester and phosphorothioate linkages.

[0276] In some embodiments, nucleoside linkages linking a base at position 3 of a UNC13A AON described herein are phosphodiester bonds. For example, the base at position 3 may be linked to each adjacent base (e.g., preceding base and succeeding base) through a phosphodiester bond. An example 18mer UNC13A AON with phosphodiester bonds linking the base at position 3 can be denoted as: XXoDoXXXXXXXXXXXXXXXwhere “o” represents a phosphodiester bond and “D” represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.

[0277] In some embodiments, one of the nucleoside linkages linking a base at position 3 of a UNC13A AON described herein is a phosphodiester bond. For example, the base at position 3 may be linked to either the preceding base or the succeeding base through a phosphodiester bond. An example 18mer UNC13A AON with a phosphodiester bond linking the base at position 3 to a preceding base can be denoted as: XXoDXXXXXXXXXXXXXXX where “o” represents a phosphodiester bond and “D” represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.

[0278] An example 18mer UNC13A AON with a phosphodiester bond linking the base at position 3 to a succeeding base can be denoted as: XXDoXXXXXXXXXXXXXXX where “o” represents a phosphodiester bond and “D” represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.

[0279] In various embodiments, in addition to one of the nucleoside linkages linking a base at position 3 of a UNC13A AON described herein being a phosphodiester bond, the UNC13A AON further includes two spacers. The two spacers can be positioned in the UNC13A AON such that the UNC13A AON includes a segment with at most 7 linked nucleosides. An example 18mer UNC13A AON with two spacers and with a phosphodiester bond linking the base at position 3 to a preceding base can be denoted as: XXoD^^XXXXXXXX^^XXXXX where “S1” represents a first spacer, “S2” represents a second spacer, “o” represents a phosphodiester bond and “D” represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.

[0280] In various embodiments, UNC13A AON described herein include one or more spacers and phosphodiester bonds are located relative to the one or more spacers. In some embodiments, the Y number of bases immediately preceding a spacer are linked through phosphodiester bonds. In various embodiments, Y is one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve bases. In particular embodiments, Y is two bases. For example, if the spacer is located at position 15, the bases at positions 13 and 14 of the UNC13A AON are each linked to their respective adjacent bases through phosphodiester bonds. As described herein, the spacer can be located at various positions in the UNC13A AON and therefore, the 2 bases immediatelypreceding the spacer can vary within the UNC13A AON depending on where the spacer is situated.

[0281] In various embodiments, the UNC13A AON may include more than one spacer. In some embodiments, only one of the spacers has Y number of bases immediately preceding the spacer that are linked through phosphodiester bonds. In such embodiments, the other spacers are linked to respective preceding bases through phosphorothioate bonds. In various embodiments, two of the spacers have Y number of bases immediately preceding the spacers that are linked through phosphodiester bonds. In various embodiments, each of the spacers in the UNC13A AON have Y number of bases immediately preceding the spacers that are linked through phosphodiester bonds. In various embodiments, all other bases of the UNC13A AON are linked through phosphorothioate bonds.

[0282] In some embodiments, Y number of bases immediately preceding a spacer and Z number of bases immediately succeeding a spacer are linked through phosphodiester bonds. In various embodiments, Y is one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve bases. In various embodiments, Z is one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve bases. Y and Z can be independent of each other. In particular embodiments, Y is one base and Z is one base. For example, if the spacer is located at position 15, the bases at positions 14 and 16 of the UNC13A AON are each linked to their respective adjacent bases through phosphodiester bonds. To provide an example, such a UNC13A AON (e.g., 18mer) can be denoted as: XXXXXXXXXoDo^oEoXXXXXX where “S” represents a spacer, “o” represents a phosphodiester bond, “D” represents a base immediately preceding the spacer, and “E” represents the base immediately succeeding the spacer. Any nucleobase in the AON can be a nucleobase analog.

[0283] As described herein, the spacer can be located at various positions in the UNC13A AON and therefore, the bases immediately preceding or immediately succeeding the spacer can vary within the UNC13A AON depending on where the spacer is situated.

[0284] In various embodiments, the UNC13A AON may include more than one spacer. In some embodiments, only one of the spacers has Y number of bases immediately preceding the spacer and Z number of bases immediately succeeding the spacer that are linked through phosphodiester bonds. In such embodiments, the other spacers of the UNC13A AON are linked to respective preceding and succeeding bases through phosphorothioate bonds. To provide an example, such a UNC13A AON (e.g., 18mer) can be denoted as:XXXoDo^^oEoXXXXXXXX^^XXX where “S1” represents a first spacer, “S2” represents a second spacer, “o” represents a phosphodiester bond, “D” represents a base immediately preceding the spacer, and “E” represents the base immediately succeeding the spacer. Any nucleobase in the AON can be a nucleobase analog.

[0285] In some embodiments, a disclosed UNC13A AON may have at least one modified nucleobase, e.g., 5-methylcytosine, and / or at least one methylphosphonate nucleotide, which is placed, for example, either at only one of the 5´ or 3´ ends or at both 5´ and 3´ ends or along the oligonucleotide sequence.

[0286] UNC13A AONs may include at least one modified sugar. For example, the sugar moiety of at least one nucleotide constituting the oligonucleotide is a ribose in which the 2´-OH group may be replaced by any one selected from the group consisting of OR, R, R´OR, SH, SR, NH2, NR2, N3, CN, F, Cl, Br, and I (wherein R is an alkyl or aryl and R´ is an alkylene). Examples of a modified sugar moiety include a 2’-Ome modified sugar moiety, bicyclic sugar moiety, 2’-O-(2-methoxyethyl) (2’MOE or MOE), 2’-O-(N-methylacetamide), 2’-deoxy-2’- fluoro nucleoside, 2’-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2’-4’-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA).

[0287] In some embodiments, UNC13A AONs comprise 2’OMe (e.g., a UNC13A AON comprising one or more 2’OMe modified sugar), 2’MOE or MOE (e.g., a UNC13A AON comprising one or more 2’MOE modified sugar), PNA (e.g., a UNC13A AON comprising one or more N-(2-aminoethyl)-glycine units linked by amide bonds or carbonyl methylene linkage as repeating units in place of a sugar-phosphate backbone), LNA (e.g., a UNC13A AON comprising one or more locked ribose, and can be a mixture of 2’-deoxy nucleotides or 2’OMe nucleotides), c-ET (e.g., a UNC13A AON comprising one or more cET sugar), cMOE (e.g., a UNC13A AON comprising one or more cMOE sugar), morpholino oligomer (e.g., a UNC13A AON comprising a backbone comprising one or more PMO), deoxy-2’-fluoro nucleoside (e.g., a UNC13A AON comprising one or more 2’-fluoro-β-D-arabinonucleoside), tcDNA (e.g., a UNC13A AON comprising one or more tcDNA modified sugar), ENA (e.g., a UNC13A AON comprising one or more ENA modified sugar), or HNA (e.g., a UNC13A AON comprising one or more HNA modified sugar). In some embodiments, a UNC13A AON comprises one or more phosphorothioate linkage, phosphodiester linkage, phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidatelinkage, morpholino linkage, PNA linkage, or any combination of phosphorothioate linkage, phosphodiester linkage, a phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, morpholino linkage, and PNA linkage. In some embodiments, a UNC13A AON comprises one or more phosphorothioate linkage, phosphodiester linkage, or a combination of phosphorothioate and phosphodiester linkages.

[0288] In some embodiments, UNC13A AONs with a sequence of any one of SEQ ID NOs: 13 – 1283 or 2571 – 2594 is a chirally controlled oligonucleotide, such as a chirally controlled oligonucleotide described in any of US Patent No.9,982,257, US Patent No.10,590,413, US 10,724,035, US 10,450,568, and PCT Publication No. WO2019200185, each of which is hereby incorporated by reference in its entirety.

[0289] For example, a UNC13A AON with a sequence of any one of SEQ ID NOs: 13 – 1283 or 2571 – 2594 is a chirally controlled oligonucleotide comprising a plurality of oligonucleotides of at least one type, wherein each type is defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone X-moieties (—X-L- R1); wherein: the oligonucleotides of the at least one type comprise one or more phosphorothioate triester internucleotidic linkages and one or more phosphate diester linkage; the oligonucleotides of the at least one type comprise at least two consecutive modified internucleotidic linkages; and oligonucleotides of the at least one oligonucleotide type comprise one or more modified internucleotidic linkages independently having the structure of:wherein: P* is an asymmetric phosphorus atom and is either Rp or Sp; W is O, S or Se; each of X, Y and Z is independently —O—, —S—, —N(-L-R1)—, or L; L is a covalent bond or an optionally substituted, linear or branched C1-C50alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6alkylene, C1-C6alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, — N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, — N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, — N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—; R1is halogen, R, or an optionally substituted C1-C10 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6alkylene, C1-C6alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, — S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—; each R′ is independently —R, —C(O)R, —CO2R, or —SO2R, or: two R′ on the same nitrogen are taken together with their intervening atoms to form an optionally substituted heterocyclic or heteroaryl ring, or two R′ on the same carbon are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring; -Cy- is an optionally substituted bivalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene; each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl; and eachindependently represents a connection to a nucleoside. In some embodiments, a UNC13A AON with a sequence of any one of SEQ ID NOs: 13 – 1283 or 2571 – 2594 is a chirally controlled oligonucleotide comprising certain chemical modifications (e.g., 2’F (2’ Fluoro, which contains a fluorine molecule at the 2’ ribose position (instead of 2’- hydroxyl group in an RNA monomer)), 2’-OMe, phosphorothioate linkages, lipid conjugation, etc.), as described in U.S. Patent No.10,450,568. Motor Neuron Diseases

[0290] Motor neuron diseases are a group of diseases characterized by loss of function of motor neurons that coordinate voluntary movement of muscles by the brain. Motor neuron diseases may affect upper and / or lower motor neurons, and may have sporadic or familial origins. Motor neuron diseases include amyotrophic lateral sclerosis (ALS or Lou Gehrig’s disease), progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, post-polio syndrome, and ALS with frontotemporal dementia.

