METHOD FOR FIELD DETECTION OF THE PRESENCE AND MULTI-RESISTANCE OF A BIO-AGGRESSOR, PARTICULARLY DEZYMO-SEPTORIA TRITICI, IN CEREAL CROPS

Abstract

The invention relates to the field of diagnostics for monitoring strains or races of pests (fungi, bacteria, viruses, and insects). More specifically, it concerns a method for detecting and characterizing, directly in the field, the presence of a strain / race of a pest and its characteristics regarding its resistance types. It also relates to a ready-to-use field diagnostic kit, called "Pedestrian-Alert," for implementing the method. It is applied, in particular, to the detection and characterization of strains of the fungus Zymo-Septoria tritici, responsible for Septoria leaf blotch of wheat, which can destroy more than 30% of the harvests of cereal crops such as common wheat, barley, and durum wheat.

Description

Title of the invention: METHOD FOR DETECTING IN THE FIELD THE PRESENCE AND MULTI-RESISTANCE OF A BIO-AGGRESSOR, IN PARTICULAR DEZYMO-SEPTORIA TRITICI, IN CEREAL CROPS

[0001] The invention relates to the field of diagnosis for monitoring strains or races of bio-aggressors (fungi, bacteria, viruses and insects). More particularly, it relates to a method for detecting and characterizing, directly in the field, the presence of a strain / race of a bio-aggressor and its characteristics concerning its types of resistance, TSR and MDR, to pesticides (modes of action), its virulence characteristics in relation to host plants, etc.

[0002] It also relates to a field diagnostic kit, called “Pedestrian Alert”, ready-to-use for implementing the method. It is applied, in particular, to the detection and characterization of strains of the fungus Zymo-Septoria tritici, responsible for wheat septoria which can destroy more than 30% of straw cereal crops such as durum wheat, soft wheat and barley. Field of invention

[0003] The present invention relates to the field of field diagnosis applied to the detection and characterization of bio-aggressor strains concerning their resistance to pesticides. In particular, it relates to the characterization of the wheat fungus Zymo-Septoria tritici. This pathogen is responsible for the disease known as "Septoria leaf spot". This disease, mainly affecting wheat, is found in all wheat-growing areas throughout the world. It is in fact one of the most damaging foliar diseases of these crops, causing significant yield losses (up to 40 qx / ha).

[0004] Septoria is the leading foliar disease of wheat in France and occurs every year. It manifests itself in so-called "septoria" spots and can cause a yield loss of around 30 to 50%.

[0005] Septoria leaf spot spreads during rain or ambient humidity. The pycnidia, haploid resulting from mitosis, become waterlogged and swell. The pycnidia then expel spores, also haploid, in the form of a transparent spore-bearing jelly called "cirrh". The spores are then disseminated by rain splashes. Septoria leaf spot can be difficult to detect, particularly because the symptomatic spots of the disease can be assimilated to simple physiological spots without evolution. Thus, the rapid and reliable determination of the presence of the pathogen is essential to allow effective treatment of cereals.

[0006] To combat this infection, antifungals from the Qol (Quinone outside Inhibitors) family, DMI (Demethylase Inhibitors) more commonly called Triazoles, or SDHI (Succinate DesHydrogenase Inhibitors) are generally used.

[0007] However, due to the single-site mode of action of commonly used antifungals and the pressure induced by the massive use of these fungicides, resistances have appeared in Zymo-Septoria tritici, these are target-related resistances or "Target-Site Resistance" (TSR).

[0008] Other types of resistance, called non-target-related, have also appeared, involving independent genetic mechanisms; they are grouped under the name of "multi-drug resistance" or MDR and affect all the modes of action of the fungicides used by drastically reducing their effectiveness. MDR also affects the effectiveness of many treatments in the clinical sector (anticancer, antibiotics, antifungals), but also in agriculture. In the case of phytopathogenic fungi, it reduces the effectiveness of several fungicidal modes of action, requiring the use of higher doses. MDR is due to the overexpression of membrane transporters that expel toxic molecules from cells.In the wheat septoria fungus, Zymo-Septoria tritici, three types of inserts in the promoter of the Major Facilitator Superfamily gene 1 (MFS1) gene encoding an MFS family transporter cause MDR phenotypes in isolates of the septoria fungus.

[0009] This phenomenon is particularly worrying in the current context aimed at reducing inputs - including pesticides (e.g. EcoPhyto II plan). With an average frequency of 26% of multi-resistant isolates in French populations of Z. tritici in 2019 (AS. Walker, pers. com.), the application of reduced doses of fungicides may not only be ineffective, but also promote survival and therefore select multi-resistant isolates. The development of tools to study the evolution of the frequencies of TSR and MDR type resistance in the field as a function of the treatments applied is essential.

