Recombinant microalgae capable of producing KTTKS peptides, polypeptides and proteins and their derivatives, and their associated processes and uses

Abstract

Recombinant microalgae capable of producing KTTKS peptides, polypeptides, or proteins and their derivatives, and their associated processes and uses. The present invention relates to a recombinant microalga comprising a nucleic acid sequence encoding a recombinant KTTKS peptide (SEQ ID No. 1); a recombinant peptide, polypeptide, or protein consisting of repeated units of SEQ ID No. 1; or a derivative thereof, said nucleic acid sequence being located in the chloroplast genome of the microalga. It also relates to a process for producing a recombinant SEQ ID No. 1 peptide; a recombinant peptide, polypeptide, or protein consisting of repeated units of SEQ ID No. 1; or a derivative thereof, wherein said process comprises transforming the chloroplast genome of a microalga with a nucleic acid sequence encoding said recombinant protein, polypeptide, or peptide.It also concerns the use of said peptides, polypeptides, or recombinant proteins in the cosmetics industry. Figure for the abstract: no figure.

Description

Title of the invention: Recombinant microalgae capable of producing KTTKS peptides, polypeptides and proteins and their derivatives, and their associated methods and uses

[0001] The present invention relates to a recombinant microalgae comprising a nucleic acid sequence encoding a recombinant peptide of KTTKS (SEQ ID NO: 1); a recombinant peptide, polypeptide or protein consisting of repeating units of SEQ ID NO: 1; or a derivative thereof, said nucleic acid sequence being located in the chloroplast genome of the microalgae. It also relates to a method for producing a recombinant peptide of SEQ ID NO: 1; a recombinant peptide, polypeptide or protein consisting of repeating units of SEQ ID NO: 1; or a derivative thereof, said method comprising transforming the chloroplast genome of a microalgae with a nucleic acid sequence encoding said recombinant peptide, polypeptide or protein. It further relates to the use of said recombinant peptide, polypeptide or protein in the cosmetic industry.

[0002] In recent years, the demand for recombinant proteins has been increasing more and more due to their high value-added applications in industries of various sectors such as personal care, cosmetics, health care, agriculture, paper industries and materials. Hundreds of examples of commercial pharmaceutical proteins produced in various recombinant systems have been launched, such as insulin, human growth hormone, erythropoietin and interferon.

[0003] Furthermore, large amounts of proteins and peptides are required for these various industrial applications.

[0004] The most common industrial expression systems include E. coli bacteria, yeast (S. cerevisiae and P. pastoris) and mammalian cell lines. Emerging technologies are insect cell cultures, plants and microalgae.

[0005] However, the expression of recombinant peptides and proteins is still limited, as great efforts are required to obtain the desired peptides and proteins in their native conformation, in high quantities and in high purity. Even a common bacterial system such as E. coli has limitations to express recombinant peptides / polypeptides / proteins. Indeed, the formation of insoluble aggregates (or inclusion bodies) occurs due to the lack of sophisticated machineries to carry out post-translational modifications, such as the formation disulfide bridges or glycosylations. This results in poor solubility of the protein of interest and / or a lack of protein activity.

[0006] Interest in microalgae as an alternative platform for recombinant protein production has grown in recent years.

[0007] Recombinant algae offer several advantages over other recombinant protein production platforms. Microalgae are photosynthetic single-celled microorganisms with low nutritional requirements for growth. They are capable of photoautotrophic, mixotrophic, or heterotrophic growth. The cost of protein production in photoauxotrophically grown algae is much lower than with other production systems. Proteins purified from algae, as from plants, are free of toxins and viral agents that can, however, be present in preparations from bacteria or mammalian cell cultures. Indeed, several species of microalgae have GRAS (generally recognized as safe) status granted by the FDA, such as the microalgae Chlorella vulgaris and Chlorella protothecoid.es S106, Dunaliella bardawil, Chlamydomonas reinhardtii and the cyanobacteria Arthrospira plantesis. .

[0008] As in transgenic plants, algae have been engineered to express recombinant genes from nuclear and chloroplast genomes.

[0009] Furthermore, recombinant synthesis of peptides and polypeptides composed of repeating units of a specific amino acid sequence is difficult because the DNA sequences encoding the peptides or polypeptides are often subject to genetic recombination resulting in genetic instability and often leading to the production of proteins smaller than the native ones.

[0010] Recombinant production of relatively small peptides can also be difficult because they may self-assemble or be subject to proteolytic degradation.

[0011] Furthermore, unlike the plant-based expression system, algae are robust industrial chassis with competitive production costs accessible on an industrial scale under reproducible, sterile and well-controlled production conditions in photobioreactors and fermenters or in single-use wave-agitated bags. In addition, they can secrete recombinant proteins outside the cell and thus into the culture media, simplifying subsequent purification steps. Algae have no seasonality and do not use arable land.

[0012] The development of chloroplast transformation in algae for the production of proteins of interest is more recent than in plants and requires improvements. Indeed, the yield of recombinant protein production is typically between 0.5 and 5% of the total soluble proteins in the chloroplast. of Chlamydomonas reinhardtii, which is still low compared to the well-established microbial platform.

[0013] Furthermore, some mammalian proteins are not readily expressed (Rasala et al., 2010).

[0014] The invention relates to the peptide KTTKS (SEQ ID No. 1), a peptide well known in the cosmetic industry marketed in a derived form Palmitoyl-KTTKS (Matrixyl®) which has demonstrated broad biological effects, in particular on the synthesis of molecules of the extracellular matrix of the skin, such as collagen. The inventors of the present invention have surprisingly succeeded in producing, in the chloroplast of microalgae, recombinant proteins, polypeptides or peptides of KTTKS (SEQ ID No. 1) and their derivatives.

[0015] Indeed, the phenomenon of homologous recombination between similar or identical sequences being very efficient in the chloroplast genome, a transgene with repeated sequences could have been very unstable.

[0016] The use of said method allows the formation of endogenous disulfide bridges which are essential for the stability and activity of proteins, peptides and polypeptides, and the increased accumulation of proteins, peptides and polypeptides.

[0017] The present invention thus relates to a recombinant microalgae comprising a nucleic acid sequence coding:

[0018] (a) a recombinant peptide of SEQ ID No. 1;

[0019] (b) a recombinant peptide, polypeptide or protein consisting of repeating units of SEQID No. 1; or

[0020] (c) a derivative of (a) or (b);

[0021] said nucleic acid sequence being located in the chloroplast genome of the microalgae.

[0022] The present invention also relates to the use of said recombinant algae to produce: (a) a recombinant peptide of SEQ ID No. 1;

[0024] (b) a recombinant peptide, polypeptide or protein consisting of repeating units of SEQID No. 1; or

[0025] (c) a derivative of (a) or (b).

[0026] The present invention further relates to a method of producing:

[0027] (a) a recombinant peptide of SEQ ID No. 1;

[0028] (b) a recombinant peptide, polypeptide or protein consisting of repeating units of SEQID No. 1; or

[0029] (c) a derivative of (a) or (b);

[0030] in the chloroplast of a microalga, said method comprising transforming the chloroplast genome of the microalga with a nucleic acid sequence encoding said recombinant protein, polypeptide or peptide.

[0031] In particular, said method comprises:

[0032] (i) providing a nucleic acid sequence encoding said protein, recombinant polypeptide or peptide;

[0033] (ii) introducing the nucleic acid sequence according to (i) into an expression vector which is capable of expressing the nucleic acid sequence in the host cell of the microalga; and

[0034] (iii) transformation of the chloroplast genome of the microalgae host cell by the expression vector.

[0035] In particular, said method further comprises:

[0036] (iv) identification of the host cell of the transformed microalgae;

[0037] (v) characterization of the host cell of the microalgae for the production of the recombinant protein, polypeptide or peptide expressed from said nucleic acid sequence;

[0038] (vi) extracting the recombinant protein, polypeptide or peptide; and optionally;

[0039] (vii) purification of the recombinant protein, polypeptide or peptide.

[0040] More particularly, the method according to the invention makes it possible to increase the accumulation and / or stability and / or solubility and / or folding and / or activity of the recombinant peptides, polypeptides or proteins according to the invention in the chloroplast of microalgae.

[0041] In particular, step (vi) may be followed by a step (vi1) of removing the algae debris.

[0042] More particularly still, said method further comprises a step (vi”) in addition to step (vi'), in which the polypeptide or protein is cleaved to allow the release of the polypeptide or peptide.

[0043] More particularly still, said method further comprises a step (vii1) in addition to step (vii), in which the polypeptide or protein is cleaved to allow the release of peptide units.

[0044] This cleavage can be carried out by any method known to those skilled in the art such as the use of an appropriate endoproteinase.

[0045] Said recombinant peptides, polypeptides and proteins produced according to the invention may further be formulated, for example, in compositions intended for use in the cosmetic industry. Such a composition may form a cosmetic ingredient concentrated in peptide(s) and / or polypeptide(s) and / or protein(s).

[0046] In one embodiment, the peptide(s) and / or polypeptide(s) and / or protein(s) produced are purified (step vii) then mixed with a physiologically acceptable medium to form the cosmetic composition.

[0047] In another embodiment, the aqueous solution of peptide(s), polypeptide(s) and / or protein(s) obtained after step (vi1) is used as is or without complete purification, optionally after concentration to the desired content, in association if necessary with a physiologically acceptable medium, to form the cosmetic composition.

[0048] Since the peptide(s), polypeptide(s) and / or protein(s) of the invention are manufactured in an aqueous medium, an important advantage of the invention is the possibility of avoiding the use of non-sustainable organic solvents (for example so-called CMR solvents) both for the manufacturing steps and for the optional post-treatments.

[0049] In yet another embodiment, the peptide(s) / polypeptide(s) / protein(s) produced and purified, for example, by the methods described in the invention, may be chemically modified at their N- or C-terminus.

[0050] More particularly, the produced and purified peptide(s) / polypeptide(s) / protein(s) may be chemically modified at the N-terminus by an acyl group (-CO-Ri) or a sulfonyl group (-SO2-Ri) and / or at the C-terminus by an ORi, NH2, NHRi or NRiR2 group; with Ri and R2 being, independently of each other, chosen from a biotinyl radical, an alkyl, aryl, aralkyl, alkylaryl, alkoxy or aryloxy radical, which may be linear, branched, cyclic, polycyclic, unsaturated, hydroxylated, carbonylated, phosphorylated and / or sulfurized, said radical having 1 to 24 carbon atoms and may contain in its skeleton an O, S and / or N heteroatom.

[0051] According to preferred characteristics, R 1 and / or R 2 is an alkyl chain of 1 to 24 carbon atoms, preferably a lipophilic alkyl chain of 3 to 24 carbon atoms; and / or the peptide or polypeptide or protein is modified by an acyl radical -CO-R 1 at the N end and not modified at the C end, the acyl radical preferably being chosen from octanoyl (C 8 ), decanoyl (C 10 ), lauroyl (C 12 ), myristoyl (C 14 ), palmitoyl (C 16 ), stearoyl (C 18 ), biotinoyl, elaidoyl, loleoyl and lipoyl; preferably chosen from lauroyl (C 12 ), myristoyl (C 14 ) and palmitoyl (C 16 ).