[0291] Symptoms of motor neuron diseases include muscle decay or weakening, muscle pain, spasms, slurred speech, difficulty swallowing, loss of muscle control, joint pain, stiff limbs, difficulty breathing, drooling, and complete loss of muscle control, including over basic functions such as breathing, swallowing, eating, speaking, and limb movement. These symptoms are also sometimes accompanied by depression, loss of memory, difficulty with planning, language deficits, altered behavior, and difficulty assessing spatial relationships and / or changes in personality.

[0292] Motor neuron diseases can be assessed and diagnosed by a clinician of skill, for example, a neurologist, using various tools and tests. For example, the presence or risk ofdeveloping a motor neuron disease can be assessed or diagnosed using blood and urine tests (for example, tests that assay for the presence of creatinine kinase), magnetic resonance imaging (MRI), electromyography (EMG), nerve conduction study (NCS), spinal tap, lumbar puncture, and / or muscle biopsy. Motor neuron diseases can be diagnosed with the aid of a physical exam and / or a neurological exam to assess motor and sensory skills, nerve function, hearing and speech, vision, coordination and balance, mental status, and changes in mood or behavior. Amyotrophic Lateral Sclerosis

[0293] ALS is a progressive motor neuron disease that disrupts signals to all voluntary muscles. ALS results in atrophy of both upper and lower motor neurons. Symptoms of ALS include weakening and wasting of the bulbar muscles, general and bilateral loss of strength, spasticity, muscle spasms, muscle cramps, fasciculations, slurred speech, and difficulty breathing or loss of ability to breathe. Some individuals with ALS also suffer from cognitive decline. At the molecular level, ALS is characterized by protein and RNA aggregates in the cytoplasm of motor neurons, including aggregates of the RNA-binding protein TDP43.

[0294] ALS is most common in males above 40 years of age, although it can also occur in women and children. Risk of ALS is also heightened in individuals who smoke, are exposed to chemicals such as lead, or who have served in the military. Most instances of ALS are sporadic, while only about 10% of cases are familial. Causes of ALS include sporadic or inherited genetic mutations, high levels of glutamate, protein mishandling. Genetic mutations associated with ALS include mutations in the genes SOD1, C9orf72, TARDBP, FUS, ANG, ATXN2, CHCHD10, CHMP2B, DCTN1, ErbB4, FIG4, HNRPA1, MATR3, NEFH, OPTN, PFN1, PRPH, SETX, SIGMAR1, SMN1, SPG11, SQSTM1, TBK1, TRPM7, TUBA4A, UBQLN2, VAPB, and VCP. Frontotemporal Dementia

[0295] Frontotemporal dementia (FTD) is a form of dementia that affects the frontal and temporal lobes of the brain. FTD includes frontotemporal lobar degeneration (FTLD). It has an earlier average age of onset than Alzheimer’s disease – 40 years of age. Symptoms of FTD include extreme changes in behavior and personality, speech and language problems, and movement-related symptoms such as tremor, rigidity, muscle spasm, weakness, and difficulty swallowing. Subtypes of FTD include behavior variant frontotemporal dementia (bvFTD), characterized by changes in personality and behavior, and primary progressive aphasia (PPA), which affects language skills, speaking, writing and comprehension. FTD is associated with tauprotein accumulation (Pick bodies) and altered TDP43 function. About 30% of cases of FTD are familial, and no other risk factors other than family history of the disease are known. Genetic mutations associated with FTD include mutations in the genes C9orf72, Progranulin (GRN), microtubule-associated protein tau (MAPT), UBQLN2, VPC, CHMP2B, TARDBP, FUS, ITM2B, CHCHD10, SQSTM1, PSEN1, PSEN2, CTSF, CYP27A1, TBK1 and TBP. Amyotrophic lateral sclerosis with frontotemporal dementia

[0296] Amyotrophic lateral sclerosis with frontotemporal dementia (ALS with FTD) is a clinical syndrome in which FTD and ALS occur in the same individual. Interestingly, mutations in C9orf72 are the most common cause of familial forms of ALS and FTD. Additionally, mutations in TBK1, VCP, SQSTM1, UBQLN2 and CHMP2B are also associated with ALS with FTD. Symptoms of ALS with FTD include dramatic changes in personality, as well as muscle weakness, muscle atrophy, fasciculations, spasticity, dysarthria, dysphagia, and degeneration of the spinal cord, motor neurons, and frontal and temporal lobes of the brain. At the molecular level, ALS with FTD is characterized by the accumulation of TDP-43 and / or FUS proteins. TBK1 mutations are associated with ALS, FTD, and ALS with FTD. Limbic-predominant age-related TDP-43 encephalopathy (LATE)

[0297] Limbic-predominant age-related TDP-43 encephalopathy (LATE) is characterized by accumulation of misfolded TDP-43 protein in the brain, specifically in the limbic system. LATE is a neurological disorder that typically manifests in older patients (e.g., greater than 80 years old). LATE can be a diagnosis for dementia and LATE often mimics the symptoms of Alzheimer’s Disease including memory loss, confusion, and mood changes. Methods of Treatment

[0298] The disclosure contemplates, in part, treating neurological diseases including any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), Limbic-predominant age-related TDP-43 encephalopathy (LATE), epilepsy, Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, and synaptic diseases like autism) in a patient in need thereof comprising administering a UNC13A AON. In some embodiments, provided herein are methods for treatment of a neurological disease in a patient in need thereof, comprising administering a disclosed UNC13A AON. In some embodiments of the disclosure, an effective amount of adisclosed UNC13A oligonucleotide may be administered to a patient in need thereof to treat a neurological disease, and / or to increase, restore, or stabilize expression of UNC13A mRNA that is capable of translation to produce a functional UNC13A protein, thereby increase, restore, or stabilize UNC13A activity and / or function.

[0299] In some embodiments, treating a neurological disease comprises at least ameliorating or reducing one symptom associated with the neurological disease (for example, reducing muscle weakness in a patient with ALS). Methods of treating a neurological disease (for example, ALS, FTD, or ALS with FTD) in a patient suffering therefrom are provided, that include administering a disclosed UNC13A AON. In some embodiments, methods of slowing the progression of a neurological disease, for example, a motor neuron disease, are provided.

[0300] Provided herein are methods of treating, reducing the risk of developing, or delaying the onset of a neurological disease in a subject in need thereof comprising administering a disclosed UNC13A AON. The methods include for example, treating a subject at risk of developing a neurological disease; e.g., administering to the subject an effective amount of a disclosed UNC13A AON. Neurological diseases that can be treated in this manner include motor neuron diseases, ALS, FTD, ALS with FTD, progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, and post-polio syndrome.

[0301] Methods of preventing or treating neurological diseases (for example, PD, ALS, FTD, and ALS with FTD) form part of this disclosure. Such methods may comprise administering to a patient in need thereof or a patient at risk, a pharmaceutical preparation comprising a UNC13A AON disclosed herein. For example, a method of preventing or treating a neurological disease is provided comprising administering to a patient in need thereof a UNC13A AON disclosed herein.

[0302] Patients treated using an above method may experience an increase, restoration of, or stabilization of UNC13A mRNA expression, which is capable of translation to produce a functional UNC13A protein, of at least about 5%, 10%, 20%, 30%, 40% or even 50%, thereby increase, restore, or stabilize UNC13A activity and / or function in a target cell (for example, a motor neuron) after administering a UNC13A oligonucleotide e.g. after 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 month, 2 months, 3, months, 4 months, 5, months, or 6 months or more. In some embodiments, administering such a UNC13A oligonucleotide may be on, e.g., at least a daily basis. The UNC13A oligonucleotide may be administered orally. In some embodiments, the UNC13A oligonucleotide is administered intrathecally, intrathalamically, or intracisternally. For example, in an embodiment describedherein, a UNC13A oligonucleotide is administered intrathecally, intrathalamically or intracisternally about every 3 months. The delay or amelioration of clinical manifestation of a neurological disease in a patient as a consequence of administering a UNC13A oligonucleotide disclosed here may be at least e.g., 6 months, 1 year, 18 months or even 2 years or more as compared to a patient who is not administered a UNC13A oligonucleotide, such as one disclosed herein.

[0303] UNC13A oligonucleotides can be used alone or in combination with each other whereby at least two UNC13A oligonucleotides are used together in a single composition or as part of a treatment regimen. UNC13A oligonucleotides may also be used in combination with other drugs or AON for treating neurological diseases or conditions.

[0304] In various embodiments, disclosed herein is a method for treating amyotrophic lateral sclerosis (ALS) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 13 – 1283 or 2571 - 2594, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and / or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2’-O-(2-methoxyethyl) nucleoside, a 2’-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2’-deoxy-2’-fluoro nucleoside, a 2’-fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises a spacer.

[0305] In various embodiments, disclosed herein is a method for treating frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and whereinoligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 13 – 1283 or 2571 - 2594, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and / or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2’-O-(2-methoxyethyl) nucleoside, a 2’-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2’-deoxy-2’-fluoro nucleoside, a 2’-fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises a spacer.

[0306] In various embodiments, disclosed herein is a method for treating amyotrophic lateral sclerosis (ALS) with frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 13 – 1283 or 2571 - 2594, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and / or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2’-O-(2-methoxyethyl) nucleoside, a 2’-O-methyl nucleoside, a 2’-O-(N-methylacetamide)nucleoside, a 2’-deoxy-2’-fluoro nucleoside, a 2’-fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises a spacer. Treatment and Evaluation

[0307] A patient, as described herein, refers to any animal at risk for, suffering from or diagnosed with a neurological disease, including, but not limited to, mammals, primates, and humans. In certain embodiments, the patient may be a non-human mammal such as, for example, a cat, a dog, or a horse. A patient may be an individual diagnosed with a high risk of developing a neurological disease, someone who has been diagnosed with a neurological disease, someone who previously suffered from a neurological disease, or an individual evaluated for symptoms or indications of a neurological disease, for example, any of the signs or symptoms associated with neurological diseases such as: amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, and Limbic-predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, and synaptic diseases like autism.

