Methods for avoiding maltitol-mediated growth inhibition

Abstract

The present invention relates to the use of specific strains of Streptococcus thermophilus to reduce the negative impact of the presence of disaccharide sugar alcohols during fermentation of a milk-based product, as well as methods for identifying specific strains of Streptococcus thermophilus, method for the preparation of a fermented milk-based product comprising disaccharide sugar alcohols, as well as methods for reducing the negative impact of the presence of disaccharide sugar alcohols during fermentation of a milk-based products.

Description

[0001] METHODS FOR AVOIDING MALTITOL-MEDIATED GROWTH INHIBITION FIELD OF THE INVENTION The present invention relates to the use of specific strains of Streptococcus ther- mophilus to reduce the negative impact of the presence of disaccharide sugar alcohols during fermentation of a milk-based product, as well as methods for identifying specific strains of Streptococcus thermophilus, method for the preparation of a fermented milk- based product comprising disaccharide sugar alcohols, as well as methods for reducing the negative impact of the presence of disaccharide sugar alcohols during fermentation of a milk-based products. BACKGROUND OF THE INVENTION The food trend of natural-everything is seeping into the sugar avoidance trend as consumers desire natural solutions to less sugar. Sweetener blends deliver the sweet spot in reduced-sugar dairy applications and maltitol is one of natural sweeteners chosen by many customers. However, the presence of maltitol seems to significantly delay the fermentation time of commercial starter cultures, for example, YO-MIX 883 and YO-MIX PRIME 800. This delay mainly occurs at lag phase of the strains during milk acidification. After screening of commercial strains, this maltitol-caused growth inhibition seems to be quite common in Streptococcus thermophilus strains. SUMMARY OF THE INVENTION It is an object of embodiments of the invention to provide solutions for mitigating the negative impact of the presence of disaccharide sugar alcohols, such as maltitol, iso- malt or lactitol during the fermentation of a milk-based products. The present invention relates in a broad aspect to a new use of sucrose-negative Streptococcus thermophilus strains for reducing the negative impact of the presence of a disaccharide sugar alcohol, when using such strains. The present invention furthermore relates in a broad aspect to a method for iden- tifying new sucrose-negative Streptococcus thermophilus strains, methods for the prepa- ration of a fermented milk-based product comprising disaccharide sugar alcohols, such as maltitol, as well as methods for reducing the negative impact of the presence of disaccha- ride sugar alcohols, such as maltitol during fermentation. Accordingly, in a first aspect the present invention relates to the use of a sucrose- negative Streptococcus thermophilus strain to reduce the negative impact of the presence of a disaccharide sugar alcohol, such as maltitol, isomalt or lactitol during fermentation of a milk-based product with said strain. In a second aspect the present invention relates to a method for identifying a su- crose-negative Streptococcus thermophilus strain, which method comprises the step of screening for and identifying Streptococcus thermophilus strains insensitive or with re- duced sensitivity to a disaccharide sugar alcohol, such as maltitol, isomalt or lactitol. In a third aspect the present invention relates to a method for the preparation of a fermented milk-based product comprising a disaccharide sugar alcohol, such as malt- itol, isomalt or lactitol, the method comprising the fermentation of a milk-based substrate with a lactic acid bacteria starter culture in the presence of at least about 0.01% w / v of sucrose. In a further aspect the present invention relates to a method for reducing the negative impact of the presence of a disaccharide sugar alcohol, such as maltitol, isomalt or lactitol during fermentation of a milk-based product with a lactic acid bacteria starter culture, the method comprising the step of adding at least about 0.01% (w / v) of sucrose to the milk base before or during fermentation. DETAILED DESCRIPTION OF THE INVENTION The present inventors have found that sucrose uptake is associated with maltitol sensitivity of Streptococcus thermophilus strains. The present inventors therefore found that the maltitol-mediated growth inhibition could be annealed either by blocking genes of the sucrose regulon, such as the sucrose phosphotransferase system via scrA and scrB gene or by adding as low as 0.01% (w / v) of sucrose to block maltitol transportation. Accordingly, in a broad aspect the present invention relates to the use of a su- crose-negative Streptococcus thermophilus strain to reduce the negative impact of the presence of a disaccharide sugar alcohol, such as maltitol, isomalt or lactitol during fer- mentation of a milk-based product with said strain. In some embodiments the sucrose-negative Streptococcus thermophilus strain is carrying one or more mutations selected from the group consisting of: 1) one or more mutation in one or more gene of the sucrose regulon; which mutation provides for a significant reduction in the ability to grow on and / or transport sucrose by said strain; and which mutation at least comprises i) one or more of the scrA gene, and / or the scrB gene and / or the scrR gene, and ii) optionally a further mutation in the promoter region regulating the expression of the scrA, scrB and / or scrR genes, such as a mutation that protect the strain from re- versing from the sucrose negative phenotype; and 2) optionally one or more further mutation affecting the glucose porter, such as affecting glcU and / or its expression, which mutation restores or improves glucose consumption of said strain when grown on glucose as the sole source of carbohydrates. In some embodiments the sucrose-negative, Streptococcus thermophilus strain has one or more mutation in the sucrose regulon in one or more of the scrA gene and the scrB gene. In some embodiments the mutation in one or more gene of the sucrose regu- lon is in the scrA gene effectively disrupting gene function, such as an insertion or dele- tion resulting in a frameshift of the open reading frame of the gene coding for the EI- IABCSucrose protein leading to the translation of a truncated EIIABCSucrose protein encoded by the scrA gene, such as a mutation by insertion or deletion of a nucleotide, such as at or around a nucleotide corresponding to position 133 of SEQ ID NO:1, in the open-read- ing-frame (ORF) of the scrA gene. In some embodiments the strain has a mutation in the promoter region regulating the expression of any one of the scrA, scrB and / or scrR genes. In some embodiments the mutation is a SNP in the promoter region of the scrA and / or scrB genes, such as a SNP in the promoter region of the scrB gene, such as a mutation near the -10 and -35 sequence of the promoter, such as a mutation of T to G corresponding to position 38 of SEQ ID NO:2 upstream of the scrB promoter, such as a mutation that will comprise the entire se- quence identified by SEQ ID NO:2 or a variant sequence being at least about 90%, such as at least about 95% identical herewith (pscrB829). Other aspects of the invention relates to a lactic acid bacteria starter culture for the fermentation of a milk-based substrate in the presence of a disaccharide sugar alco- hol, such as maltitol, isomalt or lactitol. In some embodiments the lactic acid bacteria starter culture comprises or consists of at least one Streptococcus thermophilus strain as defined herein, and optionally at least one Lactobacillus strain such as at a Lactobacillus delbrueckii subp bulgaricus strain, such as at a Lactobacillus acidophilus, such as at a Lactobacillus helveticus, optionally at least one Lactiplantibacillus strain such as at a Lactiplantibacillus plantarum, optionally at least one Lacticaseibacillus strain such as at a Lacticaseibacillus casei, such as at a Lacti- caseibacillus paracasei, such as at a Lacticaseibacillus rhamnosus, optionally at least one Limosilactobacillus strain, such as at a Limosilactobacillus fermentum, optionally at least one Leuconostoc strain, such as at a Leuconostoc mesenteroides, and optionally at least one Bifidobacterium strain, such as at a Bifidobacterium animalis subsp. animalis, such as at a Bifidobacterium animalis subsp. lactis. In some embodiments the milk-based product is a dairy product, such as a yoghurt, a cheese, a buttermilk, quark, a sour cream, kefir, a fermented whey-based be- verage, a koumiss, a milk beverage, a yoghurt drink, a fermented milk, a matured cream, a fromage frais, a milk, a dairy product retentate, a processed cheese, a cottage cheese, a cream dessert. In some embodiments the disaccharide sugar alcohol, such as maltitol, isomalt or lactitol is present in an amount of at least about 1% w / v, such as at least about 1.2% w / v, such as at least about 1.4% w / v, such as at least about 1.6% w / v, such as at least about 1.8% w / v, such as at least about 2.0% w / v, such as at least about 2.2% w / v, such as at least about 2.4% w / v, such as at least about 2.6% w / v, such as at least about 2.8% w / v, such as at least about 3.0% w / v, such as at least about 3.5% w / v, such as at least about 4.0% w / v, such as at least about 4.5% w / v, such as at least about 5.0% w / v, such as at least about 5.5% w / v, such as at least about 6.0% w / v. In dairy application, it is expected for the Streptococcus thermophilus strains used according to the invention to not consume sucrose, i.e. to have a sucrose-negative phe- notype. Accordingly, as used herein “sucrose-negative” when referring to the phenotype of a strain within the scope of the present invention is meant a strain with very limited or no ability to grow on a medium containing sucrose as a sole source of carbohydrate. This is measured by Test A described herein. In the present context a Streptococcus thermo- philus strain with very limited or no ability to grow on a medium containing sucrose as a sole source of carbohydrate refers to a strain wherein ratio of colonies forming (cfu) on sucrose (sucrose-positive colonies) compared to colonies forming (cfu) on lactose is be- low 10-2, such as below 10-3, 10-4, 10-5, 10-6, or 10-7 when tested with Test A described herein. As used herein a mutation that “provides for a significant reduction in the ability to grow on and transport sucrose” is a mutation in a strain that induces or helps to induce this strain to get a “sucrose-negative phenotype”. A Streptococcus thermophilus strain is considered “sucrose-positive phenotype” when its ratio of colonies forming (cfu) on sucrose (sucrose-positive colonies) compared to col- onies forming (cfu) on lactose are close to 1, or higher than 10-2when tested with Test A described herein. The sucrose-negative Streptococcus thermophilus strains used according to the pre- sent invention carrying one or more mutations selected from the group consisting of: 1) one or more mutation in one or more gene of the sucrose regulon; which mu- tation provides for a significant reduction in the ability to grow on and / or transport sucrose by said strain; and which mutation at least comprises i) one or more of the scrA gene, and / or the scrB gene and / or the scrR gene, and ii) optionally a further mutation in the promoter region regulating the expression of the scrA, scrB and / or scrR genes, such as a mutation that protect the strain from re- versing from the sucrose negative phenotype; and 2) optionally one or more further mutation affecting the glucose porter, such as affecting glcU and / or its