[0052] The peptide(s) / polypeptide(s) / protein(s) of the invention may also be prepared and used in a vectorized form, in particular in encapsulated form (such as macrocapsules, microcapsules or nanocapsules, macrospheres, microspheres, or nanospheres, liposomes, oleosomes or chylomicrons, macroparticles, microparticles or nanoparticles, macro-sponges, micro-sponges or nano-sponges, microemulsions or nanoemulsions, or adsorbed on powdered organic polymers, talcs, bentonites, spores or exines and other mineral or organic supports).

[0053] These compositions comprising the peptide(s) or polypeptide(s) or protein(s) of the invention when applied to the skin and / or its appendages (hair, body hair, eyelashes, eyebrows, nails, etc.) are capable of beautifying the skin and its appendages, by improving their general condition, comprising for example the following biological effects: strengthening, antioxidant, tightening, moisturizing, nourishing, protective, smoothing, remodeling, volumizing ("lipofilling"), acting on the radiance of the complexion, anti-blemish, anti-dark circles, anti-glycation, anti-aging, anti-wrinkles and fine lines, slimming, soothing, myo-relaxing, lightening, anti-redness, anti-stretch marks, etc.

[0054] Therefore, the present invention also provides the use of an aqueous mixture of peptide and / or polypeptide and / or protein produced according to the process of the invention and free from algae debris for the manufacture of a cosmetic composition. The present invention also provides the use of an aqueous mixture of peptide and / or polypeptide and / or protein produced according to the process of the invention and free from algae debris for use in a non-therapeutic cosmetic treatment.

[0055] By "recombinant peptide / polypeptide / protein" is meant in the art, and in the context of the present invention, an exogenous peptide / polypeptide / protein expressed from a recombinant gene (or a recombinant nucleic acid sequence) i.e. an exogenous gene (or exogenous nucleic acid sequence) originating from a different species (heterologous) or from the same species (homologous).

[0056] By "recombinant microalga" is meant a microalga comprising a nucleic acid sequence encoding a recombinant protein, polypeptide or peptide. In the context of the invention, the recombinant microalga is transformed as detailed further below.

[0057] By "peptides", "polypeptides", "proteins" is meant the meaning commonly understood by those skilled in the art to which this invention belongs. In particular, peptides, polypeptides and proteins are polymers of amino acids linked via peptide bonds (amides).

[0058] More particularly, the proteins according to the invention have a unique and stable three-dimensional structure and are composed of more than 50 amino acids, such as proteins of 54, 60, 66, 72, 75, 78, 84, 90, 96, 100, 102, 108, 114, 120, 150, 180, 200, 300, 350 or more amino acids; the peptides according to the invention, also called oligopeptides, are short peptides for example of 2 to 10 amino acids, such as peptides of 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; polypeptides according to the classical meaning can be composed of 11 to 50 amino acids, such as polypeptides of 11, 12, 15, 18, 20, 24, 25, 30, 35, 36, 40, 42, 45, 48 or 50 amino acids. In the context of the invention, the proteins and polypeptides are a repetition of n identical or different amino acid sequence units, i.e. a repetition of n identical or different peptide units, n being from 2 to 400, in particular from 2 to 100.

[0059] In particular, the peptides according to the invention may be the KTTKS peptide of SEQ ID No. 1 (called NY2), or its derivatives.

[0060] By "derivatives" of the peptide of SEQ ID No. 1 is meant that the native amino acid sequence of the peptide is mutated or contains one or more additional amino acids at its N-terminal or C-terminal end. These additional amino acids can be any amino acids. In particular, derivatives of the KTTKS peptide of SEQ ID No. 1 contain the KTTKS sequence with one or more amino acids at its N-terminal and / or C-terminal end.

[0061] In particular, the additional amino acids in the derivatives of the peptide of SEQ ID NO: 1 may be a lysine (K), a threonine (T), a serine (S), an aspartic acid (D), a glutamic acid (E) or a glycine (G).

[0062] For example, a derivative of the KTTKS peptide of SEQ ID NO: 1 may be the peptide of SEQ ID NO: 2 (GKTTKS) (referred to as GNY2).

[0063] Other examples are the peptides of SEQ ID No. 3 (KTTKSD) (called NY3a), of SEQ ID No. 4 (KTTKSE) (called NY3b), of SEQ ID No. 5 (DKTTKS) or of SEQ ID No. 6 (EKTTKS) and derivatives of GKTTKS which can be peptides of SEQ ID No. 7 (GKTTKSD) or of SEQ ID No. 8 (GKTTKSE).

[0064] The polypeptides according to the invention consist, as mentioned previously, of repeat units of SEQ ID No. 1, that is to say that they contain several repetitions (n ​​times) of the KTTKS peptide of SEQ ID No. 1 or of one of its derivatives.

[0065] By "derivatives" of said polypeptides according to the invention, it is meant that the native amino acid sequence of the peptide, which is repeated, is mutated or contains one or more additional amino acids at its N-terminal or C-terminal end. These additional amino acids can be any amino acids.

[0066] Examples of such derivatives are called (NY3a)n and (NY3b)n and contain several repetitions (n ​​times) of the NY3a or NY3b peptide described above.

[0067] In particular, these derivatives contain a repetition of five units of NY3a or NY3b and are called (NY3a)x5 and (NY3b)x5 respectively.

[0068] More particularly, polypeptide derivatives according to the invention are polypeptides of SEQ ID No. 9 (KTTKSDKTTKSDKTTKSDKTTKSDKTTKSD) called (NY3a)x5 or of SEQ ID No. 10 (GKTTKSDKTTKSDKTTKSDKTTKSDKTTKSDKTTKSD) called G((NY3a)x5) or of SEQ ID No. 11 (KTTKSEKTTKSEKTTKSEKTTKSEKTTKSEKTTKSE) called (NY3b)x5 or of SEQ ID No. 12 (GKTTKSEKTTKSEKTTKSEKTTKS EKTTKSE) called G((NY3b)x5).

[0069] By “mutated” peptide or polypeptide or protein is meant that the nucleic acid or amino acid sequence of the “mutated” peptide, polypeptide or protein contains one or more mutations relative to the nucleic acid or amino acid sequence of the peptide of SEQ ID No. 1 and the peptides, polypeptides or proteins consisting of repeating units of SEQ ID No. 1.

[0070] These mutations include deletions, substitutions, insertions and / or cleavage of one or more nucleic acids or amino acids.

[0071] According to the invention, a nucleic acid sequence encoding said recombinant protein, polypeptide or peptide is a nucleic acid sequence encoding the proteins, peptides or polypeptides mentioned above.

[0072] In particular, the nucleic acid sequence encoding the peptides and polypeptides of the invention is described in Table 1 below.

[0073] [Tables 1] Name of the pept ide or ptide polype Amino acid sequence Nucleic acid sequence NY2 KTTKS (SEQ ID N°l) AAAACAACTAAATCA (SEQ ID N°13) GNY2 GKTTKS (SEQNY ID N°2) GGTAAAA3 (IDAACAATAA) KTTKSDKTTKSDKTTKS DKTTKSDKTTKSD (SEQ ID N°9) AAGACTACCAAAAGTGATAAACAAC TAAAAGCGATAAGACAACTATG ATAAAACAACTCAAACAAACA ACAAAATCKTT (SEQ ID N°15) G(SDTTKTTa)xSDKKTT GKTT KILL°10) GGTAXACCAAAGAAACAAAC AACTAAAAACCAAACTAACACAAAAACAAACAAACATCH (SEQ ID N°16) (NY3b)x5 KTTKSECTXECTTKS ECTKSECT ICTCAGAACATACAT°1) AAAAAGT REPEATCAAAATCTG AGAAAACACACQUEQUEST AAAAACCATCT (SEQ ID N°17) G(NY3b)x5 GKTTKSECTXCTKTTK SECTTKSECTX (SEQ IDN°12) GGTAAACACQUESTION REQUIREMENTAAAAAAC CTGAGAAAACAACCAAGTCAGAAAAG ACAACAAAATCAGAA (SEQ ID NO: 18)

[0074] In one embodiment, the derivatives according to the invention consist of an amino acid sequence at least 80% identical to the amino acid sequence of the recombinant peptide of SEQ ID NO: 1 or of the recombinant peptide, polypeptide or protein consisting of repeated units of SEQ ID NO: 1.

[0075] By "amino acid sequence identical to at least 80%" is meant in particular an amino acid sequence identical to 81, 82, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99%. An amino acid sequence "identical" to at least 95% to an amino acid sequence claimed according to the present invention means that the amino acid sequence of the polypeptide in question is identical to the claimed sequence except that the amino acid sequence in question may comprise up to five amino acid modifications per 100 amino acids of the claimed amino acid sequence. In other words, to obtain an amino acid sequence at least 95% identical to a claimed amino acid sequence, up to 5% (5 out of 100) of the amino acid residues in the sequence in question may be inserted, deleted or replaced by another amino acid.

[0076] In the context of the present application, the percentage identity is calculated using a global alignment (i.e., the two sequences are compared over their entire length). Methods for comparing the identity of two or more sequences are well known in the art. The program "needle", which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970 J. Mol. Biol. 48: 443-453) to find the optimal alignment (including gaps) of two sequences considering their total length, can for example be used. The program "needle" is for example available on the global website ebi.ac.uk. The identity percentage according to the invention is preferably calculated using the EMBOSS (global) “needle” program with a “Gap Open” parameter equal to 10.0, a “Gap Extend” parameter equal to 0.5 and a Blosum62 matrix.

[0077] An amino acid sequence "at least 80%, 85%, 90%, 95% or 99% identical" to a reference sequence may include mutations such as deletions, insertions and / or substitutions relative to the reference sequence. In the case of substitutions, an amino acid sequence at least 80%, 85%, 90%, 95% or 99% identical to a reference sequence may correspond to a homologous sequence derived from a different species than the reference sequence. In another preferred embodiment, the substitution preferably corresponds to a conservative substitution as indicated in Table 2 below.

[0078] [Tables2] Conservative substitution Amino acid type Ala, Val, Leu, Lie, Met, Pro, Phe, Tr P Amino acids with hydrophobic aliphatic side chain Ser, Tyr, Asn, Gln, Cys Amino acids with uncharged but polar side chain Asp, Glu Amino acids with acidic side chain Lys, Arg, His Amino acids with basic side chain Gly Amino acids with neutral side chain

[0079] In particular again, the nucleic acid sequence encoding derivatives according to the invention consists of a nucleic acid sequence at least 80% identical to the nucleic acid sequence encoding the recombinant peptide of SEQ ID No. 1 or the recombinant peptide, polypeptide or protein consisting of repeated units of SEQ ID No. L

[0080] For example, said nucleic acid sequence is at least 80% identical to any one of SEQ ID Nos. 13 to 18.

