Thiazolidinones as antiviral agents

EP4731614A1Pending Publication Date: 2026-04-29UNIV DEGLI STUDI DI CAGLIARI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
UNIV DEGLI STUDI DI CAGLIARI
Filing Date
2024-06-26
Publication Date
2026-04-29

AI Technical Summary

Technical Problem

Current therapies for SARS-CoV-2 infections are predominantly symptomatic and lack specific antiviral agents that effectively inhibit viral replication, with existing drugs showing limited efficacy and potential for resistance, highlighting the need for targeted antiviral compounds that can block coronavirus replication through novel mechanisms.

Method used

Development of thiazolidinone-based compounds that specifically inhibit the NSP13 helicase enzyme, a conserved target across coronaviruses, allowing for effective blocking of viral replication and potential use in combination with other antivirals, such as Remdesivir and Nirmatrelvir, to enhance therapeutic outcomes.

Benefits of technology

The thiazolidinone compounds demonstrate significant antiviral activity by inhibiting NSP13, achieving effective viral replication blockade at low concentrations with minimal cytotoxicity, offering a promising therapeutic option for SARS-CoV-2 and potentially other coronavirus infections, including those caused by future variants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000013_0001
    Figure IMGF000013_0001
  • Figure IMGF000013_0002
    Figure IMGF000013_0002
  • Figure IMGF000013_0003
    Figure IMGF000013_0003
Patent Text Reader

Abstract

The application relates to molecules of 4-oxothiazolidin-2-ylidene structure and pharmaceutically acceptable salts thereof, alone or in association with other pharmaceutical components to be used as antiviral agents.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Thiazolidinones as antiviral agents

[0002] Technical field

[0003] The present invention relates to molecules of 4-oxothiazolidin-2-ylidene structure, their derivatives, solvates and salts, as well as pharmaceutically acceptable isomers, alone or in association with other pharmaceutical components to be used as antiviral agents, in particular for the treatment and prevention of viral infections caused by respiratory viruses such as SARS- CoV, SARS-CoV-2, MERS, hCoVs, Rhinovirus, Hepatitis C (HCV) and viruses transmitted by arthropods belonging to the Flavivirus genus, such as e.g. Zika Virus, West Nile Virus, Dengue Virus, Yellow Fever Virus.

[0004] More specifically, the invention refers to molecules capable of blocking viral replication and which are particularly effective on coronaviruses and specifically on the replication of SARS-CoV-2 through the inhibition of the helicase enzyme (NSP13); the invention therefore refers to such molecules for use in the therapeutic treatment or prophylactic treatment of viral infections, preferably coronavirus infections and even more preferably SARS-CoV-2 infections through the inhibition activity of the helicase enzyme.

[0005] The pandemic caused by SARS-CoV-2 and the inadequacy of the current pharmacological therapies available have highlighted the urgency of carrying out drug discovery projects to meet the need for effective therapeutic options.

[0006] SARS-CoV-2 has a (+)ssRNA genome, which encodes 29 different proteins. The 5' end of the genome contains ORFS1 ab and ORFS1 a genes.

[0007] ORFsI ab is the largest gene and encodes a polyprotein called ppl ab, it contains 16 non-structural proteins called NSPs (NSP1 -16). The synthesis of viral genomic RNA occurs by the viral replication and transcription complex (RTC), which mainly includes the proteins NSP7, NSP8, NSP9, NSP12, NSP13 and a short RNA primer. Before the actual replication process occurs, the proteases, MPro (NSP5) and PLPro (NSP3), carry out a series of proteolytic cuts that lead to the formation of the functioning RTC.

[0008] The NSP13 helicase enzyme of SARS CoV2 is a validated and essential target for viral replication. Furthermore, it is highly conserved among coronaviruses of interest to humans. The high conservation of the target means that the molecules described here can also be used for future epidemics and infections caused by coronaviruses of human or animal interest.1

[0009] In this regard, some of the synthesized compounds active on the viral replication of SARS-CoV-2 have proven effective in also blocking the replication of hCoV229E, an alphacoronavirus and SARS-CoV and MERS, both beta coronaviruses and all of human interest. NSP13 catalyses two associated activities: RNA unwinding and 5'-triphosphatase activity (also called NTPase activity). Furthermore, it has recently been reported that NSP13 plays a role in the evasion of the innate immune response.

[0010] The thiazolidinone structure inhibitors according to the invention are able to block the enzyme and can be used in therapy alone or in combination with other antivirals that act with different mechanisms on the virus such as Remdesivir and Nirmatrelvir with an additive effect.

[0011] Known art

[0012] To date, therapy for SARS-CoV-2 is predominantly symptomatic or non- specific.

[0013] In particular, inflammatory events are modulated with: Anakinra, an IL1 R antagonist, Baricitinib, an IL6R antagonist, Sarilumab and Tocilizumab, monoclonal antibodies that act on IL6R, heparins, for the prophylaxis of thromboembolic events and corticosteroids. Currently, only three small molecules specific drugs have been approved on an emergency basis for the treatment of the virus: Remdesivir and Molnupiravir, approved by EMA, which act on viral RNA polymerase, and Paxlovid (Nirmatrelvir-Ritonavir), a combination of two active ingredients, authorized for emergency use by the FDA on 12 / 22 / 2021 . Remdesivir can only be administered in a hospital setting. Molnupiravir was suspended first by EMA (24 / 02 / 2023) and consequently by AIFA (10 / 03 / 2023) due to lack of actual evidence of benefit in its use. Nirmatrelvir, which can be administered orally, is a prodrug that inhibits the viral protease 3CL-Pro, while Ritonavir is used to slow down the metabolism. Furthermore, some monoclonal antibodies have been approved that recognize different epitopes of the spike protein and which can also be used in combination: Sotrovimab, the Bamlanivimab / Etesevimab combination and Casirivimab / lmdevimab. The effectiveness of monoclonal therapy is affected by the appearance of variants containing mutations in the Spike protein, which preclude its recognition. Only Sotrovimab has demonstrated activity on the most widespread variant, Omicron. Other drugs and combinations such as Remdesivir, Azithromycin, Lopinavir / Ritonavir and Darunavir / Cobicistat, initially used in therapy, do not show a clear clinical benefit in terms of reduction in mortality or use of mechanical ventilation and are therefore used only in cases where it is strictly necessary. In the preventive field, the available vaccines are able to considerably reduce the severity and lethality of the disease. However, it is clear that when contracting the disease, it is essential to have adequate and effective pharmacological therapy, consisting of small molecules (traditional drugs or small molecules), which can also be assumed by non-vaccinable patients, possibly orally, and which do not require a cold chain for conservation. These molecules must have a low cost, be able to be easily produced and distributed to the population even in those countries where it is more difficult to guarantee widespread vaccination. Considering these premises, the development of specific drugs capable of treating the disease and capable of inhibiting viral targets other than those for which the drugs currently available for the treatment of COVID-19 have been approved is a priority for the global health system, and which can also be used for infections caused by other coronaviruses, and which show an adequate safety profile.

[0014] Thiazolidinones and hydrothiazoles are known for different activities on anticancer targets12’38, antimicrobial16’18’26’30’31’33’35’37’39’61, nervous system targets19’62also antiviral16’26’54’63’71, but whose ability to block the replication of coronaviruses is not reported.

[0015] In more detail, patent document CN1699355A reports a series of compounds with a trisubstituted thiazolidinone nucleus having inhibitory activity towards 3CL proteases (3CLPro), i.e. the main protease belonging to the proteome expressed by SARS-CoV also identified as MPro. From the examples reported, only inhibitory activity towards the 3CLproenzyme and no activity on viral replication can be seen.

[0016] In the paper Gao, M.; Kang, D.; Liu, N.; Liu, Y. In Silico Discovery of Small-Molecule Inhibitors Targeting SARS-CoV-2 Main Protease. Molecules 2023, 28, 5320. httDs: / / doi.orq / 10.3390 / molecules28145320 (for brevity hereinafter “Gao 2023”), compounds with inhibitory activity towards the main protease (Main Protease Mpro) expressed by the SARS- CoV genome are described. However, as also emerges from Table 2 of the scientific article, the compounds tested at a concentration of 100μM show rather low percentages of inhibition of the enzyme and no data on inhibition of viral replication are described.

[0017] In the prior art paper Guo S, Xie H, Lei Y, Liu B, Zhang L, Xu Y, Zuo Z. Discovery of novel inhibitors against main protease (Mpro) of SARS-CoV-2 via virtual screening and biochemical evaluation. Bioorg Chem. 2021 May;1 10:104767. doi: 10.1016 / j.bioorg.2021 .104767. Epub 2021 Feb 24. PMID: 33667900; PMCID: PMC7903152 (for brevity hereinafter "Guo 2021"), like the previous document, a thiazolidinone scaffold compound (VS14) with inhibitory activity towards Mproof SARS-CoV-2 is reported which shows a low capacity to inhibit the enzyme and for which no actual antiviral data are reported.

[0018] Patent application WO2010 / 039538 instead describes a compound with a thiazolidinone structure only capable of inhibiting the protease of West Nile Virus (WNV), a virus belonging to the Flavivirus family. The reported compound has no activity on WNV viral replication but a percentage of inhibition of the Mproenzyme of 59% is reported.

[0019] Thiazolidinones and hydrothiazoles are also known in the field of herbicides and antifungals. Furthermore, several molecules active on the helicase of SARS-CoV and SARS-CoV-22’9are also known. Several publications are also present in the literature wherein various inhibitory molecules of NSP13 are indicated, many of which are not active on viral replication.1’10’11There are no approved drugs that block viral replication through inhibition of the NSP13 protein. Only recently, on 04 / 26 / 2023, the phase 1 study on EIS-10700 was announced (https: / / www.eisbach.bio / #2a9e), synthesized by the start-up Eisbach Bio.

[0020] Compounds with improved antiviral activity are currently being sought. Having drugs effective on helicase available could allow therapies to be carried out using them alone, as monotherapeutics, or even in combination with other drugs. The use of multiple drugs on different targets of the same virus is already widely used in the treatment of other antiviral therapies such as the cART (combined Anti Retroviral Therapy) approach used for HIV therapy. Combination therapy is effective for effectively suppressing viral load, reducing resistance, reducing drug side effects, preserving (or improving) immune function, and reducing the risk of opportunistic infections and cancers DO 1 :10.3390 / pharmaceuticsl 31 11798.

[0021] Unless specifically excluded in the detailed description that follows, what is described in this chapter is to be considered as an integral part of the detailed description of the invention.

[0022] Summary of the invention

[0023] The invention aims to solve the technical problems highlighted by the prior art.

[0024] It is therefore an aim of the invention to make available compounds with a thiazolidinone structure with antiviral activity, in particular compounds capable of blocking the replication of coronaviruses through the inhibition of the helicase enzyme.

[0025] Another aim of the invention are the methods for the preparation of such compounds, the methods and pharmaceutical formulations for the use of said compounds in animals, in particular in mammals and humans.

[0026] Further objects and advantages will be evident from the detailed description of the invention that follows, furthermore the claims describe preferred variations of the invention, forming an integral part of the present description. Brief description of the Figures

[0027] The aims and advantages of the present invention will be clear from the detailed description that follows and from the attached drawings, provided purely for explanatory and non-limiting purposes, wherein:

[0028] Figure 1. Illustrates a Cladogram obtained by aligning the SARS-CoV-2 helicase sequence with 34 sequences with identities from 100 to 22%. View via Blast Tree View, Mid Point Root. The first clade shows the sequences most similar to the SARS-CoV-2 helicase with similarity percentages ranging from 98.83% to 58.85%, the second includes other sequences with identity percentages between 27% of the Breda virus and 21 .85% of the White bream virus, and finally Arabidopsis thaliana (25.26%);

[0029] Figure 2. Illustrates residues conserved among human-related coronaviruses are highlighted in black. Furthermore, ATP is shown as a stick and Mg2+(ATP site) and Zn2+ions as spheres;

[0030] Figure 3. Illustrates the biological activity of the compound EMAC3i [A] Inhibition of the unwinding function associated with NSP13 of SARS-CoV-2; [B] Inhibition of DNA-independent ATPase function associated with NSP13 of SARS-CoV-2; [C] Lineweaver-Burk plot of ATP competition at combination of increasing concentrations of inhibitor and ATP; [D] Replication inhibition activity of SARS-CoV-2 in infected VERO-E6-GFP cells (light grey), Cytotoxicity of the compound in uninfected VERO-E6-GFP (black);

[0031] Figure 4. Inhibition activity of SARS-CoV-2 replication in Calu3 cells by the compound EMAC3i;

[0032] Figure 5. Illustrates the sensorgram recorded during the SPR experiment relating to the binding between SARS-CoV-2 NSP13 and EMAC3i at different analyte concentrations, in the presence of 5% DMSO;

[0033] Figure 6. Illustrates the SPR analysis. Steady-state signal binding response curve between SARS-CoV-2 NSP13 and EMAC3i at different analyte concentrations;

[0034] Figure 7. Illustrates the single crystal obtained under X-rays of EMAC3i compound: the configuration of the two double bonds is Z for both; Figura 5. Illustra il sensorgramma registrato durante l’esperimento di SPR relativo al legame tra SARS-CoV2 NSP13 e EMAC3i a diverse concentrazioni di analita, in presenza del 5% di DMSO; Figura 6. Illustra l’analisi SPR. Curva di risposta del legame del segnale stazionario tra SARS-CoV2 NSP13 e EMAC3i a diverse concentrazioni di analita; Figura 7. Illustra il cristallo singolo ottenuto ai raggi X del composto EMAC3i: la configurazione dei due doppi legami è per entrambi Z; Figura 8. Illustra l’associazione con Remdesivir (ordinate) a concentrazioni crescenti di EMAC3i (ascisse). Descrizione dettagliata Salvo diversa indicazione, nella presente descrizione vengono utilizzate le seguenti definizioni: Me = metile Et = etile Pr = propile t-Bu = ter-butile Ph = fenile Alchilidene = radicale bivalente derivato da un idrocarburo alifatico saturo per eliminazione di due atomi di idrogeno, come, per es., l’etilidene (CH3−CH=) Alchenilidene = radicale bivalente derivato da un idrocarburo alifatico insaturo come, per es., l’etenilidene (CH2=C=) Alchinilidene = radicale bivalente derivato da un idrocarburo alifatico insaturo come, per es., propinilidene (CHΞCH-CH=) Arilidene = qualsiasi derivato arilico di un gruppo metilenico, per esempio, benzilidene (C6H5-CH=) Nell’ambito della presente invenzione, il termine “circa” come qui usato quando si fa riferimento ad un valore misurabile come una quantità, una the viral replication-transcription complex and helps modifying the pattern; NSP5 or major protease (MPro); NSP6, NSP7 / NSP8, polymerase cofactors, NSP9 involved in RNA binding, NSP10, cofactor of NSP14 and NSP16, NSP12 or RNA-dependent RNA polymerase, NSP13 or helicase, NSP14 or 7 methyltransferase, NSP15 or endoribonuclease, NSP16 or 2'-O- methyltransferase.

[0035] Some of the compounds described here contain one or more centers of asymmetry and can therefore give rise to diastereoisomers and optical isomers. The present invention intends to include such possible diastereoisomers as well as their racemic and resolved, optically active forms.