expression, which mutation restores or improves glucose con- sumption of said strain when grown on glucose as the sole source of carbohydrates is specifically disclosed in the International Patent application PCT / EP2023 / 055363, which disclosure is hereby incorporated by reference in its entirety. In a particular embodiment of the invention, the milk-based product is a yoghurt. The term "yogurt" is defined according to French and European regulations, i.e., coagu- lated dairy products obtained by lactic acid fermentation with specific thermophilic lactic acid bacteria (i.e. Lactobacillus delbruekii subsp. bulgaricus and Streptococcus thermoph- ilus). By “milk-based substrate”, it is meant milk substrate of animal and / or plant origin. In a particular embodiment, the milk substrate is of animal origin, such as cow, goat, sheep, buffalo, zebra, horse, donkey, or camel, and the like. The milk may be in the native state, a reconstituted milk, a skimmed milk, or a milk supplemented with com- pounds necessary for the growth of the bacteria or for the subsequent processing of fer- mented milk, such as fat, proteins of a yeast extract, peptone and / or a surfactant, for ex- ample. In a particular embodiment, the milk substrate is commercial UHT milk (Ultra High Temperature treatment, i.e., 130°C few seconds), in particular supplemented with 3 % (w / w) of semi-skimmed milk powder, and pasteurized by heating, in particular during 10 ± 1 min. at 90 ± 0.2°C. In another embodiment, the milk substrate is of plant origin, i.e., is from extracts of plant material which have been treated or otherwise (vegetable milk), such as from leguminous plants (soya bean, chick pea, lentil and the like) or from oilseeds (colza, soya bean, sesame, cotton and the like), which extract contains proteins in solution or in colloidal suspension, which are coagulable by chemical action, by acid fermentation, and / or by heat. In another embodiment, the milk substrate is a mixture of animal milk(s) and of vegetable milk(s) as defined above. Therefore, the invention provides a dairy product, in particular dairy food product or dairy feed product, in particular fermented dairy product, in particular fermented dairy food product or fermented dairy feed product, obtainable or obtained by methods as de- scribed herein with a milk substrate. The invention also provides a dairy product, in par- ticular a fermented dairy product comprising a culture of the S. thermophilus strain of the invention or comprising a composition as defined herein. In a particular embodiment, the dairy product or fermented dairy product is or comprises a yoghurt, a cheese (such as an acid curd cheese, a hard cheese, a semi-hard cheese, a cottage cheese), a buttermilk, quark, a sour cream, kefir, a fermented whey-based beverage, a koumiss, a milk bever- age, a yoghurt drink, a fermented milk, a matured cream, a fromage frais, a milk, a dairy product retentate, a processed cheese, a cottage cheese, a cream dessert, or infant milk, preferably based on a milk substrate of animal and / or plant origin. The expression “milk-based substrate” or “milk substrate” encompasses raw and / or processed milk material that can be subjected to fermentation according to the method of the invention. Thus, useful milk substrates include, but are not limited to, so- lutions / suspensions of any milk or milk like products comprising protein, such as but not limited to whole or low fat milk, skim milk, reconstituted milk powder, condensed milk, dried milk, whey or whey permeate. The milk-based substrate, in particular the milk sub- strate, provided in step a) is typically previously treated, in particular by standardization, addition of additives [e.g., sugar, sweeteners and / or stabilisers], homogenization and / or heat-treatment [e.g., pasteurization]. Thus, the milk-based substrate, in particular the milk substrate, provided in step a) is inoculated with lactic acid bacteria starter culture. The term “inoculating” means that the lactic acid bacteria are added into the milk-based substrate, in particular into the milk substrate, such that the lactic acid bacteria are able to be metabolically active and pro- duce lactic acid when incubated. The expression “starter culture” means a composition comprising or consisting of one or more lactic acid bacteria, which are responsible for the acidification of the milk- based substrate, in particular of the milk substrate. The expression lactic acid bacteria (LAB) relates to food-grade bacteria producing lactic acid as the major metabolic end- product of carbohydrate fermentation, and are in the present invention for the acidifica- tion of milk, the formation of the milk coagulum and the texture of the fermented prod- uct. Typically, any lactic acid bacteria can be used herein as long as they are suitable to ferment milk-based substrate. In a particular embodiment, the lactic acid bacterium or bacteria of the starter culture is / are from a genus selected from the group consisting of Lactobacilli, Streptococci, Bifidobacterium, Lactococci and any mixture thereof. In a par- ticular embodiment of the invention, the lactic acid bacterium or bacteria of the starter culture is / are selected from the group consisting of Lactobacillus spp., Bifidobacterium spp., Streptococcus spp., Lactococcus spp or any mixture thereof. In a particular embodi- ment, the lactic acid bacterium or bacteria of the starter culture is / are selected from the group consisting of Streptococcus thermophilus, Lactobacillus delbrueckii subsp. bulgari- cus, Bifidobacterium animalis, Bifidobacterium breve, Lactobacillus acidophilus, Lactoba- cillus casei, Lactobacillus plantarum, Lactobacillus helveticus, Lactococcus lactis and any mixture of 2, 3 or 4 of these strains. In a particular embodiment, the lactic acid starter culture comprises or consists of - as microorganism - Streptococcus thermophilus. In a particular embodiment, the lactic acid starter culture comprises or consists of – as micro- organisms - Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus. Starter cultures can be inoculated into the milk-based substrate under any form, such as under frozen, dried, freeze-dried, liquid or solid format, in the form of pellets or frozen pellets, or in the form of a powder or dried powder. In a particular embodiment of the invention, the milk-based substrate is inoculated with a starter culture under liquid form, for example as bulk starter [i.e., a culture previously propagated in a growth me- dium to obtain the required concentration of inoculation]. In a particular embodiment of the invention, the milk-based substrate is directly inoculated with a starter culture under the form of concentrates, for example frozen or dried concentrates. In a particular em- bodiment of the invention, the milk-based substrate is directly inoculated with a starter culture under liquid form as a dilution [e.g. in water or saline solution] of concentrates, such as of frozen or dried concentrates. The expression “directly inoculated” means that the starter culture is inoculated into the milk-based substrate without previous propaga- tion. The direct inoculation requires that the concentration of the starter culture be high enough. Thus, in a particular embodiment of the invention, the concentration of LAB in the frozen or dried concentrate as defined herein is in the range of 108 to 1012 cfu per g of concentrate, and more preferably at least 108, at least 109, at least 1010, at least 1011 or at least 1012 cfu / g of concentrate. Whatever the form of the LAB starter culture, the milk-based substrate is inocu- lated with a concentration of at least 105 cfu of lactic acid bacteria per g of milk-based substrate. In a particular embodiment, said milk-based substrate is inoculated at a con- centration of at least 106, at least 107 or at least 108 cfu of lactic acid bacteria per g of milk-based substrate. In a particular embodiment, said milk-based substrate is inoculated at a concentration between 105 to 108 cfu of lactic acid bacteria per g of milk-based sub- strate. A “disaccharide” or “disaccharide sugar” as used herein refers to the sugar formed when two monosaccharides are joined by glycosidic linkage. A “disaccharide sugar alco- hol” as used herein refers to a disaccharide sugar containing one hydroxyl group (–OH) attached to each carbon atom. Sucrose-negative Streptococcus thermophilus strains Sucrose-negative Streptococcus thermophilus strains suitable for the present use are specifically disclosed in the International Patent application PCT / EP2023 / 055363, which disclosure is hereby incorporated by reference in its entirety. Specifically, a sucrose-negative, Streptococcus thermophilus strain suitable for the present invention may be carrying one or more mutations selected from the group consisting of: 1) one or more mutation in one or more gene of the sucrose regulon; which mutation provides for a significant reduction in the ability to grow on and / or transport sucrose by said strain; and which mutation at least comprises i) one or more of the scrA gene, and / or the scrB gene and / or the scrR gene, and ii) optionally a further mutation in the promoter region regulating the expression of the scrA, scrB and / or scrR genes, such as a mutation that protect the strain from re- versing from the sucrose negative phenotype; and 2) optionally one or more further mutation affecting the glucose porter, such as affecting glcU and / or its expression, which mutation restores or improves glucose consumption of said strain when grown on glucose as the sole source of carbohydrates. In some embodiments such sucrose-negative, Streptococcus thermophilus strain suitable for the present invention has one or more mutation in the sucrose regulon in one or more of the scrA gene and the scrB gene. In some embodiments such mutation in one or more gene of the sucrose regulon is in the scrA gene effectively disrupting gene func- tion, such as an insertion or deletion resulting in a frameshift of the open reading frame of the gene coding for the EIIABCSucrose protein leading to the translation of a truncated EIIABCSucrose protein encoded by the scrA gene, such as a mutation by insertion or dele- tion of a nucleotide, such as at or around a nucleotide corresponding to position 133 of SEQ ID NO:1, in the open-reading-frame (ORF) of the scrA gene. In some embodiments such sucrose-negative, Streptococcus thermophilus strain suitable for the present invention has a mutation in the promoter region regulating the expression of any one of the scrA, scrB and / or scrR genes. In some embodiments such mutation is a SNP in the promoter region of the scrA and / or scrB genes, such as a SNP in the promoter region of the scrB gene, such as a mutation near the -10 and -35 sequence of the promoter, such as a mutation of T to G corresponding to position 38 of SEQ ID NO:2 upstream of the scrB promoter, such as a mutation that will comprise the entire se- quence identified by SEQ ID NO:2 or a variant sequence being at least about 90%, such as at least about 95% identical herewith (pscrB829). In some embodiments such sucrose-negative, Streptococcus thermophilus strain suitable for the present invention has a mutation affecting the glucose porter, which mu- tation restores or improves glucose consumption of said strain when grown on glucose as the sole source of carbohydrates, such as a full recovery of the growth on glucose as compared to that of a lactose-positive and sucrose-positive Streptococcus thermophilus parental strain. In some embodiments such mutation affecting the glucose porter is af- fecting glcU and / or its expression, such as located within the promoter region of glcU, such as mutations selected from a) an insertion of