[0308] “A patient in need,” as used herein, refers to a patient suffering from any of the symptoms or manifestations of a neurological disease, a patient who may suffer from any of the symptoms or manifestations of a neurological disease, or any patient who might benefit from a method of the disclosure for treating a neurological disease. A patient in need may include a patient who is diagnosed with a risk of developing a neurological disease, a patient who has suffered from a neurological disease in the past, or a patient who has previously been treated for a neurological disease.

[0309] “Effective amount,” as used herein, refers to the amount of an agent that is sufficient to at least partially treat a condition when administered to a patient. The therapeutically effective amount will vary depending on the severity of the condition, the route of administration of the component, and the age, weight, etc. of the patient being treated. Accordingly, an effectiveamount of a disclosed UNC13A oligonucleotide is the amount of the UNC13A oligonucleotide necessary to treat a neurological disease in a patient such that administration of the agent prevents a neurological disease from occurring in a subject, prevents neurological disease progression (e.g., prevents the onset or increased severity of symptoms of the neurological such as muscle weakening, spasms, or fasciculation), or relieves or completely ameliorates all associated symptoms of a neurological disease, i.e. causes regression of the disease.

[0310] Efficacy of treatment may be evaluated by means of evaluation of gross symptoms associated with a neurological disease, analysis of tissue histology, biochemical assay, imaging methods such as, for example, magnetic resonance imaging, or other known methods. For instance, efficacy of treatment may be evaluated by analyzing gross symptoms of the disease such as changes in muscle strength and control or other aspects of gross pathology associated with a neurological disease following administration, to a patient suffering from a neurological disease, a disclosed UNC13A oligonucleotide.

[0311] Efficacy of treatment may also be evaluated at the tissue or cellular level, for example, by means of obtaining a tissue biopsy (e.g., a brain, spinal, muscle, motor neuron tissue biopsy, or olfactory neurosphere cell biopsy) and evaluating gross tissue or cell morphology or staining properties. Biochemical assays that examine protein or RNA expression may also be used to evaluate efficacy of treatment. For instance, one may evaluate levels of a protein or gene product indicative of a neurological disease, in dissociated cells or non-dissociated tissue via immunocytochemical, immunohistochemical, Western blotting, or Northern blotting methods, or methods useful for evaluating RNA levels such as quantitative or semi-quantitative polymerase chain (e.g., digital PCR (DigitalPCR, dPCR, or dePCR), qPCR etc.) reaction. One may also evaluate the presence or level of expression of useful biomarkers (e.g., neurofilament light (NEFL), neurofilament heavy (NEFH), TDP-43 or p75 extracellular domain (p75ECD)) found in spinal cord fluid, cerebrospinal fluid, extracellular vesicles (for example, exosome-like cerebrospinal fluid extracellular vesicles (“CSF exosomes”), such as those described in Welton et al., (2017) “Cerebrospinal fluid extracellular vesicle enrichment for protein biomarker discovery in neurological disease; multiple sclerosis” J Extracell Vesicles., 6(1):1-10; and Street et al., (2012) “Identification and proteomic profiling of exosomes in human cerebrospinal fluid” J Transl. Med., 10:5), urine, fecal matter, lymphatic fluid, blood, plasma, or serum to evaluate disease state and efficacy of treatment. One may also evaluate the presence or level of expression of useful biomarkers found in the plasma, neuronal extracellular vesicles / exosomes. Additional measurements of efficacy may include strength duration time constant (SDTC), shortinterval cortical inhibition (SICI), dynamometry, accurate test of limb isometric strength (ATLIS), compound muscle action potential (CMAP), and ALSFRS-R. In certain embodiments, urinary neurotrophin receptor p75 extracellular domain (p75ECD) is a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) predict disease status and survival in C9ORF72-associated amyotrophic lateral sclerosis (c9ALS) patients. CSF pNFH as a prognostic biomarker for clinical trials, which will increase the likelihood of successfully developing a treatment for c9ALS.

[0312] In evaluating efficacy of treatment, suitable controls may be chosen to ensure a valid assessment. For instance, one can compare symptoms evaluated in a patient with a neurological disease following administration of a disclosed UNC13A oligonucleotide to those symptoms in the same patient prior to treatment or at an earlier point in the course of treatment or in another patient not diagnosed with the neurological disease. Alternatively, one may compare the results of biochemical or histological analysis of tissue following administration of a disclosed UNC13A oligonucleotide with those of tissue from the same patient or from an individual not diagnosed with the neurological disease or from the same patient prior to administration of the UNC13A oligonucleotide. Additionally, one may compare blood, plasma, serum, cell, urine, lymphatic fluid, spinal cord fluid, cerebrospinal fluid, or fecal samples following administration of the UNC13A oligonucleotide with comparable samples from an individual not diagnosed with the neurological disease or from the same patient prior to administration of the UNC13A oligonucleotide. In some embodiments one may compare extracellular vesicles (for example CSF exosomes), following administration of the UNC13A oligonucleotide with extracellular vesicles from an individual not diagnosed with the neurological disease or from the same patient prior to administration of the UNC13A oligonucleotide.

[0313] Validation of UNC13A oligonucleotides may be determined by direct or indirect assessment of UNC13A expression levels or activity. For instance, biochemical assays that measure UNC13A protein or RNA expression may be used to evaluate overall effect on UNC13A transcripts (for example, a UNC13A pre-mRNA) comprising a sequence that shares at least 85% identity to any one of SEQ ID NOs: 13 – 1283 or 2571 - 2594. For instance, one may measure UNC13A protein levels in cells or tissue by Western blot to evaluate overall UNC13A levels. One may also measure UNC13A mRNA levels by means of Northern blot or quantitative polymerase chain reaction to determine overall effect on UNC13A transcripts (for example, a UNC13A pre-mRNA) comprising a sequence that shares at least 85% (e.g., 85%, 86%, 87%,88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 13 – 1283 or 2571 - 2594. One may also evaluate UNC13A protein levels or levels of another protein indicative of UNC13A signaling activity in dissociated cells, non- dissociated tissue, extracellular vesicles (for example, CSF exosomes), blood, serum, or fecal matter via immunocytochemical or immunohistochemical methods.

[0314] Modulation of expression levels of UNC13A transcripts (for example, a UNC13A pre- mRNA) comprising a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 13 – 1283 or 2571 – 2594 may also be evaluated indirectly by measuring parameters such as autophagy, endocytosis, protein aggregation, and the presence or level of expression of useful biomarkers (e.g., neurofilament light (NEFL), neurofilament heavy (NEFH), TDP-43, or p75ECDfound in plasma, spinal cord fluid, cerebrospinal fluid, extracellular vesicles (for example, CSF exosomes), blood, urine, lymphatic fluid, fecal matter, or tissue to evaluate the modulation of expression of UNC13A transcripts (for example, a UNC13A pre-mRNA) comprising a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 13 – 1283 or 2571 – 2594. Modulation of expression levels of UNC13A transcripts (for example, a UNC13A pre-mRNA) comprising a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 13 – 1283 or 2571 – 2594 may also be evaluated indirectly by measuring parameters such as autophagy, endocytosis, protein aggregation, and the presence or level of expression of physiological biomarkers such as compound muscle action potential (CMAP). Additional measurements may include strength duration time constant (SDTC), short interval cortical inhibition (SICI), dynamometry, accurate test of limb isometric strength (ATLIS), compound muscle action potential, and ALSFRS-R. In certain embodiments, urinary neurotrophin receptor p75 extracellular domain (p75ECD) is a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) predict disease status and survival in c9ALS patients. CSF pNFH as a prognostic biomarker for clinical trials, which will increase the likelihood of successfully developing a treatment for c9ALS.

[0315] The disclosure also provides methods of restoring expression of full length UNC13A transcripts in cells of a patient suffering from a neurological disease. Full length UNC13A transcripts may be restored in any cell in which UNC13A expression or activity occurs, includingcells of the nervous system (including the central nervous system (e.g., spinal cord or brain), the peripheral nervous system, motor neurons, glial cells, astrocytes, oligodendrocytes, microglia, the brain, the brain stem, the frontal lobes, the temporal lobes, the spinal cord), the musculoskeletal system, spinal fluid, and cerebrospinal fluid. Cells of the musculoskeletal system include skeletal muscle cells (e.g., myocytes). Motor neurons include upper motor neurons and lower motor neurons. Pharmaceutical Compositions and Routes of Administration

[0316] The present disclosure also provides methods for treating a neurological disease via administration of a pharmaceutical composition comprising a disclosed UNC13A oligonucleotide. In another aspect, the disclosure provides a pharmaceutical composition for use in treating a neurological disease. The pharmaceutical composition may be comprised of a disclosed UNC13A oligonucleotide, and a pharmaceutically acceptable carrier. As used herein the term “pharmaceutical composition” means, for example, a mixture containing a specified amount of a therapeutic compound, e.g., a therapeutically effective amount, of a therapeutic compound in a pharmaceutically acceptable carrier to be administered to a mammal, e.g., a human, in order to treat a neurological disease. In some embodiments, described herein are pharmaceutical compositions comprising a disclosed UNC13A oligonucleotide, and a pharmaceutically acceptable carrier. In another aspect, the disclosure provides use of a disclosed UNC13A oligonucleotide in the manufacture of a medicament for treating a neurological disease. “Medicament,” as used herein, has essentially the same meaning as the term “pharmaceutical composition.”

[0317] As used herein, “pharmaceutically acceptable carrier” means buffers, carriers, and excipients suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. The carrier(s) should be “acceptable” in the sense of being compatible with the other ingredients of the formulations and not deleterious to the recipient. Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is known in the art. In one embodiment the pharmaceutical composition is administered orally and includes an enteric coating suitable for regulating the site of absorption of the encapsulated substances within the digestive system or gut. For example, an enteric coating can include an ethylacrylate-methacrylic acid copolymer.