[0036] The optically active (R) and (S) isomers can be resolved using conventional techniques.

[0037] The compounds described herein contain olefinic double bonds and, unless otherwise specified, are intended to include both geometric E isomers and Z isomers, the two isomeric forms being collectively denoted by the symbol

[0038] The pharmaceutical compositions of the present invention comprise a compound of Formula (I) as the active ingredient or a pharmaceutically acceptable salt thereof and may also contain a pharmaceutically acceptable carrier and optionally other therapeutic ingredients.

[0039] The term "pharmaceutically acceptable salts" refers to salts prepared from non-toxic pharmaceutically acceptable bases including inorganic bases and organic bases.

[0040] Salts derived from inorganic bases include but are not limited to: aluminium, ammonium, calcium, copper, ferric and ferrous iron, lithium, magnesium, manganic and manganous salts, potassium, sodium and zinc.

[0041] Particularly preferred are ammonium, calcium, magnesium, potassium and sodium salts.

[0042] Salts derived from pharmaceutically acceptable non-toxic organic bases include but are not limited to: salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as arginine, betaine, caffeine , choline, N,N'-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine, tripropylamine and tromethamine.

[0043] It will be understood that in the following discussion of treatment methods, references to compounds of General Formula (I) or General Formulas (II) and (III) are intended to also include pharmaceutically acceptable salts or solvates.

[0044] The extent of the prophylactic or therapeutic dose of a compound of Formula (I) and of the general Formulas (II) and (III) will vary based on the severity of the pathological condition to be treated, the route of administration, age, weight and the response of the single patient.

[0045] Any suitable route of administration can be employed to provide an animal, e.g. a mammal, especially a human, with an effective dosage of a compound of the present invention.

[0046] Dosage forms include tablets, lozenges, dispersions, suspensions, solutions, capsules, creams, ointments and aerosols.

[0047] Compositions include but are not limited to compositions suitable for oral, rectal, topical, parenteral (including subcutaneous, intramuscular and intravenous), ocular (ophthalmic), pulmonary (nasal or buccal inhalation) or nasal administration, although the most suitable route in each specific case will depend on the nature and severity of the conditions to be treated and the nature of the active ingredient.

[0048] They may be conveniently presented in unit dosage form and prepared by any of the methods well known in the pharmaceutical field.

[0049] For administration by inhalation, the compounds of the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or nebulizers. The compounds can also be delivered as powders which can be formulated, and the powder composition can be inhaled with the aid of an insufflation powder inhaler device.

[0050] The preferred delivery system for inhalation is a metered dose inhalation (MDI) aerosol, which may be formulated as a suspension or solution of the compound of Formula (I) and General Formulas (II) and (III) in suitable propellants, such as fluorocarbons or hydrocarbons.

[0051] Suitable topical formulations of the compounds of Formula (I) and General Formulas (II) and (III) include but are not limited to transdermal devices, aerosols, creams, ointments, lotions and sprinkling powders.

[0052] In practical use, the compounds of Formula (I) and general Formulas (II) and (III) can be combined as an active ingredient in admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques.

[0053] The vehicle can take a wide variety of forms depending on the preparation form desired for administration, for instance oral or parenteral (including intravenous) and aerosol.

[0054] In the preparation of the compositions for the oral pharmaceutical form, any of the usual pharmaceutical means can be used, such as, for instance, water, glycols, oils, alcohols, flavouring agents, preservatives and colorants in the case of oral liquid preparations, such as, for instance, suspensions, elixirs and solutions; or vehicles such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders and disintegrating agents in the case of solid oral preparations such as, for instance, powders, capsules and tablets, solid oral preparations being preferred over liquid preparations.

[0055] Due to their ease of administration, tablets and capsules represent the most advantageous oral unit dosage form, in which case solid pharmaceutical vehicles are obviously used.

[0056] If desired, the tablets may be coated by standard aqueous or non- aqueous techniques. In addition to the common dosage forms reported above, the compounds of Formula (I) and general Formulas (II) and (III) can also be administered via controlled release media and / or delivery devices.

[0057] DOI: 10.1038 / s41551 -021 -00698-w; DOI: 10.1016 / B978-0-12-818038- 9.00006-5.

[0058] The pharmaceutical compositions of the present invention suitable for oral administration may be presented as discrete units such as capsules, sachets or tablets each containing a predetermined amount of the active ingredient, as a powder or granules or as a solution or suspension in an aqueous liquid, a non-aqueous, an oil-in-water liquid emulsion, or a water-in- oil liquid emulsion.

[0059] Such compositions may be prepared by any of the pharmaceutical methods, but all methods include the step of bringing the active ingredient into association with the vehicle constituting one or more necessary ingredients.

[0060] In general, compositions are prepared by uniformly and intimately mixing the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation.

[0061] For instance, a tablet may be prepared by compression or molding, optionally with one or more pharmaceutically acceptable accessory ingredients.

[0062] Tablets can be prepared by compressing in a suitable machine, the active ingredient into a flowable form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surfactant or dispersing agent.

[0063] In addition to the compounds of Formula (I) and the general Formulas (II) and (III), the pharmaceutical compositions of the present invention can also contain other active ingredients, such as antivirals, in particular the antivirals active on coronaviruses in general and on SARS- CoV2, such as Remdesivir, Molnupirnavir, Nirmaltrevir or others, broad-spectrum inhibitors active on homologous targets, inhibitors of viral proteases and polymerases, and other molecules capable of improving half-life and pharmacokinetic characteristics, as in the case of the Paxlovid combination wherein Ritonavir was inserted, for this purpose. As well as the association with drugs used to alleviate the symptoms of the infection, such as anti-inflammatories, anti-IL.

[0064] ★ ★★★★

[0065] The compounds of this invention are defined in General Formula (I): wherein: indicates a double bond and the configuration of the double bond can be E or Z; indicates a single bond or double bond, the configuration of carbon 5 can be R or S, if the bond is single, E or Z, if double;

[0066] R1 = indolin-2-one-3-ylidene and substituted indolin-2-one-3-ylidene; aryl and substituted aryl; arylidene and substituted arylidene; linear, branched or cyclic alkyl with a number of carbons from 3 to 7, possibly containing heteroatoms; alkylidene, alkenylidene, branched or cyclic with a number of carbons from 3 to 7 possibly containing heteroatoms; alkynylidene;

[0067] R2 = Linear, branched or cyclic alkyl with a number of carbon atoms from 3 to 7, possibly also combined with cycles containing heteroatoms, aryl, substituted aryl, aromatic and condensed heterocycles, arylidene, alkynylidene;

[0068] R3 = Linear, branched or cyclic alkyl with a number of carbons from 3 to 7, aryl, substituted aryl, aromatic and condensed heterocycles, arylidene, alkynylidene.

[0069] The compounds of the present invention can be prepared according to the following general method. indica un legame singolo o doppio legame, la configurazione del carbonio 5 può essere R o S, se il legame è singolo, E o Z, se doppio; da 3 a 7, arile, arile sostituito, eterocicli aromatici e condensati, arilidene, achinilidene. I composti della presente invenzione possono essere preparati secondo il seguente metodo generale. I composti desiderati si possono ottenere seguendo lo schema di reazione multi-step riportato nello Schema 1 e nello Schema 2.

[0070] i bromoacetato di etile, CH3COONa, etanolo, 40-50 °C, 24 h; iii) isatina o aldeide aromatica variamente sostituita, EtOH, morfolina. Il primo step di reazione prevede la sintesi di un derivato tioureidico a partire da un’ammina ed un isotiocianato, entrambi diversamente sostituiti, in etanolo, a temperatura di riflusso, per 24 ore. Il secondo step conduce alla formazione di un tiazolidinone sostituito mediante reazione del derivato tioureidico, sintetizzato nel primo step, con il bromoacetato di etile, in presenza di un catalizzatore basico (acetato di sodio), a temperatura di 30-40°C per circa 24 h. Nel terzo e ultimo step, il tiazolidinone viene condensato con un’isatina o un’aldeide variamente sostituita, attraverso una reazione di Knoevenagel (DOI: 10.1002 / 0471264180.or015.02). Schema 2. Sintesi dei prodotti con legame singolo, e conseguente centro di a I a e s ostituiti, in etanolo, a temperatura di riflusso, per 24 ore. Il secondo step conduce alla formazione di un tiazolidinone sostituito mediante reazione del derivato tioureidico, sintetizzato nel primo step, con l’acido α -bromo-2- arilacetico diversamente sostituito in presenza di DCC, utilizzando il DCM come solvente di reazione. Composti preferiti che rientrano nella Formula generale (I) sono elencati appresso e sono rappresentati dalle Formule generali (II) e (III); nel seguito il numero che precede il simbolo chimico sta ad indicare la posizione di quest’ultimo nella formula generale: In cui: R = 5Cl,5Br, 7Br, 5NO2, 7F, 5F, 5OCH3, 5CH3, H; R4 = H, COCH3 R5= , 4Cl-Ph, 4F-Ph, Et, CicloPr, Cicloesile, Etilmorfolina R6 = SO2NH2, H, COOH, CN, SO2NHCOCH3 R7 = Ariliden R8 = Ph o Ci R9 = Benzen Più precisam EMAC5 SERIES wherein:

[0071] R= H, 5CI, 5Br, 7Br, 5NO2, 7F, 5F, 5OCH3, 5CH3

[0072] EMAC6 SERIES wherein:

[0073] R= H, 5CI, 5Br, 7Br, 5NO2, 7F, 5F, 5OCH3, 5CH3

[0074] EMAC7 SERIES wherein:

[0075] R= H, 5CI, 5Br, 7Br, 5NO2, 7F, 5F, 5OCH3, 5CH3

[0076] EMAC8 SERIES wherein:

[0077] R= H, 5CI, 5Br, 7Br, 5NO2, 7F, 5F, 5OCH3, 5CH3

[0078] EMAC9 SERIES wherein: R= H, 5CI,5Br, 7Br, 5NO2, 7F, 5F, 5OCH3, 5CH3 EMACW and EMAC11 SERIES wherein:

[0079] R = 4Br, 2,4CI, 4tBu, 2-OCH3, 4F, 4OCH3, 3NO2, 3CH3, 3,4,5OCH3, 40H, 4CN, 4CH3, 3,4CI, 2,5CI, 3OCH3, 3,4OCH3, 3,4F, 4NO2, 2CH3, 3OCH3-4OEt,

[0080] 3OCH3-4OH, 30H wherein:

[0081] R = 1 H-(indole-3-yl)methylene, 1 -methyl-(1 H-indol-3-yl)methylene, 5- (quinolin-3-yl)methylene, 5-(naphthalene-2-yl)methylene, 6- methoxy(naphthalene-1 -yl)methylene, 2-methoxy(naphthalene-1 - yl)methylene, 3,8-dimethoxy(naphthalene-2-yl)methylene. EMAC12 SERIES wherein:

[0082] R = 4Br, 2,4CI, 4tBu, 2-OCH3, 4F, 4OCH3, 3NO2, 3CH3, 3,4,5OCH3, 40H, 4CN, 4CH3, 3,4CI, 2,5CI, 3OCH3, 3,4OCH3, 3,4F, 4NO2, 2CH3, 3OCH3-4OEt,

[0083] 3OCH3-4OH, 30H

[0084] EMAC13 wherein:

[0085] R = 1 H-(indole-3-yl)methylene, 1 -methyl-(1 H-indol-3-yl)methylene, 5-

[0086] (quinolin-3-yl)methylene, 5-(naphthalene-2-yl)methylene, 6- methoxy(naphthalene-1 -yl)methylene, 2-methoxy(naphthalene-1 - yl)methylene, 3,8-dimethoxy(naphthalene-2-yl)methylene. EMAC16 and EMAC17 wherein:

[0087] R= 7Br, 5CI, 5NO2

[0088] R’= H, CN wherein:

[0089] R = 5CI, 6CI, 5Br, 7Br, 5NO2, 7F, 5F, 5OCH3, 5CH3, H EMAC20 SERIES wherein:

[0090] R = Alkyl, alkenylidene R' = Phenyl, cyclohexyl

[0091] Particularly preferred compounds falling within the general formula (I) that have been synthesized, purified and characterized are listed below in Table 1 .

[0092] Table 1

[0093]

[0094] With reference to the antiviral activity of the compounds of Formula (I) and those of the general Formulas (II) and (III) and above all of the antiviral activity against SARS- CoV-2, it is important to underline that among the specific targets of this virus emerge non-structural viral proteins (NSPs) with precise enzymatic functions, which are not affected by the high rate of mutation like the spike protein. Among these, the NSP13 protein represents an excellent target as it is involved in the viral replication complex. It has two associated activities: RNA unwinding and a 5'-triphosphatase activity. The sequence of NSP13 is highly conserved both in coronaviruses responsible for infections in animals (bat, other birds, mouse, ox) and in coronaviruses of human interest (Fig. 1 ). From the comparison with the helicase sequence of SARS-CoV-2 with other coronaviruses of human interest we can see how the percentage of identity is greater than 60% and positivity (considering the similar, positive residues, as indicated by BLAST) greater than 75% (Table 2 and Fig.2).

[0095] Furthermore, sequence identity is maintained among all the variants of major interest isolated so far. Therefore, identifying small molecules capable of inhibiting viral replication by targeting the NSP13 protein makes it possible to have highly specific, potentially low-toxic drugs that can be used in the case of infections or possible future epidemics caused by new coronaviruses.

[0096] Unlike what emerged in the prior art, the compounds according to the present invention were not created for the inhibition of virus proteases (e.g., CLProof SARS- CoV) but were optimized for blocking the helicase activity associated with the protein NSP13, and therefore the consequent viral replication.

[0097] The compounds according to the present invention appear to be particularly promising when compared with the compounds of the known art since the latter, as emerges from the literature documents, show rather low or sometimes non-existing inhibition percentages of viral proteases, and for this reason they have not even been tested for viral replication blocking tests. Any expert in the art, due to the limited inhibitory efficacy on said proteases, would discard the aforementioned products a priori.

[0098] See compounds as an example

[0099] AN-655 / 14907067 % inhibition @ 100 μM 13.3% AK-968 / 37129380 % inhibition @ 100 μM 12.5% AG-205 / 36953218 % inhibition @ 100μM -13.8% reported in the “Gao 2023” documents and the compound

[0100] VS14 % inhibition @ 10 μM 1 1 % reported in the "supplementary information" of "Guo 2021".

[0101] Observing the data associated with the compounds exemplified in "Guo 2021" and especially in "Gao 2023", and reported above, it appears clear that not only the enzyme inhibition efficacy as such is reduced (less than 14% or even negative) but that this inhibition was obtained by using fairly high concentrations of the compound, a characteristic that could significantly negatively affect the selectivity, cytotoxicity and dosage of any deriving drug.

[0102] The compounds according to the present invention, however, have not only been shown to exert antiviral activity by inhibiting helicase but have advantageously demonstrated to be more effective than the compounds in the literature in relation to blocking viral replication, leading to results that cannot be predicted from the simple structural similarity with the existing compounds. This effectiveness (some compounds reach EC50 in the low micromolar range) could absolutely not be deduced from the mere structural analogy or from the reduced enzymatic activities of the literature compounds.