a T nucleotide in the poly-T region at position corresponding to position -75 of the glcU promoter identified as SEQ ID NO:3 (pglcUIN_T), such as a mutation that will contain a T nucleotide at position 102 of SEQ ID NO:4, such as a mutation comprising the entire sequence identified by SEQ ID NO:4 or a variant sequence being at least about 90%, such as at least about 95% identical herewith; b) an insertion of a C nucleotide in the poly-T region at position corresponding to position -75 of the glcU promoter identified as SEQ ID NO:3 (pglcUIN_C), such as a mutation that will contain a C nucleotide at position 102 of SEQ ID NO:5, such as a mutation that will comprise the entire sequence identified by SEQ ID NO:5 or a variant sequence being at least about 90%, such as at least about 95% identical herewith; c) a mutation of a T to a C nucleotide in the poly-T region at position corresponding to position -81 of the glcU promoter identified as SEQ ID NO:3 (pglcUSNP_C), such as a muta- tion that will contain a C nucleotide at position 96 of SEQ ID NO:6, such as a mutation that will comprise the entire sequence identified by SEQ ID NO:6 or a variant sequence being at least about 90%, such as at least about 95% identical herewith; d) an insertion of a sequence at a position corresponding to between nucleotide position 110 and 111 of the glcU promoter identified as SEQ ID NO:3, such as an insertion of a sequence identified by nucleotide 1 to 1321 of SEQ ID NO: 8, such as a mutation that will comprise the entire sequence identified by SEQ ID NO:7 or a variant sequence being at least about 90%, such as at least about 95% identical herewith or SEQ ID NO:8 or a vari- ant sequence being at least about 90%, such as at least about 95% identical herewith (pglcUIS). In some embodiments such sucrose-negative, Streptococcus thermophilus strain suitable for the present invention is selected from the group consisting of: - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosci- ences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH, on 18. January 2022 under number DSM34132; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosci- ences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH, on 18. January 2022 under number DSM34133; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosci- ences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH, on 18. January 2022 under number DSM34134; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosci- ences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH, on 18. January 2022 under number DSM34138; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosci- ences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH, on 18. January 2022 under number DSM34139; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosci- ences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH, on 18. January 2022 under number DSM34140; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosci- ences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH, on 18. January 2022 under number DSM34146; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosci- ences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH, on 18. January 2022 under number DSM34147; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosci- ences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH, on 16. February 2022 under number DSM34172; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosci- ences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH, on 6. February 2024 under number DSM34931; and - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosci- ences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH, on 6. February 2024 under number DSM34932. In a particular embodiment, a “variant sequence” of the strain as defined herein has a sequence identity of at least 90%, or at least 95% with reference to a specific SEQ ID NO referred to, or with the genome sequence of the parent strain from which the vari- ant sequence is obtained including or without including the specific mutation or insertion of the strain, in particular an identity of at least 90%, at least 91%, at least 95%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.92%, at least 99.94%, at least 99.96%, at least 99.98%, or at least 99.99% with the specific SEQ ID NO referred to, or with the genome sequence of the parent strain from which the variant is obtained. The identity is described in comparing the two sequences over their full- length (global alignment) and may be calculated using any program based on the Needle- man-Wunsch algorithm. The sucrose phosphoenolpyruvate-sugar phosphotransferase system (PTS) and the sucrose regulon The sucrose phosphoenolpyruvate-sugar phosphotransferase system (PTS) refers to the system used by bacteria for sugar uptake where the source of energy is from phosphoenolpyruvate (PEP). It consists of two non-specific energy-coupling components involved in all the PTSs, i.e. enzyme I (EI) and a heat-stable protein (HPr), and one su- crose-specific multi-domains permease EIIABCsucrose encoded by scrA, that internalizes su- crose as sucrose-6-phosphate. Three other genes are genetically associated to scrA (same genetic locus) on a sucrose regulon; namely scrB (codes for a sucrose-6-phos- phate hydrolase), scrR (encodes a GalR-LacI-type transcription regulator) and scrK (en- codes a Fructokinase). They are located on 2 operons that are divergently transcribed (scrAK on one side and scrBR on the other side) with the operon operator in between. The term “sucrose regulon” as used herein thus refers to the scrA gene and the genes genetically associated to scrA, namely scrB, scrR and scrK. In some embodiments the sucrose-negative phenotype, of the sucrose-negative, Streptococcus thermophilus strains suitable for the present invention, is conferred by a mutation in the scrA gene. This has been demonstrated with one single mutation (scrA829) in 3 different genetic backgrounds, which mutation is an insertion of one single base-pair (bp) in position 133 causing a frameshift of the open-reading-frame (ORF) with the con- sequence of a truncated EIIABCsucrose protein of 45 aa out of 539 aa for the native protein, which effectively is a gene disruption making the truncated protein product inactive. Thus, it may be expected that most frameshifts (insertions or deletions (indels), except insertion or deletion of 3 bp, and multiples of 3 bp) in the gene will have identical effect of gene disruption making the protein product inactive. SNPs (single nucleotide polymor- phism), in particular SNPs generating stop codons or that affecting amino acids involved in the catalytic site of the protein, are expected to have similar effects of affecting the en- zyme active sites and suppressing the activity. In some embodiments the sucrose-negative phenotype of the sucrose-negative, Streptococcus thermophilus strains suitable for the present invention, is conferred by a mutation in the scrB gene. In some embodiments the sucrose-negative phenotype is con- ferred by a mutation in the scrR gene. In some embodiments the one or more gene of the sucrose regulon involves one or more mutation in one or more of the genes scrA, scrB, and the scrR gene, disrupting the function of one or more of these genes. Mutations in the promoter region regulating the expression of the scrA, scrB and / or scrR genes. The pscrB region is the operator region driving the expression of the divergently transcribed genes of the sucrose-regulon. This promoter region drives the transcription of scrA and scrK on one side and scrB and scrR on the other side. We have characterized one single mutation referred to as “pscrB829”. This specific mutation was being transferred into multiple strains with the same phenotypical consequences, facilitating the strain su- crose-negative. The mutation is a SNP located in a region likely to be the promoter region of scrB (in the area likely to contain the -10 and -35 sequence of the promoter), or in particular a SNP in promoter region of scrAB leading to a transition of T to G, at position - 38 of scrB promoter. In some embodiments the sucrose-negative phenotype is conferred by a mutation in the pscrB region. Mutations affecting the glucose porter, such as affecting glcU and / or its expres- sion. Gene glcU encodes a non-PTS transporter (porter) of glucose, also referred to as the “non-PTS glucose permease” or simply the “glucose porter”. It has its own promoter region (pglcU). Some mutations in pglcU allow strains bearing the scrA829 and / or pscrB829 mutation to recover a growth rate on glucose similar to that of the parental strain. This has been characterized with 4 different mutations. One is a SNP, 2 are insertions at the same position but different nucleotide, and the 3rd is an insertion of an IS. All allowed the full recovery of the growth on glucose. Also, this has been characterized by mutations in 3 independent genetic backgrounds. All three strains fully recover the ability to grow on glucose. Accordingly, such a mutation of the glucose porter may restore or improve glucose consumption by the strain. As used herein “restores or improves glucose con- sumption” in relation to a mutation affecting the glucose porter by a strain refers to a strain, which after this mutation either recover from e.g., a mutation in the sucrose regu- lon to a growth rate similar to or higher than that of the parental strain without such mu- tation in the sucrose regulon, or alternative which mutation affecting the glucose porter of a strain just improve the strains’ ability to grow on glucose. In some embodiments, this term “restores or improves glucose consumption” means that such mutation will give the strain a glucose-positive phenotype and be considered glucose-positive as defined herein. The present applicant has performed reverse genetics on one pglcU mutant. The pglcU mutation in one of the mutants was reverted to the original wild-type (WT, paren- tal) sequence. This reversion resulted in a glucose slow-growing strain, demonstrating that the pglcU mutation by itself was responsible for the glucose-positive phenotype of the triple mutant (scrA, pscrB, pglcU). In addition, introducing through genetic engineer- ing in a sucrose-negative and glucose slow-growing strain, the pglcU mutation renders the strain glucose-positive. In one specific embodiment the mutation affecting the glucose porter is the mutation identified as pglcUIN_T, wherein the insertion of a T nucleotide in the poly-T at position corresponding to -75 of the glcU promoter restores / improves glucose uptake and consumption. In another specific embodiment the mutation affecting the glucose porter is the mutation identified as pglcUIN_C, wherein the insertion of a C nucleotide in the poly-T re- gion at position corresponding to -75 of the glcU promoter restores / improves glucose up- take and consumption. In another specific embodiment the mutation affecting the glucose porter is the mutation identified as pglcUSNP_C, wherein a mutation of a T to a C nucleotide in the poly- T region at position corresponding to -81 of the glcU promoter restores / improves glucose uptake and consumption. In another specific embodiment the mutation affecting the glucose porter is the mutation identified as pglcUIS, wherein an insertion of a sequence at a position corre- sponding to between nucleotide position 110 and 111 relative to the sequence of strain ST1-ABU4 identified herein or of ST1 identified by SEQ ID NO:3 of the glcU promoter, which insertion restores and / or improves glucose uptake and consumption. It is expected that a scrA829 mutation may have pleiotropic effects on the expres- sion of other genes involved in carbohydrate utilization. This effect is likely to take place at the