[0081] By "nucleic acid sequence at least 80% identical" is meant in particular a nucleic acid sequence that is 81, 82, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical. For example, a nucleic acid sequence that is 95% "identical" to a claimed sequence of the present invention means that the sequence of the polynucleotide is identical to the claimed sequence except that the sequence may comprise up to five nucleotide modifications per 100 nucleotides of the claimed sequence. In other words, to obtain a polynucleotide having a sequence at least 95% identical to a claimed sequence, up to 5% (5 out of 100) of the nucleotides in the sequence may be inserted, deleted or substituted with another nucleotide. In other words, the sequences must be compared over their entire length (i.e., by preparing a global alignment).For example, a first polynucleotide of 100 nt (nucleotides) which is included in a second polynucleotide of 200 nt is 50% identical to said second polynucleotide. The program “needle”, which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970, “A general method applicable to the search for similarities in the amino acid sequence of two proteins”, J. Mol. Biol. 48: 443-453) to find the optimal alignment (including gaps) of two sequences by considering their entire length, can for example be used. Preferably, the percentage identity according to the invention is calculated using the program “needle” with a “Gap open” parameter equal to 10.0, a “Gap Extend” parameter equal to 0.5 and a Blosum 62 matrix. The "needle" program is for example available on the ebi.ac.uk World Wide Web website.

[0082] In one embodiment, the nucleic acid sequence encoding the protein, polypeptide or peptide according to the invention is codon-optimized for expression in the chloroplast genome of the microalgal host cell.

[0083] As mentioned above, the nucleic acid sequence according to the invention is introduced into an expression vector which is capable of expressing the nucleic acid sequence.

[0084] By "introduction" is meant the cloning of the nucleic acid sequence encoding the recombinant protein / polypeptide / peptide into the expression vector using methods well known to those skilled in the art and in such a way as to lead to the expression of this nucleic acid sequence.

[0085] "Expression vectors" or "transformation vectors" or "recombinant DNA constructs", or similar terms, are defined herein as DNA sequences that are necessary for the transcription of recombinant genes and the translation of their mRNAs in microalgal host cells. "Expression vectors" contain one or more expression cassettes for the recombinant genes (one or more genes encoding the protein, peptide or polypeptide of interest and often selection markers). In the case of transformation of the chloroplast genome, the expression vectors also contain homologous recombination regions for the integration of expression cassettes within the chloroplast genome.

[0086] In the context of the invention, the expression vector may in particular be a circular molecule with a plasmid backbone containing the two homologous recombination regions surrounding the expression cassettes, or a linearized molecule corresponding to the expression vector linearized by enzymatic digestion or to a PCR fragment containing only the expression cassettes surrounded by the two homologous recombination regions.

[0087] In particular, the expression vectors of the invention comprise at least one expression cassette and are, for example, vectors pNY18, pNY 19, pNY 13, pNY14, pNY15 or pNY16.

[0088] An "expression cassette" contains a coding sequence operatively fused to one or more regulatory elements or regulatory sequences, such as fused at its 5' end to a promoter and / or a 5'UTR and at its 3' end to a 3'UTR.

[0089] The "coding sequence" is the portion of a gene and its corresponding transcribed mRNA that is translated into a recombinant protein / polypeptide / peptide. The coding sequence includes, for example, an initiation regulatory sequence of translation and a stop codon. In some embodiments, the expression cassette may contain a polycistron composed of more than one coding sequence encoding multiple proteins under the control of a single promoter / 5'UTR and 3'UTR.

[0090] Said expression cassettes are flanked by endogenous left (LHRR) and right (RHRR) sequences identical to those surrounding the targeted integration site in the chloroplast genome. These left (LHRR) and right (RHRR) homologous regions allow the integration of expression cassettes after exchanges by homologous recombination between the homology regions.

[0091] Homologous recombination is the ability of complementary DNA sequences to align and exchange regions of homology. Transgenic ("donor") DNA containing sequences homologous to the targeted genomic sequences ("template") is introduced into the organism and then undergoes recombination into the genome at the site of the corresponding homologous genomic sequences.

[0092] Given its nature, homologous recombination is a precise gene targeting event, and therefore, most transgenic lines generated with the same targeting sequence will be essentially identical in phenotype, requiring screening for far fewer transformation events.

[0093] In the case of transformation of the chloroplast genome of a microalga, the integration of expression cassettes within the chloroplast genome occurs after homologous recombination between the endogenous homologous sequences of the expression vector with the genomic sequences identical or similar to those surrounding the targeted integration site in the chloroplast genome.

[0094] In the context of the present invention, other integration sites may be between the genes rbcL and atpA, or psaB and trnG, or atpB and 16S rDNA, or psaA exon3 and tmE, or tmE and psbH, or psbN and psbT, or psbB and tmD.

[0095] In some embodiments, in order to improve its accumulation, the polypeptide protein or recombinant peptide may be fused to endogenous proteins, such as for example to the large subunit of ribulose bisphosphate carboxylase (Rubisco LSU). In this case, the promoter and the 5'UTR will be those of the endogenous rbcE gene, after homologous recombination of the transformation vector into the chloroplast genome.

[0096] The protein, peptide or polypeptide of interest will further be separated from the RBCL either in vivo or in vitro, depending on the processing system chosen.

[0097] In one embodiment, said coding sequence in the expression cassette may also comprise a nucleic acid sequence encoding an epitope tag (Tag), in particular the Flag epitope tag, more particularly the Flag tag repeated 3 times (3xFlag tag), in order to identify and / or purify the recombinant protein, polypeptide or peptide.

[0098] In particular, said epitope tag sequence is placed at the N-terminal end of the protein, peptide or polypeptide. More particularly, another epitope tag sequence may be placed at the C-terminal end of the protein, peptide or polypeptide according to the invention, alone or in addition to that at the N-terminal end, in order to monitor the release of the peptide / polypeptide / protein of interest in order to follow its cleavage, for example by an endoprotease.

[0099] Examples of epitope tag sequences are the Flag tag (SEQ ID NO: 19: DYKDDDDK), the 3xFlag tag (SEQ ID NO: 20: DYKDDDDKDYKDDDDKDYKDDDDK), the HA tag (SEQ ID NO: 21: YPYDVPDYA), the 3xHA tag (SEQ ID NO: 22: YPYDVPDYAYPYDVPDYAYPY DVPDYA), the His tag (SEQ ID NO: 23: HHHHHH).

[0100] A "promoter" as used herein refers to a regulatory nucleic acid sequence that directs the transcription of a nucleic acid.

[0101] The "5'UTR" or 5' untranslated region (also known as the guide sequence or guide RNA) is the region of an mRNA that is directly upstream of the start codon.

[0102] The "3'UTR" or 3' untranslated region is the section of messenger RNA (mRNA) that immediately follows the translation termination codon.

[0103] A 5'UTR and a 3'UTR are required for transcript (mRNA) stability and translation initiation.

[0104] For chloroplast expression in microalgae, the promoters, 5'UTRs and 3'UTRs that can be used in the context of the invention are, for example: the promoters and 5'UTRs of the genes psbD, psbA, psaA, atpA and atpB, the promoter of the 16S rRNA gene (Prm) fused with a 5'UTR, the 3'UTR of psbA, the 3'UTR of atpA or the 3'UTR of rbcL.

[0105] A 5'UTR of exogenous origin such as for example the 5'UTR of the 10L gene of the bacteriophage T7 can also be used fused downstream of a microalgal promoter. In particular, the nucleic acid sequence is operably linked at its 5' end to the promoter of the 16S rRNA gene of Chlamydomonas reinhardtii (Prrri).

[0106] The stable expression and translation of the nucleic acid sequence according to the present invention can for example be controlled by the promoter and the 5'UTR of psbD and by the 3'UTR of atpA.

[0107] Also, in one embodiment of the recombinant microalgae or the method according to the invention, the nucleic acid sequence encoding a recombinant protein, polypeptide or peptide is operably linked to at least one regulatory sequence chosen from the promoter and 5'UTR of psbD (SEQ ID N °78) or the promoter of the 16S rRNA (Prrn) fused to the 5'UTR of atpA (SEQ ID No. 76), the promoter and 5'UTR of psaA, the promoter and 5'UTR of atpA, the 3'UTR of atpA (SEQ ID No. 79), the 3'UTR of rbcL (SEQ ID No. 77).

[0108] In one embodiment, the promoterless gene encoding the protein, peptide or polypeptide of interest may be integrated after a region of homologous recombination within the chloroplast genome just downstream of a native promoter.

[0109] As mentioned above, the chloroplast genome of the microalgae host cell is transformed by the expression vector. This genetic transformation of microalgal host cells, and more particularly of the microalgal chloroplast genome, by an expression vector according to the invention can be carried out according to any appropriate technique well known to those skilled in the art, including in particular biolistics (Boynton et al., 1988; Goldschmidt-Clermont, 1991), electroporation (Fromm et al., Proc. Nat. Acad. Sci. (USA) (1985) 82: 5824-5828; see Maruyama et al. (2004), Biotechnology Techniques 8: 821-826), transformation of glass beads (Purton et al., review), protoplasts treated with CaCl2 and polyethylene glycol (PEG) (see Kim et al. (2002), Mar. Biotechnol. 4: 63-73) or microinjection.

[0110] In particular, said transformation uses the technique of helium bombardment of gold micro-projectiles complexed with the transforming DNA.

[0111] To identify microalgal transformants, a selection marker gene may be used. For example, the aadA gene encoding aminoglycoside 3'-adenylyltransferase and conferring resistance to spectinomycin and streptomycin in the case of chloroplast transformation of Chlamydomonas reinhardtii may be mentioned. In another embodiment, the selection marker gene may be the aphA-6 Ab gene of Acinetobacter baumannii encoding 3'-aminoglycoside phosphotransferase type VI and conferring resistance to kanamycin.

[0112] Chloroplast genome engineering can thus be carried out using a selection marker gene conferring resistance to an antibiotic or using the reversion of a photosynthetic mutant.

[0113] In particular, in one embodiment, the expression vector for the transformation of the chloroplast genome comprises two expression cassettes comprising the nucleic acid sequence encoding the recombinant protein, polypeptide or peptide according to the invention and the selection marker gene.

[0114] More particularly, the expression vector for the transformation of the chloroplast genome comprises an expression cassette comprising the nucleic acid sequence encoding the recombinant protein, polypeptide or peptide according to the invention and an expression cassette comprising the aadA gene encoding the aminoglycoside 3"-adenylyltransferase (as for example in [Fig.2]).

[0115] In another embodiment of the invention, corresponding to the case of the reversion of a light-sensitive photosynthetic mutant, the expression vector comprises the wild-type RHRR region which is deleted in the mutant strain.

[0116] After homologous recombination, the deleted region is restored in the genome of the photosynthetic mutant which can then grow under light.