[0103] In particular, compound 1 reported by patent document CN1699355A was synthesized and subjected to the SARS-CoV-2 viral replication blocking assay. The compound showed no activity at the maximum concentration used of 30μM (further details are reported in the comparison example in the Examples section). On the contrary, several of the compounds that fall into Formulas (I), (II), (III) have the ability to block viral replication at concentrations <30 pM, as reported in Table 4 and therefore represent a notable advance and are advantageous compared to compound 1 . It is therefore clear that the structural proximity between the compounds according to the present invention and the literature compound is absolutely not indicative of the antiviral activity expressed by the molecule. The latter, therefore, can be considered not inferable from what is described in prior art. The compounds of the invention, acting in addition on an enzymatic target different from that described in the patent document CN1699355A, therefore prove to be more effective and consequently advantageous compared to those in the literature.

[0104] Some of the compounds reported in formulas (I), (II), (III) inhibit the NTPase function of the WNV helicase with IC50 values in the micromolar range. This turns out to be an advantage compared to the only compound with a thiazolinidone structure reported in patent application WO2010 / 039538 because it is known that blocking the helicase causes an arrest of transcription of the viral nucleic acid72. Blocking replication interrupts the life cycle of the virus, preventing new virions from being produced. Furthermore, interfering with genome replication can lead to a more rapid reduction in viral load. This may be particularly important in the early stages of the infection, where a rapid decrease in viral replication can help containing the spread of the virus in the body while avoiding more severe symptoms. Even for SARS-CoV-2 infections it has been seen that the therapy is effective if it is intervened in the initial stages73.

[0105] As will be detailed below, the inventors have developed biochemical assays for both the enzymatic functions associated with NSP13 of SARS-CoV-2 and viral replication assays on cells under biosafety level 3 containment conditions.

[0106] This allowed to conduct biological assays initially on a small library of compounds as possible inhibitors of NSP13 of SARS-CoV-2, identifying a promising scaffold.

[0107] The IC50 of the compounds is evaluated, i.e. the concentration of a given compound such as to produce 50% inhibition of each of the two enzymatic functions of the helicase: unwinding and NTPase; EC50, i.e. the concentration of a given compound such as to produce 50% of the maximal effect of blocking viral replication; CC50, i.e. it is the concentration of the compound necessary to reduce cell viability by 50%; and SI, i.e. the CC50 / EC50 ratio, which indicates the selectivity of the compound, i.e. the toxic concentration of a compound compared to its effective bioactive concentration. The higher the value the better the selectivity of the compound.

[0108] EMAC3a-3i series showed good inhibitory activity on both functions of NSP13 with IC50 values in the low micromolar range, and for some compounds also the ability to inhibit viral replication at non-cytotoxic concentrations.

[0109] The most promising compound, EMAC3I, showed IC50 values equal to 1 .4 μM on the unwinding activity, 14μM on the ATPase function (Fig. 3A-B) and EC50 equal to 22 pM, being non-toxic up to 100μM (Fig. 3D). In tests with BSA / TCEP it showed IC50 values of 2.15 ± 0.19μM on unwinding, 8.52 ± 0.68μM on ATPase function and an EC50 value of 23.9 ± 1 .8 on VER-E6-GFP cells (as can be seen from Tables 3 and 4). Furthermore, enzyme kinetic studies showed that EMAC3I inhibits the NSP13 enzyme of SARS-CoV-2 by not competing with the substrate (ATP) (Fig. 3C). Therefore, the molecule has an allosteric inhibition mechanism and should not interfere with other cellular enzymes that use ATP, as demonstrated by its poor cytotoxicity.

[0110] Structure of EMAC3I compound

[0111] Furthermore, the viral replication data was also reproduced using Calu3 cells (HTB-55 - ATCC Cell Bank), a cell line derived from human lung adenocarcinoma and therefore the inhibitory action of viral replication on these most involved human cells is confirmed in the process of viral infection (Fig.4).

[0112] Finally, the dissociation constant of the protein-inhibitor complex KD was determined with the Surface Plasmon Resonance (SPR) method, capable of detecting the mass variation of the protein as a function of its interaction with the compound; KD was calculated equal to 6.20μM (Fig.5-6).

[0113] The compound proved to be active on cells (Beas2B (ATCC code CRL -3588™)) infected with an alphacoronavirus responsible for infections in humans, hCoV229E (EC50 5.7 ±0.1 ).

[0114] The helicase of this coronavirus has a similarity percentage of 60.3% and positive residues of 75%. This demonstrates sequence conservation across coronaviruses and the ability of our compounds to inhibit viral replication of other coronaviruses. The compound is also active on MERS (EC50 4.6± 1.1 ), which presents a helicase enzyme with 72.13% sequence identity and 84% residues with positive similarity. Therefore, even higher than hCoV229E. It appears clear that the identified scaffold is suitable for the creation of universal inhibitors of coronaviruses of human interest (pan- coronavirus). Furthermore, the behaviour of EMAC3i in the presence of the reference compound for the enzymatic assay SSYA10-001 was studied in more detail through the analysis of the Yonetani-Theorell plot (DOI: 10.1016 / s0076-6879(82)87028-6). From the study it was found that the two compounds do not disturb each other in their bonding. This could indicate that they do not bind at the same site or that the site is so large that both can bind at the same time.

[0115] In addition, association studies of EMAC3I with drugs currently approved and in use in Italy have been carried out.

[0116] The two drugs used in therapy are Remdesivir and Nirmatrelvir, molecules with different mechanisms. Remdesivir is a prodrug inhibitor of the viral polymerase, while Nirmatrelvir is an inhibitor of the viral main protease (MPro, also called CL-Pro, NSP5).

[0117] It is observed that the association of EMAC3I compound improves the EC50 value of Remdesivir. In fact, at increasing doses of EMAC3I compound the EC50 of Remdesivir decreases (Fig. 7). In particular, the active ingredient Remdesivir alone has an EC50 of 0.1542μM but, by adding a concentration of 10μM of EMAC3I, the value decreases by more than 3 times reaching an EC50 of 0.047 pM. This data demonstrates that the association of EMAC3I compound with Remdesivir entails therapeutic advantages.

[0118] Further studies show that the effect is additive. A similar effect is observed for Nirmatrelvir.

[0119] EMAC3I compound was characterized with spectroscopic techniques (NMR and HRMS) and X-Ray. The single crystal was decisive in attributing the configuration of the double bond on N, which turned out to be Z.

[0120] In the literature, the portion with the thiazolidinone linked to the indolinone has already been studied for other targets and the double bond is always indicated in the Z configuration, also confirmed by the crystal obtained for EMAC3I (Fig.8).

[0121] The activity data are particularly interesting if we consider that, to date, no molecule for this target has yet been authorized in therapy, that the molecules active on the helicase enzyme available in the literature are few and there is little data on viral replication. The mechanism of action of the only compound in clinical phase I, EIS- 10700, is unknown. Recently the start-up that studied it published a patent document describing allosteric inhibitors, which could include EIS-10700 or similar (PCT / EP2022 / 080307).

[0122] The inventors then synthesized the thiazolinone derivatives reported in Table 1. The compounds of General Formula (II) and (III), included in the description of General Formula (I), were synthesized and most of these were subjected to biological assays.

[0123] The antiviral properties on SARS-CoV-2 of the compounds are indicated in the following Table 3. In particular, the IC50 (pM) values of the unwinding of the helicase in BSA / TCEP, the IC50 (pM) values of the NTPase function in BSA / TCEP, EC50 (pM) measurements, CC5o(pM) or %viability, and SI values CC50 / EC50) are reported Table 3

[0124] As can be seen from the biological results, some compounds are powerful antivirals. The pharmacokinetic profile useful for the subsequent phases of pharmaceutical development was also predicted for all compounds.

[0125] The compounds of the invention can be used against other viruses, such as hepatitis C (HCV) and viruses transmitted by arthropods belonging to the Flavivirus genus, such as Zika Virus, West Nile Virus, Dengue Virus, Yellow Fever Virus.

[0126] From the analysis of the activity data reported in Table 3 it emerges that the substitution in position 5 of the thiazolidinone ring is important. In fact, the unsubstituted compounds are inactive (EMAC2a, EMAC2e, EMAC2T, EMAC2) and in any case do not fall within Formulas (I), (II), (III).

[0127] The preferential substitutions in position 3 of the thiazolidinone ring are also para- substituted aromatic groups or, always in position 3 of the thiazolidinone ring, an aliphatic 6-membered ring (cyclohexyl) is preferred. The sulfonamide group is not essential for the inhibition of the enzyme (EMAC9 series), but still seems to play an important role for viral replication.

[0128] The substitution of the isatin ring in position 5 with an arylidene group leads to compounds generally more active on the enzyme (EMAC9, EMAC10, EMAC12 and EMAC13 series), and, when accompanied by the substitution in position 3 with cyclohexyl, also a better inhibition of viral replication, although in some cases there is an increase in cytotoxicity.

[0129] The synthesized compounds show an enzymatic activity which during the optimization phase reached the low micromolar range both in terms of IC50 and EC50 values. In particular, the compounds EMAC3i, EMAC5b, EMAC8T, EMAC9g, EMAC13j and EMAC13o represent the most promising compounds (Table 4, selection from Table 3), and in general EMAC3-5-8-13 series show several interesting compounds. Many of these compounds also showed activity against MERS and hCoV229E, as reported in Tables 5 and 6.

[0130] Below, table 4 shows the EC50 values of the compounds, tested against SARS- CoV-2 in VERO-E6-GFP cells (Vero-E6 African monkey kidney cells (ATCC code CRL- 1586)) and related CC50 values. Measurement of total well fluorescence was performed 3 days after cell infection.

[0131] Table 4

[0132] GC376, reference compound, covalent 3CLPro inhibitor with low oral absorptior as a reference for the study of other molecules active on coronaviruses

[0133] The compounds have the advantage of acting on a validated target, conserved among coronaviruses.

[0134] The compounds inhibit both enzymatic activities. Some of these compounds do not act with a non-competitive mechanism with respect to ATP. This could be advantageous for the selectivity and lower toxicity of the compounds as ATP is used by many enzymes, even of the human cell. Others, such as EMAC5b, have proven to be competitive with ATP, however with reduced or acceptable cytotoxicity.

[0135] All the modifications made led to active compounds with the majority characterized by IC50 < 20 μM for both or at least one of the functions of the enzyme. Some of the compounds are active on the viral replication of SARS-CoV-2, SARS-CoV, but also other coronaviruses, such as hCoV229E and MERS. This makes them excellent candidates as universal inhibitors for coronaviruses (pan-coronavirus).

[0136] In particular, Table 5 shows the EC50 value, measured against hCoV229E, and the CC50 of the compounds, tested by MTT test in Beas2B cells.

[0137] Table 5

[0138] Table 6 instead shows the EC50 values against MERS and the CC50 of the compounds, tested in VERO-E6-GFP cells 4 days after infection. Table 6 Furthermore, the antiviral properties on the helicase activity of NS3 WNV (NS3Hel) of the synthesized compounds are shown in Table 7 below: the IC50 values (pM) of the NTPase function in BSA / TCEP.

[0139] Table 7

[0140] This data demonstrate that the compounds of formulas (I), (II), (III) are potentially advantageous also against infections caused by Flaviviruses through the inhibition of the viral helicase NS3Hel. The helicases of coronaviruses and flaviviruses belong to two super families, SF1 and SF2, respectively. All SF1 and SF2 helicases share 7 conserved motifs (I, la, II, III, IV, V and VI, DOI: 10.1007 / b135974 20). The activity on the WNV NS3Hel helicase could therefore be explained by the interaction with one of these conserved domains in both SFs. The data would support the possibility that the compounds have a pan-helicase inhibitory function for SF1 and SF2.

[0141] Table 8 below shows the activities of the best compounds, active on the viral helicase of SARS-COV-2 and active on viral replication, towards the protease (3CLPro) and the RNA-dependent RNA polymerase (RdRp) of SARS-CoV-2. Table 8

[0142] Furthermore, some compounds have shown an additive effect in combined use with approved drugs already in use in therapy (Remdesivir and Nirmatrelvir). Combination therapy is effective in effectively suppressing viral load, reducing resistance problems and drug side effects.

[0143] The advantage in the development of our molecules is also linked to the fact that they could also be taken by non-vaccinable patients, possibly orally. Furthermore, the compounds are stable at room temperature and do not require a cold chain for storage. Finally, the molecules would cost less than biological drugs and have the advantage of being able to be easily produced and distributed to the population, even in those countries where it is more difficult to guarantee widespread vaccination.

[0144] ★ ★★★★

[0145] The invention is further defined by reference to the following exemplary part, which is intended to be illustrative and not restrictive of the scope of the invention.

[0146] Determination of the unwinding activity associated with NSP13 of SARS-CoV-2

[0147] The unwinding activity of SARS-CoV-2 NSP13 was measured in black 384-well plates (PerkinElmer), in a reaction volume of 40 pl containing 20 mM Tris-HCI, pH 7.2, 50 mM NaCI, 2μM Hel Capture oligo (5'- TGG TGC TCG AAC AGT GAC -3') from Biomers, 5 mM MgCh, 0.01 mg / ml BSA, 0.18 mM TCEP, 5% DMSO or inhibitor and 1 nM purified NSP13. The reaction mixture containing the enzyme was pre-incubated for 10 minutes with inhibitor at room temperature (RT). The reaction was started by adding 1 mM ATP and 750 nM paired synthetic DNA substrate (5'-AGT CTT CTC CTG GTG CTC GAA CAG TGA C-Cy3-3’, 5’-BHQ-2-GTC ACT GTT CGA GCA CCA CCT CTT CTG A-3') purchased from the Biomers company. After 15 min of incubation at 37°C, the products were measured with Victor Nivo (Perkin) at 530 / 580 nm. Experiments were performed in duplicate, results reporting the mean and standard deviation of at least two independent replicates.

[0148] Determination of ATPase-associated activity of NSP13 of SARS-CoV-2

[0149] SARS-CoV-2 helicase-associated ATPase activity was measured in a transparent 96-well plate (PerkinElmer), in a reaction volume of 25 pl containing 20 mM Tris-HCI, pH 7.2, 50 mM NaCI, 2 mM MgCI2, 0.01 mg / ml BSA, 0.18 mM TCEP, 5% DMSO or inhibitor, and 25 nM purified NSP13. The reaction was started by adding 400μM ATP. After 30 minutes of incubation at 37°C, 50 ml of Biomol® Green Reagent (Prod. No. BML-AK11 1 , Enzo Lifescience) was added and the reaction was incubated for 10 min at room temperature, protected from light. The products were measured with Victor Nivo (Perkin) at 650 nm. Experiments were performed in duplicate, results reporting the mean and standard deviation of at least two independent replicates.

[0150] SARS-CoV-2 replication assay

[0151] The African green monkey kidney cell line (ATCC:CRL-1586™), previously engineered to constitutively express GFP (VERO-E6-GFP), was kindly provided as a Material Transfer Agreement (MTA) by Janssen Pharmaceutical. Cells were maintained in Dulbecco's modified Eagle's medium (DMEM; Gibco) supplemented with 10% v / v foetal bovine serum (FBS; Gibco), 0.075% sodium bicarbonate (7.5% solution, Gibco) and 1 x Pen-strep (Euroclone) and maintained under 5% CO2 at 37°C. The SARS-CoV-2 BetaCov / Belgium / GHB-03021 / 2020 strain was provided by KU Leuven.