transcription level (as suggested by the location of the mutation in pglcU, and by the common knowledge on the regulation of the catabolism of carbohydrate). Thus, a scrA829 mutation is likely to down regulate glcU expression, and mutation in pglcU, possi- bly reverts this down-regulation, possibly making the expression constitutive. SEQUENCES SEQ ID NO:1_partial scrA829 ATGGATTACAAACAAATTGCAAAAGAAGTCATCGAAGCCCTCGGTGGAC- GTGAAAATGTTAACAGTGTTGCTCACTGTGCGACACGTCTACGTGTTATGGTTAAAGATGAAAACA AAATCAATAAAGAAAAAAGCTGAGAATATTGAAAAAGTTCAAGG SEQ ID NO:2_pscrB829 ATTTAATAATCTCCTAATTTATTTATTAGTAATATAGGAAACGTTTTACCTA- GAAAAATCAACGATTTATAATAAGAAAACAAAAAAATGCTAAACGTTTGACATATGACAGAAAGAT GTTAAAATTAATATCGTAAAGAAAAGTGAAACGTTTTCAAAAACAAATTTTGTTAAA- GATGTTAAAATTGATATCGTAAAGAAAAGCGAAACGTTTTCAAAAACAAATTTTATTAAGGAGAAT TTTGCAA SEQ ID NO:3 CCAAATGGAGAACCGCCTCAAATGATAAATTTATTATTCAACACCAGTTGACGTAGAAC- CACAGTTATGGTTCTTGTGTATTTTTTTATCTCTTGTTTTTTCCCGAAATAAGAGTAATATAGAGCT ATGCTTAATTTTTTAGGTAAAAAATTATTTTAAAGAGGTAAATATAAAC SEQ ID NO:4 CCAAATGGAGAACCGCCTCAAATGATAAATTTATTATTCAACACCAGTTGACGTAGAAC- CACAGTTATGGTTCTTGTGTATTTTTTTATCTCTTGTTTTTTTCCCGAAATAAGAGTAATATAGAGCT ATGCTTAATTTTTTAGGTAAAAAATTATTTTAAAGAGGTAAATATAAAC SEQ ID NO:5 CCAAATGGAGAACCGCCTCAAATGATAAATTTATTATTCAACACCAGTTGACGTAGAAC- CACAGTTATGGTTCTTGTGTATTTTTTTATCTCTTGTTTTTTCCCCGAAATAAGAGTAATATAGAGC TATGCTTAATTTTTTAGGTAAAAAATTATTTTAAAGAGGTAAATATAAAC SEQ ID NO:6 CCAAATGGAGAACCGCCTCAAATGATAAATTTATTATTCAACACCAGTTGACGTAGAAC- CACAGTTATGGTTCTTGTGTATTTTTTTATCTCTTGCTTTTTCCCGAAATAAGAGTAATATAGAGCT ATGCTTAATTTTTTAGGTAAAAAATTATTTTAAAGAGGTAAATATAAAC SEQ ID NO:7 CCAAATGGAGAACCGCCTCAAATGATAAATTTATTATTCAACACCAGTTGACGTAGAACC ACAGTTATGGTTCTTGTGTATTTTTTTATCTCTTGTTTTTTCCCGAAATAGGTAGTGTAA AATAAGTTGTGTAAACACAAAAAGGAATAAATCCGTTATAGTAGAGTTGCAAAACATTAC TAGAAAGAGATTTATTCCTATGACTCCGTTTACCACAGAACTACTTAACTTCCTTGCCCA AAAGCAAGATATTGATGAATTTTTCCGTACTTCTCTTGAAACAGCTATGAATGATCTGCT TCAAGCAGAGTTATCAGCCTTTTTAGGGTATGAACCTTACGATAAATTAGGCTATAATTC TGGGAATAGTCGTAACGGAAGCTATGCACGGAAATTCGAAACCAAATATGGGACTGTTCA GTTGAGTATTCCTAGAGATCGTAATGGGAACTTTAGTCCAGCTTTGCTTCCCGCTTATGG ACGTCGAGATGACCACTTGGAAGAGATGGTTATCAAACTCTATCAAACCGGTGTAACGAC TCGAGAAATTAGTGATATCATCGAGCGAATGTATGGTCATCACTATAGTCCTGCCACAAT TTCTAATATCTCAAAAGCAACTCAGGAGAATGTCGCTACTTTTCATGAGCGAAGCTTAGA AGCCAATTACTCTGTTTTATTTCTTGACGGAACCTATCTTCCCTTAAGACGTGGAACCGT TAGTAAAGAATGTATTCATATCGCACTTGGCATTACACCAGAAGGACAGAAGGCTGTTCT TGGATATGAAATCGCTCCAAATGAAAACAATGCTTCTTGGTCCACCCTGTTAGACAAGCT TCAAAACCAAGGAATCCAACAGGTTTCTCTTGTAGTGACCGATGGCTTCAAGGGGCTTGA AGAGATTATCAATCAGGCTTACCCATTAGCTAAACAACAACGTTGCTTAATTCATATTAG TCGAAATCTAGCTAGTAAAGTGAAACGAGCAGATAGAGCGGTTATTCTGGAGCAATTTAA AACGATTTATCGTGCTGAAAATTTAGAAATGGCAGTGCAAGCTTTAGAGAACTTTATCGC CGAATGGAAACCAAAGTATAGGAAAGTCATGGAAAGTCTGGAGAATACGGATAATCTTTT AACTTTTTATCAGTTTCCCTACCAGATTTGGCATAGCATTTATTCGACAAACCTCATTGA GTCTCTTAACAAAGAAATCAAACGTCAAACGAAAAAGAAGGTCCTTTTTCCTAACGAGGA GGCTCTGGAACGTTATTTAGTTACCCTGTTTGAAGATTATAATTTCAAGCAAAATCAACG CATCCATAAAGGGTTTGGACAATGTACTGACACACTTGAAAGCTTATTTGATTAACATTC TTCAACTCTACTTGAGTGTTTACACATAATTATTGACAGTATCCCGAAATAAGAGTAATA TAGAGCTATGCTTAATTTTTTAGGTAAAAAATTATTTTAAAGAGGTAAATATAAAC SEQ ID NO:8: GGTAGTGTAAAATAAGTTGTGTAAACACAAAAAGGAATAAATCCGTTATAGTAGAGTTGC AAAACATTACTAGAAAGAGATTTATTCCTATGACTCCGTTTACCACAGAACTACTTAACT TCCTTGCCCAAAAGCAAGATATTGATGAATTTTTCCGTACTTCTCTTGAAACAGCTATGA ATGATCTGCTTCAAGCAGAGTTATCAGCCTTTTTAGGGTATGAACCTTACGATAAATTAG GCTATAATTCTGGGAATAGTCGTAACGGAAGCTATGCACGGAAATTCGAAACCAAATATG GGACTGTTCAGTTGAGTATTCCTAGAGATCGTAATGGGAACTTTAGTCCAGCTTTGCTTC CCGCTTATGGACGTCGAGATGACCACTTGGAAGAGATGGTTATCAAACTCTATCAAACCG GTGTAACGACTCGAGAAATTAGTGATATCATCGAGCGAATGTATGGTCATCACTATAGTC CTGCCACAATTTCTAATATCTCAAAAGCAACTCAGGAGAATGTCGCTACTTTTCATGAGC GAAGCTTAGAAGCCAATTACTCTGTTTTATTTCTTGACGGAACCTATCTTCCCTTAAGAC GTGGAACCGTTAGTAAAGAATGTATTCATATCGCACTTGGCATTACACCAGAAGGACAGA AGGCTGTTCTTGGATATGAAATCGCTCCAAATGAAAACAATGCTTCTTGGTCCACCCTGT TAGACAAGCTTCAAAACCAAGGAATCCAACAGGTTTCTCTTGTAGTGACCGATGGCTTCA AGGGGCTTGAAGAGATTATCAATCAGGCTTACCCATTAGCTAAACAACAACGTTGCTTAA TTCATATTAGTCGAAATCTAGCTAGTAAAGTGAAACGAGCAGATAGAGCGGTTATTCTGG AGCAATTTAAAACGATTTATCGTGCTGAAAATTTAGAAATGGCAGTGCAAGCTTTAGAGA ACTTTATCGCCGAATGGAAACCAAAGTATAGGAAAGTCATGGAAAGTCTGGAGAATACGG ATAATCTTTTAACTTTTTATCAGTTTCCCTACCAGATTTGGCATAGCATTTATTCGACAA ACCTCATTGAGTCTCTTAACAAAGAAATCAAACGTCAAACGAAAAAGAAGGTCCTTTTTC CTAACGAGGAGGCTCTGGAACGTTATTTAGTTACCCTGTTTGAAGATTATAATTTCAAGC AAAATCAACGCATCCATAAAGGGTTTGGACAATGTACTGACACACTTGAAAGCTTATTTG ATTAACATTCTTCAACTCTACTTGAGTGTTTACACATAATTATTGACAGTATCCCGAAAT A SEQ ID NO: 9: PCR amplification and DNA sequencing primer (scrAB-F1): TTA TTT AAC TGC GAT GAA GTC AT SEQ ID NO: 10: PCR amplification and DNA sequencing primer (scrAB-R3): CTA GTA TTT TAA GTC GAA GTA G SEQ ID NO: 11: idf-13508-F: TTTTCAATATTCTCAGCTTTTTT SEQ ID NO: 12: idf-13508-R: CCTAATTTATTTATTAGTAATATAGG STRAIN DEPOSITS: The following strains have been deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH, on 18. January 2022: Streptococcus thermophilus strain deposited under accession number DSM34133; and Streptococcus thermophilus strain deposited under accession number DSM34134. Deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen, GmbH on 6. February 2024: Streptococcus thermophilus strain deposited under accession number DSM34931; and Streptococcus thermophilus strain deposited under accession number DSM34932. EXAMPLES Test A (used to measure ability to grow on a medium containing sucrose as a sole source of carbohydrate): S. thermophilus strains to be tested were cultivated overnight at 37°C in 10 mL of M17 medium (Thermos Scientific™ Oxoid™, CM0785) containing 30 g / L of lactose. Cells from each culture were harvested by centrifugation (2100 g for 10 min at 4°C), the cell pellet was resuspended into 10 mL fresh sugar-free M17 medium. One hundred microliters of serial 10-fold dilutions of the cell suspension were used to seed the surface of agar plates of M17 medium containing 30 g / L of either lactose or sucrose. Upon incubation at 37°C under anaerobic conditions (in a sealed container using the Anaerocult® A system (Merck, Darmstadt, Germany)) for 24 hours, colonies grown on lactose and on sucrose were numerated. The ratio of colonies forming (cfu) on sucrose (sucrose-positive colo- nies) compare to lactose (lactose-positive colonies) was calculated. Example 1. Addition of 3% or higher percentage of maltitol significantly delayed yogurt fermentation Materials and methods M17 medium For Streptococcus thermophilus, the medium used is the M17 medium known to persons skilled in the art. The M17 medium has the following composition per H2O Ascorbic acid, 0.5 g Casein peptone (tryptic), 2.5 g Disodium -glycerophosphate pentahydrate, 19 g Magnesium sulfate hydrate, 0.25 g Meat extract, 5 g Meat peptone (peptic), 2.5 g Soyapeptone (papainic), 5 g Yeast extract, 2.5 g Final pH 7.1±0.2 (25oC) Carbon sources added are sterile lactose 10 g / l, sucrose 10 g / l, or lactose 10 g / l and maltitol 30 g / l Milk base 97% (w / w) fresh milk (3.2% protein, 3.8% fat and 5.0% carbohydrate) was added with 3% (w / w) maltitol or food-grade water as control. Mixed thoroughly for 30 min at room temperature, pasteurized at 95oC for 10 min, cooled down to 43oC as fermentation tem- perature. Experimental plan Preparation of Streptococcus thermophilus seeds used for milk fermentation. The 500 ml overnight grown strains were inoculated into indicated medium with 1% inoc- ulation volume and incubated for 24 h at 37oC. The strain culture was harvested by cen- trifugation (4,000 rpm, 10 min at room temperature), and washed twice with phosphate buffered saline (PBS) buffer, resuspended in 50 ml 10% glycerol and frozen at -80oC for further use. Yogurt sample preparation The 200 mL of milk base was inoculated with commercial YO-MIX series cultures or Streptococcus thermophilus strain at 20 DCU / 100L, if not specified. The fermentation was carried out at 43oC in water bath, and the pH was monitored by iCINAC system (Alliance Instruments, France; pH electrode Mettler 405 DPAS SC, Toledo, Spain). The pH was measured and recorded every 5 minutes and until 24 h. The following parameters are cal- culated: Ta stands for the half time for acidification, more precisely is the time needed for a re- duction of 0.08 pH units from the original pH. ½ Ta, therefore, means the time needed for a reduction of 0.04 pH units from the original pH. This a way to study the delay required for bacteria to really start the milk acidifica- tion, indicative of the lag phase of the Streptococcus thermophilus strain. Time to pH 4.60 (TpH4.60), is the time needed to reach pH 4.60, indicative of the fer- mentation time for bioprocess. Results Acidification of Yo-Mix cultures Table 1. Lag phase and fermentation time of Yo-Mix cultures in maltitol recipe Culture Recipe ½ Ta TpH4.60 (min) (min) Ctrl 35 241 Yo-Mix Prime800 3% Maltitol 190 447 Ctrl 36 300 Yo-Mix 885 3% Maltitol 303 613 Ctrl 48 300 Yo-Mix M11 3% Maltitol 289 492 Ctrl 33 268 Yo-Mix PRIME900 3% Maltitol 123 542 Ctrl 38 262 Yo-Mix 883 3% Maltitol 204 637 Ctrl 29 241 Yo-Mix 495 3% Maltitol 144 706 Yo-Mix series and Yo-Mix PRIME series are commercial starter cultures from IFF, usually are the mixture of Streptococcus thermophilus and Lactobacillus delbrucekii subsp. bul- garicus strains. As will appear from Table 1 the ½ Ta and TpH4.60 of cultures with addition of maltitol in the milk base will significantly longer than in control. Thus, the maltitol has negative im- pact of the yogurt fermentation. Acidification of Streptococcus thermophilus strains. Table 2. Lag phase of Streptococcus thermophilus strains in maltitol recipe Strain name Ctrl (min) 3% Maltitol (min) DSM32823 44 52 DSM28257 66 331 DSM33849 38 204 DSM33829 41 284 DSM34180 32 249 CNCM I-2425 35 286 DSM34172 35 295 DSM27029 33 402 ST1 58 79 ST2 37 136 ST3 55 257 ST4 40 193 ST5 39 201 ST6 31 164 ST7 35 199 ST8 31 192 ST9 39 271 ST10 36 268 ST11 35 286 ST12 33 277 ST13 33 296 Table 3. Fermentation time of Streptococcus thermophilus strains in maltitol recipe Ctrl (min) 3% Maltitol (min) DSM32823 257 293 DSM28257 398 690 DSM33849 258 530 DSM33829 284 489 DSM34180 260 643 CNCM I-2425 315 654 DSM34172 357 747 ST1 429 573 ST2 242 580 ST3 567 762 ST4 312 670 ST5 275 498 ST6 756 913 ST7 256 571 ST8 299 506 ST9 237 481 ST10 232 596 ST11 242 503 ST12 221 500 ST13 254 527 As will appear from Table 2 and Table 3, the ½ Ta and TpH4.60 of Streptococcus ther- mophilus strains with addition of maltitol in the milk base will significantly longer than in control. Thus, the maltitol has negative impact of the yogurt fermentation. Example 2. Addition of at least 0.1% of sucrose anneals negative impact of maltitol Materials and methods Milk base 94% (w / w) fresh milk (3.2% (w / w) protein, 3.8% fat and 5.0% carbohydrate) was added with 6% (w / w) maltitol, and then added 1% (w / v) sucrose, or 1% (w / v) glucose, or 1% (w / v) fructose, or 1% (w / v) galactose. 