[0318] In one embodiment, a disclosed UNC13A oligonucleotide and any pharmaceutical composition thereof may be administered by one or several routes, including topically, intrathecally, intrathalamically, intracisternally, intracerebroventricularly, parenterally, orally, rectally, buccally, sublingually, vaginally, pulmonarily, intratracheally, intranasally, transdermally, or intraduodenally. The term parenteral as used herein includes subcutaneous injections, intrapancreatic administration, intravenous, intracisternal, intracerebroventricular, intrathecal, intrathalamic, intramuscular, intraperitoneal, intrasternal injection or infusion techniques. For example, a disclosed UNC13A oligonucleotide may be administered subcutaneously to a subject. In another example, a disclosed UNC13A oligonucleotide may be administered orally to a subject. In another example, a disclosed UNC13A oligonucleotide may be administered directly to the nervous system, or specific regions or cells of the nervous system (e.g., the brain, brain stem, lower motor neurons, spinal cord, upper motor neurons) via parenteral administration, for example, a disclosed UNC13A oligonucleotide may be administered intrathecally, intrathalamically intracisternally, or intracerebroventricularly.

[0319] In various embodiments, a UNC13A oligonucleotide, for example a UNC13A AON, can be exposed to calcium-containing buffers prior to administration. Such calcium-containing buffers can mitigate toxicity adverse effects of the UNC13A oligonucleotide. Further details of exposing an example antisense oligonucleotide to calcium-containing buffers is described in Moazami, et al., Quantifying and Mitigating Motor Phenotypes Induced by Antisense Oligonucleotides in the Central Nervous System, bioRxiv 2021.02.14.431096, which is hereby incorporated by reference in its entirety.

[0320] In some embodiments, a UNC13A oligonucleotide, for example a UNC13A AON, can be encapsulated in a nanoparticle coating. It is believed that nanoparticle encapsulation prevents AON degradation and enhances cellular uptake. For example, in some embodiments a UNC13A oligonucleotide is encapsulated in a coating of a cationic polymer, for example, a synthetic polymer (e.g., poly-L-lysine, polyamidoamine, a poly(β-amino ester), and polyethyleneimine) or a naturally occurring polymer (e.g., chitosan and a protamine). In some embodiments, a UNC13A oligonucleotide is encapsulated in a lipid or lipid-like material, for example, a cationic lipid, a cationic lipid-like material, or an ionizable lipid that is positively charged only at an acidic pH. An example of a lipid nanoparticle nucleotide therapy includes Exicure’s XCUR- FXN, a lipid-nanoparticle spherical nucleic acid (SNA)-based therapeutic candidate. For example, in some embodiments, a UNC13A oligonucleotide is encapsulated in a lipidnanoparticle that includes hydrophobic moieties, e.g., cholesterol and / or a polyethylene glycol (PEG) lipid.

[0321] In various embodiments, a pharmaceutical composition comprising a disclosed UNC13A oligonucleotide may further comprise a bolaamphiphilic compound. Example bolaamphiphilic compounds are described in WO2014039493A1, WO2014039500A1, WO2014039502A1, WO2014039503A1, and WO2014039504A1, each of which is hereby incorporated by reference in its entirety. In particular embodiments, a bolaamphiphilic compound is a compound according to formula I: HG2L1HG1, or a pharmaceutically acceptable salt, solvate, hydrate, prodrug, stereoisomer, tautomer, isotopic variant, or N-oxide thereof, or a combination thereof; wherein: each HG1and HG2is independently a hydrophilic head group; and L1is alkylene, alkenyl, heteroalkylene, or heteroalkenyl linker; unsubstituted or substituted with C1-C20 alkyl, hydroxyl, or oxo.

[0322] In one embodiment, with respect to the bolaamphiphilic compound of formula I, the bolaamphiphilic compound is a compound according to formula II, III, IV, V, or VI:

[0323] or a pharmaceutically acceptable salt, solvate, hydrate, prodrug, stereoisomer, tautomer, isotopic variant, or N-oxide thereof, or a combination thereof; wherein: each HG1and HG2is independently a hydrophilic head group; each Z1and Z2is independently -C(R3)2-, -N(R3)- or -0-; each Rla, Rlb, R3, and R4is independently H or Ci-C8alkyl; each R2aand R2bis independently H , Ci-C8 alkyl, OH, alkoxy, or O-HG1or O-HG2; each n8, n9, n11, and n12 is independently an integer from 1-20; n10 is an integer from 2-20; and each dotted bond is independently a single or a double bond.

[0324] In one embodiment, with respect to the bolaamphiphilic compound of formula I, II, III, IV, V, or VI, each HG1and HG2is independently selected from:

[0325] wherein: X is -NR5aR5b, or -N+R5aR5bR5c; each R5a, and R5bis independently H or substituted or unsubstituted C1-C20 alkyl or R5aand R5bmay join together to form an N containing substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocyclyl; each R5cis independently substituted or unsubstituted C1-C20 alkyl; each R8is independently H, substituted or unsubstituted C1-C20alkyl, alkoxy, or carboxy; ml is 0 or 1; and each n13, n14, and n15 is independently an integer from 1-20.

[0326] In various embodiments, pharmaceutical compositions disclosed herein comprise complexes between bolaamphiphiles and pharmacologically or biologically active compounds (e.g., an UNC13A oligonucleotide disclosed herein). In various embodiments, the pharmaceutical compositions disclosed herein comprise a bolaamphiphile vesicle complexes comprising one or more bolaamphiphilic compounds and the biologically active compound is an oligonucleotide (e.g., an UNC13A oligonucleotide disclosed herein).

[0327] Pharmaceutical compositions containing a disclosed UNC13A oligonucleotide, such as those disclosed herein, can be presented in a dosage unit form and can be prepared by any suitable method. A pharmaceutical composition should be formulated to be compatible with its intended route of administration. Useful formulations can be prepared by methods well known in the pharmaceutical art. For example, see Remington’s Pharmaceutical Sciences, 18thed. (Mack Publishing Company, 1990).

[0328] Pharmaceutical formulations, in some embodiments, are sterile. Sterilization can be accomplished, for example, by filtration through sterile filtration membranes. Where the composition is lyophilized, filter sterilization can be conducted prior to or following lyophilization and reconstitution. Parenteral Administration

[0329] The pharmaceutical compositions of the disclosure can be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intracisternal, intracerebroventricular, intramuscular, subcutaneous, intrathecal, intrathalamic, intralesional, or intraperitoneal routes. The preparation of an aqueous composition, such as an aqueous pharmaceutical composition containing a disclosed UNC13A oligonucleotide, will be known to those of skill in the art in light of the present disclosure. Typically, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified.

[0330] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including normal saline, artificial cerebrospinal fluid, sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

[0331] Solutions of active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables. The sterile injectable preparation may also be a sterile injectable solution, suspension, or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer’s solution, U.S.P., and isotonic sodium chloride solution. In one embodiment, a disclosed UNC13A antisense oligonucleotide may be suspended in a carrier fluid comprising 1% (w / v) sodium carboxymethylcellulose and 0.1% (v / v) TWEEN™ 80. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0332] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium andthe required other ingredients from those enumerated above. Sterile injectable solutions of the disclosure may be prepared by incorporating a disclosed UNC13A antisense oligonucleotide in the required amount of the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum- drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter.

[0333] The preparation of more, or highly concentrated solutions for intramuscular injection is also contemplated. In this regard, the use of DMSO as solvent is preferred as this will result in extremely rapid penetration, delivering high concentrations of the disclosed oligonucleotide to a small area.

[0334] Suitable preservatives for use in such a solution include benzalkonium chloride, benzethonium chloride, chlorobutanol, thimerosal and the like. Suitable buffers include boric acid, sodium and potassium bicarbonate, sodium and potassium borates, sodium and potassium carbonate, sodium acetate, sodium biphosphate and the like, in amounts sufficient to maintain the pH at between about pH 6 and pH 8, and for example, between about pH 7 and pH 7.5. Suitable tonicity agents are dextran 40, dextran 70, dextrose, glycerin, potassium chloride, propylene glycol, sodium chloride, and the like, such that the sodium chloride equivalent of the solution is in the range 0.9 plus or minus 0.2%. Suitable antioxidants and stabilizers include sodium bisulfite, sodium metabisulfite, sodium thiosulfite, thiourea and the like. Suitable wetting and clarifying agents include polysorbate 80, polysorbate 20, poloxamer 282 and tyloxapol. Suitable viscosity-increasing agents include dextran 40, dextran 70, gelatin, glycerin, hydroxyethylcellulose, hydroxymethylpropylcellulose, lanolin, methylcellulose , petrolatum, polyethylene glycol, polyvinyl alcohol, polyvinylpyrrolidone, carboxymethylcellulose and the like. Oral Administration

[0335] In some embodiments, contemplated herein are compositions suitable for oral delivery of a disclosed UNC13A oligonucleotide, e.g., tablets that include an enteric coating, e.g., a gastro- resistant coating, such that the compositions may deliver a UNC13A oligonucleotide to, e.g., the gastrointestinal tract of a patient.

[0336] For example, a tablet for oral administration is provided that comprises granules (e.g., is at least partially formed from granules) that include a disclosed UNC13A oligonucleotide, e.g., aUNC13A oligonucleotide represented by any SEQ ID NOs: 13 – 1283 or 2571 – 2594 that targets a UNC13A transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1284 - 2554, and pharmaceutically acceptable excipients. Such a tablet may be coated with an enteric coating. Contemplated tablets may include pharmaceutically acceptable excipients such as fillers, binders, disintegrants, and / or lubricants, as well as coloring agents, release agents, coating agents, sweetening, flavoring such as wintergreen, orange, xylitol, sorbitol, fructose, and maltodextrin, and perfuming agents, preservatives and / or antioxidants.

[0337] In some embodiments, contemplated pharmaceutical formulations include an intra- granular phase that includes a disclosed UNC13A oligonucleotide, e.g., a UNC13A oligonucleotide represented by any of SEQ ID NOs: 13 – 1283 or 2571 – 2594 that targets a UNC13A transcript comprising a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1284-2554, and a pharmaceutically acceptable salt. In some embodiments, contemplated pharmaceutical formulations include an intra-granular phase that includes a disclosed UNC13A oligonucleotide, e.g., a UNC13A oligonucleotide represented by any of SEQ ID NOs: 13 – 1283 or 2571 – 2594 that targets a UNC13A transcript comprising a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1284-2554, and a pharmaceutically acceptable filler. For example, a disclosed UNC13A oligonucleotide and a filler may be blended together, optionally, with other excipients, and formed into granules. In some embodiments, the intragranular phase may be formed using wet granulation, e.g., a liquid (e.g., water) is added to the blended UNC13A oligonucleotide and filler, and then the combination is dried, milled and / or sieved to produce granules. One of skill in the art would understand that other processes may be used to achieve an intragranular phase.