[0152] All work related to the virus was carried out in high containment biosafety level 3 certified facilities at the University of Cagliari. Cells were seeded at 10,000 cells / well in 96-well plates. The following day, cells were incubated with the control compounds and virus at different MOI 0.01 , in the presence of 2 μM pgp inhibitor CP-100356.26. The compound GC376 was used as a positive control. The medium was removed 72 hours after infection and the total fluorescence of the well was measured with a Victor 3 with excitation wavelength of 485 / 535 nm. Inhibition of viral replication was calculated as the percentage of virus-induced cytopathic effect on untreated infected controls.

[0153] Determination of viral replication inhibition in Calu-3 by RT-qPCR

[0154] Calu-3 cells (human lung adenocarcinoma cell line, an epithelial respiratory model (HTB-55 code: BS TCL 103, provided as MTA by Istituto Zooprofilattico Sperimentale della Lombardia e dell'Emilia Romagna (IZSBS) - Brescia) were maintained in Dulbecco's modified Eagle's medium (DMEM; Gibco) supplemented with 10% v / v heat-inactivated foetal bovine serum (FBS; Gibco), 1 x Pen-strep (Euroclone), 1 mM Na Pyruvate (Euroclone), 1 mM nonessential amino acids (Euroclone) and maintained under 5% CO2 at 37°C.

[0155] Calu-3 cells were seeded into 96-well plates (40000 cells / well final volume 200 pl). The next day, compounds were added to the cells and the cells were infected with SARS-CoV-2 (MOI = 0.5) for one hour and then the virus inoculum was removed. Cells were placed in fresh medium with the indicated compounds. At 48 hours postinfection, viral RNA was extracted from the supernatant with the QIAamp Viral RNA Mini Kit (Qiagen) following the manufacturer's instructions.

[0156] RT-qPCR was performed in 20 pl to detect the copy number of the SARS-CoV-2 S gene using primers: f: GTGTTTATTTTGCTTCCACTG; r: GGCTGAGAGACATATTCAAAA with Luna Universal One-Step RT-qPCR Kit (New England Biolabs) according to the manufacturer's instructions in a CFX-96 RT-PCR (Biorad). Results report the mean and standard deviation of two independent biological replicates in duplicate.

[0157] Surface Plasmon Resonance

[0158] SPR on NSP13 of SARS-CoV-2 was performed in a Biacore X100 instrument (Cytiva) at 25°C, according to the manufacturer's protocol. Briefly, NSP13 (50 pg / ml concentration in sodium acetate buffer, pH 5.0; running buffer: HBS-EP+ 1 X (Cytiva)) was attached to a CM5 Sensor Chip (Cytiva) with the mating procedure of the amine. Then, serial dilutions of the analyte in 5% DMSO (dilution and running buffer: 20 mM Tris-HCI pH 7.8, 150 mM NaCI, 1 mM EDTA, 5% DMSO) were injected onto the surface. The contact time was 120 seconds, and the dissociation time was 180 seconds. Solvent correction (8-point DMSO curve) was performed to subtract the DMSO contribution to the final signal. The results were analysed in Biacore X100 evaluation software. The analyte was tested in a 5-point curve (25 pM, 12.5 pM, 6.25 pM, 3.125 pM, and 1.563 pM) in 5% DMSO for its binding to the SARS-CoV-2 ligand NSP13. hCoV229E replication assay hCoV229E (ATCC® VR-740™) was propagated in MRC-5 cells (ATCC:CCL- 171 ™) maintained in MEM (Gibco) supplemented with 10% v / v foetal bovine serum (FBS HI; Gibco), 1 mM Na Pyruvate (Euroclone), 1 mM nonessential amino acids (Euroclone), and 1 x Pen-strep (Euroclone) and maintained under 5% CO2 at 37°C. BEAS-2B cells kindly provided as MTA by Pierre-Olivier Vidalain (Centre International de Recherche en Infectiologie, Universite Lyon, Inserm, U1 1 1 1 , Universite Claude Bernard Lyon 1 , CNRS, Lyon, France. This product, ATCC code CRL-3588™, is an ATCC-manufactured progeny of CRL-9609 cited in U.S. Patent No. 4,885,238) were maintained in DMEM / F-12 (Gibco), 5% FBS HI (Gibco), 1 % Kanamycin (Thermo- Fisher Scientifics), at 37°C with 5% CO2 2*104cells per well were seeded into a transparent 96-well plate and incubated overnight to reach 90% confluence. 24 hours later the cells were infected with hCoV229E m.o.i. 0.06 in DMEM / F-12 in the presence of compound or 0.1 % DMSO (untreated controls). Cells were incubated for two hours at 35°C with 5% CO2, then the virus was removed, replaced with complete medium with or without compound, and incubated at 35°C with 5% CO2. After 72 hours, 20 pl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (Sigma-Aldrich) dissolved in PBS at 7.5 mg / ml were added to each well and incubated at 37°C with 5% CO2 for 1 h. Then the supernatant was removed, and the cells were lysed with 100 pl / well of: 10% 2-Propanol, 0.004% Triton-X-100 (Sigma-Aldrich), 0.0004% HCI; then, the absorbance was read at 570 nm with a PerkinElmer Victor Nivo5 plate reader. hMERS replication assay

[0159] Middle East respiratory syndrome (ME RS) coronavirus, strain IP / COV / MERS / Hu / France / FRA2 (Ref-SKU: 014V-02970) was provided by the EVA- GLOBAL Jessica VANHOMWEGEN laboratory, Pasteur Institute. African green monkey kidney cells (ATCC: CRL-1586™), previously engineered to constitutively express GFP (VERO-E6 GFP), were seeded at 10,000 cells / well in black 96-well plates. The following day, cells were incubated with the control compounds at different concentrations and the virus at an MOI of 0.005 in the presence of 2 mM Pgp inhibitor CP-100356. 4 days postinfection, the medium was removed and total well GFP fluorescence was measured with a Victor 3 with excitation wavelength of 485 / 535 nm. Inhibition of viral replication was calculated as the percentage of virus-induced cytopathic effect on untreated infected controls. The EC50 value was calculated with Prism 9. Version 9.1 .2 via non-linear regression. Experiments represent the mean and standard deviation of at least two independent experiments in triplicate.

[0160] NS3Hel WNV inhibition assay

[0161] The ATPase activity of flavivirus NS3Hel was evaluated through a colorimetric assay to measure ATP hydrolysis using the Biomol Green reagent. The concentration of inorganic phosphate is determined by comparing the absorbance at a wavelength of 650 nm to a standard curve of known inorganic phosphate.

[0162] Activity is measured in a transparent 96-well plate (PerkinElmer) as reported by Corona et al. (2022). Briefly, in a 25 pl reaction volume containing 50 mM Tris-HCI pH 7.5, 40 mM KCI, 20 mM MgCh, 0.01 mg / ml BSA and 0.16 mM TCEP, 5% DMSO or inhibitor and 10 nM of purified NS3Hel. The reaction begins by adding 200 mM ATP. After 30 minutes of incubation at 37°C, 50 pl of Biomol® Green Reagent (Prod. No. BML-AK1 11 . Enzo Lifescience) is added and the reaction is incubated for 10 minutes at room temperature, protected from light. Products are measured with Victor Nivo (Perkin) at 650 nm.

[0163] Activity assay against the protease (3CLPro) and the RNA-dependent RNA polymerase (RdRp) of SARS-CoV-2.

[0164] The enzymatic activity and inhibition of MPro(also called 3CLPro) of SARS-CoV-2 were assessed using a FRET assay, as described in Kuzikow et al. (DOI: 10.1021 / acsptsci.0c00216). Briefly, SARS-CoV-2 MProwas pre-incubated with different concentrations of the compounds at 37°C for 30 minutes, in a reaction mixture containing 20 mM Tris-HCI pH 7.3, 100 mM NaCI and 1 mM EDTA. Subsequently, 12 pM FRET substrate (DABCYL-KTSAVLQJ,SGFRKM-EDANS peptide) was added and the reaction was carried out at room temperature for 15 min, after which the fluorescent signal was acquired (ex / em 320 / 480).

[0165] Activity assay against the RNA dependent RNA polymerase (RdRp) of SARS- CoV-2. The RdRp activity of SARS-CoV-2 NSP12 was measured in black 96-well plates (PerkinElmer), in a reaction volume of 25 pL containing 50 mM Tris-HCI pH 8.0, 1 mM DTT, 2.5 mM MgCh, 50 mM NaCI, 10% glycerol, 20 μM UTP, 10 U / pL RNAse inhibitor (Thermo Scientific), 12.5 nM RNA template polyA, 4% DMSO or inhibitor, and 400 nM purified NSP12. The reaction mixture containing the enzyme and RNA template was incubated for 60 minutes with the inhibitor at 37°C. After incubation, the reaction was stopped by adding 2 pL of 200 mM nuclease-free EDTA. Next, 170 pL of 1 x PicoGreen (Invitrogen) in 1 x TE was added to the mixture and the reaction was incubated for 5 minutes at room temperature, protected from light. Products were measured with Victor Nivo (PerkinElmer, Waltham, Massachusetts, United States) at 502 / 523 nm (em / ex).

[0166] The list of sequences used in the biological assays is shown in Table 9

[0167] Table 9

[0168] The invention is further defined by reference to the following examples of compounds, which are intended to be illustrative and not limiting of the scope of the invention.

[0169] EXAMPLES

[0170] Starting materials and reagents, when not specified, were purchased from authorized suppliers and used as such without the need for further purification.

[0171] All melting points were determined by the capillary method using a Stuart SMP1 1 type apparatus without the use of an internal standard. Melting points, reaction yields and analytical data are in agreement with theoretical data.

[0172] TLC chromatography, used to evaluate the progress of the reaction, was performed using silica gel plates (Merck F254), and analyzed with UV light.

[0173] The NMR spectra of all samples were measured in DMSO-d6 and Acetone-d6 at 278.1 K with a Bruker 600 spectrometer.

[0174] Furthermore, all compounds were characterized with high-resolution mass spectrometry (HRMS).

[0175] Mass spectra were acquired on an Orbitrap “Classic” mass spectrometer (Thermo Fisher Scientific, Germany). The compounds were initially dissolved in dimethyl sulfoxide (DMSO) at a concentration of 10 mg / ml. The stock solutions were then diluted 50-fold in acetonitrile, and further diluted 20-fold in 80% methanol containing 0.1 % formic acid. Solutions were infused directly into the mass spectrometer at 5 pl / min. Mass spectra were acquired in positive ion mode (4300 V). The ion transfer tube temperature was 280°C, while the lens S value was 95 units. Full MS spectra were acquired at a resolution of 140,000, in the m / z range 250-1200 m / z.

[0176] Synthesis of thioureide derivatives as starting products but not included in Formulas I, II, III:

[0177] - 4-(3-phenylthioureido)benzenesulphonamide (EMACIa)

[0178] - 4-(3-ethylthioureido)benzenesulphonamide (EMACI b)

[0179] - 4-(3-cyclohexylthioureido)benzenesulphonamide (EMACIc)

[0180] - 4-(3-cyclopropylthioureido)benzenesulphonamide (EMACId)

[0181] - 4-(3-(4-fluorophenyl)thioureido)benzenesulphonamide (EMAC1 e)

[0182] - 4-(3-(4-chlorophenyl)thioureido)benzenesulphonamide (EMAC1 f)

[0183] - 1,3-diphenylthiourea (EMACIg)

[0184] - 1-(2-morpholinoethyl)-3-phenylthiourea (EMACI h)

[0185] - 1-(2-morpholinoethyl)-3-phenylthiourea (EMAC1 I)

[0186] A solution of isothiocyanate (23.2 mmol, 1 eq) is added to an ethanolic suspension (50 mL) of the amine (23.2 mmol, 1 eq). The reaction mixture is left under magnetic stirring for 24 h at reflux temperature and subsequently filtered under vacuum to obtain the corresponding thioureide derivative.

[0187] Synthesis of thiazolidinone derivatives as starting products but not included in Formulas I, II, III: - (Z)-4-((4-oxo-3-phenylthiazolidin-2-ylidene)amino)benzenesulphonamide ( EM AC2a)

[0188] (Z)-4-((3-(2-morpholinoethyl)-4-oxothiazolidin-2-ylidene)amino)benzonitrile

[0189] (EMAC2h)

[0190] - (Z)-3-(2-morpholinoethyl)-2-(phenylimino)thiazolidin-4-one (EMAC2i)

[0191] Ethyl bromoacetate (136 mmol, 1.2 eq) was added to an ethanolic suspension (40 mL) of the thioureide derivative (1 1 .3 mmol, 1 eq). The reaction was carried out in the presence of sodium acetate (68.2 mmol, 6 eq), for 24 hours at 50°C. Once the reaction was completed, the suspension was filtered under vacuum to obtain the corresponding thiazolidinone derivative. The solid obtained by filtration was suspended in distilled water and subsequently filtered under vacuum.

[0192] Synthesis of thiazolidinone derivatives final products and included in Formulas I, II, III:

[0193] - (Z)-4-((3-ethyl-4-oxothiazolidin-2-ylidene)amino)benzenesulphonamide (EMAC2b)

[0194] (Z)-4-((3-cyclohexyl-4-oxothiazolidin-2-ylidene)amino)benzenesulphonamide

[0195] (EMAC2c)

[0196] (Z)-4-((3-cyclopropyl-4-oxothiazolidin-2-ylidene)amino)benzenesulphonamide (EMAC2d) -(Z)-4-((3-(4-fluorophenyl)-4-4-oxothiazolidin-2-ylidene)amino)benzenesulphonamide (EMAC2e)

[0197] Ethyl bromoacetate (136 mmol, 1.2 eq) was added to an ethanolic suspension (40 mL) of the thioureide derivative (1 1 .3 mmol, 1 eq). The reaction was carried out in the presence of sodium acetate (68.2 mmol, 6 eq), under stirring, for 24 hours, at reflux temperature. Once the reaction was completed, the suspension was filtered under vacuum to obtain the corresponding thiazolidinone derivative. The solid obtained by filtration was suspended in distilled water and subsequently filtered under vacuum.