94% (w / w) fresh milk was used as control. Mixed thoroughly for 30 min at room temperature, pasteurized at 95oC for 10 min, cooled down to 43oC as fermentation temperature. Experimental plan Preparation of Streptococcus thermophilus seeds used for milk fermentation. The 500 ml overnight grown strains were inoculated into indicated medium with 1% inoc- ulation volume and incubated for 24 h at 37oC. The strain culture was harvested by cen- trifugation (4,000 rpm, 10 min at room temperature), and washed twice with phosphate buffered saline (PBS) buffer, resuspended in 50 ml 10% glycerol and frozen at -80oC for further use. Yogurt sample preparation The 200 mL of milk base was inoculated with commercial YO-MIX series cultures or Streptococcus thermophilus strain at 20 DCU / 100L, if not specified. The fermentation was carried out at 43oC in water bath, and the pH was monitored by iCINAC system until 24 h. Results Addition of sucrose but not other common sugar could anneal negative impact of maltitol. Table 4. Sugar addition Culture Maltitol Sugar addition 1 / 2Ta TpH4.60 (%) (%) (min) (min) 0 no sugar 41 260 6 no sugar 366 616 6 1% sucrose 39 242 YO-MIX PRIME 800 6 1% glucose 317 503 6 1% fructose 267 607 6 1% galactose 241 605 Yo-Mix PRIME 800 are commercial starter cultures, usually are the mixture of Streptococcus thermophilus and Lactobacillus delbrucekii subsp. bulgaricus strains. As will appear from Table 4, only addition of sucrose could anneal the negative impact of maltitol on lag phase and fermentation time. Addition of at least 0.1% sucrose could anneal negative impact of 6% maltitol. Table 5. Sucrose amount for annealing the negative impact of maltitol on starter cultures Maltitol in Sucrose in ½ Ta TpH4.60 Starter cul- milk base milk base (min) (min) ture (%) (%) 15 0 0 41 247 6 0 176 616 YO-MIX PRIME 6 1 37 243 800 6 0.1 40 350 6 0.01 48 408 6 0.001 356 615 0 0 36 300 3 0 303 61320 3 1 34 251 3 0.1 36 632 YO-MIX 885 3 0.05 35 690 3 0.01 38 648 3 0.005 48 715 3 0.001 258 673 Yo-Mix 885 and Yo-Mix PRIME 800 are commercial starter cultures from IFF, usually are the mixture of Streptococcus thermophilus and Lactobacillus delbrucekii subsp. bulgaricus strains. As will appear from Table 5, addition of at least 0.1% sucrose could anneal the negative impact of maltitol on YO-MIX PRIME 800, and addition of at least 1% sucrose could anneal the negative impact of maltitol on YO-MIX 885. Table 6. Sucrose addition to anneal the negative impact of maltitol on lag phase (½ Ta) of Streptococcus thermophilus strains Maltitol in Sucrose in milk base milk base Time (min) (%) (%) DSM33849DSM34180 ST2 ST4 DSM34172 0 0 34 36 29 40 29 6 0 106 280 133 146 258 6 1 35 35 27 37 29 6 0.1 35 36 31 40 28 6 0.01 45 264 143 206 184 6 0.001 203 284 147 290 335 As will appear from Table 6, addition of at least 0.01% sucrose in 6% maltitol recipe could anneal the lag phase delay of DSM33849, and addition of at least 0.1% sucrose in 6% maltitol recipe could anneal the lag phase delay of DSM34180, ST2, ST4, and DSM34172. Table 7. Sucrose addition to anneal the negative impact of maltitol on fermentation time (TpH4.60) of Streptococcus thermophilus strains Maltitol in Sucrose in milk base milk base Time (min) (%) (%) DSM33849DSM34180 ST2 ST4 DSM34172 0 0 493 387 253 412 304 6 0 1108 485 636 714 602 6 1 522 311 248 366 285 6 0.1 581 443 352 739 698 6 0.01 888 438 623 812 620 6 0.001 739 535 600 733 584 As will appear from Table 7, addition of at least 0.01% sucrose in 6% maltitol recipe could partially anneal the fermentation delay of DSM34180 (ST0176C1), and addition of at least 0.1% sucrose in 6% maltitol recipe could anneal the fermentation delay of DSM33849 (ST12456), , ST2, ST4, and DSM34172. Example 3. Blocking the sucrose phosphotransferase system via mutations in scrA and scrB genes of Streptococcus thermophilus gives sucrose-negative phenotype and leads to maltitol tolerance. Sucrose-negative Streptococcus thermophilus strains with mutations in scrA and scrB genes of Streptococcus thermophilus are prepared as specifically described in International Patent application PCT / EP2023 / 055363. Alternatively, Sucrose-negative Streptococcus thermophilus strains with mutations in scrA and scrB may be prepared as described in the following. Materials and methods M17 medium The recipe was described previously. Chemical defined medium A-Preparation of Chemically Defined Medium (CDM) In 860 mL of freshly prepared growing buffer. Add: 10 mL 100x vitamin solution (defrost one 11 mL-vitamin aliquot) 10 mL 100x metal solution (defrost one 40 mL-metal aliquot) 20 mL of freshly prepared 50xDNA precursor mix 100 mL 10xamino acids solution (defrost three 40 mL-aa aliquot) Mix by stirring and check that every component is dissolved bring the pH up to 6.6 with HCl 32% Filter-sterilize using 0.2 micron filters Wrap the 1 L-bottle in aluminum foil and keep at 4°C. The medium can be kept for maxi- mum 2 weeks at 4°C. B-Buffers and Solutions for the CDM Growing buffer composition (volume: 1 L). Prepare fresh solution every time 1 lactose monohydrate (VWR 24945.291) 10 g 2 sodium acetate (Sigma S7545-25 OG) 1 g 3 citric acid tri-ammonium salt (Sigma A1332-100G) 0.6 g 4 KH2PO4(VWR 26936.293) 3 g 5 K2HPO4 (Merck 1.05104.1000) 2.5 g 6 urea (Merck) 0.24 g 7 L-tyrosine (Sigma T3754-100G) 0.29 g 8 L-ascorbic acid (Sigma A5960-100G) 0.5 g Add 800 mL MilliQ water. Heat the solution (max. temperature: 40°C.). Bring the pH to 6.8-7 to dissolve all the components. Bring the volume up to 860 mL with milliQ water. Prepare fresh solution every time Vitamin solution 100x (volume: 1 L) 1 Pyridoxamine-HCl (Sigma P9380-5G) 0.5 g 2 Nicotinic acid (Sigma NO765-100G) 0.1 g 3 Riboflavin (Sigma R4500-5G) 0.1 g 4 Calcium panthotenate (Sigma P6045-100G) 0.1 g 5 Thiamin-HCl (Sigma T4625-25G) 0.1 g 6 Pyridoxine-HCl (Sigma P9755-5G) 0.2 g 7 4-aminobenzoic acid sodium salt (Sigma A6928- 1 g 100G) 8 Biotin (Sigma B4501-1G) 1 g 9 Folic acid (Sigma F7876-1G) 0.1 g 10 Vitamin B12 (Sigma V2876-1G) 0.1 g 11 Orotic acid (Sigma O1756-10G) 0.5 g 12 Thymidine (Sigma T1895-5G) 0.5 g 13 Inosine (Sigma I4125-5G) 0.5 g 14 Lipoic acid (Sigma T5625-5G) 0.25 g Add 700 mL MilliQ water bring the pH up to 10 with NaOH 10 M to dissolve all the vitamins bring pH back to 6.6 with HCl 32% bring the volume of the solution to 1 L with milliQ water Make 11 mL-aliquots in 50 mL-falcon tubes. Wrap the tubes in aluminum foil. The con- centrated vitamin mix can be kept at -20°C. for several months. Metal solution 100x (volume: 1 L) 1 MgCl2(H2O)6: (Sigma M2670-100G) 20 g 2 CaCl2(H2O)2: (Sigma C2536-500G) 5 g 3 Fe(II)Cl2·(H2O)4 : (Fluka 44936-50G) 0.5 g 4 ZnSO4(H2O)7: (Sigma Z1001-500G) 0.5 g 5 Cu(II)SO4(H2O)5: (Sigma C3036-250G) 0.01 g 6 Co(II)Cl2·(H2O)6 : (Sigma C2911-100G) 0.25 g 7 Mn(II)SO4H2O : (Sigma M1144-100G) 2.8 g Add 800 mL milliQ water and 4.8 mL HCl 32% dissolve all metals by stirring bring the volume up to 1 L with milliQ water Make 40 mL-aliquots in 50 mL-falcon tubes. The concentrated metal mix can be kept at - 20° C. for several months DNA precursor mix 50x (volume: 20 mL) Prepare fresh solution every time 1 Adenine (Sigma A2786-5G) 0.01 g 2 Guanine (Sigma G6779-5G) 0.01 g 3 Xanthine (Sigma X4002-5G) 0.01 g 4 Uracil (Sigma U1128-25G) 0.01 g Add 20 mL of filter-sterilized NaOH 0.1 M (the NaOH Solution is prepared using milliQ wa- ter). Dissolve all DNA precursors by heating the Solution (max. temperature: 40° C) Amino acid solution 10x (volume: 1 L) 1 L-arginine-HCl (Sigma A5006-100G) 3.5 g 2 L-cysteine (Sigma C7352-25G) 2.5 g 3 L-Histidine (Sigma H8000-25G) 1.5 g 4 L-proline (Sigma P0380-100G) 6.75 g 5 L-alanine (Sigma A7627-100G) 2.4 g 6 L-asparagine (Sigma A0884-100G) 3.5 g 7 L-aspartic acid (Sigma A9256-100G) 4.55 g 8 L-glycine (Sigma G7126-100G) 1.75 g 9 Isoleucine (Sigma I2752-100G) 2.1 g 10 L-leucine (Sigma L8000-100G) 4.75 g 11 L-lysine-HCl (Sigma L5626-100G) 4.4 g 12 L-methionine (Sigma M9625-100G) 1.25 g 13 L-phenylalanine (Sigma P2126-100G) 2.75 g 14 L-serine (Sigma S4500-100G) 2.25 g 15 L-threonine (Sigma T8625-100G) 1.75 g 16 L-tryptophane (Sigma T0254-25G) 0.5 g 17 L-valine (Sigma VO500-50G) 3.25 g 18 Glutamine (Sigma G3126-100G) 3.9 g 19 Glutamic Acid (Sigma G1251-100G) 3.98 g Add 800 mL of milliQ water bring the pH up to 7-7.2 to dissolve all the amino acids bring the volume up to 1 L with milliQ water make 40 mL-aliquots in 50 mL-falcon tubes. The concentrated amino acid solution can be kept for several months at -20° C. Experimental plan Creation of sucrose-negative Streptococcus thermophilus strain using natural competence transformation A-Preparation of donor DNA For the preparation of the template DNA, overnight culture of S. thermophilus strain in was deposited on the surface of FTA card (FTA® technology CloneSaver Card, Whatman, St. Louis, Missouri, USA) and prepared according to the manufacturer’s instruction. For PCR amplification and DNA sequencing, primer pair (scrAB-F1: 5’- TTA TTT AAC TGC GAT GAA GTC AT-3’ and scrAB-R3: 5’-CTA GTA TTT TAA GTC GAA GTA G-3’) were pur- chased from Sangon (Shanghai, China). High quality donor DNA was prepared by PCR amplifications of the scrA829 and pscrB829 were prepared according to the protocol of PrimeSTAR® HS DNA polymerase (Takara, Beijing, China) and eluted in Tris-Cl 10 mM. The sequence was further confirmed by Sanger sequencing (Shanghai, China). The donor DNA was purified by 80% ethanol and 1 / 10 volume of 3 M sodium acetate (pH 5.2). B-Preparation of competent cells Competent cells of the recipient strains (DSM34172 and DSM34180) were prepared. Briefly, an overnight culture of S. thermophilus grown in M17 supplemented with 30 g / L lactose at 37°C was washed twice (5,000 × g, 9 min, room temperature) in one volume of CDM lactose and resuspended in one volume of CDM lactose. The washed culture was then 30-fold diluted in CDM supplemented with lactose to obtain OD600of 0.05, incubated 1h15 at 37°C and then, stocked at -20°C. C-Transformation of amplified fragment by natural competence method r 3 h at 37 °C. Normally growth of the cells was checked based on colony size on LM17+6% maltitol agar plate compared to LM17 plate. Individual cell was inoculated in 200 mL LM17 anaer- obically at 37oC for 48 h. The replacement was verified by PCR with specific primer pair specifically designed to detect clones with the desired mutation. idf-13508-F: 5’-TTTTCAATATTCTCAGCTTTTTT-3’ idf-13508-R: 5’- CCTAATTTATTTATTAGTAATATAGG-3’ The colonies with positive PCR result (transformants) were further used as template to amplify potential mutations, and two SNPs were confirmed by Sanger sequencing (San- gon, Shanghai). The term transformant refers to the Streptococcus thermophilus strain harboring scrA829 and pscrB829 genes, which replaced its native genes. Growth of transformants in M17 medium Overnight grown strains were inoculated into M17 medium supplemented with 1% lac- tose, 1%lactose and 3%maltitol, or 1% sucrose at 1% inoculation (v / v), and incubated for 24 h at 37oC, OD600 was online automatically monitored at indicated time. Streptococcus thermophilus seeds used for milk fermentation The 500 ml overnight grown strains were inoculated into indicated medium with 1% inoc- ulation volume and incubated for 24 h at 37oC. The strain culture was harvested by cen- trifugation (4,000 rpm, 10 min at room temperature), and washed twice with phosphate buffered saline (PBS) buffer, resuspended in 50 ml 10% glycerol and frozen at -80oC for further use. Milk inoculation The 200 mL of milk base was inoculated with lab-scale Streptococcus thermophilus strain at 1% (v / v). The fermentation was carried out at 43oC in water bath, and the pH was monitored by iCINAC system until 24 h. Ta stands for the half time for acidification, more precisely is the time needed for a re- duction of 0.08 pH units from the original pH. ½ Ta, therefore, means the time needed for a reduction of 0.04 pH units from the original pH. This a way to study the delay required for bacteria to really start the milk acidifica- tion, indicative of the lag phase of the Streptococcus thermophilus strain. Time to pH 4.60 (TpH4.60), is the time needed to reach pH 4.60, indicative of the fer- mentation time for bioprocess. Results The sucrose-negative are insensitive to maltitol Two wild type Streptococcus thermophilus strain DSM 34172 and DSM 34180 were se- lected as mother strains, and sucrose-negative transformants were investigated. The names of the transformants are listed below: Table 8. Name of transformants Engineered mutation Name of trans- Mother strain formant ST14 scrA829, pscrB829 DSM34172-Trans- DSM34172 formant ST15 scrA829, pscrB829 DSM34180-Trans- DSM34180 formant