[0338] In some embodiments, contemplated formulations include an extra-granular phase, which may include one or more pharmaceutically acceptable excipients, and which may be blended with the intragranular phase to form a disclosed formulation.

[0339] A disclosed formulation may include an intragranular phase that includes a filler. Exemplary fillers include, but are not limited to, cellulose, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol, sorbitol, microcrystalline cellulose, pectin, polyacrylates, dextrose, cellulose acetate, hydroxypropylmethyl cellulose, partially pre-gelatinized starch, calcium carbonate, and others including combinations thereof.

[0340] In some embodiments, a disclosed formulation may include an intragranular phase and / or an extragranular phase that includes a binder, which may generally function to hold the ingredients of the pharmaceutical formulation together. Exemplary binders of the disclosure may include, but are not limited to, the following: starches, sugars, cellulose or modified cellulose such as hydroxypropyl cellulose, lactose, pre-gelatinized maize starch, polyvinyl pyrrolidone, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, low substituted hydroxypropyl cellulose, sodium carboxymethyl cellulose, methyl cellulose, ethyl cellulose, sugar alcohols and others including combinations thereof.

[0341] Contemplated formulations, e.g., that include an intragranular phase and / or an extragranular phase, may include a disintegrant such as but not limited to, starch, cellulose, crosslinked polyvinyl pyrrolidone, sodium starch glycolate, sodium carboxymethyl cellulose, alginates, corn starch, crosmellose sodium, crosslinked carboxymethyl cellulose, low substituted hydroxypropyl cellulose, acacia, and others including combinations thereof. For example, an intragranular phase and / or an extragranular phase may include a disintegrant.

[0342] In some embodiments, a contemplated formulation includes an intra-granular phase comprising a disclosed UNC13A oligonucleotide and excipients chosen from: mannitol, microcrystalline cellulose, hydroxypropylmethyl cellulose, and sodium starch glycolate or combinations thereof, and an extra-granular phase comprising one or more of: microcrystalline cellulose, sodium starch glycolate, and magnesium stearate or mixtures thereof.

[0343] In some embodiments, a contemplated formulation may include a lubricant, e.g. an extra-granular phase may contain a lubricant. Lubricants include but are not limited to talc, silica, fats, stearin, magnesium stearate, calcium phosphate, silicone dioxide, calcium silicate, calcium phosphate, colloidal silicon dioxide, metallic stearates, hydrogenated vegetable oil, corn starch, sodium benzoate, polyethylene glycols, sodium acetate, calcium stearate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate, talc, and stearic acid.

[0344] In some embodiments, the pharmaceutical formulation comprises an enteric coating. Generally, enteric coatings create a barrier for the oral medication that controls the location at which the drug is absorbed along the digestive track. Enteric coatings may include a polymer that disintegrates at different rates according to pH. Enteric coatings may include for example, cellulose acetate phthalate, methyl acrylate-methacrylic acid copolymers, cellulose acetate succinate, hydroxylpropylmethyl cellulose phthalate, methyl methacrylate-methacrylic acid copolymers, ethylacrylate-methacrylic acid copolymers, methacrylic acid copolymer type C, polyvinyl acetate-phthalate, and cellulose acetate phthalate.

[0345] Exemplary enteric coatings include Opadry®AMB, Acryl-EZE®, Eudragit®grades. In some embodiments, an enteric coating may comprise about 5% to about 10%, about 5% to about 20%, 8% to about 15%, about 8% to about 20%, about 10% to about 20%, or about 12% to about 20%, or about 18% of a contemplated tablet by weight. For example, enteric coatings may include an ethylacrylate-methacrylic acid copolymer.

[0346] For example, in a contemplated embodiment, a tablet is provided that comprises or consists essentially of about 0.5% to about 70%, e.g., about 0.5% to about 10%, or about 1% to about 20%, by weight of a disclosed UNC13A oligonucleotide or a pharmaceutically acceptable salt thereof. Such a tablet may include for example, about 0.5% to about 60% by weight of mannitol, e.g., about 30% to about 50% by weight mannitol, e.g., about 40% by weight mannitol; and / or about 20% to about 40% by weight of microcrystalline cellulose, or about 10% to about 30% by weight of microcrystalline cellulose. For example, a disclosed tablet may comprise an intragranular phase that includes about 30% to about 60%, e.g. about 45% to about 65% by weight, or alternatively, about 5 to about 10% by weight of a disclosed UNC13A oligonucleotide, about 30% to about 50%, or alternatively, about 5% to about 15% by weight mannitol, about 5% to about 15% microcrystalline cellulose, about 0% to about 4%, or about 1% to about 7% hydroxypropylmethylcellulose, and about 0% to about 4%, e.g., about 2% to about 4% sodium starch glycolate by weight.

[0347] In another contemplated embodiment, a pharmaceutical tablet formulation for oral administration of a disclosed UNC13A oligonucleotide comprises an intra-granular phase, wherein the intra-granular phase includes a disclosed UNC13A AON or a pharmaceutically acceptable salt thereof (such as a sodium salt), and a pharmaceutically acceptable filler, and which may also include an extra-granular phase, that may include a pharmaceutically acceptable excipient such as a disintegrant. The extra-granular phase may include components chosen from microcrystalline cellulose, magnesium stearate, and mixtures thereof. The pharmaceutical composition may also include an enteric coating of about 12% to 20% by weight of the tablet. For example, a pharmaceutically acceptable tablet for oral use may comprise about 0.5% to 10% by weight of a disclosed UNC13A AON, e.g., a disclosed UNC13A AON or a pharmaceutically acceptable salt thereof, about 30% to 50% by weight mannitol, about 10% to 30% by weight microcrystalline cellulose, and an enteric coating comprising an ethylacrylate-methacrylic acid copolymer.

[0348] In another example, a pharmaceutically acceptable tablet for oral use may comprise an intra-granular phase, comprising about 5 to about 10% by weight of a disclosed UNC13A AON,e.g., a disclosed UNC13A AON or a pharmaceutically acceptable salt thereof, about 40% by weight mannitol, about 8% by weight microcrystalline cellulose, about 5% by weight hydroxypropylmethyl cellulose, and about 2% by weight sodium starch glycolate; an extra- granular phase comprising about 17% by weight microcrystalline cellulose, about 2% by weight sodium starch glycolate, about 0.4% by weight magnesium stearate; and an enteric coating over the tablet comprising an ethylacrylate-methacrylic acid copolymer.

[0349] In some embodiments the pharmaceutical composition may contain an enteric coating comprising about 13% or about 15%, 16%, 17% or 18% by weight, e.g., AcyrlEZE® (see, e.g., PCT Publication No. WO 2010 / 054826, which is hereby incorporated by reference in its entirety).

[0350] The rate at which the coating dissolves and the active ingredient is released is its dissolution rate. In an embodiment, a contemplated tablet may have a dissolution profile, e.g., when tested in a USP / EP Type 2 apparatus (paddle) at 100 rpm and 37 °C in a phosphate buffer with a pH of 7.2, of about 50% to about 100% of the UNC13A oligonucleotide releasing after about 120 minutes to about 240 minutes, for example after 180 minutes. In another embodiment, a contemplated tablet may have a dissolution profile, e.g., when tested in a USP / EP Type 2 apparatus (paddle) at 100 rpm and 37 °C in diluted HCl with a pH of 1.0, where substantially none of the UNC13A oligonucleotide is released after 120 minutes. A contemplated tablet, in another embodiment, may have a dissolution profile, e.g., when tested in USP / EP Type 2 apparatus (paddle) at 100 rpm and 37 °C in a phosphate buffer with a pH of 6.6, of about 10% to about 30%, or not more than about 50% of the UNC13A oligonucleotide releasing after 30 minutes.

[0351] In some embodiments, methods provided herein may further include administering at least one other agent that is directed to treatment of diseases and disorders disclosed herein. In one embodiment, contemplated other agents may be co-administered (e.g., sequentially or simultaneously). Dosage and Frequency of Administration

[0352] The dosage or amounts described below refer either to the oligonucleotide or a pharmaceutically acceptable salt thereof.

[0353] In some embodiments, methods described herein include administering at least 1 µg, at least 5 µg, at least 10 µg, at least 20 µg, at least 30 µg, at least 40 µg, at least 50 µg, at least 60 µg, at least 70 µg, at least 80 µg, at least 90 µg, or at least 100 µg of a UNC13A antisense oligonucleotide e.g., a UNC13A oligonucleotide. In some embodiments, methods includeadministering from 10 mg to 500 mg, from 1 mg to 10 mg, from 10 mg to 20 mg, from 20 mg to 30 mg, from 30 mg to 40 mg, from 40 mg to 50 mg, from 50 mg to 60 mg, from 60 mg to 70 mg, from 70 mg to 80 mg, from 80 mg to 90 mg, from 90 mg to 100 mg, from 100 mg to 150 mg, from 150 mg to 200 mg, from 200 mg to 250 mg, from 250 mg to 300 mg, from 300 mg to 350 mg, from 350 mg to 400 mg, from 400 mg to 450 mg, from 450 mg to 500 mg, from 500 mg to 600 mg, from 600 mg to 700 mg, from 700 mg to 800 mg, from 800 mg to 900 mg, from 900 mg to 1 g, from 1 mg to 50 mg, from 20 mg to 40 mg, or from 1 mg to 500 mg of a UNC13A antisense oligonucleotide.