[0198] Synthesis of compounds falling under Formulas I, II, III:

[0199] - 4-(((Z)-5-((Z)-5-chloro-2-oxoindoline-3-ylidene)-4-oxo-3-phenylthiazolidin-2-ylidene) amino)benzenesulphonamide (EMAC3a)

[0200] 4-(((Z)-5-((Z)-7-fluoro-2-oxoindoline-3-ylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC3h)

[0201] 4-(((Z)-5-((Z)-5-nitro-2-oxoindolin-3-ylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC3b)

[0202] 4-(((Z)-5-( (Z)-5-bromo-2-oxoindoline-3-ylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC3d)

[0203] 4-(((Z)-5-((Z)-5-methoxy-2-oxoindoline-3-ylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide ( EM AC3e)

[0204] 4-(((Z)-5-((Z)-5-fluoro-2-oxoindoline-3-ylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide ( EM AC3c)

[0205] 4-(((Z)-5-((Z)-7-bromo-2-oxoindoline-3-ylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide ( EM AC3i )

[0206] 4-(((Z)-4-oxo-5-((Z)-2-oxoindolin-3-ylidene)-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide ( EM AC3g )

[0207] 4-(((Z)-5-((Z)-5-methyl-2-oxoindoline-3-ylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide ( EM AC3f )

[0208] - 4-(((Z)-5-((Z)-5-chloro-2-oxoindoline-3-ylidene)-3-(4-fluorophenyl)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EMAC7a)

[0209] - 4-(((Z)-3-(4-fluorophenyl)-5-((Z)-5-nitro-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide ( EM AC7b)

[0210] - 4-(((Z)-5-((Z)-5-fluoro-2-oxoindoline-3-ylidene)-3-(4-fluorophenyl)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide ( EM AC7c)

[0211] - 4-(((Z)-5-((Z)-5-bromo-2-oxoindoline-3-ylidene)-3-(4-fluorophenyl)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EMAC7d)

[0212] 4- (( (Z)-3-(4-fluorophenyl) -5-( (Z) -5-methoxy-2-oxoindoline-3-ylidene)-4- oxothiazolidin-2-ylidene)amino)benzenesulphonamide (EMAC7e)

[0213] - 4-(((Z)-3-(4-fluorophenyl)-5-((Z)-5-methyl-2-oxoindoline-3-ylidene)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EMAC7f)

[0214] 4-(((Z)-3-(4-fluorophenyl)-4-oxo-5-((Z)-2-oxoindoline-3-ylidene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC7g)

[0215] - 4-(((Z)-5-((Z)-7-fluoro-2-oxoindoline-3-ylidene)-3-(4-fluorophenyl)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide ( EM AC7h)

[0216] - 4-(((Z)-5-((Z)-7-bromo-2-oxoindoline-3-ylidene)-3-(4-fluorophenyl)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EMAC7i )

[0217] - 4-(((Z)-5-((Z)-5-chloro-2-oxoindoline-3-ylidene)-3-(4-chlorophenyl)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EMAC8a )

[0218] - 4-(((Z)-3-(4-chlorophenyl)-5-((Z)-5-nitro-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide fEM AC8b )

[0219] - 4-(((Z)-3- (4-chlorophenyl) -5-( (Z) -5-fluoro-2-oxoindoline-3-ylidene)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EM AC8c )

[0220] - 4-(((Z)-5-((Z)-5-bromo-2-oxoindoline-3-ylidene)-3-(4-chlorophenyl)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EM AC8d )

[0221] 4-(((Z)-3-(4-chlorophenyl)-5-((Z)-5-methoxy-2-oxoindoline-3-ylidene)-4- oxothiazolidin-2-ylidene)amino)benzenesulphonamide (EMAC8eJ

[0222] - 4-(((Z)-3-(4-chlorophenyl)-5-((Z)-5-methyl-2-oxoindoline-3-ylidene)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EM AC8f )

[0223] 4-(((Z)-3-(4-chlorophenyl)-4-oxo-5-((Z)-2-oxoindoline-3-ylidene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC8g )

[0224] - 4-(((Z)-3-(4-chlorophenyl)-5-((Z)-7-fluoro-2-oxoindoline-3-ylidene)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EM AC8h )

[0225] 4-(((Z)-3-(4-chlorophenyl)-4-oxo-5-((Z)-2-oxoindoline-3-ylidene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC8i )

[0226] - (Z)-5-((Z)-5-chloro-2-oxoindolin-3-ylidene)-3-phenyl-2-(phenylimino)thiazolidin-4- one (EMAC9a,l

[0227] - (Z)-5-((Z)-5-nitro-2-oxoindolin-3-ylidene)-3-phenyl-2-(phenylimino)thiazolidin-4-one

[0228] (EMAC9bJ

[0229] - (Z)-5-((Z)-5-fluoro-2-oxoindolin-3-ylidene)-3-phenyl-2-(phenylimino)thiazolidin-4-one

[0230] (EMAC9cJ

[0231] (Z)-5-((Z)-5-bromo-2-oxoindolin-3-ylidene)-3-phenyl-2-(phenylimino)thiazolidin-4- one (EMAC9d,l

[0232] - (Z)-5-((Z)-5-methoxy-2-oxoindolin-3-ylidene)-3-phenyl-2-(phenylimino)thiazolidin-4- one (EMAC9e,l

[0233] (Z)-5-((Z)-5-methyl-2-oxoindolin-3-ylidene)-3-phenyl-2-(phenylimino)thiazolidin-4- one (EMAC9TJ

[0234] (Z)-5-((Z)-2-oxoindoline-3-ylidene)-3-phenyl-2-(phenylimino)thiazolidin-4-one

[0235] (EMAC9gJ

[0236] (Z)-5-((Z)-7-fluoro-2-oxoindoline-3-ylidene)-3-phenyl-2-(phenylimino)thiazolidin-4- one (EMAC9h,l

[0237] (Z)-5-((Z)-7-bromo-2-oxoindolin-3-ylidene)-3-phenyl-2-(phenylimino)thiazolidin-4- one (EMAC9i,l

[0238] 4-(((Z)-5-((Z)-5-chloro-2-oxoindolin-3-ylidene)-3-ethyl-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC4a )

[0239] 4-(((Z)-3-ethyl-5-((Z)-5-nitro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC4b )

[0240] 4-(((Z)-3-ethyl-5-((Z)-5-nitro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EM AC4b )

[0241] 4-(((Z)-3-ethyl-5-((Z)-5-fluoro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC4c )

[0242] 4-(((Z)-5-((Z)-5-bromo-2-oxoindoline-3-ylidene)-3-ethyl-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EMAC4d )

[0243] 4-(((Z)-3-ethyl-5-((Z)-5-methoxy-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EMAC4e )

[0244] 4-(( (Z)-3-ethyl-5-( (Z) -5-methyl-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC4f )

[0245] 4-(((Z)-3-ethyl-4-oxo-5-((Z)-2-oxoindolin-3-ylidene)thiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC4g )

[0246] 4-(((Z)-3-ethyl-5-((Z)-7-fluoro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EMAC4h )

[0247] 4-(((Z)-5-((Z)-7-bromo-2-oxoindoline-3-ylidene)-3-ethyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC4i )

[0248] 4-(((Z)-5-((Z)-5-chloro-2-oxoindoline-3-ylidene)-3-cyclopropyl-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC6a )

[0249] 4-(( (Z)-3-cyclopropyl-5-( (Z) -5-nitro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC6b )

[0250] 4-(((Z)-3-cyclopropyl-5-((Z)-5-fluoro-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC6c )

[0251] 4-(((Z)-5-((Z)-5-bromo-2-oxoindoline-3-ylidene)-3-cyclopropyl-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC6d )

[0252] - 4-(((Z)-3-cyclopropyl-5-((Z)-5-methoxy-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC6e )

[0253] 4-(( (Z)-3-cyclopropyl-5-( (Z) -5-methyl-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC6f )

[0254] 4-(((Z)-3-cyclopropyl-4-oxo-5-((Z)-2-oxoindoline-3-ylidene)thiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC6g )

[0255] 4-(((Z)-3-cyclopropyl-5-((Z)-7-fluoro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EMAC6h ) 4-(((Z)-5-((Z)-7-bromo-2-oxoindoline-3-ylidene)-3-cyclopropyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC6I )

[0256] Morpholine (1.15 mol, 1 eq) and variously substituted isatin (1.15 mmol, 1 eq) were added to the methanolic solution (10 mL) of the thiazolidinone derivative (1.15 mmol, 1 eq). The reaction was carried out at 50°C for 24 hours under stirring and, once completed, the hot suspension was filtered under vacuum. The product obtained was purified by crystallization or chromatographic column.

[0257] Synthesis of compounds falling under Formulas I, II, III:

[0258] - N-((4-(((Z)-5-((Z)-1-acetyl-5-nitro-2-oxoindolin-3-ylidene)-4-oxo-3-phenylthiazolidin- 2-ylidene)amino)phenyl)sulfonyl)acetamide (EMAC3.1 bj

[0259] N-((4-(((Z)-5-((Z)- 7-bromo-2-oxoindolin-3-ylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)phenyl)sulfonyl)acetamide (EMAC3.2I )

[0260] - N-((4-(((Z)-5-((Z)-1-acetyl-5-nitro-2-oxoindolin-3-ylidene)-3-ethyl-4-oxothiazolidin-2- ylidene)amino)phenyl)sulfonyl)acetamide (EMAC4.1 bj

[0261] - N-((4-(((Z)-5-((Z)-7-bromo-2-oxoindolin-3-ylidene)-3-ethyl-4-oxothiazolidin-2- ylidene)amino)phenyl)sulfonyl)acetamide (EMAC4.2I )

[0262] Sodium acetate (0.61 mmol, 1 eq.) and variously substituted isatin (0.61 mmol, 1 eq.) were added to the solution in acetic anhydride (10 mL) of the thiazolidinone derivative (0.61 mmol, 1 eq.). The reaction was carried out under stirring, at reflux temperature, for 24 hours.

[0263] Once completed, the hot suspension was filtered under vacuum. The product obtained was suspended in distilled water and subsequently filtered under vacuum.

[0264] Synthesis of compounds falling under Formulas I, II, III:

[0265] 4-(((2Z)-5-(4-bromobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 OaJ

[0266] 4-(((2Z)-5-(2,4-dichlorobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 ObJ

[0267] 4-(((2Z)-5-(4-(tert-butyl)benzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 OcJ

[0268] 4-(((2Z)-5-(2-methoxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Od )

[0269] 4-(((2Z)-5-(4-fluorobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Oe ) 4-(((2Z)-5-(4-methoxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Of J

[0270] 4-(((2Z)-5-(3-nitrobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Oh )

[0271] 4-(((2Z)-5-(3-methylbenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Oi ) 4-(((2Z)-4-oxo-3-phenyl-5-(3,4,5-trimethoxybenzylidene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 OjJ

[0272] 4-(((2Z)-5-(4-hydroxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 OkJ

[0273] 4-(( (2Z)-5-(( 1 H-indole-3-yl)methylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 OI )

[0274] 4-(((2Z)-4-oxo-3-phenyl-5-(quinoline-4-ylmethylene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Om )

[0275] 4-(((2Z)-5-(naphthalene- 1 -ylmethylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Oo )

[0276] 4-(((2Z)-5-((4-methoxynaphthalene- 1 -yl)methylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 OpJ

[0277] 4-(((2Z)-5-(4-cyanobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11aJ

[0278] 4-(((2Z)-5-(4-methylbenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 bj

[0279] 4-(((2Z)-5-(3,4-dichlorobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 cj

[0280] - 4-(((2Z)-5-(2, 6-chlorobenzilidene)-4-oxo-3-phenyl thiazolidine-2-ylidene)amino) benzenesulphonamide (EMAC11 dj

[0281] 4-(((2Z)-5-(3-methoxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide fEMACI 1eJ

[0282] 4-(((2Z)-5-(3,4-dimethoxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 f J

[0283] 4-(((2Z)-5-(3,4-difluorobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 g )

[0284] 4-(((2Z)-5-(4-nitrobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 h J

[0285] 4-(((2Z)-5-(2-methylbenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 i )

[0286] 4-(((2Z)-5-(4-ethoxy-3-methoxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 jj 4-(((2Z)-5-(4-hydroxy-3-methoxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 kJ

[0287] 4-(((2Z)-5-(3-hydroxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC111 )

[0288] 4-(((2Z)-5-((1 -methyl-1 H-indol-3-yl)methylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 mJ

[0289] 4-(((2Z)-4-oxo-3-phenyl-5-(quinoline-3-ylmethylene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 nJ

[0290] 4-(((2Z)-5-(naphthalene-2-ylmethylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 oj

[0291] 4-(((2Z)-5-((2-methoxynaphthalene- 1 -yl)methylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 pj

[0292] 4-(((2Z)-5-((2-methoxynaphthalene- 1 -yl)methylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 qj

[0293] 4- (( (2Z)-5-( (6-methoxynaphthalene-2-yl)methylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 rj

[0294] Morpholine (1.15 mmol, 1 eq) and variously substituted aldehyde (1.15 mmol, 1 eq) were added to the methanolic solution (10 mL) of thiazolidinone (1.15 mmol, 1 eq). The reaction was carried out at 50°C for 24 hours under stirring and, once completed, the hot suspension was filtered under vacuum. The product obtained was purified by crystallization or chromatographic column.

[0295] Synthesis of compounds falling under Formulas I, II, III:

[0296] 4-(((Z)-5-((Z)-5-chloro-2-oxoindoline-3-ylidene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5a J

[0297] 4-(((Z)-3-cyclohexyl-5-((Z)-7-fluoro-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5h J

[0298] 4-(((Z)-3-cyclohexyl-5-((Z)-5-nitro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5b J 4-(((Z)-5-((Z)-5-bromo-2-oxoindoline-3-ylidene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5d )

[0299] 4-(((Z)-3-cyclohexyl-5-((Z)-5-methoxy-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5e )

[0300] 4-(((Z)-3-cyclohexyl-5-((Z)-5-fluoro-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5c )

[0301] 4-(((Z)-5-((Z)-7-bromo-2-oxoindoline-3-ylidene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5I )

[0302] 4-(((Z)-3-cyclohexyl-4-oxo-5-((Z)-2-oxoindoline-3-ylidene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5g )

[0303] 4-(((Z)-3-cyclohexyl-5-((Z)-5-methyl-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5fJ

[0304] 4-(((Z)-5-((Z)-5-chloro-2-oxoindolin-3-ylidene)-4-oxo-3-(2-(piperidin- 1 - yl)ethyl)thiazolidin-2-ylidene)amino)benzonitrile (EMAC16a )

[0305] 4-(((Z)-5-((Z)-7-bromo-2-oxoindoline-3-ylidene)-3-(2-morpholinoethyl)-4- oxothiazolidin-2-ylidene)amino)benzonitrile (EMAC16i )

[0306] Piperidine (1.15 mmol, 1 eq) and variously substituted isatin (1 eq) were added to the ethanolic solution (10 mL) of thiazolidinone (1.15 mmol, 1 eq). The reaction was carried out at 50°C for 24 hours under stirring and, once completed, the hot suspension was filtered under vacuum. The product obtained was purified by crystallization or chromatographic column.

[0307] Synthesis of compounds falling under Formulas I, II, III:

[0308] 4-(((Z)-3-(2-morpholinoethyl)-5-((Z)-5-nitro-2-oxoindoline-3-ylidene)-4- oxothiazolidin-2-ylidene)amino)benzonitrile (EMAC16bJ

[0309] (Z)-5-((Z)-5-chloro-2-oxoindoline-3-ylidene)-3-(2-morpholinoethyl)-2- (phenylimino)thiazolidin-4-one (EMAC17aJ

[0310] (Z)-3-(2-morpholinoethyl)-5-((Z)-5-nitro-2-oxoindolin-3-ylidene)-2- (phenylimino)thiazolidin-4-one (EMAC17bJ

[0311] (Z)-5- ( (Z) - 7-bromo-2-oxoindolin-3-ylidene)-3- (2-morpholinoethyl) -2- (phenylimino)thiazolidin-4-one (EMAC17i )

[0312] N,N-diisopropylethylamine (6.05 mmol, 10 eq) and variously substituted isatin (0.67 mmol, 1 eq) were added to the dichloromethane solution of the thiazolidinone derivative (0.61 mmol, 1 eq). The mixture is left under magnetic stirring at reflux temperature for 24 hours. The resulting precipitate was vacuum filtered to obtain the desired product, which was purified via crystallization or column chromatography.