[0002] 0 0 0 0 0 0 0 0 NB42103-WO-PCT2 ± ± ± ± ± ± ± ± 7 8 2 4 1 8 6 2 4 2. 4 2. 4 3. 02. 4 1 41 3 48 1 1 0 0 1 2 . . 1 0. . 00. . 2 1 . 1 . 1 . 1 . 1 0. 00. e 0 0 0 0 0 0 0 0 r ± ± ± ± ± ± ± ±a8 7 1 2 2 9 4 2 y 24 e 0 . 2 0 . 4 3 0 . 92 0. 8 1 21 2441 0 0 . . 1 0. . 00. . h 2 1 . 1 . 1 . 1 . 1 0. 00.ts n a ± ± ± ± ± ± ± ± e 73 74 0909 01 922620 20 m 8 . . 2. 0. 3. 0. 2. 0. 1. 0. 1. 0. 4. 0. 1. 0.,1 1 0 1 0 1 01 0 1 0001 000 ecr u ± ± ± ± ± ± ± ± o 73 64 0981 50920920s6 2. 0. 2. 0. 3. 0. 1. 2. 0. 0. 1. 0. 4. 0. 1. 0. n 1 1 0 1 0 1 01 0 1 0001 000 o bra ± ± ± ± ± ± ± ±c74 54 9047 61 8295 20el20 2. 0. 2. 1. 1. 0. 9 o 4 . . . 0. 1. 0. 3. 0. 1. 0. 1 1 0 1 0 1 01 0 000 01 000ss a e ± ± ± ± ± ± ± ± s 54 25 7 1 94 207297 20 o 2. 0. 2. 0. 2. 1. 0. 0 r 2 . 8. 0. 1. 0. 3. 0. 1. 0. c 1 1 0 1 0 1 01 0 000 01 000 u s ht± ± ± ± ± ± ± ±i94 38 5 7 03 43 729420w0 1. 0. 0. 0. 2. 1. 0. 0. 5. 0. 1. 0. 3. 0. 1. 0. d 1 1 0 1 0 1 01 0 000 01 000 et n e ± ± ± ± ± ± ± ± m 1 6 77 67 01 425201 20el9. 0. 4. 0. 1. 0. 8. 0. 3. 0. 1. 0. 4. 0. 1. 0. p 8 00 0 0 1 000 0 00 01 000 p u s 7 ± ± ± ± ± ± ± ± 1 92 02 3 200 1 1 5221 20 m 2. 0. 2. 0. 0. 0. 4. 0. 2. 0. 1. 0. 4. 0. 1. 0M. n ui6 00 0 0 1 000 0 00 01 000id w e or ± ± ± ± ± ± ± . m ± 40 20 3 1ge 7 70 41 4241 20 t p 1 1. 0. 1. 0. 6. 0. 1. 0. 1. 0. 1. 0. 9. 0. 1. 0. o y M 4 00 0 0 00 00 0 00 00 0 00nto ndn ilu e s ± ± o h t ± ± ± ± ± ± 1 0 1 0 8 060 303c pn 1 8020 a 1. 0. 1. 0. 1. 0. 1. 0. 1. 0. 1. 0. 1. 0. 1. 0. 5 e m 2 00 0 0 00 00 0 00 00 0 00 1vit r T a ofSg s d e n ± ± ± ± ± ± ± ± n n a 1 1 1 0 5 060 30301 1 20 - r 1 0 1 0 1 01 0 1 01 01 01 0ae t . . . . . . . . . . . . . . . . 4 s e 0 00 0 0 00 00 0 00 00 0 00 1 or h T fSc t -c -c -c - - - - - , us o ) c n h(alalalalus us us us9,e oieelt % % % % % % % % bvi1 1 1 1 1 atiamzi1 1 1 s il- T + itc / 7 e + e + e + + es + es + es + esTo e e 1 s 7 1 s 7 1 s 7 e 1 s 7 7 7 7 1 or 1 or 1 or 1 or m p- u RpiMo t Mo t Mo t Mo t M c M c M c M c or e rfso a r t g c u 2 0 2 0 a a 7 8 7 8 eplS. 1 1 1 1 g 4 4 p 9n4 4 a i 3 4 3 5 3 4 3 5lnliir ela M 1 M 1 M M o b r 1 1 t S T S T S T S Twb s r a S a T D S D S D S D S A h Table 10a. Lag phase and fermentation time of transformants in milk fermentation Name Maltitol in ½ Ta TpH4.60 milk (%) (min) (min) DSM34172 0 26.00 304.42 DSM34172 3 263.80 673.73 ST14 0 24.86 273.78 ST14 3 24.70 274.29 DSM34180 0 17.85 152.30 DSM34180 3 45.00 224.21 ST15 0 17.54 147.16 ST15 3 17.98 127.41 As will appear from Table 10a, the lag phase and fermentation time in milk of all two transformants, ST14 and ST15, are not impacted by 3% maltitol. Table 10b. Four sucrose-negative strains are insensitive to maltitol Maltitol in ½ Ta TpH4.60 Name milk (%) (min) (min) DSM34133 0 21.24 211.52 DSM34133 3 21.74 249.28 DSM34134 0 26.75 260.79 DSM34134 3 27.02 305.53 DSM34931 0 32.37 306.29 DSM34931 3 36.13 284.01 DSM34932 0 36.19 275.26 DSM34932 3 32.90 283.85 As will appear from Table 10b, the lag phase and fermentation time in milk of all four de- posited strains are not impacted by 3% maltitol. Example 4. Use of maltitol as selection to obtain sucrose-negative mutant Because maltitol-insensitive phenotype links to the sucrose-negative phenotype in Strep- tococcus thermophilus strain, we are able to select sucrose-negative Streptococcus ther- mophilus strain with maltitol addition. Materials and methods M17 medium For Streptococcus thermophilus, the medium used is the M17 medium known to persons skilled in the art. The M17 medium has the following composition per H2O Ascorbic acid, 0.5 g Casein peptone (tryptic), 2.5 g Disodium -glycerophosphate pentahydrate, 19 g Magnesium sulfate hydrate, 0.25 g Meat extract, 5 g Meat peptone (peptic), 2.5 g Soyapeptone (papainic), 5 g Yeast extract, 2.5 g Final pH 7.1±0.2 (25oC) Carbon sources added are sterile lactose 10 g / l, sucrose 10 g / l, or lactose 10 g / l and maltitol 30 g / l. Milk base 94% (w / w) fresh milk (3.2% protein, 3.8% fat and 5.0% carbohydrate) was added with 6% (w / w) maltitol or food-grade water as control. Mixed thoroughly for 30 min at room temperature, pasteurized at 95oC for 10 min, cooled down to 43oC as fermentation tem- perature. Experimental plan UV mutagenesis Working culture of wide-type ST11563 was inoculated at 1% (v / v) into 10 mL M17+1%lactose broth and incubated at 37oC about 16 h until reached (OD6000.4-0.5). Wide type refers to the non-mutated form of a bacterium, as found in nature. Then, these 16h-cultures were centrifuged the cell pellets were washed twice in sterile 0.9% NaCl. The washed cell pellets were resuspended in 8 mL sterile 0.9% NaCl and the homogenous cell suspension was spread evenly for form a thin layer in 90 mm petri dish. These petri dishes were arranged parallelly on a leveraged platform in the laminar airflow which the height was adjusted to 30 cm between the platform surface and the UV lamp (36W) of the laminar airflow. The cell suspensions (with the lid of petri dishes being removed) were exposure to the UV radiation (254 nm) for 30 s to create random muta- tion(s). The exposure to UV radiation was performed in dark. In dark, the cell suspen- sions were collected into respective sterile centrifuge tubes immediately after the UV ex- posure. Screening of maltitol-insensitive mutants Enrichment of the maltitol-insensitive mutant was performed by supplementing 6% malt- itol in M17+2%lactose medium. The experiment was performed in dark and incubated anaerobically at 37°C for 24 h. The presumptive maltitol-insensitive mutants were se- lected and purified twice on M17+2%lactose+6%maltitol agar. Single colony was trans- ferred to 10 mL M17+2%lactose broth and incubated anaerobically at 37oC for 48 h, cen- trifuged, re-suspended with 25% glycerol, and stored at -80oC for future use. Growth of mutants in M17 medium Overnight grown strains were inoculated into indicated medium with 1% inoculation vol- ume, and incubated for 24 h at 37oC, OD600 was online automatically monitored at indi- cated time. Preparation of Streptococcus thermophilus seeds used for milk fermentation The 500 ml overnight grown strains were inoculated into indicated medium with 1% inoc- ulation volume and incubated for 24 h at 37oC. The strain culture was harvested by cen- trifugation (4,000 rpm, 10 min at room temperature), and washed twice with phosphate buffered saline (PBS) buffer, resuspended in 50 ml 10% glycerol and frozen at -80oC for further use. Yogurt sample preparation The 200 mL of milk base was inoculated with lab-scale Streptococcus thermophilus strain at 1% (v / v). The fermentation was carried out at 43oC in water bath, and the pH was monitored by iCINAC system until 24 h. Ta stands for the lag time for acidification, more precisely is the time needed for a reduc- tion of 0.08 pH units from the original pH. ½ Ta, therefore, means the time needed for a reduction of 0.04 pH units from the original pH. This a way to study the delay required for bacteria to really start the milk acidifica- tion, indicative of the lag phase of the Streptococcus thermophilus strain. Time to pH 4.60 (TpH4.60), is the time needed to reach pH 4.60, indicative of the fer- mentation time for bioprocess. Results are according to the following tables. - 71108081805 62 %1.4. . . .0.1.7142.1 0 ± 8.1 0 ± 23.1 0 ± 33.1 0 ± 33.1 0 ± 13.1 0 ± 23.1 0 ± 51 4 h 3tiw 7 1 2 8 6 .1.4 0.3 0.3 1.8 30.5 30.4 31.M 81 1 0 ± 6.1 0 ± 2.1 0 ± 2.1 0.0.0.0S d ± 1 1 ± 1 1 ± 2 1 ± 5Det d n 7 e e 7121806 8 5 4 11. .1 0 ± 64. .1 0 ± 03. .1 0 ± 23.1.1 0 ± 13.0.1 0 ± 13.0.1 0 ±3.1.0m m 2 1 ± 5alenp 7 , p 61.1.2 04.1.8 03.0.6 03.1.8 03.0.5 3.0.4 3.1.niu 1 1 ± 61 ± 0 1 ± 2 1 ± 1 1 0 ± 01 0 ± 2 1 0 ± 4asrt ms ui61.21.90.00.80.50.31.e d 311.1 0 ± 54.1 0 ± 03.1 0 ± 23.1 0 ± 93.1 0 ± 13.1 0 ± 23.1 0 ± 4p e yt m6 e 7di1 211.1.2 1 0 ± 44.1.9 1 0 ± 03.0.9 1 0 ± 21.0.8 1 0 ± 93.0.5 1 0 ± 13.0.2 1 0 ± 23.1.1 0 ± 4w Ms na i6 s 1113 9 4 8 5 2 .1.1 0 ± 44.1.1 0 ± 03.0.1 0 ± 19.0.00 ±3.0.03.0.03.1.02 t 8 1 ± 01 ± 2 1 ± 47 n 1 at 6131003 8 5 04 u1. .4. .4. .5.0.3.0.3.0.3 1.3 01 1 0 ± 41 0 ± 0 1 0 ± 1 00 ± 7 1 0 ± 01 0.0 : ± 2 1 ± 5MmS e 1D vi14 t1.1.4 04.1.0 04.0.2 02.0.9 3.0.5 3.0.8 2.1.g ael9 1 ± 5 1 ± 0 1 ± 1 00 ± 61 0 ± 01 0 ± 2 1 0nib ± 5 g s e aun-T0 n1.1.5 04.1.1 04.0.4 01.0.8 3.0.4 3.0.2 2.1.s ei8 1 ± 8 1 ± 0 1 ± 2 00 ± 3 1 0 ± 01 0 ± 3 1 0t s ± 4n da ot r e c t 1251202090407 u usil70. .1 0 ± 54. .1 0 ± 04. .1 0 ± 21. .00 ± 33. .1 0 ± 03. .1 0 ± 30.1.1 0m se ± 2o d r n wa33t as.61.40.10104071d 2tl68.00 ± 34.1 0 ± 04.1 0 ± 21. .00 ± 64. .1 0 ± 03. .1 0 ± 47. .00 ± 5e 7 uni1 s a 4 e 6 3r 5.3.7 04.0.5 04.0.0 01.0.1 04.0.3 3.0.4 4.1.tb M e h 5 0 ± 01 ± 2 1 ± 4 0 ± 8 1 0 ± 1 1 0 ± 5 00 ± 7oS e D T . 01.40.50.00803041wfe3.04.04.01. .03. .03. .02. .0,os o 4 0 ± 3 1 ± 2 1 ± 6 0 ± 21 ± 21 ± 3 0 ± 0d se roh v c 7t r u1.0.7 02.1.9 02.2.0 01.0.5 00.0.0 00.1.6 01.0.0 e usm c3 0 ± 3 1 ± 0 1 ± 4 0 ± 01 ± 61 ± 8 0 ± 4 h % g t1niw r 30.71.04.00.60.70.30.o 21.05.09.01.03.03.01.0n o 0 ± 1 0 ± 5 0 ± 6 0 ± 1 0 ± 3 0 ± 8 0 ± 2e r,le G rc.os2ti2 ttl0.20.51.00.70.70.20.m1.02.03.01.01.01.01.0 n a 1 0 ± 1 0 ± 5 0 ± 6 0 ± 1 0 ± 1 0 ± 2 0 ± 1d n autmidau e 10.90.60.90.505010i1sM %m0.00 ± 11.00 ± 32.00 ± 90.00 ± 21. .00 ± 11. .00 ± 11. .00 ± 1s - 23d 7 e n 7 n 1 e 1 ) -c -c -c -c l - l - l -g 4a M h(alalalala c a c a malalusa 3 e n t sie m m %1 %1 %1 %1 % %1 % %1 % % u M o S t htim-T+ + + + 3+ 3 3 1 l + + + + + em Dca V dlw c / 7 or e e 1 es 7 RpiMo1 es 7 t Mo1 es 7 e 7 e l 7 e l 7 s t Mo1 s t Mototi1 s toMot ti1 s toMot ti1 t MorcUn na%G1.o1t , 1 1 e14 1 3 4 - 1 3 u 4 - 1 3 u 2 4 - 1 3 u 4 - 1 u 4d n sni1t271323es at oela M MM- n MM- tM1 MM- tMM- tMa u tc b artS 2 S 2aS 2 n a S 4 S 2 n a S 2 n S 2 B MalT S D 7 D 7tD 7tD 3 D 7tD 7atD 70.3 0 ± 11.0.00 ± 10.3 0 ± 11.0.00 ± 1niart0.3s01.0.0 t ± 1 0 ± 1 ner0.30.a p0 ± 11.00 ± 1fo s0.2 t0 ± 11.0.n 00 ± 1 at u0.20.m01.e ± 1 00 ± 1vita0.200.g el.± 11.00 ± 1 n o - eti.slt02 01.0.a 0 or ± 1 0 ± 1 cmu s %0.20 301. .er y ± 1 00 ± 1a2b0.t d 2 0 ± 11.0.neatc 00 ± 1 t u a p0.2 M- m0 ± 11.0.2i00 ± 1 7 t 1 o 4n0.2 e0 ± 11.0.3 r 00 ± 1 M SaDst0.2 n00.d a ± 11.00 ± 1 n t a u 1m0.20.t n e0 ± 11.00 ± 2 atviu ta0.2 M g - e01.0.2 n ± 1 00 ± 2 7 - 1 es0.2 4 3 o0 ± 21.0.rc 00 ± 2 M S u0.D s2 o0 ± 21.0.ht w 00 ± 2 otbh0.2 , to00.1 b ± 11.00 ± 11fle oba h - t usTw % or 1 me ogs +7 e rfeor1 s o r h c Mrc aeT. p 2- 1 p 7 a 1u 4 - 3 ul4M-1t22 n MM- tli3 n M 7atS D27atws S A D Sucrose negative mutants are maltitol insensitive in milk fermentation The acidification kinetics in milk fermentation of two sucrose-negative Streptococcus thermophi- lus mutants are further checked. The results are listed in Table 12: Table 12. Milk acidification Strain Recipe ½ Ta TpH4.60 (min) (min) DSM34172 Control 29 304 DSM34172-Mutant1 Control 20 144 DSM34172-Mutant2 Control 21 280 DSM34172 6%maltitol 258 602 DSM34172-Mutant1 6%maltitol 20 147 DSM34172-Mutant2 6%maltitol 22 253 As will appear from Table 12, the lag phase and fermentation time in milk of both two sucrose negative mutants, DSM34172-Mutant1 and DSM34172-Mutant2, are not impacted by 6% malt- itol.