[0354] In some embodiments, methods described herein include administering formulations that include about 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1 g, 1.5 g, 2.0 g, 2.5 g, 3.0 g, 3.5 g, 4.0 g, 4.5 g, or 5.0 g of a disclosed UNC13A oligonucleotide. In some embodiments, a formulation may include about 40 mg, 80 mg, or 160 mg of a disclosed UNC13A oligonucleotide. In some embodiments, a formulation may include at least 100 µg of a disclosed UNC13A oligonucleotide. For example, formulations may include about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, or 30 mg of a disclosed UNC13A oligonucleotide. The amount administered will depend on variables such as the type and extent of disease or indication to be treated, the overall health and size of the patient, the in vivo potency of the UNC13A oligonucleotide, the pharmaceutical formulation, and the route of administration. The initial dosage can be increased beyond the upper level in order to rapidly achieve the desired blood-level or tissue level. Alternatively, the initial dosage can be smaller than the optimum, and the dosage may be progressively increased during the course of treatment. Human dosage can be optimized, e.g., in a conventional Phase I dose escalation study. Dosing frequency can vary, depending on factors such as route of administration, dosage amount and the disease being treated. Exemplary dosing frequencies are once per day, once per week and once every two weeks. In some embodiments, dosing is once per day for 7 days. In some embodiments, dosing is once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, or once every 12 weeks. In some embodiments, dosing is once a month to every three months. In some embodiments, dosing is once every 2 weeks for three dose, then monthly, bimonthly, or every three or four months.Combination Therapies

[0355] In various embodiments, a UNC13A AON as disclosed herein can be administered in combination with one or more additional therapies. The combination therapy of the disclosed oligonucleotide and the one or more additional therapies can, in some embodiments, be synergistic in treating any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Parkinson’s disease, Parkinson’s disease with or without dementia, and Limbic-predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, and synaptic diseases like autism.

[0356] Non-limiting examples of therapies for Parkinson’s disease (PD) include: deep brain stimulation, levodopa and carbidopa (duopa, rytary, Sinemet, inbrija), istradefylline (nourianz), safinamide (xadago), pramipexole (Mirapex), rotigotine (neupro), ropinirole (requip), amantadine (gocovri, Symmetrel, osmolex), benztropine (Cogentin), trihexyphenidyl (artane), selegiline (eldepryl, zelapar), rasagiline, entacapone (comtan), opicapone (ongentys), tolcapone (tasmar), apomorphine (apokyn, kynmobi), exenatide, lingzhi, BIIB054, BIIB094, Caffeine, sarizotan, Nuplazid, and embryonic dopamine cell implantation.

[0357] Non-limiting examples of therapies for Alzheimer’s disease (AD) include aducanamab (Aduhlem), memantine (Namenda), Donepezil (Aricept), Rivastigmine (Exelon), Galantamine (razadyne), Namzeric, Suvorexant (belsomra), and lecanemab.

[0358] A non-limiting example of a therapy for amyotrophic lateral sclerosis (ALS) is pridopidine.

[0359] Non-limiting examples of therapies for frontotemporal dementia (FTD) include olanzapine (Zyprexa), quetiapine (Seroquel), SSRIs (citalopram (Cipramil), dapoxetine (Priligy), escitalopram (Cipralex), fluoxetine (Prozac or Oxactin), fluvoxamine (Faverin), paroxetine (Seroxat), sertraline (Lustral), vortioxetine (Brintellix)), divalproex sodium (Depakote), carbamazepine (Tegretol), and medroxyprogestrone.

[0360] Non-limiting examples of therapies for epilepsy include Brivaracetam (briviact), cannabidiol (epidiolex), carbamazepine (carbatrol, Tegretol), cenobamate (xcopri), diazepam(valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aptiom), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar xr, Trileptal), perampanel (fycompa), phenobarbital, phenytoin (dilantin), pregabalin (lyrica), tiagabine (gabitril), topiramate (topamax), valproate (depakene, depakote), and zonisamide (zonegran).

[0361] Example additional therapies include any of Riluzole (Rilutek), PrimeC, Edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitor, antipsychotic agents, cholinesterase inhibitors, memantine, benzodiazepine antianxiety drugs, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa / carbidopa, dopaminergic agents (e.g., ropinirole, pramipexole, rotigotine), medroxyprosterone, KCNQ2 / KCNQ3 openers (e.g., retigabine, XEN1101, or QRL-101), bioactive scaffolds, anticonvulsants and psychostimulant agents. Additional therapies can further include breathing care, physical therapy, occupational therapy, speech therapy, and nutritional support. Further non-limiting examples of additional therapies include any of deep brain stimulation, levodopa and carbidopa (duopa, rytary, Sinemet, inbrija), istradefylline (nourianz), safinamide (xadago), pramipexole (Mirapex), rotigotine (neupro), ropinirole (requip), amantadine (gocovri, Symmetrel, osmolex), benztropine (Cogentin), trihexyphenidyl (artane), selegiline (eldepryl, zelapar), rasagiline, entacapone (comtan), opicapone (ongentys), tolcapone (tasmar), apomorphine (apokyn, kynmobi), exenatide, lingzhi, BIIB054, BIIB094, Caffeine, sarizotan, embryonic dopamine cell implantation, aducanamab (Aduhlem), memantine (Namenda), Donepezil (Aricept), Rivastigmine (Exelon), Galantamine (razadyne), Namzeric, Suvorexant (belsomra), lecanemab, olanzapine (Zyprexa), quetiapine (Seroquel), SSRIs (citalopram (Cipramil), dapoxetine (Priligy), escitalopram (Cipralex), fluoxetine (Prozac or Oxactin), fluvoxamine (Faverin), paroxetine (Seroxat), sertraline (Lustral), vortioxetine (Brintellix))), divalproex sodium (Depakote), carbamazepine (Tegretol), medroxyprogestrone, Brivaracetam (briviact), cannabidiol (epidiolex), carbamazepine (carbatrol, Tegretol), cenobamate (xcopri), diazepam (valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aptiom), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar xr, Trileptal), perampanel (fycompa), phenobarbital, phenytoin (dilantin), pregabalin (lyrica), tiagabine (gabitril), topiramate (topamax), valproate (depakene, depakote), and zonisamide (zonegran). In various embodiments, an additional therapy can be a second antisense oligonucleotide. As anexample, the second antisense oligonucleotide may target a UNC13A transcript (e.g., UNC13A pre-mRNA, mature UNC13A mRNA) to modulate the expression levels of full length UNC13A protein.

[0362] Non-limiting examples of therapies for spinal cord injury includes bioactive scaffolds, such as bioactive scaffolds with enhanced supramolecular motion. Further details of example bioactive scaffolds as therapies for spinal cord injury is described in Alvarez et al., “Bioactive scaffolds with enhanced supramolecular motion promote recovery from spinal cord injury.” Science, 374, 848-856 (2021), which is hereby incorporated by reference in its entirety.

[0363] In various embodiments, the disclosed oligonucleotide and the one or more additional therapies can be conjugated to one another and provided in a conjugated form. Further description regarding conjugates involving the disclosed oligonucleotide is described below. In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided concurrently. In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided simultaneously. In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided sequentially. Conjugates

[0364] In certain embodiments, provided herein are oligomeric compounds, which comprise an oligonucleotide (e.g., UNC13A oligonucleotide) and optionally one or more conjugate groups and / or terminal groups. Conjugate groups include one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and / or at any internal position. In certain embodiments, conjugate groups are attached to the 2’-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and / or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’-end of oligonucleotides.

[0365] Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.Conjugate Groups

[0366] In certain embodiments, a UNC13A AON is covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In particular embodiments, conjugate groups modify the circulation time (e.g., increase) of the oligonucleotides in the bloodstream such that increased concentrations of the oligonucleotides are delivered to the brain. In particular embodiments, conjugate groups modify the residence time (e.g., increase residence time) of the oligonucleotides in a target organ (e.g., brain) such that increased residence time of the oligonucleotides improves their performance (e.g., efficacy). In particular embodiments, conjugate groups increase the delivery of the oligonucleotide to the brain through the blood brain barrier and / or brain parenchyma (e.g., through receptor mediated transcytosis). In particular embodiments, conjugate groups enable the oligonucleotide to target a specific organ (e.g., the brain). In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765- 2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac -glycerol or triethyl -ammonium l,2-di-0- hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651- 3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014 / 179620). Conjugate Moieties

[0367] Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, dyes, bile acids, and phenylbutyric acid. In particular embodiments, conjugate moieties are selected from a peptide, a lipid, N- acetylgalactosamine (GalNAc), cholesterol, vitamin E, lipoic acid, panthothenic acid, polyethylene glycol, an antibody (e.g., an antibody for crossing the blood brain barrier such as anti-transferrin receptor antibody), or a cell-penetrating peptide (e.g., transactivator of transcription (TAT) and penetratine).

[0368] In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)- pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethacin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Conjugate Linkers

[0369] Conjugate moieties are attached to a UNC13A AON through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbon chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

[0370] In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

[0371] In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general,a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0372] Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- l-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0373] In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise 3 linker-nucleosides.

[0374] In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N -benzoyl-5 -methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0375] Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.

[0376] In certain embodiments, it is desirable for a conjugate group to be cleaved from the UNC13A AON. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

[0377] In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

[0378] In certain embodiments, a cleavable moiety comprises or consists of one or more linker- nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and / or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2’-deoxy nucleoside that is attached to either the 3’ or 5’- terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2’-deoxy adenosine. Terminal Groups

[0379] In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5’-phosphate. Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but notlimited to 5’-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2’-linked nucleosides. In certain such embodiments, the 2’-linked nucleoside is an abasic nucleoside. In various embodiments, terminal groups comprise one or more spacers. Diagnostic Methods

[0380] The disclosure also provides a method of diagnosing a patient with a neurological disease that relies upon detecting levels of UNC13A expression signal in one or more biological samples of a patient. As used herein, the term “UNC13A expression signal” can refer to any indication of UNC13A gene expression, or gene or gene product activity. UNC13A gene products include RNA (e.g., mRNA), peptides, and proteins. Indices of UNC13A gene expression that can be assessed include, but are not limited to, UNC13A gene or chromatin state, UNC13A gene interaction with cellular components that regulate gene expression, UNC13A gene product expression levels (e.g., expression levels of UNC13A transcripts (for example, a UNC13A pre-mRNA) comprising a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 13-1283 or 2571-2594 , or interaction of UNC13A RNA or protein with transcriptional, translational, or post-translational processing machinery.