[0313] Synthesis of compounds falling under Formulas I, II, III:

[0314] 4-(((2Z)-5-(4-bromobenzylidene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12a )

[0315] 4-(((Z)-3-cyclohexyl-5-((Z)-2,4-dichlorobenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12bJ

[0316] 4-(((2Z)-5-(4-(tert-butyl)benzylidene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12c )

[0317] 4-(((2Z)-3-cyclohexyl-5-(2-methoxybenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12d )

[0318] 4-(((2Z)-3-cyclohexyl-5-(4-fluorobenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12e)

[0319] 4-(((2Z)-3-cyclohexyl-5-(4-methoxybenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12f )

[0320] 4-(((2Z)-3-cyclohexyl-5-(3-nitrobenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12h )

[0321] 4-(((2Z)-3-cyclohexyl-5-(3-methylbenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12i )

[0322] 4-(((2Z)-3-cyclohexyl-4-oxo-5-(3,4,5-trimethoxybenzylidene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12]^)

[0323] 4-(((2Z)-5-((1H-indole-3-yl)methylene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12I )

[0324] 4-(((2Z)-3-cyclohexyl-4-oxo-5-(quinolin-4-ylmethylene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12m )

[0325] 4-(((2Z)-3-cyclohexyl-5-(naphthalene- 1 -ylmethylene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12o )

[0326] - 4-(((2Z)-3-cyclohexyl-5-((4-methoxynaphthalene- 1 -yl)methylene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12pJ

[0327] 4-(((2Z)-5-(4-cyanobenzylidene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13a J

[0328] 4-(((2Z)-3-cyclohexyl-5-(4-methylbenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13bJ 4-(((Z)-3-cyclohexyl-5-((Z)-3,4-dichlorobenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13c )

[0329] 4-(((2Z)-3-cyclohexyl-5-(2,6-dichlorobenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13d )

[0330] 4-(((2Z)-3-cyclohexyl-5-(3-methoxybenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide <EMAC13e)

[0331] 4-(((2Z)-3-cyclohexyl-5-(3,4-dimethoxybenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13f )

[0332] 4-(((2Z)-3-cyclohexyl-5-(4-nitrobenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13h )

[0333] 4-(((2Z)-3-cyclohexyl-5-(2-methylbenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13i )

[0334] 4-(((2Z)-3-cyclohexyl-5-(4-ethoxy-3-methoxybenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13]^)

[0335] 4-(((2Z)-3-cyclohexyl-5-(( 1 -methyl- 1 H-indole-3-yl)methylene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13m )

[0336] 4-(((2Z)-3-cyclohexyl-4-oxo-5-(quinoline-3-ylmethylene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13n )

[0337] 4-(((2Z)-3-cyclohexyl-5-(naphthalene-2-ylmethylene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13o )

[0338] - 4-(((2Z)-3-cyclohexyl-5-((2-methoxynaphthalene- 1 -yl)methylene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13pJ

[0339] 4-(((2Z)-3-cyclohexyl-5-((3,8-dimethoxynaphthalene-2-yl)methylene)-4- oxothiazolidin-2-ylidene)amino)benzenesulphonamide (EMAC13qJ

[0340] - 4-(((2Z)-3-cyclohexyl-5-((6-methoxynaphthalene-2-yl)methylene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13r /

[0341] Piperidine (0.61 mmol, 1 eq) and variously substituted aldehyde (0.61 mmol, 1 eq) were added to the ethanolic solution (10 mL) of thiazolidinone (0.61 mmol, 1 eq). The reaction was carried out at 50°C for 24 hours under stirring and, once completed, the hot suspension was filtered under vacuum. The obtained product was purified by crystallization or chromatographic column.

[0342] Comparison example

[0343] Comparison of activity between EMAC5b and compound 1 of patent CN1699355A. Compound 1 reported by patent document CN1699355A was synthesized and subjected to the SARS-CoV-2 viral replication blocking assay. As can be seen from table 10 below, compound 1 did not show activity at the maximum concentration used of 30 pM, unlike what was achieved by the compound according to the invention EMAC5b.

[0344] Table 10. Showing EC50 of compounds, tested against SARS-CoV-2 in VERO-E6- GFP cells. The measurement of total well fluorescence is performed 3 days after cell infection.

[0345] References

[0346] 1. Spratt, A. N.; Gallazzi, F.; Quinn, T. P.; Lorson, C. L.; Sbnnerborg, A.; Singh, K. Coronavirus helicases: attractive and unique targets of antiviral drug-development and therapeutic patents. Expert Opinion on Therapeutic Patents 2021 , 31, 339-350.

[0347] 2. Shen, J.; Zuo, J.; Wang, K.; Tong, X.; Yang, L. Preparation of 4-guanidinobenzoic acid aryl ester compounds and its application in preparation of SARS-CoV-2 virus inhibitors. CN114805141 , 2022.

[0348] 3. Sun, H.; Yuen, K.-Y.; Yuan, S.; Wang, R.; Li, H.; Chan, F.-W.; Cheng, T.; Wang, S. Compositions and methods for treating a SARSCoV-2 infection using Bismuth (III)- containing compounds and optionally combined with thiol-containing small molecular compounds. WO2021244481 , 2021 .

[0349] 4. Lorens, J. B.; Maury, W. AXL inhibitors for antiviral therapy. WO2021204713, 2021 .

[0350] 5. Kim, Y. G. Compounds inhibiting activity of SARS and COVID-19 coronavirus helicase nsP13 and their pharmaceutical uses. KR2021145487, 2021.

[0351] 6. Ju, J.; Jockusch, S.; Tao, C.; Chien, M.; Russo, J. J.; Kumar, S.; Li, X.; Wang, X. Therapeutics for COVID-19. WO2021155119, 2021 .

[0352] 7. Sarafianos, S. G.; Adedeji, A. O. Suppression of severe acute respiratory syndrome coronavirus (SARS-CoV) replication using triazole derivatives as SARS helicase inhibitors. WO2013188887, 2013. 8. Keum, Y. S.; Jung, Y. J.; Yoo, M. S.; Jin, Y. W. Flavonoids inhibiting SARS coronavirus activity, pharmaceutically acceptable derivatives and salts thereof, and composition and health functional food for treating or preventing SARS. KR2013031551 , 2013.

[0353] 9. Jung, Y. H.; Jung, Y. J.; Lee, C. U. Aryl diketo acids for inhibiting SARS coronavirus. KR2010029528, 2010.

[0354] 10. White, M. A.; Lin, W.; Cheng, X. Discovery of COVID-19 Inhibitors Targeting the SARS-CoV-2 Nsp13 Helicase. The Journal of Physical Chemistry Letters 2020, 11, 9144-9151.

[0355] 11. Zeng, J.; Weissmann, F.; Bertolin, A. P.; Posse, V.; Canal, B.; Ulferts, R.; Wu, M.; Harvey, R.; Hussain, S.; Milligan, J. C.; Roustan, C.; Borg, A.; McCoy, L.; Drury, L. S.; Kjaer, S.; McCauley, J.; Howell, M.; Beale, R.; Diffley, J. F. X. Identifying SARS- CoV-2 antiviral compounds by screening for small molecule inhibitors of NSP13 helicase. The Biochemical journal 2021 , 478, 2405-2423.

[0356] 12. Ahmed, E. M.; Taha, N. M.; Abd El-Gawad, S. M.; Nady, N. M. S. Novel thiourea, quinazoline, thiazolidine, thieno[2,3-d]-pyrimidine, 4-thiazolidinone, pyrrole, pyrrolo[2,3-d]pyrimidine derivatives containing sulfamoyl moiety. Chem. Sin. 2011, 2, 197-210.

[0357] 13. Baburajeev, C. P.; Mohan, C. D.; Rangappa, S.; Mason, D. J.; Fuchs, J. E.; Bender, A.; Barash, U.; Vlodavsky, I.; Basappa; Rangappa, K. S. Identification of Novel Class of Triazolo-Thiadiazoles as Potent Inhibitors of Human Heparanase and their Anticancer Activity. BMC Cancer 2017, 17, 235 / 1 .

[0358] 14. Bhagat, D. S.; Chawla, P. A.; Gurnule, W. B.; Shejul, S. K.; Bumbrah, G. S. An Insight into Synthesis and Anticancer Potential of Thiazole and 4-thiazolidinone Containing Motifs. Curr. Org. Chem. 2021, 25, 819-841.

[0359] 15. Boiko, N. M.; Klyuchivska, O. Y.; Kobylinska, L. L; Havrylyuk, D. Y.; Ryabtseva, A. O.; Mitina, N. Y.; Lesyk, R. B.; Zaichenko, O. S.; Stoika, R. S. Vitality and morphology of tumor cells treated with 4-tiazolidinone derivatives immobilized on nanoscale polymer carrier. Biotechnol. Acta 2015, 8, 39-48.

[0360] 16. Devinyak, O.; Zimenkovsky, B.; Lesyk, R. Biologically active 4-thiazolidinones: a review of QSAR studies and QSAR modeling of antitumor activity. Curr. Top. Med. Chem. (Sharjah, United Arab Emirates) 2012, 12, 2763-2784.

[0361] 17. Devinyak, O. T.; Lesik, R. B. The study of the structure -anticancer activity relationship of 4-thiazolidinone derivatives using multivariate adaptive regression splines. Zh. Org. Farm. Khim. 2013, 11, 62-67.

[0362] 18. Dhanya, S.; Prasobh, G. R.; Sheeja, R. A. G.; Athira, A. S.; Ajila, E. Thiazolidinone as a lead compound in drug discovery- a review. Indo Am. J. Pharm. Sci. 2021 , 8, 293-298.

[0363] 19. Duffy, K. J.; Erickson-Miller, C. L.; Kikkawa, H.; Maroney, A. C. 1 ,3-Thiazol-4-(5H)- one derivatives for the treatment of nervous system diseases, bone diseases, and other conditions. W02008150837, 2008.

[0364] 20. Kobylinska, L.; Ivasechko, I.; Skorokhyd, N.; Panchuk, R.; Riabtseva, A.; Mitina, N.; Zaichenko, A.; Lesyk, R.; Zimenkovsky, B.; Stoika, R.; Vari, S. G. Enhanced Proapoptotic Effects of Water Dispersed Complexes of 4-Thiazolidinone-Based Chemotherapeutics with a PEG-Containing Polymeric Nanocarrier. Nanoscale Res. Lett. 2019, 14, 1 -16.

[0365] 21. Kobylinska, L.; Khylyuk, D.; Subtelna, I.; Kitsera, M.; Lesyk, R. In silico identification and biochemical validation of plausible molecular targets of 4-thiazolidinone derivative Les-3833 as a potential anticancer agent. Ukr. Biochem. J. 2021 , 93, 7-

[0366] 22.

[0367] 22. Kobylinska, L.; Lozynskii, A.; Lesyk, R.; Stoika, R.; Vari, S. G. Biodistribution and anticancer characteristics of Les-3833, a novel 4-thiazolidinone-based lead compound. Sci. Pharm. 2020, 88, 18.

[0368] 23. Kobylinska, L. I.; Havrylyuk, D. Y.; Ryabtseva, A. O.; Mitina, N. E.; Zaichenko, O. S.; Lesyk, R. B.; Zimenkovsky, B. S.; Stoika, R. S. Biochemical indicators of hepatotoxicity in blood serum of rats under the effect of novel 4-thiazolidinone derivatives and doxorubicin and their complexes with polyethyleneglycol-containing nanoscale polymeric carrier. Ukr. Biokhim. Zh. 2015, 87, 122-132.

[0369] 24. Kobylinska, L. I.; Panchuk, R. R.; Lesyk, R. B.; Zimenkovsky, B. S.; Stoika, R. S. Indicators of oxidative and nitrosative stress and activity of enzymes of nitric oxide metabolism in rats treated with 4-thiazolidinone derivatives possessing antineoplastic activity. Ukr. Biochem. J. 2017, 89, 77-83.

[0370] 25. Kryshchyshyn, A.; Kaminskyy, D.; Grellier, P.; Lesyk, R. In Thiazolidinone-related heterocyclic compounds as potential antitrypanosomal agents, 2021 ; IntechOpen Ltd.: 2021 ; p 1.

[0371] 26. Kumar, R.; Patil, S. Biological prospective of 4-thiazolidinone: a review. Hygeia 2017, 9, 80-97.

[0372] 27. L, K.; O, K.; R, L.; R, S. Targeting of the pro-oxidant-antioxidant balance in vitro and in vivo by 4-thiazolidinone-based chemotherapeutics with anticancer potential. Ukr. Biochem. J. 2019, 91, 7-17.

[0373] 28. Lesyk, R. B.; Zimenkovsky, B. S.; Kaminskyy, D. V.; Kryshchyshyn, A. P.; Havryluk, D. Y.; Atamanyuk, D. V.; Subtel'na, I. Y.; Khyluk, D. V. Thiazolidinone motif in anticancer drug discovery. Experience of DH LNMU medicinal chemistry scientific group. Biopolym. Ce / / 2011 , 27, 107-117.

[0374] 29. Liu, X.-j. ; Yan, B. The instance of new drug research and development: novel anti- cancer lead compounds of 4-thiazolidinones. Shandong Daxue Xuebao, Lixueban 2010, 45, 1 -5.

[0375] 30. Mehta, D. P.; Sengar, N. P. S.; Pathak, A. K. 4-thiazolidinone- a new profile of various pharmacological activities. Orient. J. Chem. 2008, 24, 441 -454.

[0376] 31 . Pan, B.; Yin, H.; Wei, P.; Han, S. Study on the structure and pharmacological activity of 4-thiazolidinones. Zhongguo Xiandai Yingyong Yaoxue 2010, 27, 607-612.

[0377] 32. S Ramadan, W.; Saleh, E. M.; Menon, V.; Vazhappilly, C. G.; Abdu-Allah, H. H. M.; El-Shorbagi, A.-N. A.; Mansour, W.; El-Awady, R. Induction of DNA damage, apoptosis and cell cycle perturbation mediate cytotoxic activity of new 5- aminosalicylate-4-thiazolinone hybrid derivatives. Biomed. Pharmacother. 2020, 131, 1 10571.

[0378] 33. Senkardes, S.; Kucukguzel, S. g. Recent Progress on Synthesis and Anticancer Activity of 4-Thiazolidinone. Mini-Rev. Org. Chem. 2016, 13, 377-388. 34. Skora, B.; Lewinska, A.; Kryshchyshyn-Dylevych, A.; Kaminskyy, D.; Lesyk, R.; Szychowski, K. A. Evaluation of Anticancer and Antibacterial Activity of Four 4- Thiazolidinone-Based Derivatives. Molecules 2022, 27, 894.

[0379] 35. Subhedar, D. D.; Shaikh, M. H.; Shingate, B. B.; Nawale, L.; Sarkar, D.; Khedkar, V. M. Novel tetrazoloquinoline-thiazolidinone conjugates as possible antitubercular agents: synthesis and molecular docking. MedChemComm 2016, 7, 1832-1848.