[0003] CLAIMS 1. Use of a sucrose-negative Streptococcus thermophilus strain to reduce the negative impact of the presence of a disaccharide sugar alcohol, such as maltitol, isomalt or lactitol during fermentation of a milk-based product with said strain. 2. Use according to claim 1, which sucrose-negative Streptococcus thermophilus strain is carry- ing one or more mutations selected from the group consisting of: 1) one or more mutation in one or more gene of the sucrose regulon; which mutation pro- vides for a significant reduction in the ability to grow on and / or transport sucrose by said strain; and which mutation at least comprises i) one or more of the scrA gene, and / or the scrB gene and / or the scrR gene, and ii) optionally a further mutation in the promoter region regulating the expression of the scrA, scrB and / or scrR genes, such as a mutation that protect the strain from reversing from the sucrose negative phenotype; and 2) optionally one or more further mutation affecting the glucose porter, such as affecting glcU and / or its expression, which mutation restores or improves glucose consumption of said strain when grown on glucose as the sole source of carbohydrates. 3. The use according to claim 2, which sucrose-negative, Streptococcus thermophilus strain has one or more mutation in the sucrose regulon in one or more of the scrA gene and the scrB gene. 4. The use according to claims 2 or 3, which mutation in one or more gene of the sucrose regu- lon is in the scrA gene effectively disrupting gene function, such as an insertion or deletion resulting in a frameshift of the open reading frame of the gene coding for the EIIABCSucrose protein leading to the translation of a truncated EIIABCSucroseprotein encoded by the scrA gene, such as a mutation by insertion or deletion of a nucleotide, such as at or around a nu- cleotide corresponding to position 133 of SEQ ID NO:1, in the open-reading-frame (ORF) of the scrA gene. 5. The use according to any one of claims 2-4, which strain has a mutation in the promoter re- gion regulating the expression of any one of the scrA, scrB and / or scrR genes. 6. The use according to claim 5, which mutation is a SNP in the promoter region of the scrA and / or scrB genes, such as a SNP in the promoter region of the scrB gene, such as a muta- tion near the -10 and -35 sequence of the promoter, such as a mutation of T to G corre- sponding to position 38 of SEQ ID NO:2 upstream of the scrB promoter, such as a mutation that will comprise the entire sequence identified by SEQ ID NO:2 or a variant sequence being at least about 90%, such as at least about 95% identical herewith (pscrB829). The use according to any one of claims 1-6, which sucrose-negative Streptococcus ther- mophilus strain is selected from: - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34132; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34133; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34134; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34138; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34139; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34140; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34146; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34147; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 16. February 2022 under number DSM34172; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 6. February 2024 under number DSM34931; and - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 6. February 2024 under number DSM34932. A method for identifying a sucrose-negative Streptococcus thermophilus strain, which method comprises the step of screening for and identifying Streptococcus thermophilus strains insensitive or with reduced sensitivity to a disaccharide sugar alcohol, such as malt- itol, isomalt or lactitol. A method for the preparation of a fermented milk-based product comprising a disaccharide sugar alcohol, such as maltitol, isomalt or lactitol, the method comprising the fermentation of a milk-based substrate with a lactic acid bacteria starter culture in the presence of at least about 0.01% w / v of sucrose. A method for reducing the negative impact of the presence of a disaccharide sugar alcohol, such as maltitol, isomalt or lactitol during fermentation of a milk-based product with a lactic acid bacteria starter culture, the method comprising the step of adding at least about 0.01% (w / v) of sucrose to the milk base before or during fermentation. The method according to any one of claims 9 or 10, which lactic acid bacteria starter culture comprises or consists of at least one Streptococcus thermophilus strain as defined in claims 1-7, and optionally at least one Lactobacillus strain such as at a Lactobacillus delbrueckii subp bulgaricus strain, such as at a Lactobacillus acidophilus, such as at a Lactobacillus hel- veticus, optionally at least one Lactiplantibacillus strain such as at a Lactiplantibacillus plantarum, optionally at least one Lacticaseibacillus strain such as at a Lacticaseibacillus ca- sei, such as at a Lacticaseibacillus paracasei, such as at a Lacticaseibacillus rhamnosus, op- tionally at least one Limosilactobacillus strain, such as at a Limosilactobacillus fermentum, optionally at least one Leuconostoc strain, such as at a Leuconostoc mesenteroides, and op- tionally at least one Bifidobacterium strain, such as at a Bifidobacterium animalis subsp. ani- malis, such as at a Bifidobacterium animalis subsp. lactis. The use or method according to any one of claims 1-11, wherein said milk-based product is a dairy product, such as a yoghurt, a cheese, a buttermilk, quark, a sour cream, kefir, a fer- mented whey-based beverage, a koumiss, a milk beverage, a yoghurt drink, a fermented milk, a matured cream, a fromage frais, a milk, a dairy product retentate, a processed cheese, a cottage cheese, a cream dessert. The use or method according to any one of claims 1-11, wherein said disaccharide sugar al- cohol, such as maltitol, isomalt or lactitol is present in an amount of at least about 1% w / v, such as at least about 1.2% w / v, such as at least about 1.4% w / v, such as at least about 1.6% w / v, such as at least about 1.8% w / v, such as at least about 2.0% w / v, such as at least about 2.2% w / v, such as at least about 2.4% w / v, such as at least about 2.6% w / v, such as at least about 2.8% w / v, such as at least about 3.0% w / v, such as at least about 3.5% w / v, such as at least about 4.0% w / v, such as at least about 4.5% w / v, such as at least about 5.0% w / v, such as at least about 5.5% w / v, such as at least about 6.0% w / v. A Streptococcus thermophilus strain, sucrose-negative Streptococcus thermophilus strain se- lected from the group consisting of: - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34133; - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 6. February 2024 under number DSM34931; and - a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 6. February 2024 under number DSM34932.