[0381] Detection of UNC13A expression signal may be accomplished through in vivo, in vitro, or ex vivo methods. In a preferred embodiment, methods of the disclosure may be carried out in vitro. Methods of detecting may involve detection in blood, serum, fecal matter, tissue, cerebrospinal fluid, spinal fluid, urine, extracellular vesicles (for example, CSF exosomes), or cells of a patient. Detection may be achieved by measuring expression signal of UNC13A transcripts (for example, a UNC13A pre-mRNA) comprising a sequence that shares at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 13-1283 or 2571-2594 in whole tissue, tissue explants, cell cultures, dissociated cells, cell extract, extracellular vesicles (for example, CSF exosomes), or body fluids, including blood, spinal fluid, cerebrospinal fluid, urine, lymphatic fluid, plasma, or serum. Methods of detection include assays that measure levels of UNC13A gene product expression such as Western blotting, FACS, ELISA, other quantitative binding assays, cell or tissue growth assays, Northern blots, quantitative or semi-quantitative polymerasechain reaction, medical imaging methods (e.g., MRI), or immunostaining methods (e.g., immunohistochemistry or immunocytochemistry). Modifications in General

[0382] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.

[0383] Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of a uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “ATmCGAUCG,” whereinmC indicates a cytosine base comprising a methyl group at the 5- position.

[0384] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as α or β such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that contain stereocenters that are drawn or described with undefined stereochemistry included all such possible isomers, including theirstereorandom and optically pure forms, unless specified otherwise. Likewise, all tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

[0385] The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to:2H or3H in place of1H,13C or14C in place of12C,15N in place of14N,17O or18O in place of16O, and33S,34S,35S, or36S in place of32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. EXAMPLES

[0386] The disclosure is further illustrated by the following examples. The examples are provided for illustrative purposes only, and are not to be construed as limiting the scope or content of the disclosure in any way. Example 1: Methods for Evaluating UNC13A Antisense Oligonucleotides

[0387] UNC13A antisense oligonucleotides were evaluated in iPSC derived human motor neurons (hMN). The cells were seeded in 96-well plates at a density of 35,000 cells / well. Antisense oligonucleotide (AON) to TDP43 was transfected with Endoporter (Gene Tools, Philomath, OR, USA) to decrease expression of the full length UNC13A transcript. Vehicle control consisted of motor neuron treatment with Endoporter alone. Positive controls included cells that were treated with TDP43 AON alone (“AON TDP43” or “TDP43 AON”).

[0388] TDP43 AON is a gapmer oligonucleotide and has the following sequence and chemistry: 5’ A*A*G*G*C*T*T*C*A*T*A*T*T*G*T*A*C*T*T*T 3’ (SEQ ID NO: 2595) where * = phosphorothioate, underlined = DNA, other=2’MOE RNA;each “C”is 5-MeC.

[0389] To evaluate UNC13a AON ability to restore full length UNC13A (UNC13A FL) mRNA (also referred to as correctly spliced UNC13A (UNC13A CS) mRNA), antisense oligonucleotides to UNC13A were co-incubated with TDP43 AON in Endoporter in media before addition to the cells. After 72 hours, antisense oligonucleotides and Endoporter were washed out and replaced with fresh media alone. After an additional 12 days, RNA was collected from the 96-well plates for RT-qPCR.RNA was isolated, cDNA generated andmultiplexed RT-qPCR assay performed with Taqman probes for UNC13A full length transcript and reference GAPDH quantification.

[0390] Transcript levels (e.g., UNC13A full length transcript or TDP43 transcript) were detected by RT-qPCR using Taqman. Specifically, RT-qPCR was performed for detecting GAPDH using Thermofisher® TaqMan Gene Expression Assay Hs03929097_g1. RT-qPCR was performed for detecting UNC13A-FL transcripts using Thermofisher® TaqMan Gene Expression Assay Hs01000584_m1.

[0391] RT-qPCR was performed on Applied Biosystems ® 7500 Real-time PCR systems. One cycle of reverse transcription was performed at a temperature of 50℃ for 5 min. One cycle of RT inactivation / initial denaturation was performed at a temperature of 95℃ for 20 seconds. Forty five cycles of amplification were performed at a temperature of 95℃ for 1 second followed by 60℃ for 20 seconds.

[0392] UNC13A-FL (Ct) was normalized to GAPDH (deltaCt). To visualize the quantitative changes (e.g., % decrease of UNC13A-FL), the normalized UNC13A-FL signal was further normalized to the vehicle (treated with Endoporter alone, deltadeltaCt). Relative quantity (RQ) of transcript level was calculated using the equation RQ=2-deltadeltaCtand is used to describe the treatment condition comparison to normal, healthy levels (1.0). RQ values for UNC13A FL were normalized using the following formula: (((RQAON − RQTDP43) / (RQendo−RQTDP43))∗100

[0393] Table 3 shows the RT-qPCR results of UNC13A AONs with two spacers in human motor neurons. UNC13A AONs (e.g., UNC13A oligonucleotides with two spacers) were tested for their ability to increase or restore full-length UNC13A mRNA (i.e., mRNA from which full- length UNC13A protein is translated) levels. In some cases, UNC13A AONs with spacers increased full-length UNC13A mRNA (“UNC13A FL”), also referred to herein as correctly spliced UNC13A (UNC13A CS). In some cases, UNC13A AONs with two spacers increased full-length UNC13A mRNA or correctly spliced UNC13A mRNA (UNC13A CS)). Specific AON sequences are labeled according to their corresponding SEQ ID NO.

[0394] Altogether, these results demonstrate that different UNC13A AONs including two spacers are capable of increasing UNC13A-FL mRNA compared to TDP-43 AON treated alone control group.20 63 92 06 1 5676620 137. .3 5301 4.5 6.8289 87435 38 606820 O-oi8733 4 8 0’2ht5106210030086681o4 hti ro7226. 81955.41296 24..70350 whps231 5.5.3.0seo - -6 6-dishopelera803c573783260 7us330 4 4 9 4 33neg830. 8071133689d4eifak7 5.5 8.1 0.2 5.1 3.3.5idniloe. mdinie s7o er79 5reeh68102 1 9 8 a5481 4 2nlcud945365 4 7890258 7wonres66 3 95 5h etol475 6 60 5 2sncs55.71351 3 62.4 542943 seilid-.4-.0.7.9 0.5ditla soe dl naca)’au,iI n)oC(geaillM u o- me5 s( ro neen FfA sisoCG G G A A A ito ntyreAACCAFC ACA A A A A AafcCColcyap CC CFG G GG GFse htse aGAAFACAA A AFAdmstCC is-5neCFA ACF C CoCG G GT T Telc aseAG G GTTF FTTTT u nhtirpwerFCA AC C CeCC CT T Fht de FCATCGTFFTT T F TT G G Gfoca.A A Ah lepdisAT T TG G GceroGCTCTCTA A Aae, sed ilet”cu n oCn “aeshc to 88 91929394 an 89 0i esi5252525259w 25252re,shFtei otesiys obdelmetnracUagid*usni5Example 2: Methods for Evaluating UNC13A Antisense Oligonucleotides

[0395] UNC13A antisense oligonucleotides were evaluated in iPSC derived human motor neurons (hMN). The cells were seeded in 96-well plates at a density of 35,000 cells / well. Antisense oligonucleotide (AON) to TDP43 was transfected with Endoporter (Gene Tools, Philomath, OR, USA) to decrease expression of the full length UNC13A transcript and increase expression of UNC13A cryptic exon. Vehicle control consisted of motor neuron treatment with Endoporter alone. Positive controls included cells that were treated with TDP43 AON alone (“AON TDP43” or “TDP43 AON”).

[0396] TDP43 AON is a gapmer oligonucleotide and has the following sequence and chemistry: 5’ A*A*G*G*C*T*T*C*A*T*A*T*T*G*T*A*C*T*T*T 3’ (SEQ ID NO: 2595) where * = phosphorothioate, underlined = DNA, other=2’MOE RNA;each “C”is 5- MeC.

[0397] To evaluate UNC13A AON ability to reduce UNC13A cryptic exon levels, antisense oligonucleotides to UNC13A were co-incubated with TDP43 AON in Endoporter in media before addition to the cells. After 72 hours, antisense oligonucleotides and Endoporter were washed out and replaced with fresh media alone. After six additional days, RNA was collected from the 96-well plates for RT-qPCR. RNA was isolated, cDNA generated and multiplexed RT-qPCR assay performed with Taqman probes for UNC13A cryptic exon, and reference GAPDH quantification.

[0398] Transcript levels (e.g., UNC13A cryptic exon, and TDP43 transcript) were detected by RT-qPCR using Taqman. Specifically, RT-qPCR was performed for detecting GAPDH using Thermofisher® TaqMan Gene Expression Assay Hs03929097_g1. UNC13a cryptic exon was detect using custom sequences. UNC13A Cryptic Exon: Forward Primer: ATTGTTCTGCACGTCGGT (SEQ ID NO: 2596) Reverse Primer: GTCTGGGTATGTCTCTTCCAG (SEQ ID NO: 2597) Probe Sequence: AGTTCTTTCCAGGAAACCCAGGCA (SEQ ID NO: 2598)

[0399] RT-qPCR was performed on Applied Biosystems ® 7500 Real-time PCR systems. One cycle of reverse transcription was performed at a temperature of 50℃ for 5 min. One cycle of RT inactivation / initial denaturation was performed at a temperature of 95℃ for 20 seconds. Forty five cycles of amplification were performed at a temperature of 95℃ for 1 second followed by 60℃ for 20 seconds.

[0400] UNC13A-cryptic (Ct) was normalized to GAPDH (deltaCt). To visualize the quantitative changes (e.g., % decrease of UNC13A-cryptic), the normalized UNC13A-cryptic signal was further normalized to the vehicle (treated with Endoporter alone, deltadeltaCt). Relative quantity (RQ) of transcript level was calculated using the equation RQ=2-deltadeltaCtand is used to describe the treatment condition comparison to normal, healthy levels (1.0). RQ values for UNC13A cryptic were normalized using the following formula: (((RQAON − RQendo) / (RQTDP43- RQendo))∗100

[0401] Table 4 shows the RT-qPCR results of UNC13A AONs with spacers in human motor neurons.