[0380] 36. Szychowski, K. A.; Leja, M. L.; Kaminskyy, D. V.; Binduga, U. E.; Pinyazhko, O. R.; Lesyk, R. B.; Gminski, J. Study of novel anticancer 4-thiazolidinone derivatives. Chem.-Biol. Interact. 2017, 262, 46-56.

[0381] 37. Verma, M.; Verma, P. Anticancer and antimicrobial potential of thiazolidin-4-one: a mini review. World J. Pharm. Pharm. Sci. 2018, 7, 1397-1409.

[0382] 38. Zimenkovs'kii, B. S.; Devinyak, O. T.; Lesik, R. B. Modeling of a possible pharmacophore group for 4-thiazolidinones with the anticancer activity. Zh. Org. Farm. Khim. 2012, 10, 76-82.

[0383] 39. Altameemi, H. A.; Askar, F. W.; Nief, O. A. Synthesis and biological evaluation of some imidazoline derivatives. IOP Conf. Ser.: Mater. Sci. Eng. 2020, 871, 012030.

[0384] 40. Desai, N.; Trivedi, A.; Pandit, U.; Dodiya, A.; Rao, V. K.; Desai, P. Hybrid Bioactive Heterocycles as Potential Antimicrobial Agents: A Review. Mini-Rev. Med. Chem. 2016, 16, 1500-1526.

[0385] 41 . Froes, T. Q.; Chaves, B. T.; Mendes, M. S.; Ximenes, R. M.; da Silva, I. M.; da Silva, P. B. G.; de Albuquerque, J. F. C.; Castilho, M. S. Synthesis and biological evaluation of thiazolidinedione derivatives with high ligand efficiency to P. aeruginosa PhzS. J. Enzyme Inhib. Med. Chem. 2021 , 36, 1217-1229.

[0386] 42. Jacob, B.; Bisht, L. K.; Chandy, V. Quantitative structure activity relationship studies of some new 4-thiazolidinone derivatives as antimicrobial agents. Res. Rev.: J. Pharm. Sci. 2017, 8, 1 -3.

[0387] 43. Jernberg, G. R. Enhanced delivery of a hydrophobic agent in the oral cavity by coupling to a hydrophilic agent with cellular activity. US20200375935, 2020.

[0388] 44. Kalaiya, S. B.; Parikh, A. R. Studies on thiadiazoles: preparation and antimicrobial activity of sulfonamides, 4-thiazolidinone and 2-azetidinone derived from 2-amino- 5-benzyl-1 ,3,4-thiadiazole. J. Inst. Chem. (India) 1985, 57, 161.

[0389] 45. Karanth, S.; Narayana, B.; Kodandoor, S. C.; Sarojini, B. K. 2-{[(4-Hydroxy-3,5- dimethoxyphenyl)methylidene]hydrazinylidene}-4-oxo-1 ,3-thiazolidin-5-yl acetic acid. Molbank 2018, M1009.

[0390] 46. Kelarev, V. I.; Silin, M. A.; Koshelev, V. N.; Kobrakov, K. I.; Rybina, I. I.; Korolev, V. K. Inhibition of biodegradation of hydrocarbon fuels and lubricant oils by nitrogen heterogeneous ring compounds. Khim. Tekhnol. (Moscow, Russ. Fed.) 2002, I Q- 13.

[0391] 47. Liesen, A. P.; de Aquino, T. M.; Goes, A. J. S.; de Lima, J. G.; de Faria, A. R.; Alves, A. J. Preparation methods, reactivity and biological importance of 4-thiazolidinones. Quim. Nova 2008, 31, 369-376.

[0392] 48. Maddry, J. A.; Ananthan, S.; Goldman, R. C.; Hobrath, J. V.; Kwong, C. D.; Maddox, C.; Rasmussen, L.; Reynolds, R. C.; Secrist, J. A., Ill; Sosa, M. I.; White, E. L.; Zhang, W. Antituberculosis activity of the Molecular Libraries Screening Center Network library. Tuberculosis (Oxford, U. K.) 2009, 89, 354-363.

[0393] 49. Patil, A. P.; Patel, T. K.; Patil, A. FL; Patil, C. S.; Patil, S. T.; Pawar, S. P. Chemistry & biological activities of 4-thiazolidinone. World J. Pharm. Pharm. Sci. 2015, 4, 1780-1791.

[0394] 50. Piscopo, E.; Diurno, M. V.; Gagliardi, FL; Mazzoni, O.; Veneruso, G. Studies on heterocyclic compounds: 1 ,3-thiazolidin-4-one derivatives. IV. Biological activity of variously substituted 2,3-diaryl- 1 ,3-thiazolidin-4-ones. Boll. - Soc. Ital. Biol. Sper. 1989, 65, 853.

[0395] 51 . Ramalingam, P.; Ganapaty, S.; Baburao, C.; Ravi, T. K. Impact of 4-thiazolidinones and 2-azetidinones on antimicrobial spectrum of nalidixic acid. Acta Cienc. Indica, Chem. 2006, 32, 433-436.

[0396] 52. Sharma, R.; Samadhiya, P.; Srivastava, S. D.; Srivastava, S. K. Conventional and Microwave Induced Synthesis of 4-Oxo-Thiazolidine Derivatives and Their Biological Activities. Proc. Natl. Acad. Sci., India, Sect. A 2012, 82, 211 -219.

[0397] 53. Vinay, V.; Lakshika, K. A review on anti microbial activity of 4-thiazolidinone derivatives. Int. J. Res. Pharm. Sci. (Jaipur, India) 2011, 1, 17-27.

[0398] 54. Chitre, T. S.; Patil, S. M.; Sujalegaonkar, A. G.; Asgaonkar, K. D.; Khedkar, V. M.; Garud, D. R.; Jha, P. C.; Gaikwad, S. Y.; Kulkarni, S. S.; Choudhari, A.; Sarkar, D. Non Nucleoside Reverse Transcriptase Inhibitors, Molecular Docking Studies and Antitubercular Activity of Thiazolidin-4-one Derivatives. Curr. Comput.-Aided Drug Des. 2019, 15, 433-444.

[0399] 55. Dash, S. Studies of inclusion complexes of 4-thiazolidinone derivatives with beta- cyclodextrin characterization, phase solubility and inclusion mode. Pharma Chem. 2021, 13, 17-23.

[0400] 56. El Zoeiby, A.; Sanschagrin, F.; Levesque, R. C. Structure and function of the Mur enzymes: development of novel inhibitors. Mol. Microbiol. 2003, 47, 1 -12.

[0401] 57. Elenich, I. P.; Rassukana, Y. V.; Khomutnik, Y. Y.; Kornet, M. M.; Brazhko, O. A.; Sinitsya, A. D.; Onis'ko, P. P. Synthesis, the antioxidant and antibacterial activity of fluoroalkyl substituted thiazolidinones and thiazinanones incorporating an aminophosphonate or aminocarboxylate fragment. Zh. Org. Farm. Khim. 2014, 12, 45-48.

[0402] 58. Khomami, A.; Rahimi, M.; Tabei, A.; Saniee, P.; Mahboubi, A.; Foroumadi, A.; Koopaei, N. N.; Almasirad, A. Synthesis and Docking Study of Novel 4- Thiazolidinone Derivatives as Anti-Gram-positive and Anti-H. pylori Agents. MiniRev. Med. Chem. 2019, 19, 239-249.

[0403] 59. Mohanta, R.; Sahu, S. K. Designing, synthesis and biological evaluation of some 5- mercapto pyrimidine derivatives. Int. J. Drug Dev. Res. 2012, 4, 352-358.

[0404] 60. Murthy, N. S.; Srinivasa, V. Screening of new synthetic thiazolidin-4-ones for anti- inflammatory activity in albino rats. Indian J. Pharmacol. 2003, 35, 61-62.

[0405] 61. Patel, R. B.; Patel, K. D.; Trivedi, J. J.; Trivedi, B. K. Antibacterial activity of bis(thiazolidinones). J. Inst. Chem. (India) 1982, 54, 85. 62. Kumar, D.; Kumar, V.; Mundlia, J.; Pradhan, D.; Malik, S. Thiazolidin-4-one Derivatives as Central Nervous System Potential Agents. Cent. Nerv. Syst. Agents Med. Chem. 2015, 15, 23-27.

[0406] 63. Barreca, M. L.; Chimirri, A.; De Clercq, E.; De Luca, L.; Monforte, A.-M.; Monforte, P.; Rao, A.; Zappala, M. Anti-HIV agents: design and discovery of new potent RT inhibitors. Farmaco 2003, 58, 259-263.

[0407] 64. Manvar, D.; Kucukguzel, I.; Erensoy, G.; Tatar, E.; Deryabasogullari, G.; Reddy, H.; Talele, T. T.; Cevik, O.; Kaushik-Basu, N. Discovery of conjugated thiazolidinone- thiadiazole scaffold as antidengue virus polymerase inhibitors. Biochem. Biophys. Res. Commun. 2016, 469, 743-747.

[0408] 65. Petrou, A.; Eleftheriou, P.; Geronikaki, A.; Akrivou, M. G.; Vizirianakis, I. Novel thiazolidin-4-ones as potential non-nucleoside inhibitors of HIV-1 reverse transcriptase. Molecules 2019, 24, 3821.

[0409] 66. Rawal, R. K.; Kumar, A.; Siddiqi, M. I.; Katti, S. B. Molecular docking studies on 4- thiazolidinones as HIV-1 RT inhibitors. J. Mol. Model. 2007, 13, 155-161.

[0410] 67. Rawal, R. K.; Murugesan, V.; Katti, S. B. Structure-activity relationship studies on clinically relevant HIV-1 NNRTIs. Curr. Med. Chem. 2012, 19, 5364-5380.

[0411] 68. Roberts, M.; Whyteside, G.; Brae, A. Liver-specific inducible promoters comprising a CRE regulatory element capable of being bound and activated by a heterodimer of CAR and RXR and methods of use in gene therapy. W02020148555, 2020.

[0412] 69. Sokolova, A. S.; Yarovaya, O. I.; Bormotov, N. I.; Shishkina, L. N.; Salakhutdinov, N. F. Synthesis and antiviral activity of camphorbased 1 ,3-thiazolidin-4-one and thiazole derivatives as Orthopoxvirusreproduction inhibitors. MedChemComm 2018, 9, 1746-1753.

[0413] 70. Verma, A.; Saraf, S. K. 4-Thiazolidinone - A biologically active scaffold. Eur. J. Med. Chem. 2008, 43, 897-905.

[0414] 71. Zhang, Q.-q.; Liu, X.-y. Advances in new 4-thiazolidone derivatives and their antiviral activities. Yaoxue Jinzhan 2012, 36, 394-399.

[0415] 72. Malone, B., Urakova, N., Snijder, E.J. et al. Structures and functions of coronavirus replication-transcription complexes and their relevance for SARS-CoV-2 drug design. Nat Rev Mol Cell Biol 23, 21-39 (2022). https: / / doi.Org / 10.1038 / s41580- 021 -00432-z.

[0416] 73. Larners, M.M., Haagmans, B.L. SARS-CoV-2 pathogenesis. Nat Rev Microbiol 20, 270-284 (2022). https: / / doi.org / 10.1038 / s41579-022-00713-0