[0117] In particular, the coding sequence of the expression cassette according to the invention also comprises a nucleic acid sequence encoding a signal peptide. By "signal peptide" (SP) is meant in the present invention an amino acid sequence placed at the N-terminal end of the newly synthesized protein or polypeptide or recombinant peptide. This signal peptide will allow the translocation and accumulation of the protein in the lumen of the chloroplast thylakoids and not in the chloroplast stroma. The signal peptide is cleaved after translocation through the thylakoid membranes.

[0118] For example, such a signal peptide sequence is selected from known proteins translocated into the thylakoid lumen using either the double arginine translocation (Tat) pathway or the Sec pathway.

[0119] For example, signal peptides may be derived from algal proteins located in the lumen of thylakoids, such as the signal peptide of the 16 and 23 kDa subunits of the water oxidation complex of photosystem II of Chlamydomonas reinhardtii, or the Rieske subunit of the b6f complex of Chlamydomonas reinhardtii or the alpha subunit of phycoerythrin from cryptophytes (e.g., from Guillardia theta).

[0120] In particular, the signal peptide may be extracted from a bacterial protein, such as the sequence of the TorA gene of E. coli encoding trimethylamine-N-oxide reductase 1 (UniProt number P33225) (SP; SEQ ID NO: 24: NNNDLFQASRRRFLAQLGGLTVA GMLGPSLLTPRRATAAQA and the nucleic acid sequence of SEQ ID NO: 80). This signal peptide uses the Tat system. This amino acid sequence is cleaved from the protein after the latter has translocated across the thylakoid membrane.

[0121] Other signal peptides may be used which do not leave additional amino acids at the N-terminus of the recombinant protein, such as a signal peptide from an algae, and in particular from Chlamydomonas reinhardtii.

[0122] In one embodiment, the recombinant protein or polypeptide or peptide may be produced as a fusion protein.

[0123] The invention thus also relates to a microalgae or a recombinant method according to the invention, in which the nucleic acid sequence encoding a recombinant protein, polypeptide or peptide is operationally fused to its 5' or 3' end to a nucleic acid sequence encoding a fusion partner (or "carrier")

[0124] Fusion partners have been developed in the production of recombinant proteins in order to increase accumulation yields and / or solubility and / or folding and / or to facilitate protein purification. Fusion partners of different sizes (or molecular masses) have been used in various production systems in order to improve protein solubility and accumulation (MBP ("Maltose Binding Protein"), GST (glutathione-S-transferase), thioredoxin, GB1, NusA ("N-utilizing substance A"), SUMO ("small ubiquitin-like modifier"), Fh8) and to facilitate detection and purification (such as, but not limited to, MBP, GST and small peptide epitope tags such as the c-myc tag, the polyhistidine tag (His tag), the Flag tag, the HA tag.Another type of fusion tags used for purification are stimulus-responsive tags (or environmentally sensitive polypeptides) that allow precipitation of the fusion protein when the stimulus, such as a change in temperature or ionic strength of the solution, is adjusted.

[0125] In particular, a fusion partner according to the present invention may be one of the different thioredoxins of Chlamydomonas reinhardtii and in particular thioredoxin m of Chlamydomonas reinhardtii encoded by a nucleic acid sequence derived from the sequence XM_001690262 in GenBank or aprotinin. More particularly, the fusion partner according to the invention is aprotinin.

[0126] The fusion partner and the recombinant protein, polypeptide or peptide are fused together to form a fusion protein.

[0127] By "aprotinin" is meant basic trypsin inhibitor (BPTI), a small single-chain protein crosslinked by three disulfide bridges which consists of 58 amino acid residues with a molecular mass of 6.5 kDa and an isoelectric point of 10.9.

[0128] Said protein is well known to those skilled in the art and is commercially available. It can, for example, be produced in recombinant systems such as plants (in the cytoplasm by nuclear transformation (Pogue et al., 2010) or in the lumen of thylakoids by chloroplast transformation (Tissot et al., 2008).

[0129] Its formula is C284H432N84O79S7 and its molar mass 6511.51 g / mol (g.-moF1 \

[0130] The amino acid sequence of Bos Taurus (bovine) aprotinin is RPDFC LEPPY TGPCK ARIIR YFYNA KAGLC QTFVY GGCRA KRNNF KSAED CMRTC GGA (SEQ ID No. 25 and SEQ ID No. 81 for the native nucleic acid sequence of mature aprotinin from Bos taurus (GenBank accession number X05274)).

[0131] In the context of the present invention, the term "aprotinin" also covers chimeric aprotinin and mutated aprotinin.

[0132] By "chimeric aprotinin" is meant that the aprotinin is linked at its N-terminal end and / or its C-terminal end to one or more epitope tag peptides and / or signal peptides and / or protease recognition cleavage sites.

[0133] By “mutated” aprotinin is meant that the “mutated” nucleic acid or amino acid sequence contains one or more mutations relative to the nucleic acid or amino acid sequence of the aprotinin or chimeric aprotinin used in particular in the present invention. These mutations include deletions, substitutions, insertions and / or cleavages of one or more nucleic acids or amino acids.

[0134] The chimeric aprotinin may be, for example, the protein called 3F / HA-APRO, comprising aprotinin fused at its N-terminus to an HA epitope tag or a 3XFlag (3F) epitope tag.

[0135] Other examples of chimeric aprotinin may be the protein designated HA-SP-3F-FX-APRO (SEQ ID NOS. 26 and 27) comprising aprotinin fused at its N-terminus to an amino acid sequence consisting of an HA epitope tag (HA) followed by a signal peptide (SP), a 3XFlag epitope tag (3F) and a factor Xa cleavage site (FX; IEGR), or the chimeric aprotinin designated HA-SP-3F-APRO comprising aprotinin fused at its N-terminus to an HA tag followed by the signal peptide SP and a 3XFlag tag (3F), or a chimeric aprotinin designated HA-SP-APRO comprising aprotinin fused at its N-terminus to an HA tag followed by the signal peptide SP.

[0136] A signal peptide is as described previously.

[0137] Other signal peptides may be used that do not leave additional amino acids at the N-terminus of the recombinant protein.

[0138] If the signal peptide is cleaved after translocation into the lumen of the chloroplast thylakoids (or across the thylakoid membranes), two other chimeric aprotinins can be produced in vivo 3F-APRO (SEQ ID NO: 28) or 3F-FX-APRO (SEQ ID NO: 29).

[0139] In particular, according to the invention, the fusion partner is used to improve the accumulation and / or stability of recombinant peptides, polypeptides and proteins.

[0140] Even more particularly, and as mentioned above, said fusion protein also comprises cleavage sites recognized by specific proteases.

[0141] The cleavage sites recognized by specific proteases are well known to those skilled in the art. They are used to separate aprotinin from the recombinant protein, polypeptide or peptide of interest, in the case where the fusion partner should be removed if it could interfere with the activity or structure of said protein, polypeptide or peptide and therefore with their uses.

[0142] In particular, said cleavage sites consist of a recognition sequence of an endoprotease and / or an endoproteinase (or cleavage site of a protease or recognition site of a protease). More particularly, the sequence of said cleavage sites is placed between the two coding sequences (that of aprotinin and that of the recombinant protein, polypeptide or peptide of interest according to the invention).

[0143] Cleavage of the fusion protein can be carried out either in vivo (in the recombinant host cell before extraction or upon application to the skin for cosmetic peptides) or in vitro after extraction and purification by addition of protease.

[0144] Cleavage of the fusion protein can be carried out either in vivo (in the recombinant host cell before extraction or upon application to the skin for cosmetic peptides) or in vitro after extraction and purification by addition of protease.

[0145] Non-limiting examples of proteases are factor Xa (FX), tobacco edge virus (TEV) protease, enterokinase (EK), SUMO protease, thrombin, human rhinovirus 3C protease (HRV 3C), endoproteinase Arg-C, endoproteinase Asp-C, endoproteinase Asp-N, endoproteinase Lys-C, endoproteinase Glu-C, proteinase K, ITgA protease, trypsin, chymotrypsin and thermolysin.

[0146] Self-cleaving peptides can also be used, such as the Intein system (Yang et al., 2003), the viral 2A system (Rasala et al., 2012) or the Chlamydomonas pre-ferredoxin site (Muto et al., 2009).

[0147] In one embodiment, a linker may be placed between aprotinin and the protease cleavage site. Linkers can be classified into three types: flexible, rigid, and cleavable. The usual function of linkers is to fuse the two partners of the fusion protein (e.g., for flexible linkers or rigid linkers) or to release them under specific conditions (cleavable linkers) or to provide other functions of the proteins in drug design such as enhancing their biological activities or targeted delivery.

[0148] In one embodiment of the present invention, the linker may also make the protease cleavage site more accessible to the enzyme if needed.

[0149] In one embodiment, the flexible linker contains small non-polar (e.g., Gly) or polar (e.g., Ser or Thr) amino acids. Examples of such linkers are given in Chen et al., 2013.

[0150] Flexible linkers according to the invention may be LG (RSGGGGSGGGGSGS; SEQ ID No. 30) or LGM (RSGGGGSSGGGGGGSSRS; SEQ ID No. 31).

[0151] In particular and as an example of the present invention, the NY2 peptide or the (NY3a)x5 or (NY3b)x5 polypeptides can be produced in fusion proteins and can be fused to the C-terminus of the chimeric aprotinin HA-SP-3F-FX-APRO.

[0152] This fusion partner can be separated from the polypeptide or peptide of interest by the flexible linker LGM followed by a cleavage site for TEV protease (TV; SEQ ID NO: 32 ENLYFQG) or enterokinase (EK; SEQ ID NO: 33 DDDDK).

[0153] Therefore, in the present invention, the amino acid sequence and nucleic acid sequence of the different fusion proteins produced in independent algal transformants are for example the protein called HA-SP-3F-FX-APRO-LGM-EK-NY2 (SEQ ID NOS. 34 and 35), HA-SP-3F-FX-APRO-LGM-TV-NY2 (SEQ ID NOS. 36 and 37), HA-SP-3F-FX-APRO-LGM-EK-(NY3a)x5 (SEQ ID NOS. 38 and 39), HA-SP-3F-FX-APRO-LGM-TV-(NY3a)x5 (SEQ ID NOS. 40 and 41), HA-SP-3F-FX-APRO-LGM-EK-(NY3b) x5 (SEQ ID NOS. 42 and 43) or HA-SP-3F-FX-APRO-LGM-TV-(NY3b)x5 (SEQ ID No. 44 and 45).

[0154] When a fusion protein with a fusion partner is involved, step (vi) of the method according to the invention is a step of purification of the fusion protein.

[0155] In this case, the method optionally comprises a step (vii) in which the fusion protein is cleaved.

[0156] Said cleavage can be carried out by any method known to those skilled in the art such as the use of an appropriate protease to release the recombinant peptide, polypeptide or protein.

[0157] Said step (vii) is optionally followed by a purification step (viii) of the recombinant protein, polypeptide or peptide.

[0158] In particular, said method further comprises a step (vii1) between step (vii) and step (viii), in which the polypeptide is cleaved to allow the release of peptide units.

[0159] This cleavage can be carried out by any method known to those skilled in the art such as the use of an appropriate endoproteinase.