[0402] As shown in Table 4, UNC13A AONs (e.g., UNC13A oligonucleotides with two spacers) were tested for their ability to reduce UNC13A transcripts with a cryptic exon. In some cases, UNC13A AONs with spacers reduced UNC13A cryptic exon levels. In some cases, UNC13A AONs without spacers reduced UNC13A cryptic exon levels. Specific AON sequences are labeled according to their corresponding SEQ ID NO.

[0403] As shown in Table 4, a 200 nM dose of SEQ ID NO: 2593 (AGAGFTCTTTCCFGGAAA) reduced UNC13A cryptic exon levels to 8.9%.72 9693136562695. 2915.915 1835153269029..94. . . . 83128547644.6-31. 1s8ogelcak. 2 unil04 6n6 63929ne ie0 089 219 4463 94 0757 13ddirseh3 669068636 6 621 26 03eif649 6i o7 77 48d e dolces78 8.03. .20.7 53.3.15 6. muol5725201 7.55138. 8262 enrrcsaetnidni12 5 1wlls98aa)6 928324792703779o hd’a344430477808949854 sniI(05322 9603001 5 51sea,)al.48 7. 091640 1.3829ditCu 96. 7251. 17. 15. 457401 8.. 841oe elcMmro u - n5(Fo ge filno oisroeceastynclpsesaityhsnte tnACACAA Aafm-eseACG G G A o5rCACAAAAA A AsACCCCA A Ae a peCCCG GG di hti rFGAF FGCCAF FA GGF F sw Aoe.eFACCAA CAA A A CC C lcduecdisCCFA AF C CCCG G GT T TnalpoeFCGTA AG GTFTTTeTht erlcsuATCATF A AFFC C C CCC C F TCTTC fFFoin GT” atA A AT F TG Ghc C“ oG G GTA A ATTTTTA A Aaen , G G GCTCTCTG G G A A AdhcsietaeoFn,syesei it bei dwoet6r ac8788898091929394em hrid52525259 t25252525252oasgnisu sesln)aEreUOca* Mps

Claims

CLAIMS WHAT IS CLAIMED IS:

1. A modified UNC13A oligonucleotide consisting of 18 oligonucleotide units comprising at least one spacer.

2. The oligonucleotide of claim 1, wherein the modified UNC13A oligonucleotide comprises a sequence at least 85% complementary to an equal length portion of any one of SEQ ID NOs: 1-12.

3. The oligonucleotide of any one of claims 1- 2, wherein 16 of the 18 oligonucleotide units are complementary to an equal length portion of any one of SEQ ID NOs: 1-12.

4. The oligonucleotide of any one of claims 1 - 3, wherein the oligonucleotide comprises a segment with at most 7 linked nucleosides.

5. The oligonucleotide of any one of claims 1 - 4, wherein the oligonucleotide comprises a segment with at most 6, 5, 4, 3, or 2 linked nucleosides.

6. The oligonucleotide of any one of claims 1 - 5, wherein every segment of the oligonucleotide comprises at most 7 linked nucleosides.

7. The oligonucleotide of any one of claims 4-6, wherein the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 13 – 1283 or 2571 - 2594.

8. The oligonucleotide of claim 7, wherein the oligonucleotide comprises two spacers.

9. The oligonucleotide of claim 8, wherein the oligonucleotide is 100% identical to any one of SEQ ID NOs: 2571 - 2594.

10. The oligonucleotide of any one of claims 1-9, wherein the spacer is a nucleoside- replacement group comprising a non-sugar substitute that is incapable of linking to a nucleotide base.

11. The oligonucleotide of claim 10, wherein the spacer is located between positions 4 and 15 of the oligonucleotide.

12. The oligonucleotide of claim 10 or 11, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 10 and 15 of the oligonucleotide.

13. The oligonucleotide of claim 12, wherein the spacer and the second spacer are separated by at least 2 nucleobases, at least 3 nucleobases, at least 5 nucleobases at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases in the oligonucleotide.

14. The oligonucleotide of any one of claims 11 - 13, wherein the spacer is located between positions 4 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 10 and 15 of the oligonucleotide.

15. The oligonucleotide of any one of claims 11 -14, wherein the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 11 of the oligonucleotide.

16. The oligonucleotide of any one of claims 11 -14, wherein the spacer is located at position 5 of the oligonucleotide, and wherein the second spacer is located at position 13 of the oligonucleotide.

17. The oligonucleotide of any one of claims 11 -14, wherein the spacer is located at position 6 of the oligonucleotide, and wherein the second spacer is located at position 14 of the oligonucleotide.

18. The oligonucleotide of claim 14, wherein at least one of the two spacers are adjacent to a guanine nucleobase.

19. The oligonucleotide of claim 18, wherein each of the at least one of the two spacers immediately precede a guanine nucleobase.

20. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is a nucleoside-replacement group comprising a non-sugar substitute wherein the non-sugar substitute does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal,aminal or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base.

21. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula (X), wherein:Formula (X) Ring A is an optionally substituted 4-8 member monocyclic cycloalkyl group or a 4-8 member monocyclic heterocyclyl group, wherein the heterocyclyl group contains 1 or 2 heteroatoms selected from O, S and N, provided that A is not capable of forming a covalent bond to a nucleobase; and the symbol represents the point of connection to an internucleoside linkage.

22. The oligonucleotide of claim 21, wherein each of the first or second spacers is independently represented by Formula (Xa), wherein:Formula (Xa).

23. The oligonucleotide of claim 21 or 22, wherein ring A is an optionally substituted 4-8 member monocyclic cycloalkyl group selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; or a 4-8 member monocyclic heterocyclyl group, selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, 164yrrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl.

24. The nucleotide of claim 23, wherein ring A is tetrahydrofuranyl.

25. The nucleotide of claim 23, wherein ring A is tetrahydropyranyl.

26. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula I, wherein:Formula (I) X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.

27. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula I’, wherein:Formula (I’) X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.

28. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula (Ia), wherein:Formula (Ia); and n is 0, 1, 2 or 3.

29. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula (Ia’), wherein:Formula (Ia’); and n is 0, 1, 2 or 3.

30. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula II, wherein:Formula (II); and X is selected from -CH2- and -O-.

31. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula II’, wherein:Formula (II’); and X is selected from -CH2- and -O-.

32. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula (Iia), wherein:Formula (Iia).

33. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula (Iia’), wherein:Formula (Iia’).

34. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula (IIi), wherein:Formula (IIi) X is selected from -CH2- and -O-.

35. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula (IIi’), wherein:Formula (IIi’) X is selected from -CH2- and -O-.

36. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula (IIib), wherein:Formula (IIib).

37. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula (IIib’), wherein:Formula (IIib’).

38. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula III, wherein:Formula (III); and X is selected from -CH2- and -O-.

39. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula III’, wherein:Formula (III’); and X is selected from -CH2- and -O-.

40. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula (IIIa), wherein:Formula (IIIa).

41. The oligonucleotide of any one of claims 10-19, wherein each of the first or second spacers is independently represented by Formula (IIIa’), wherein:Formula (IIIa’).

42. The oligonucleotide of any one of the above claims, wherein the oligonucleotide further comprises a locked nucleic acid (LNA).

43. The oligonucleotide of claim 42, wherein the locked nucleic acid (LNA) is located at one of positions 4, 7, 9, 12, or 13 of the oligonucleotide.

44. The oligonucleotide of any one of the above claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 10%.

45. The oligonucleotide of any one of the above claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 20%.

46. The oligonucleotide of any one of the above claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 25%.

47. The oligonucleotide of any one of the above claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 30%.

48. The oligonucleotide of any one of the above claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 40%.

49. The oligonucleotide of any one of the above claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 50%.

50. The oligonucleotide of any one of the above claims, wherein the oligonucleotide is 18 oligonucleotide units in length.

51. The oligonucleotide of any one of the above claims, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.

52. The oligonucleotide of any one of the above claims, wherein one or more internucleoside linkage of the oligonucleotide is a modified internucleoside linkage.

53. The oligonucleotide of claim 52, wherein the modified internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.

54. The oligonucleotide of claim 52 or 53, wherein all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

55. The oligonucleotide of claim 53, wherein the phosphorothioate linkage is in one of a Rp configuration or a Sp configuration.

56. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises at least one modified sugar moiety.

57. The oligonucleotide of claim 56, wherein the modified sugar moiety is one of a 2'- OMe modified sugar moiety, bicyclic sugar moiety, 2’-O-(2-methoxyethyl) (2’-MOE), 2'- deoxy-2'-fluoro nucleoside, 2’-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2’-4’-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA).

58. The oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length UNC13A protein.

59. The oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 100% increase of full length UNC13A protein.

60. The oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 200% increase of full length UNC13A protein.

61. The oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 300% increase of full length UNC13A protein.

62. The oligonucleotide of any one of claims 58- 61, wherein increase of the full length UNC13A protein is measured in comparison to a reduced level of full length UNC13A protein achieved using a TDP43 antisense oligonucleotide.

63. The oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full length UNC13A protein.

64. The oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 50%, 60%, 70%, 80%, or 90% reduction of a mis-spliced UNC13A transcript.

65. A method of treating a neurological disease and / or a neuropathy in a patient in need thereof, the method comprising administering to the patient an oligonucleotide of any one of claims 1-64.

66. The method of claim 65, wherein the neurological disease selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’sdisease with or without dementia, Limbic-predominant age-related TDP-43 encephalopathy (LATE)), epilepsy, Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, and synaptic diseases like autism.

67. The method of claim 66, wherein the neurological disease is ALS.

68. The method of claim 66, wherein the neurological disease is FTD.

69. The method of claim 66, wherein the neurological disease is ALS with FTD.

70. The method of claim 66, wherein the neurological disease is AD.

71. The method of claim 66, wherein the neurological disease is PD.

72. The method of claim 65, wherein the neuropathy is chemotherapy induced neuropathy.