[0004] ABSTRACT The present invention relates to the use of specific strains of Streptococcus thermophilus to reduce the negative impact of the presence of disaccharide sugar alcohols during fermentation of a milk-based product, as well as methods for identifying specific strains of Streptococcus ther- mophilus, method for the preparation of a fermented milk-based product comprising disaccharide sugar alcohols, as well as methods for reducing the negative impact of the presence of disaccha- ride sugar alcohols during fermentation of a milk-based products.

[0005] (Original in Electronic Form)

[0006] FOR RECEIVING OFFICE USE ONLY

[0007] FOR INTERNATIONAL BUREAU USE ONLY

Claims

CLAIMS1. Use of a sucrose-negative Streptococcus thermophilus strain to reduce the negative impact of the presence of a disaccharide sugar alcohol, such as maltitol, isomalt or lactitol during fermentation of a milk-based product with said strain.

2. Use according to claim 1, which sucrose-negative Streptococcus thermophilus strain is carrying one or more mutations selected from the group consisting of:1) one or more mutation in one or more gene of the sucrose regulon; which mutation provides for a significant reduction in the ability to grow on and / or transport sucrose by said strain; and which mutation at least comprises1) one or more of the scrA gene, and / or the scrB gene and / or the scrR gene, and ii) optionally a further mutation in the promoter region regulating the expression of the scrA, scrB and / or scrR genes, such as a mutation that protect the strain from reversing from the sucrose negative phenotype; and2) optionally one or more further mutation affecting the glucose porter, such as affecting glcU and / or its expression, which mutation restores or improves glucose consumption of said strain when grown on glucose as the sole source of carbohydrates.

3. The use according to claim 2, which sucrose-negative, Streptococcus thermophilus strain has one or more mutation in the sucrose regulon in one or more of the scrA gene and the scrB gene.

4. The use according to claims 2 or 3, which mutation in one or more gene of the sucrose regulon is in the scrA gene effectively disrupting gene function, such as an insertion or deletion resulting in a frameshift of the open reading frame of the gene coding for the EIIABCsucrose protein leading to the translation of a truncated EIIABCsucrose protein encoded by the scrA gene, such as a mutation by insertion or deletion of a nucleotide, such as at or around a nucleotide corresponding to position 133 of SEQ ID NO:1, in the open-reading-frame (ORF) of the scrA gene.

5. The use according to any one of claims 2-4, which strain has a mutation in the promoter region regulating the expression of any one of the scrA, scrB and / or scrR genes.

6. The use according to claim 5, which mutation is a SNP in the promoter region of the scrA and / or scrB genes, such as a SNP in the promoter region of the scrB gene, such as a mutation near the -10 and -35 sequence of the promoter, such as a mutation of T to G corresponding to position 38 of SEQ ID NO:2 upstream of the scrB promoter, such as a mutation that will comprise the entire sequence identified by SEQ ID NO:2 or a variant sequence being at least about 90%, such as at least about 95% identical herewith pscrB829').

7. The use according to any one of claims 1-6, which sucrose-negative Streptococcus thermophilus strain is selected from:- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34132;- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34133;- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34134;- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34138;- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34139;- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34140;- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34146;- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34147;- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 16. February 2022 under number DSM34172;- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 6. February 2024 under number DSM34931; and- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 6. February 2024 under number DSM34932.

8. A method for identifying a sucrose-negative Streptococcus thermophilus strain, which method comprises the step of screening for and identifying Streptococcus thermophilusstrains insensitive or with reduced sensitivity to a disaccharide sugar alcohol, such as malt- itol, isomalt or lactitol.

9. A method for the preparation of a fermented milk-based product comprising a disaccharide sugar alcohol, such as maltitol, isomalt or lactitol, the method comprising the fermentation of a milk-based substrate with a lactic acid bacteria starter culture in the presence of at least about 0.01% w / v of sucrose.

10. A method for reducing the negative impact of the presence of a disaccharide sugar alcohol, such as maltitol, isomalt or lactitol during fermentation of a milk-based product with a lactic acid bacteria starter culture, the method comprising the step of adding at least about 0.01% (w / v) of sucrose to the milk base before or during fermentation.

11. The method according to any one of claims 9 or 10, which lactic acid bacteria starter culture comprises or consists of at least one Streptococcus thermophilus strain as defined in claims 1-7, and optionally at least one Lactobacillus strain such as at a Lactobacillus delbrueckii subp bulgaricus strain, such as at a Lactobacillus acidophilus, such as at a Lactobacillus hel- veticus, optionally at least one Lactiplantibacillus strain such as at a Lactiplantibacillus plantarum, optionally at least one Lacticaseibacillus strain such as at a Lacticaseibacillus easel, such as at a Lacticaseibacillus paracasei, such as at a Lacticaseibacillus rhamnosus, optionally at least one Limosilactobacillus strain, such as at a Limosilactobacillus fermentum , optionally at least one Leuconostoc strain, such as at a Leuconostoc mesenteroides, and optionally at least one Bifidobacterium strain, such as at a Bifidobacterium animalis subsp. ani- malis, such as at a Bifidobacterium animalis subsp. lactis.

12. The use or method according to any one of claims 1-11, wherein said milk-based product is a dairy product, such as a yoghurt, a cheese, a buttermilk, quark, a sour cream, kefir, a fermented whey-based beverage, a koumiss, a milk beverage, a yoghurt drink, a fermented milk, a matured cream, a fromage frais, a milk, a dairy product retentate, a processed cheese, a cottage cheese, a cream dessert.

13. The use or method according to any one of claims 1-11, wherein said disaccharide sugar alcohol, such as maltitol, isomalt or lactitol is present in an amount of at least about 1% w / v, such as at least about 1.2% w / v, such as at least about 1.4% w / v, such as at least about 1.6% w / v, such as at least about 1.8% w / v, such as at least about 2.0% w / v, such as at least about 2.2% w / v, such as at least about 2.4% w / v, such as at least about 2.6% w / v, such as at least about 2.8% w / v, such as at least about 3.0% w / v, such as at least about 3.5% w / v, such as at least about 4.0% w / v, such as at least about 4.5% w / v, such as at least about 5.0% w / v, such as at least about 5.5% w / v, such as at least about 6.0% w / v.

14. A Streptococcus thermophilus strain, sucrose-negative Streptococcus thermophilus strain selected from the group consisting of:- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 18. January 2022 under number DSM34133;- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 6. February 2024 under number DSM34931; and- a strain deposited under the Budapest Treaty in the name of DuPont Nutrition Biosciences ApS at the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkul- turen, GmbH, on 6. February 2024 under number DSM34932.

Images