[0160] Identification of fusion or recombinant proteins can be performed by Western blotting using specific antibodies.

[0161] The characterization of the microalgal host cell producing the recombinant protein, polypeptide or peptide can be carried out by techniques known to those skilled in the art, for example by PCR screening of antibiotic-resistant transformants or Western Blot analysis carried out on total protein extracts.

[0162] The extraction of total proteins can be carried out using well-known techniques (centrifugation, lysis (chemically, mechanically, thermally, enzymatically), sonication, etc.).

[0163] The removal of algae debris can be carried out by any suitable method known to those skilled in the art, such as filtration, precipitation, centrifugation, etc.

[0164] The purification can be carried out using well-known techniques. In one embodiment, it comprises affinity chromatography and / or a step of separating the peptide, polypeptide or protein according to the invention and the fusion partner (for example by enterokinase protease digestion) and / or by size exclusion chromatography.

[0165] In one embodiment, the affinity chromatography step can be replaced by ion exchange chromatography, which is less expensive for large-scale purification.

[0166] According to the invention, a "microalga" is a eukaryotic microbial organism which contains a chloroplast or a plastid, and optionally which is capable of carrying out photosynthesis, or a prokaryotic microbial organism (cyanobacteria) capable of carrying out photosynthesis.

[0167] In particular, said microalgae is chosen from the group consisting of Chlorophyta (green algae), Rhodophyta (red algae), Stramenopiles (heterokonts), Xanthophyceae (yellow-green algae), Glaucocystophyceae (glaucocystophytes), Chlorarachniophyceae (chlorarachniophytes), Euglenida (euglenids), Haptophyceae (coccolithophorids), Chrysophyceae (golden algae), Cryptophyta (cryptomonads), Dinophyceae (dinoflagellates), Haptophyceae (coccolithophorids), Bacillariophyta (diatoms), Eustigmatophyceae (eustigmatophytes), Raphidophyceae (raphidophytes), Scenedesmaceae, Phaeophyceae (brown algae).

[0168] More particularly, said microalgae is chosen from the group consisting of Chlamydomonas, Chlorella, Dunaliella, Haematococcus, diatoms, Scenedesmaceae, Tetraselmis, Ostreococcus, Porphyridium and Nannochloropsis.

[0169] More particularly still, said microalga is chosen from the group consisting of Chlamydomonas, more particularly Chlamydomonas reinhardtii, even more particularly Chlamydomonas reinhardtii 137c or a deficient strain such as Chlamydomonas reinhardtii CW15.

[0170] In particular, said microalga is cultivated under conventional conditions known to those skilled in the art. For example, Chlamydomonas reinhardtii is cultivated in TAP (tris acetate phosphate) medium to a semi-logarithmic exponential phase (densities of approximately 1-2x106 cells / ml) and / or at a temperature between 23°C and 25°C (ideally 25°C) and / or on a rotary shaker in the presence of constant light (70-150 qE / m2 / s). The experimental part illustrates the culture conditions.

[0171] All embodiments mentioned within the scope of the present invention can be combined.

[0172] The above-mentioned recombinant microalgae and the method for producing a recombinant protein, polypeptide or peptide in the chloroplast of microalgae can also be applied, at least in part, to peptides, polypeptides and proteins: - dipeptides selected from VW, YR, [3AH, KT, RT, M02K, M02Ava, AvaM02, PR, PA, PM, PP, PG, PS, AP and GP;

[0173] These dipeptides are described in WO2001 / 064178, WO2003 / 068141, WO1998 / 007744, WO2010 / 1336965, FR2668365, WO2006 / 114657 and WO2010 / 080376, WO2014 / 080376. - tripeptides chosen from GHK, KAvaK, KFK, K[3AK, KAbuK, KAcaK, KPK, KMK, KMOK, KM02K, PPS, PPD, PPK, PPL, PPA, PPR, APR, SPR, LPR, QPK, QPH, QPM, QPA, QPR, YPR, LPA, SPA, LPM, IPM, MPL, K(P)HG, K(Pyr)HG, K(Hyp)HG, K(P)GH, K(Pyr)GH, K(Hyp)GH, K(Ac)HG, K(Ac)GH, KHG and KGH;

[0174] These tripeptides are described in WO2000 / 040611, WO2001 / 043701, WO2000 / 058347, WO2005 / 048968, WO2012 / 164488, WO2012 / 143845, WO2005 / 102266, WO2007 / 093839, WO2010 / 050191, WO2010 / 082175, WO2010 / 082177, WO2015 / 181688, WO2015 / 181688, WO2014 / 080376, WO2017 / 216177 and WO2016 / 097966. tetrapeptides chosen from GQPR (SEQ ID No. 46), TKPR (SEQ ID No. 47), KTFK (SEQ ID No. 48), KTAK (SEQ ID No. 49), KAYK (SEQ ID No. 50), KFYK (SEQ ID No. 51), KAvaM02K (SEQ ID No. 52), KM02TK (SEQ ID No. 53), AQPR (SEQ ID No. 54) and AQPK (SEQ ID No. 55);

[0175] These tetrapeptides are described in WO2000 / 043417, WO2003 / 068141, WO2005 / 048968, WO2012 / 164488, WO2005 / 102266, WO2007 / 093839, WO2019 / 193113, WO2010 / 082177 and WO2014 / 080376. YGGFL pentapeptides (SEQ ID No. 56) or YGGFP (SEQ ID No. 57);

[0176] These pentapeptides are described in WO2000 / 015188. hexapeptides chosen from HLDIIW (SEQ ID No. 58), HLDIIF (SEQ ID No. 59) and HLDIITpi (SEQ ID No. 60).

[0177] These hexapeptides are described in WO2007 / 068998, FR2735687 and WO2007 / 129270.

[0178] In these sequences:

[0179] MO means a methionine sulfone;

[0180] MO2 means a methionine sulfoxide;

[0181] Ava corresponds to 5-amino valeric acid;

[0182] Abu corresponds to amino butyric acid;

[0183] K(P) corresponds to a proline grafted onto the chain of the amino acid lysine;

[0184] K(Pyr) corresponds to a proline grafted onto the side chain of the amino acid lysine;

[0185] K(Hyp) corresponds to a proline grafted onto the side chain of the amino acid lysine;

[0186] K(Ac) corresponds to a proline grafted onto the side chain of the amino acid lysine; and

[0187] Tpi corresponds to tryptoline-3-carboxylic acid.

[0188] This type of modification of natural amino acids can be carried out by chemical synthesis after the production of the peptide sequences in the chloroplast of the recombinant microalgae.

[0189] A particularly interesting list is the list comprising VW, YR, KT, PA, PM, PP, GHK, KAvaK, KFK, KM02K, PPL, PPA, SPR, LPA, SPA, K(P)HG, K(Pyr)HG, K(Hyp)HG, K(P)GH, K(Pyr)GH, K(Hyp)GH, K(Ac)HG, K(Ac)GH, KHG, KGH, GQPR (SEQ ID NO: 46) and KTFK (SEQ ID NO: 48).

[0190] Said peptides, polypeptides and proteins can further be subjected to one or more treatments to obtain compounds formulated for the cosmetic industry. They can thus be used in cosmetic compositions.

[0191] The recombinant microalgae and the method for producing a recombinant protein, polypeptide or peptide in the microalgae chloroplast mentioned above can also be applied to polypeptides or proteins designed to further contain peptides (amino acid units) of different biological and physical properties, such as for example the addition of collagen or silk peptides, or the biotin or hyaluronic acid binding domain, or heparin binding domains, or growth factors, or protease degradation sites or cell binding domains (such as for example the RGD domain involved in the recognition of fibrillins).Particularly interesting combinations of peptide sequences are combinations of peptides either of the same activity to synergistically enhance that activity or peptides of different activities to advantageously provide multiple activities.

[0192] The invention will be further illustrated by the following figures and examples. FIGURES

[0193] [Fig.l] [Fig.l]: Codon usage in the chloroplast genome of Chlamydomonas reinhardtii

[0194] [Fig.2] [Fig.2]: Schematic presentation of chloroplast transformation vectors for the production of fusion proteins with peptides and polypeptides of KTTKS and their derivatives.

[0195] [Fig.3] [Fig.3]: Western blot analysis of independent algal transformants 137c or CW-NY18 (A, B) and 137c or CW-NY19 (C, D) expressing genes encoding peptide-containing fusion proteins, using an anti-Flag M2 monoclonal antibody. 100 pg or 50 pg of each of the total soluble protein samples extracted by lysis with SDS buffer from NY18 or NY 19, respectively, were separated on a 15% SDS polyacrylamide gel. MW: molecular weight markers. 50 pg of total soluble protein samples extracted by sonication from transformant CW-AU76-1 were loaded as a positive control (C, D). Arrows indicate the positions of the recombinant proteins.

[0196] [Fig.4] [Fig.4]: Western blot analysis of independent algal transformants 137c or CW-NY13 (A, B), 137c or CW-NY14 (C, D) expressing the genes encoding the polypeptide-containing fusion proteins (NY3a)x5 and (NY3b)x5, using an anti-Flag M2 monoclonal antibody. 100 pg (or 50 pg for NY14 transformants) of each of the total soluble protein samples extracted by lysis with SDS buffer from NY 13 or NY 15, respectively, were separated on a 15% SDS polyacrylamide gel. MW: molecular weight markers. 50 pg of total soluble protein samples extracted by sonication from transformant CW-AU76-1 were loaded as a positive control. Arrows indicate the positions of the recombinant proteins.

[0197] [Fig.5] [Fig.5]: Western blot analysis of independent algal transformants 137c or CW-NY 15 (E, F), expressing genes encoding polypeptide-containing fusion proteins (NY3a)x5 and (NY3b)x5, using an anti-Flag M2 monoclonal antibody. 100 pg (or 50 pg for NY 14 transformants) of each of the total soluble protein samples extracted by lysis with SDS buffer from NY 13 or NY 15, respectively, were separated on a 15% SDS polyacrylamide gel. MW: molecular weight markers. 50 pg of total soluble protein samples extracted by sonication from transformant CW-AU76-1 were loaded as a positive control. Arrows indicate the positions of recombinant proteins.

[0198] [Fig.6] [Fig.6]: Western blot analysis of different elution fractions of anti-Flag M2 affinity chromatography performed on protein extract of transformants CW-NY 13-4 (A) and CW-NY18-6 (B) using monoclonal anti-Flag M2 antibody. Different amounts (25 or 50 pg) of sonicated and / or ammonium sulfate precipitated protein samples or one volume of elution fraction were loaded onto a 15% SDS polyacrylamide gel. A) CW-NY13-4 SA: Ammonium sulfate precipitated proteins from CW-NY 13-4. MW: Molecular weight markers. Load: Total soluble protein extracted by sonication before incubation with anti-Flag M2 resin. FT: Flow-through. EA: Elution fraction. W: Wash fraction. Arrows indicate the positions of purified recombinant proteins. EXAMPLES Example 1 Materials and Processes

[0199] All oligonucleotides and synthetic genes were purchased from Eurofins. All enzymes were purchased from NEB, Promega, Invitrogen, and Sigma Aldrich / Merck. All plasmids were constructed on the pBluescript II backbone. Algal strains and growth conditions

[0200] The two algal strains used are the wild type (137c; mt+) and the cell wall deficient strain CW 15 (CC-400; mt+) of Chlamydomonas reinhardtii obtained from the Chlamydomonas Resource Center, University of Minnesota).