Claims

CLAIMS1. A compound represented by formula (I)Tor a pharmaceutically acceptable salt thereof, wherein:indicates a double bond and the configuration of the double bond can be E or Z;indicates a single bond or double bond, the configuration of carbon 5 can be R or S, if the bond is single, E or Z, if double;R1 = indolin-2-one-3-ylidene and substituted indolin-2-one-3-ylidene; aryl and substituted aryl; arylidene and substituted arylidene; linear, branched or cyclic alkyl with a number of carbons from 3 to 7, possibly containing heteroatoms; alkylidene, alkenylidene, branched or cyclic with a number of carbons from 3 to 7 possibly containing heteroatoms; alkynylidene;R2 = Linear, branched or cyclic alkyl with a number of carbon atoms from 3 to 7, possibly also combined with cycles containing heteroatoms, aryl, substituted aryl, aromatic and condensed heterocycles, arylidene, alkynylidene;R3 = Linear, branched or cyclic alkyl with a number of carbons from 3 to 7, aryl, substituted aryl, aromatic and condensed heterocycles, arylidene, alkynylidene; said compound being chosen among the compounds represented by formula (III):wherein:R7 = Arylidene, Alkylidene, AlkenylideneR8 = Ph or CyclohexylR9 = Benzenesulphonamide and among the compounds chosen in the Group consisting of:4-(((Z)-5-((Z)-5-chloro-2-oxoindolin-3-ylidene)-4-oxo-3-phenyl-thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC3a )4-(((Z)-5-((Z)- 7-fluoro-2-oxoindoline-3-ylidene)-4-oxo-3-phenyl-thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC3h )4-(((Z)-5-((Z)-5-nitro-2-oxoindolin-3-ylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EM AC3b )4-(((Z)-5-( (Z)-5-bromo-2-oxoindoline-3-ylidene)-4 -oxo-3-phenyl-thiazolidin-2- ylidene)amino)benzenesulphonamide (EM AC3d )4-(((Z)-5-( (Z)-5-methoxy-2-oxoindoline-3-ylidene)-4-oxo-3-phenyl-thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC3e )4-(((Z)-5-( (Z)-5-fluoro-2-oxoindoline-3-ylidene)-4-oxo-3-phenyl-thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC3c )4-(((Z)-5-((Z)- 7-bromo-2-oxoindoline-3-ylidene)-4 -oxo-3-phenyl-thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC3I )4-(((Z)-4-oxo-5-((Z)-2-oxoindolin-3-ylidene)-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EM AC3g )4-(((Z)-5-((Z)-5-methyl-2-oxoindoline-3-ylidene)-4-oxo-3-phenyl-thiazolidin-2- ylidene)amino)benzenesulphonamide (EM AC3f )- 4-(((Z)-5-((Z)-5-chloro-2-oxoindoline-3-ylidene)-3-(4-fluorophenyl)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EMAC7a )- 4-(((Z)-3-(4-fluorophenyl)-5-((Z)-5-nitro-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC7b )- 4-(((Z)-5-((Z)-5-fluoro-2-oxoindoline-3-ylidene)-3-(4-fluorophenyl)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC7c )- 4-(((Z)-5-((Z)-5-bromo-2-oxoindoline-3-ylidene)-3-(4-fluorophenyl)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EMAC7d )4-(((Z)-3-(4-fluorophenyl)-5-((Z)-5-methoxy-2-oxoindoline-3-ylidene)-4- oxothiazolidin-2-ylidene)amino)benzenesulphonamide (EMAC7e)- 4-(((Z)-3-(4-fluorophenyl)-5-((Z)-5-methyl-2-oxoindoline-3-ylidene)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EM AC7f )4-(((Z)-3-(4-fluorophenyl)-4-oxo-5-((Z)-2-oxoindoline-3-ylidene)-thiazolidin-2- ylidene)amino)benzenesulphonamide (EM AC7g )- 4-(((Z)-5-((Z)-7-fluoro-2-oxoindoline-3-ylidene)-3-(4-fluorophenyl)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EM AC7h )- 4-(((Z)-5-((Z)-7-bromo-2-oxoindoline-3-ylidene)-3-(4-fluorophenyl)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EMAC7i )- 4-(((Z)-5-((Z)-5-chloro-2-oxoindoline-3-ylidene)-3-(4-chlorophenyl)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EM AC8a )- 4-(((Z)-3-(4-chlorophenyl)-5-((Z)-5-nitro-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC8b )- 4-(((Z)-3-(4-chlorophenyl)-5-((Z)-5-fluoro-2-oxoindoline-3-ylidene)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EM AC8c )- 4-(((Z)-5-((Z)-5-bromo-2-oxoindoline-3-ylidene)-3-(4-chlorophenyl)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EM AC8d )4-(((Z)-3-(4-chlorophenyl)-5-((Z)-5-methoxy-2-oxoindoline-3-ylidene)-4- oxothiazolidin-2-ylidene)amino)benzenesulphonamide (EMAC8eJ- 4-(((Z)-3-(4-chlorophenyl)-5-((Z)-5-methyl-2-oxoindoline-3-ylidene)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EM AC8f )4-(((Z)-3- (4-chlorophenyl) -4-oxo-5-( (Z) -2-oxoindoline-3-ylidene)-thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC8g )- 4-(((Z)-3-(4-chlorophenyl)-5-((Z)-7-fluoro-2-oxoindoline-3-ylidene)-4-oxothiazolidin- 2-ylidene)amino)benzenesulphonamide (EM AC8h )4-(((Z)-3- (4-chlorophenyl) -4-oxo-5-( (Z) -2-oxoindoline-3-ylidene)-thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC8i )- (Z)-5-((Z)-5-chloro-2-oxoindoline-3-ylidene)-3-phenyl-2-(phenylimino)-thiazolidin-4- one (EMAC9a,l- (Z)-5-((Z)-5-nitro-2-oxoindolin-3-ylidene)-3-phenyl-2-(phenylimino)-thiazolidin-4-one(EMAC9bJ(Z)-5-((Z)-5-fluoro-2-oxoindolin-3-ylidene)-3-phenyl-2-(phenylimino)-thiazolidin-4- one (EMAC9c,l(Z)-5-((Z)-5-bromo-2-oxoindolin-3-ylidene)-3-phenyl-2-(phenylimino)-thiazolidin-4- one (EMAC9d,l- (Z) -5-( (Z)-5-methoxy-2-oxoindolin-3-ylidene)-3-phenyl-2- (phenylimino)-thiazolidin-4- one (EMACQe)(Z) -5-( (Z)-5-methyl-2-oxoindolin-3-ylidene)-3-phenyl-2- (phenylimino)-thiazolidin-4- one (EMAC9fJ(Z)-5-((Z)-2-oxoindoline-3-ylidene)-3-phenyl-2-(phenylimino)thiazolidin-4-one(EMAC9gJ(Z)-5-((Z)-7-fluoro-2-oxoindolin-3-ylidene)-3-phenyl-2-(phenylimino)-thiazolidin-4- one (EMAC9h,l(Z)-5-((Z)-7-bromo-2-oxoindolin-3-ylidene)-3-phenyl-2-(phenylimino)-thiazolidin-4- one (EMAC9i,l4-(((Z)-5-((Z)-5-chloro-2-oxoindolin-3-ylidene)-3-ethyl-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC4a )4-(((Z)-3-ethyl-5-((Z)-5-nitro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC4b )4-(((Z)-3-ethyl-5-((Z)-5-fluoro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC4c )4-(((Z)-5-((Z)-5-bromo-2-oxoindoline-3-ylidene)-3-ethyl-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC4d )4-(((Z)-3-ethyl-5-((Z)-5-methoxy-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC4e )4-(( (Z)-3-ethyl-5-( (Z) -5-methyl-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide fEM AC4f )4-(((Z)-3-ethyl-4-oxo-5-((Z)-2-oxoindolin-3-ylidene)thiazolidin-2- ylidene)amino)benzenesulfonamide fEM AC4g )4-(((Z)-3-ethyl-5-((Z)-7-fluoro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide fEM AC4h )4-(((Z)-5-((Z)-7-bromo-2-oxoindolin-3-ylidene)-3-ethyl-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide fEM AC4i )4-(((Z)-5-((Z)-5-chloro-2-oxoindoline-3-ylidene)-3-cyclopropyl-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide fEM AC6a )4-(( (Z)-3-cyclopropyl-5-( (Z) -5-nitro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide fEM AC6b )4-(((Z)-3-cyclopropyl-5-((Z)-5-fluoro-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide fEM AC6c )4-(((Z)-5-((Z)-5-bromo-2-oxoindoline-3-ylidene)-3-cyclopropyl-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC6d )- 4-(((Z)-3-cyclopropyl-5-((Z)-5-methoxy-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC6e )4-(( (Z)-3-cyclopropyl-5-( (Z) -5-methyl-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC6f )4-(((Z)-3-cyclopropyl-4-oxo-5-((Z)-2-oxoindoline-3-ylidene)thiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC6g )4-(((Z)-3-cyclopropyl-5-((Z)-7-fluoro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EMAC6h )4-(((Z)-5-((Z)-7-bromo-2-oxoindoline-3-ylidene)-3-cyclopropyl-4-oxothiazolidin-2- ylidene)amino)benzenesulfonamide (EM AC6i )- N-((4-(((Z)-5-((Z)-1-acetyl-5-nitro-2-oxoindolin-3-ylidene)-4-oxo-3-phenylthiazolidin- 2-ylidene)amino)phenyl)sulfonyl)acetamide (EMAC3.1 bjN-((4-(( (Z)-5-((Z)-7-bromo-2-oxoindolin-3-ylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)phenyl)sulfonyl)acetamide (EM AC3.2i )- N-((4-(((Z)-5-((Z)-1 -acetyl-5-nitro-2-oxoindolin-3-ylidene)-3-ethyl-4-oxothiazolidin-2- ylidene)amino)phenyl)sulfonyl)acetamide (EMAC4.1 bjN-((4-(((Z)-5-((Z)-7-bromo-2-oxoindolin-3-ylidene)-3-ethyl-4-oxothiazolidin-2- ylidene)amino)phenyl)sulfonyl)acetamide (EM AC4.2i )4-(((2Z)-5-(4-bromobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 OaJ4-(((2Z)-5-(2,4-dichlorobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 ObJ4-(((2Z)-5-(4-(tert-butyl)benzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Oc )4-(((2Z)-5-(2-methoxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Od )4-(((2Z)-5-(4-fluorobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 OeJ4-(((2Z)-5-(4-methoxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Of J4-(((2Z)-5-(3-nitrobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Oh )4-(((2Z)-5-(3-methylbenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Oi ) 4-(((2Z)-4-oxo-3-phenyl-5-(3,4,5-trimethoxybenzylidene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 OjJ4-(((2Z)-5-(4-hydroxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 OkJ4-(((2Z)-5-((1 H-indole-3-yl)methylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 OI )4-(((2Z)-4-oxo-3-phenyl-5-(quinolin-4-ylmethylene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Om )4-(((2Z)-5-(naphthalene- 1 -ylmethylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 Oo )4-(((2Z)-5-((4-methoxynaphthalene- 1 -yl)methylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC1 OpJ4-(((2Z)-5-(4-cyanobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11aJ4-(((2Z)-5-(4-methylbenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 bj4-(((2Z)-5-(3,4-dichlorobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 cj4-(((2Z)-5-(2,6-dichlorobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 d )4-(((2Z)-5-(3-methoxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide fEMACI 1eJ4-(((2Z)-5-(3,4-dimethoxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 f J4-(((2Z)-5-(3,4-difluorobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 g )4-(((2Z)-5-(4-nitrobenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 h J4-(((2Z)-5-(2-methylbenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 i )4-(((2Z)-5-(4-ethoxy-3-methoxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide fEMAC11 jj4-(((2Z)-5-(4-hydroxy-3-methoxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 kJ4-(((2Z)-5-(3-hydroxybenzylidene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC111 )4-(((2Z)-5-((1 -methyl-1 H-indol-3-yl)methylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 mJ4-(((2Z)-4-oxo-3-phenyl-5-(quinoline-3-ylmethylene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 nJ4-(((2Z)-5-(naphthalene-2-ylmethylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 oj4-(((2Z)-5-((2-methoxynaphthalene- 1 -yl)methylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 pj4-(((2Z)-5-((2-methoxynaphthalene- 1 -yl)methylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 qj4-(((2Z)-5-((6-methoxynaphthalene-2-yl)methylene)-4-oxo-3-phenylthiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC11 rj4-(((Z)-5-((Z)-5-chloro-2-oxoindoline-3-ylidene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5a J4-(((Z)-3-cyclohexyl-5-((Z)-7-fluoro-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5h J4-(((Z)-3-cyclohexyl-5-((Z)-5-nitro-2-oxoindolin-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5b J4-(((Z)-5-((Z)-5-bromo-2-oxoindoline-3-ylidene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5d J4-(((Z)-3-cyclohexyl-5-((Z)-5-methoxy-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5e J4-(((Z)-3-cyclohexyl-5-((Z)-5-fluoro-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5c J4-(((Z)-5-((Z)-7-bromo-2-oxoindoline-3-ylidene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5i J4-(( (Z)-3-cyclohexyl-4-oxo-5-( (Z) -2-oxoindoline-3-ylidene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5g J4- (( (Z)-3-cyclohexyl-5-( (Z) -5-methyl-2-oxoindoline-3-ylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC5TJ4-(((Z)-5-((Z)-5-chloro-2-oxoindolin-3-ylidene)-4-oxo-3-(2-(piperidin- 1 - yl)ethyl)thiazolidin-2 -ylidene)amino)benzonitrile (EMAC16a J 4-(((Z)-5-((Z)-7-bromo-2-oxoindoline-3-ylidene)-3-(2-morpholinoethyl)-4- oxothiazolidin-2-ylidene)amino)benzonitrile (EMAC16i )4-(((Z)-3-(2-morpholinoethyl)-5-((Z)-5-nitro-2-oxoindoline-3-ylidene)-4- oxothiazolidin-2-ylidene)amino)benzonitrile (EMAC16bJ(Z) -5-( (Z)-5-chloro-2-oxoindoline-3-ylidene)-3- (2-morpholinoethyl) -2- (phenylimino)thiazolidin-4-one (EMAC17aJ(Z)-3- (2-morpholinoethyl)-5-( (Z) -5-nitro-2-oxoindolin-3-ylidene)-2- (phenylimino)thiazolidin-4-one (EMAC17bJ(Z)-5- ( (Z) - 7-bromo-2-oxoindolin-3-ylidene)-3- (2-morpholinoethyl) -2- (phenylimino)thiazolidin-4-one (EMAC17i )4-(((2Z)-5-(4-bromobenzylidene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12a ) 4-(((Z)-3-cyclohexyl-5-((Z)-2,4-dichlorobenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12bJ4-(((2Z)-5-(4-(tert-butyl)benzylidene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12cJ4- (( (2Z) -3-cyclohexyl-5-(2-methoxybenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12d )4-(((2Z)-3-cyclohexyl-5-(4-fluorobenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12e)4-(((2Z)-3-cyclohexyl-5-(4-methoxybenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12f )4-(((2Z)-3-cyclohexyl-5-(3-nitrobenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12h )4-(((2Z)-3-cyclohexyl-5-(3-methylbenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12i ) 4-(((2Z)-3-cyclohexyl-4-oxo-5-(3,4,5-trimethoxybenzylidene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12]^)4- (( (2Z)-5-( ( 1 H-indole-3-yl)methylene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12I )4-(((2Z)-3-cyclohexyl-4-oxo-5-(quinolin-4-ylmethylene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12m )4-(((2Z)-3-cyclohexyl-5-(naphthalene- 1 -ylmethylene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12o )- 4-(((2Z)-3-cyclohexyl-5-((4-methoxynaphthalene- 1 -yl)methylene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC12pJ4-(((2Z)-5-(4-cyanobenzylidene)-3-cyclohexyl-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13a )4-(((2Z)-3-cyclohexyl-5-(4-methylbenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13bJ4-(((Z)-3-cyclohexyl-5-((Z)-3,4-dichlorobenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13c )4-(( (2Z) -3-cyclohexyl-5-(2, 6-dichlorobenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13d )4-(( (2Z) -3-cyclohexyl-5-(3-methoxybenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13eJ4-(((2Z)-3-cyclohexyl-5-(3,4-dimethoxybenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13f )4-(((2Z)-3-cyclohexyl-5-(4-nitrobenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13h )4-(((2Z)-3-cyclohexyl-5-(2-methylbenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13i )4-(((2Z)-3-cyclohexyl-5-(4-ethoxy-3-methoxybenzylidene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13]^)4-(((2Z)-3-cyclohexyl-5-(( 1 -methyl- 1 H-indole-3-yl)methylene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13m )4-(( (2Z) -3-cyclohexyl-4-oxo-5-(quinoline-3-ylmethylene)thiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13n )4-(((2Z)-3-cyclohexyl-5-(naphthalene-2-ylmethylene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13o )- 4-(((2Z)-3-cyclohexyl-5-((2-methoxynaphthalene- 1 -yl)methylene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13pJ4-(((2Z)-3-cyclohexyl-5-((3,8-dimethoxynaphthalene-2-yl)methylene)-4- oxothiazolidin-2-ylidene)amino)benzenesulphonamide (EMAC13qJ- 4-(((2Z)-3-cyclohexyl-5-((6-methoxynaphthalene-2-yl)methylene)-4-oxothiazolidin-2- ylidene)amino)benzenesulphonamide (EMAC13r / 2. The compound according to claim 1 for use in the medical field.

3. A composition comprising a compound according to any one of claims 1 -2 and a pharmaceutically acceptable vehicle.

4. The composition according to the previous claim in form of tablets, pastilles, dispersions, suspensions, solutions, capsules, creams, ointments and aerosols.

5. The composition according to any one of claims 3-4 wherein the compound is in combination with controlled release means and / or dispensing devices.

6. The composition according to any one of claims 3-4 for oral, rectal, topical, parenteral, subcutaneous, intramuscular, intravenous, ocular, pulmonary, nasal or buccal inhalation administration.

7. The composition according to any one of claims 3-6 which is administered in combination with other drugs, preferably chosen from broad-spectrum viral inhibitors, inhibitors of viral proteases and / or polymerases, steroidal and non-steroidal anti- inflammatories, antipyretics, mucolytics, decongestants, antihistamines, anti-IL, molecules capable of improving half-life and bioavailability of the active ingredients, even more preferably chosen from Remdesivir, Molnupirnavir, Nirmaltrevir, Ritonavir and related mixtures.

8. The composition according to any one of claims 3-7 for use in the medical field.

9. The compound or composition according to any one of claims 1 -8 for use in a method for treating and preventing viral infections.

10. The compound or the composition according to any of claims 1 -8 for use according to the previous claim wherein the viral infection is an infection by SARS-CoV, SARS- CoV-2, MERS, hCoVs, Rhinoviruses and viruses transmitted by arthropods belonging to the genus Flavivirus, Zika Virus, West Nile Virus, Dengue Virus, Yellow Fever Virus.

11. A pressurized package or nebulizer or inhaler device comprising the compound or composition according to the preceding claims.