[0201] Prior to transformation, all strains were grown in TAP (Tris Acetate Phosphate) medium to mid-log exponential phase (densities of approximately 1-2x106 cells / ml) at 23°C to 25°C (ideally 25°C) on a rotary shaker in the presence of constant light (70-150 pE / m2 / s).

[0202] The transformants were cultured under the same conditions and media supplemented with (containing) 100 pg / ml of spectinomycin or 100 pg / ml of kanamycin, depending on the selection marker gene present in the transformation vector.

[0203] Growth kinetics were also monitored by measuring optical density at 750 nm using a spectrophotometer. Transformation of the algae

[0204] Chlamydomonas reinhardtii cells are transformed using the technique of helium gun bombardment of gold microprojectiles complexed with transforming DNA, as described in Boynton et al., 1988. Briefly, Chlamydomonas reinhardtii cells were grown in TAP medium to mid-log exponential phase, harvested by gentle centrifugation, and then resuspended in TAP medium to a final concentration of 1.108 cells / ml. 300 μL of this cell suspension was plated onto TAP agar medium supplemented with 100 μg / ml spectinomycin or 100 μg / ml kanamycin, depending on the selection marker gene present in the transformation vector. The dishes were bombarded with gold particles (S550d; Seashell Technology) coated with a transformation vector, as described by the manufacturer. The dishes were then placed at 25°C under standard lighting conditions to allow selection and formation of transformed colonies.

[0205] Total DNA extraction and PCR screening of positive transformants

[0206] Total DNA extraction was performed using Chelex 100 chelating resin (Biorad) from isolated colonies (approximately 1 mm in diameter) of wild-type Chlamydomonas strains and / or antibiotic-resistant transformants.

[0207] From isolated colonies, a quantity of cells corresponding to approximately 0.5 mm in diameter was taken with a tip and resuspended in 20 μL of H2 O. 200 μL of ethanol was added and incubated for 1 min at room temperature. 200 μL of 5% Chelex was incorporated and vortexed. After an incubation of 8 min at 100°C, the mixture was cooled and centrifuged for 5 min at 13,000 rpm. Finally, the supernatant was collected.

[0208] After transformation, algal colonies growing on restrictive solid media plates should have the antibiotic-resistant gene and the transgene(s) incorporated into their genome.

[0209] In order to identify stable integration of recombinant genes into the algal genome, antibiotic-resistant transformants were screened by polymerase chain reaction (PCR or PCR amplification) in a thermocycler using 1 μL of previously extracted total DNA as template, two synthetic and specific oligonucleotides (primers) and Taq polymerase (GoTaq, Promega). PCR amplification cycles followed the manufacturer's recommended guidelines. PCR reactions were subjected to gel electrophoresis to verify the PCR fragment of interest. Protein extraction, Western blot analysis

[0210] Chlamydomonas cells (50 ml, 1-2.106 cells / ml) were collected by centrifugation. The cell pellet was resuspended in lysis buffer (50 mM Tris-HCl pH 6.8, 2% SDS and 10 mM EDTA). In some embodiments of the example, the lysis buffer did not contain 10 mM EDTA. After 30 min at room temperature, cell debris was removed by centrifugation at 13,000 rpm and the supernatant containing total soluble proteins was collected.

[0211] Depending on the additional analysis step, total soluble proteins were extracted under non-denaturing conditions. The cell pellet was resuspended in a buffer containing 20 mM Tris-HCl pH 6.8. The sonication step was performed with the algal cell suspension kept on ice, using a cell disruptor, a FB505 500W sonicator (Sonic / FisherBrand) and a microtip setting of 20% power, with sonication continued for 5 min. After sonication, cell debris was removed by centrifugation at 13,000 rpm, 30 min.

[0212] Total soluble proteins present in the supernatant were quantified using the Pierce BCA Protein Assay Kit, following the supplier's instructions (Thermofisher).

[0213] Total soluble protein samples (50 or 100 pg or other amount mentioned later in the example depending on the experiment) were separated in 12 or 15% Tris-glycine SDS-PAGE prepared according to Laemmli (1970).

[0214] For experiments performed under reducing conditions, samples were prepared in Laemmli sample loading buffer with 50 mM DTT (or higher depending on the fusion protein) or 5% beta-mercaptoethanol, and further denatured for 5 min at 95 °C before loading. SDS PAGE experiments were performed using a BioRad protein gel tank.

[0215] After separation, the samples were transferred to a nitrocellulose membrane (GE Healthcare) using a standard transfer buffer and a Biorad Trans-Blot® Turbo™ transfer system. In order to visualize the transferred proteins, the nitrocellulose membrane was stained with Ponceau S dye. The membranes were then blocked with Tris-buffered saline Tween (TBS-T) buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.1% Tween-20) containing 5% Bovine serum albumin (BSA). After one hour of saturation at room temperature with gentle shaking, the membranes were incubated overnight at 4°C with TTBS buffer containing a mouse primary antibody (see Table 3).

[0216] The antibodies mentioned in Table 3 below were used as primary antibodies.

[0217] [Tables3] Primary Antibody Source Dilution Monoclonal ANTLFLAG® M2 antibody produced in Sigma mice 1:1000 Monoclonal ANTLHA PURIFIED antibody produced in Sigma mouse IGG 1:6000 Monoclonal ANTLAprotinin antibody produced in Abcam mice 1:2000 or 1:3000 Primary antibodies

[0218] After three washes with TBS-T-BSA buffer, the membranes were incubated for one hour at room temperature with TBS-T-BSA buffer containing secondary antibodies (Promega). After four washes with TTBS buffer and one wash with TBS buffer, the membranes were revealed using a horseradish peroxidase (HRP)-conjugated secondary antibody (Anti-Mouse IgG (H+L), HRP conjugate; Promega) and visualized by enhanced chemiluminescence (ECL) using Clarity Max as the ECL substrate (Biorad) and the ChemiDoc™ XRS+ system (Biorad). Protein purification

[0219] Depending on the protein and the additional steps to which the protein is subjected, the first or second method below is carried out.

[0220] 1) After centrifugation, the algal cell pellets were resuspended in a buffer containing 50 mM Tris-HCl pH8, 500 mM NaCl, and 0.1% Tween 20. Approximately 10 ml of buffer was used per g of wet algal cells, depending on the transformants. The resuspended cells were sonicated under the same conditions as described previously.

[0221] 2) After centrifugation, the algal cell pellets were resuspended in a buffer containing 20 mM Tris-HCl pH 6.8. The resuspended cells were sonicated under the same conditions as described previously. Total soluble proteins were precipitated with 80% ammonium sulfate as described by Wingfield, 2001. After centrifugation at 15,000 g for 30 min at 4°C, the protein pellets were resolubilized in 60 mM Tris-HCl buffer pH 8. These suspensions were dialyzed in Slide-A-Lyzer dialysis cassettes (3.5 kDa MWCO, Thermo Scientific) as described by the manufacturer against the previous buffer. As the next step was anti-FLAG M2 affinity chromatography, NaCl and Tween 20 were added to the dialyzed samples to adjust the buffer composition to that of the binding buffer described below. Affinity chromatography

[0222] All recombinant proteins were tagged at their N-terminus with a FLAG epitope tag that will bind specifically to an anti-FLAG M2 affinity gel (Sigma / Merck). This resin contains a mouse monoclonal antibody ANTI-FLAG® M2 that is covalently attached to the agarose.

[0223] All steps of this experiment were performed as described by the manufacturer. Briefly, the total soluble protein samples were filtered using a 0.45 µm cellulose acetate filter and mixed with an anti-FLAG M2 affinity gel prepared as recommended by the manufacturer and equilibrated in binding buffer (50 mM Tris-HCl pH8, 500 mM NaCl, 0.1% Tween 20). Approximately 1 ml of resin was used for 4-8 g of wet algal cells, depending on the transformants. Binding of the recombinant fusion protein was performed at 4°C for 4 h or overnight with gentle, continuous shaking from start to finish. After incubation, the resin-incubated soluble protein mixture was loaded by gravity onto an empty Bio-rad Econo-pac column or collected by centrifugation, and washed several times with 40 column volumes of TBST and 20 column volumes of TBS. The protein of interest was eluted from the resin using 100 mM glycine pH 3.5, 500 mM NaCl and neutralized with Tris-HCl pH 8 to a final concentration of 50 mM. Each elution fraction was further analyzed by SDS-PAGE and Western Blot.

[0224] The elution fractions containing the protein of interest were dialyzed in Slide-A-Lyzer dialysis cassettes (3.5 kDa MWCO, Thermo Scientific) as described by the manufacturer against the buffer used in the next step, such as for protease digestion. The dialyzed samples were concentrated using a Vivaspin 6 (3 kDa MWCO, GE Healthcare).

[0225] Separation of the protein of interest from the fusion partner

[0226] The separation of the protein of interest from the fusion partner was carried out by digestion by a protease, in particular, in the present invention by enterokinase (light chain) or the protease of the tobacco etch virus ("Tobacco Etch Virus" TEV) from New England BioLabs (NEB).

[0227] Enzymatic digestions were carried out according to the manufacturer's recommendations.

[0228] For example, for enterokinase light chain digestion, reactions combined 25 μg of protein of interest in 20 μL of buffer (20 mM Tris-HCl pH 8.0, 50 mM NaCl, 2 mM CaCl2), with 1 μL of enterokinase light chain. Incubation was carried out at 25 °C for 16 h.

[0229] For example, for TEV digestion, the typical reaction recommended by the manufacturer combined 15 μg of protein substrate with 5 μL of TEV protease reaction buffer (10X) to obtain a total reaction volume of 50 μL. After addition of 1 μL of TEV protease, the reaction was incubated at 30°C for 1 hour or at 4°C overnight.

[0230] For example, for factor Xa digestion, the manufacturer recommended digesting 50 μg of fusion protein with 1 μg of FXa in a volume of 50 μL at 23°C for 6 h. The reaction buffer consisted of 20 mM Tris-HCl pH 8.0, 100 mM NaCl, and 2 mM CaCl2. Cleavage of the polypeptide using endoproteinases

[0231] The choice of endoproteinase used to cleave the polypeptide of interest depends on the amino acid sequence of this polypeptide. The endoproteinases can be, for example, endoproteinase Glu-C, endoproteinase Arg-C, endoproteinase Asp-C, endoproteinase Asp-N or endoproteinase Lys-C.

[0232] Enzymatic digestions were performed as recommended by the manufacturer.

[0233] For example, for digestion of endoproteinase Glu-C (from NEB), the manufacturer recommended digesting 1 μg of substrate protein with 50 ng of endoproteinase Glu-C at 37°C for 16 h. The reaction buffer consisted of 50 mM Tris-HCl pH 8.0 and 0.5 mM GluC-GluC. Size exclusion chromatography (SEC)

[0234] Size exclusion chromatography of the purified and digested fusion protein was performed using an AKTA Pure system (GE Healthcare) to separate the protein of interest from the fusion partner.

[0235] A Superdex S30 Increase G10 / 300 GL column (GE Healthcare) and a HiLoad 26 / 600 Superdex 30 prep grade column were first calibrated using two standards diluted with 2X PBS buffer (or a buffer appropriate for the next step): aprotinin (bovine lung; 6.5 kDa) and glycine (75 Da).

[0236] After a water wash step, the Superdex S30 Increase G10 / 300 GL column was equilibrated in a running buffer (2X PBS, pH 7.4 or a buffer appropriate for the next step) and 200 to 500 pL of samples were passed through the column at a flow rate of 0.5 ml / min. Protein elution was detected by measuring optical absorbance at 280, 224 and 214 nm. Fractions of 0.5 ml were collected and analyzed by SDS-PAGE followed by Western-Blot or stained with Coomassie blue dye.

[0237] After a water wash step, the HiLoad 26 / 600 Superdex 30 prep grade column was equilibrated in running buffer (2X PBS, pH 7.4 or the appropriate buffer for the next step) and samples (4 to 30 ml) were passed through the column at a flow rate of 2.6 ml / min. Protein elution was detected by measuring optical absorbance at 280, 224 and 214 nm. 4 ml fractions were collected and analyzed by SDS-PAGE followed by Western blotting.

[0238] In some embodiments, the elution fractions of interest were pooled and evaporated using a SpeedVac (Eppendorf). The peptides or polypeptides or proteins present in these evaporated samples were subjected to Edman degradation to confirm the amino acid sequence at the N-terminus of the protein of interest. Example 2:

[0239] Production of KTTKS mono- and polypeptides or derivatives in a fusion protein using aprotinin as a fusion partner, in the chloroplast of Chlamydomonas reinhardtii by transformation of the chloroplast genome

[0240] Construction of transformation vectors (pNY18, pNY19, pNY13, pNY14, pNY15, pNY16)

[0241] Several chloroplast transformation vectors were constructed to express KTTKS (designated NY2) and GKTTKS (designated GNY2) peptides and KTTKS derivative polypeptides in a fusion protein using aprotinin as the fusion partner ([Fig.2]).

[0242] In the chloroplast transformation vector, the NY2 peptide and the polypeptides (NY3a)x5 (KTTKSDKTTKSDKTTKSDKTTKSDKTTKSD) (SEQ ID NO:9) and (NY3b)x5 (KTTKSEKTTKSEKTTKSEKTTKSEKTTKSE) (SEQ ID NO:11) were produced into fusion proteins, as exemplified in the present invention, at the C-terminus of the chimeric aprotinin HA-SP-3F-FX-APRO. This fusion partner contained aprotinin fused at their N-terminus to an amino acid sequence consisting of the HA epitope tag (HA) followed by the signal peptide (SP), the 3XFlag epitope tag (3F) and the cleavage site for factor Xa (FX; IEGR (SEQ ID NO:61)).

[0243] In the fusion protein, the NY2 peptide or the (NY3a)x5 and (NY3b)x5 polypeptides were separated from the fusion partner by the flexible linker LGM (RSGGGGSSGGGGGGSSRS) followed by a cleavage site for the TEV protease (TV; SEQ ID NO: 32; ENLYFQG) or enterokinase (EK; SEQ ID NO: 3; DDDDK).

[0244] Therefore, different fusion proteins were produced in independent algal transformants, such as the protein called HA-SP-3F-FX-APRO-LGM-EK-NY2 (SEQ ID NOS. 33 and 34), HA-SP-3F-FX-APRO-LGM-TV-NY2 (SEQ ID NOS. 35 and 36), HA-SP-3F-FX-APRO-LGM-EK-(NY3a)x5 (SEQ ID NOS. 37 and 38), HA-SP-3F-FX-APRO-LGM-TV-(NY3a)x5 (SEQ ID NOS. 39 and 40), HA-SP-3F-FX-APRO-LGM-EK-(NY3b)x5 (SEQ ID NOS. 41 and 42), HA-SP-3F-FX-APRO-LGM-TV-(NY3b)x5 (SEQ ID No. 43 and 44) ​​([Fig.2]).

[0245] After their production in the algal chloroplasts, the signal peptide (SP) will address these fusion proteins into the thylakoids. During protein translocation, the N-terminal HA-SP fragment will be cleaved and the following other recombinant proteins will be produced in vivo, 3F-FX-APRO-LGM-TV-(NY3b)x5 (SEQ ID No. 62), 3F-FX-APRO-LGM-EK-(NY3b)x5 (SEQ ID No. 63), 3F-FX-APRO-LGM-TV-(NY3a)x5 (SEQ ID No. 64), 3F-FX-APRO-LGM-EK-(NY3a)x5 (SEQ ID No. 65), 3F-FX-APRO-LGM-EK-NY2 (SEQ ID No. 66) and 3F-FX-APRO-LGM-TV-NY2 (SEQ ID No. 67).

[0246] The release of the peptides and polypeptides from the chimeric aprotinin will be carried out in vitro by site-specific proteolysis of the fusion protein with enterokinase or TEV proteases.

[0247] After cleavage of the fusion protein HA-SP-3F-FX-APRO-LGM-TV-NY2 or 3F-FX-APRO-LGM-TV-NY2 by TEV protease, the released peptide will be GNY2 (GKTTKS). In the case of TEV digestion of the fusion proteins HA-SP-3F-FX-APRO-LGM-TV-(NY3a)x5 (or 3F-FX-APRO-LGM-TV-(NY3a)x5) and HA- SP-3F-FX-APRO-LGM-TV-(NY3b)x5 (or 3F-FX-APRO-LGM-TV-(NY3b)x5), the released polypeptides will be G((NY3a)x5) and G((NY3b)x5), respectively.

[0248] In Chlamydomonas reinhardtii, it has been shown that codon usage in the nucleic acid sequence encoding the protein of interest plays an important role in protein accumulation (Franklin et al., 2002; Mayfield and Schultz, 2004).

[0249] The nucleic acid sequence encoding the chimeric aprotinin was designed and optimized to enhance their expression in C. reinhardtii host cells.

[0250] Methods for modifying polynucleotides for enhanced expression in the host cell are known in the art, particularly in the algal cell, particularly in C. reinhardtii.

[0251] A codon usage database can be found at http: / / www.kazusa.or.jp / codon / . (See codon usage for the chloroplast genome of C. reinhardtii; [Fig.l]).

[0252] To improve the expression in the chloroplast of C. reinhardtii of the gene of interest in the present invention, the codons of their native sequence which are not commonly used were replaced with a codon encoding the same or similar amino acid residue which is more commonly used in the chloroplast codon bias of C. reinhardtii. In addition, other codons were replaced to avoid multiple or extended codon repeat sequences, or certain restriction enzyme site, or having a higher probability of secondary structure which could reduce or interfere with the expression efficiency.

[0253] In order to verify and fulfill all the above-mentioned criteria, the amino acid sequence of the protein of interest was also optimized by Eurofins GENEius software using the appropriate codon usage for the chloroplast of C. reinhardtii.

[0254] After optimization, the gene encoding aprotinin (APRO) was operably fused at its 5' end to a codon-optimized nucleic acid sequence encoding the HA epitope tag (HA) followed by a signal peptide, the 3XFlag epitope tag (3F) and the cleavage site recognized by the protease factor Xa (FX) to form the chimeric aprotinin HA-SP-3F-FX-APRO (SEQ ID NOS. 26 and 27).

[0255] The nucleic acid sequence encoding the recombinant KTTKS or GKTTKS peptide, or the KTTKS polypeptide or their derivatives were designed and optimized as mentioned above in order to improve their expression in C. reinhardtii host cells.

[0256] After codon optimization, the different synthetic genes GNC-LENY3a2 (SEQ ID No. 68), GNC-LENY3bl (SEQ ID No. 69), GNC-LTNY3a2 (SEQ ID No. 70) and GNC-LTNY3bl (SEQ ID No. 71) coding respectively for the polypeptides (NY3a)x5, (NY3b)x5), G((NY3a)x5) and G((NY3b)x5) were synthesized by Eurofins. These optimized genes were cloned by Gibson assembly downstream of the gene coding the fusion partner in an expression cassette present in the chloroplast transformation vector pAU76 linearized by P meï to give respectively, pNY16, pNY14, pNY15 and pNY13.

[0257] The chloroplast transformation vectors pNY 13 and pNY 14 allowed the expression of the (NY3b)x5 polypeptide in the fusion proteins HA-SP-3F-FX-APRO-LGM-TV-(NY3b)x5 and HA-SP-3F-FX-APRO-LGM-EK-(NY3b)x5, respectively ([Fig.2]).

[0258] The chloroplast transformation vectors pNY 15 and pNY 16 allowed the expression of the (NY3a)x5 polypeptide in the fusion proteins HA-SP-3F-FX-APRO-LGM-TV-(NY3a)x5 and HA-SP-3F-FX-APRO-LGM-EK-(NY3a)x5, respectively ([Fig.2]).

[0259] The optimized genes GNC-ALENY2 (SEQ ID No. 72) and GNC-ALTNY2 (SEQ ID No. 73) were cloned by Gibson assembly into an expression cassette present in the chloroplast transformation vector pLE63 linearized by Bamïïl and Pmeï digestions to give respectively, pNY18 and pNY 19.

[0260] The chloroplast transformation vectors pNY18 and pNY 19 allowed the expression of the NY2 peptide in the fusion proteins HA-SP-3F-FX-APRO-LGM-EK-NY2 and HA-SP-3F-FX-APRO-LGM-TV-NY2, respectively ([Fig.2]).

[0261] The expression vectors pAU76 and pLE63 for transformation of the chloroplast genome contained two expression cassettes ([Fig.2]) for the expression of the genes encoding the selection marker and the fusion protein.

[0262] These two expression cassettes are flanked by an endogenous left (LHRR) and right (RHRR) homologous recombination sequence that are identical to those surrounding the targeted integration site in the chloroplast genome of C. reinhardtii. In a preferred embodiment, the chloroplast transformation vectors of the present invention allow for targeted integration of the transgenes into the chloroplast genome of C. reinhardtii between the 5S rDNA and psbA genes (and derived for example from GenBank accession number NC005352).

[0263] The selection marker gene was the aadA gene encoding aminoglycoside 3"-adenylyltransferase and conferring resistance to spectinomycin and streptomycin. The gene is operably linked at its 5' end to the C. reinhardtii 16S rRNA promoter (Prrn) fused to the 5'UTR of atpA (SEQ ID NO:76) and at its 3' end to the 3'UTR of the C. reinhardtii rbcL gene (SEQ ID NO:77) ([Fig.2]).

[0264] Stable expression and translation of the fusion protein gene are driven by the promoter and 5'UTR of C. reinhardtii psbD (SEQ ID NO:78) and the 3'UTR of C. reinhardtii atpA (SEQ ID NO:79) ([Fig.2]). Transformation of algae

[0265] The transformation vectors pNY18, pNY 19, pNY 13, pNY 14, pNY 15, pNY 16 were bombarded in C. reinhardtii cell (137c and CW15) as described in Example 1. In order to identify stable integration of the recombinant genes encoding the fusion protein into the algal chloroplast genome, spectinomycin-resistant colonies were screened by PCR analysis. For the PCR-positive screens of the fusion protein gene, the primers O5'ASTatpA2 5'-CCTACTTAATTAAAAACtgcagtagctagctctgc-3' (SEQ ID NO: 74) and O3'SUTRpsbD 5'-cgatgagttgtttttttattttggagatacacgc-3' (SEQ ID NO: 75), respectively in the 3'UTR of atpA and the 5'UTR of psbD were used. Analysis and results

[0266] Western blot analysis of total soluble proteins extracted from different independent strains transformed with different expression vectors revealed that the fusion proteins HA-SP-3F-FX-APRO-LGM-EK-NY2, HA-SP-3F-FX-APRO-LGM-TV-NY2, HA-SP-3F-FX-APRO-LGM-EK-(NY3a)x5, HA-SP-3F-FX-APRO-LGM-TV-(NY3a)x5, HA-SP-3F-FX-APRO-LGM-EK-(NY3b)x5, HA-SP-3F-FX-APRO-LGM-TV-(NY3b)x5 were indeed produced (Figures 4 and 5).

[0267] Furthermore, in all transformants, the HA epitope tag and signal peptide appear to be cleaved because Western blots performed on the same soluble total protein extracts showed that the primary anti-HA antibody did not recognize any fusion protein. Thus, the fusion proteins produced in the different transformants would be 3F-FX-APRO-LGM-EK-NY2, 3F-FX-APRO-LGM-TV-NY2, 3F-FX-APRO-LGM-EK-(NY3a)x5, 3F-FX-APRO-LGM-TV-(NY3a)x5 and 3F-FX-APRO-LGM-EK-(NY3b)x5.

[0268] Comparison of fusion protein amounts between different types of transformants, performed by Western blot analyses, showed that among all producer transformants, clones CW-NY13-4 and CW-NY18-6 produced high levels of 3F-FX-APRO-LGM-TV-(NY3b)x5 (0.1% of total soluble protein; TSP) and 3F-FX-APRO-LGM-EK-NY2 (0.089% TSP), respectively. Thus, these two transformants were used for larger-scale production. Example 3:

[0269] Purification of peptides and polypeptides and KTTKS or derivatives

[0270] Approximately 80 g of cells for each CW-NY 13-4 and CW-NY18-6 transformant were produced from several cascade cultures of IL. The algal cells were resuspended and sonicated as described in the Materials and Methods section. 850 ml of total soluble protein extract for each CW-NY 13-4 and CW-NY18-6 transformant was obtained.

[0271] In order to concentrate these 850 ml extract volumes, an additional ammonium sulfate precipitation and dialysis step was added prior to affinity chromatography as described in Example 1.

[0272] The fusion proteins were purified by anti-Flag M2 affinity chromatography. The elution fractions were analyzed by Western Blot analysis. The results, shown in [Fig.6], revealed the efficiency of affinity chromatography purification of the fusion proteins produced in the CW-NY13-4 and CW-NY18-6 transformants.

[0273] The elution fractions from the affinity chromatography containing the FX-APRO-LGM-EK-NY2 or 3F-FX-APRO-LGM-TV-(NY3b)x5 fusion protein were dialyzed in dialysis cassettes (3.5 kDa MWCO) against the buffer used in the subsequent protease digestion step and concentrated using centrifugal concentrators (3 kDa MWCO).

[0274] Then, cleavage of the fusion partner peptide or polypeptide was performed with site-specific proteolysis of the APRO-LGM-EK-NY2 or APRO-LGM-TV-(NY3b)x5 fusion protein using enterokinase or TEV protease, respectively.

[0275] After an overnight incubation at 4°C, the digests of each fusion protein were injected onto a HiLoad 26 / 600 Superdex 30 prep grade column and run at a flow rate of 2.6 ml / min. These size exclusion chromatography (SEC) experiments allowed the purification of the NY2 peptide and the (NY3b)x5 polypeptide.

[0276] Additional analyses on SEC-purified (NY3b)x5 polypeptide and NY2 peptide were performed by high-performance liquid chromatography (HPLC) on C18 and C4 large-pore reverse-phase columns with UV detection at 215 nm and mass spectrometry.

[0277] In order to cleave the (NY3b)x5 polypeptides into peptides by endoproteinase, the SEC elution fractions were evaporated and dialyzed for salt removal and buffer change, using dialysis tubing with a 1 kDa cutoff.

[0278] After endoproteinase Glu-C digestion of the dialyzed samples as described in Example 1, the released peptides were purified by size exclusion chromatography.

Claims

Claims

1. A recombinant microalgae comprising a nucleic acid sequence encoding: (a) a recombinant peptide of SEQ ID No. 1; (b) a recombinant peptide, polypeptide or protein consisting of repeating units of SEQ ID No. 1; or (c) a derivative of (a) or (b); said derivative of (a) comprising the native amino acid sequence of said peptide mutated or containing one or more additional amino acids at its N-terminal or C-terminal end; said derivative of (b) comprising the native amino acid sequence of the peptide which is repeated, mutated or containing one or more additional amino acids at its N-terminal or C-terminal end; said derivative of (a) or (b) consisting of an amino acid sequence at least 80% identical to the amino acid sequence of the recombinant peptide of SEQ ID No. 1 or the recombinant peptide, polypeptide or protein consisting of repeating units of SEQ ID No. 1;and said nucleic acid sequence being located in the chloroplast genome of the microalgae.;

2. A process for producing: (a) a recombinant peptide of SEQ ID NO: 1; (b) a recombinant peptide, polypeptide or protein consisting of repeating units of SEQ ID NO: 1; or (c) a derivative of (a) or (b); said derivative of (a) comprising the native amino acid sequence of said peptide mutated or containing one or more additional amino acids at its N-terminus or C-terminus; said derivative of (b) comprising the native amino acid sequence of the peptide which is repeated, mutated or containing one or more additional amino acids at its N-terminus or C-terminus; and said derivative of (a) or (b) consisting of an amino acid sequence at least 80% identical to the amino acid sequence of the recombinant peptide of SEQ ID NO: 1 or the recombinant peptide, polypeptide or protein consisting of repeating units of SEQ ID NO: 1; in the chloroplast of a microalga, wherein said method comprises transforming the chloroplast genome of the microalgae with a nucleic acid sequence encoding said protein, said polypeptide, or said recombinant peptide.

3. A method according to claim 2 comprising: (i) providing a nucleic acid sequence encoding said recombinant protein, polypeptide or peptide; (ii) introducing the nucleic acid sequence according to (i) into an expression vector which is capable of expressing the nucleic acid sequence in the microalgal host cell; (iii) transforming the chloroplast genome of the microalgal host cell with the expression vector.

4. The method of claim 3, further comprising: (iv) identifying the host cell of the transformed microalga (v) characterizing the host cell of the microalga for the production of recombinant protein, polypeptide or peptide expressed from said nucleic acid sequence; and (vi) extracting the recombinant protein, polypeptide or peptide; and optionally (vii) purifying the recombinant protein, polypeptide or peptide.

5. A method according to any one of claims 3 or 4, wherein said expression vector also comprises at least one expression cassette, said at least one expression cassette comprising the nucleic acid sequence encoding said recombinant protein, polypeptide or peptide.

6. A recombinant microalgae according to claim 1 or a method according to any one of claims 2 to 5, wherein the nucleic acid sequence encoding the protein, polypeptide or peptide is codon-optimized for expression in the chloroplast genome of the microalgae host cell.

7. A recombinant microalgae according to any one of claims 1 or 6 or a method according to any one of claims 3 to 6, wherein said nucleic acid sequence encoding a recombinant protein, polypeptide or peptide is operatively fused at its 5' or 3' end to a nucleic acid sequence encoding a fusion partner.

8. Recombinant microalgae according to any one of claims 1 or 6 to 7 or method according to any one of claims 3 to 7, wherein said nucleic acid sequence encoding a recombinant protein, polypeptide or peptide is operably linked to at least one regulatory sequence selected from the promoter and 5'UTR of psbD or the promoter of 16S rRNA (Prm) fused to the 5'UTR of atpA, the promoter and 5'UTR of psaA, the promoter and 5'UTR of atpA, the 3'UTRs of atpA and rbcL.

9. The method of any one of claims 5 to 8, wherein said at least one expression cassette further comprises a nucleic acid sequence encoding an epitope tag peptide operably fused at its 5' or 3' end to said nucleic acid sequence encoding the recombinant protein, polypeptide or peptide.

10. The method of any one of claims 5 to 9, wherein said at least one expression cassette further comprises a nucleic acid sequence encoding a signal peptide.

11. A method according to any one of claims 5 to 10, wherein said at least one expression cassette further comprises a nucleic acid sequence encoding an amino acid sequence enabling the production of said recombinant protein, polypeptide or peptide in a specific cellular compartment.

12. A recombinant microalga according to any one of claims 1 and 6 to 8 or a method according to any one of claims 2 to 11, said microalga being selected from the group consisting of Chlorophyta, Chlorophyceae, Pleurastrophyceae, Prasinophyceae, Chromophyta, Bacillariophyceae, Chrysophyceae, Phaeophyceae, Eustigmatophyceae, Haptophyceae, Raphidophyceae, Xanthophyceae, Cryptophyta, Cryptophyceae, Rhodophyta, Porphyridiophycea, Stramenopiles, Glaucophyta, Glaucocystophyceae, Chlorarachniophyceae, Haptophyceae, Dinophyceae, Scenedesmaceae, Euglenophyta and Euglenophyceae.

13. A recombinant microalgae and method according to claim 12, said microalgae being selected from the group consisting of Chlamydomonas, Chlorella, Dunaliella, Haematococcus, diatoms, Scenedesmaceae, Tetraselmis, Ostreococcus, Porphyridium and Nannochloropsis.

14. Use of an aqueous mixture of peptide and / or polypeptide and / or protein produced according to the process of any one of claims 2 to 13 and free from algae debris for the manufacture of a cosmetic composition.

15. Use of an aqueous mixture of peptide and / or polypeptide and / or protein produced according to the method of any one of claims 2 to 13 and free from algae debris for use in a non-therapeutic cosmetic treatment.

16. Use of a recombinant algae according to any one of claims 1, 6-8 or 12-13, for manufacturing: a. a recombinant peptide of SEQ ID No. 1; b. a recombinant peptide, polypeptide or protein consisting of repeat units of SEQ ID No. 1; or c. a derivative of (a) or (b).

Images