[0010] In this context, it is essential to quickly diagnose plant damage caused by septoria linked to TSR and / or MDR resistance.

[0011] The state of the art teaches numerous detection methods using the quantitative PCR method. However, the reliability of these methods can be uncertain depending on the detection method used. Indeed, when carrying out a conventional PCR method, polymers can form, resulting from poor pairing of the primer sequences and the targeted DNA sequences. The formation of these polymers, in particular dimers, plays a determining role in the reliability of the results obtained when revealing the amplified sequences. The presence of polymerizations in fact leads to false positives, particularly if the detection is done on an immunological strip. Neutralization of these polymers is therefore essential to obtain reliable results.

[0012] To limit the formation of these polymers, the state of the art offers different solutions.

[0013] Document WO2006112818A2 describes a method reducing dimer formation by adding modified nucleobases to the 3' end of primers. The document provides polynucleotides comprising at least one modified pyrimidine nucleobases and no more than 4 nucleotides at the 3' end of the polynucleotide.

[0014] Document EP2814976 B1 proposes a method for reducing the non-specific formation of dimeric or polymeric nucleic acid in which 2-amino-deoxyadenosine (2-amino-dA), 2-thio-deoxythymidine (2-thio-dT) or other nucleotide analogues of interest are incorporated into the random hexamers used for the amplification of the target nucleic acid.

[0015] Although functional, the known methods of the state of the art are imperfect. Indeed, they propose the design of specific Single Nucleotid Polymorphism (SNP) primers by a PCR method with additions of nucleo-bases, which is more complex, requires more technicality and requires more time.

[0016] One of the detection methods already known from the state of the art is that using recombinase polymerase amplification which makes it possible to highlight the presence of a specific marker characterizing a bio-aggressor (also known as Flashdiag). This method is characterized by: taking a piece of leaf showing a symptom, extracting the DNA or RNA from the sample by grinding and filtration steps, the sample is then placed in a tube containing the probes and primers necessary for detection and the mixture undergoes amplification by recombinase polymerase, finally, the tube is placed in a U-star type cassette for revealing the result using specific DNA probes.

[0017] There is a real need for a field diagnostic tool that can quickly detect the presence of a bio-aggressor and identify, for example, its resistance to pesticides to guide the choice of treatment(s) to be applied. Description of the invention

[0018] The invention relates to a method for detecting in the field, i.e. outside the laboratory, directly near the field, the presence of a bio-aggressor. It also makes it possible to determine the resistance of bio-aggressors to pesticide treatments, more particularly the detection of TSR and / or MDR resistance, in order to monitor its development in the field. More particularly, the invention relates to the detection of an infection of straw cereals (barley, durum wheat, soft wheat) by the pathogenic agent. Zymo-Septoria tritici.

[0019] The method according to the invention comprises taking a sample of leaf from the plant suspected of being infected, or of insect vectors of parasites or weeds present in the crop, extracting the DNA or RNA from said sample, amplifying by PCR or RT-PCR DNA or RNA sequences of the bio-aggressor to determine i) the presence of the latter using a pair of specific primers making it possible to amplify a sequence characteristic of said aggressor, ii) the possible presence of at least one mutation responsible for resistance to a phytopharmaceutical treatment, this amplification being carried out in the presence of interfering DNA complementary to the parts of the primers capable of forming polymers between them in order to avoid the formation of aspecific bands on the immunological strips responsible for false positives;the revelation of the presence of said aggressor and possibly of its resistance is carried out on immunological strips (for example nitrocellulose DAS-Elisa type).;

[0020] The invention also relates to a kit for detecting the presence of a bio-aggressor and its resistance to pesticide treatments, suitable for field use, in particular for the detection of strains of the pathogen Zymo-Septoria tritici and their resistance to antifungal treatments. Advantage of the invention

[0021] The present invention meets the needs of the agricultural world by proposing a rapid detection method making it possible to highlight both the presence of a bioaggressor and the multi-resistance of the latter to phytopharmaceutical treatments thanks to amplification by quantitative PCR and detection on immunological strips. More particularly, this method applies to the detection of the pathogen Zymo-Septoria tritici.

[0022] PCR amplification allows rapid and efficient determination of a bioaggressor and a mutation, in particular that inducing multi-resistance. The DNA or RNA extract from the sample is directly introduced into a mixture containing primers specific to the aggressor and others specific to the mutations responsible for resistance and the whole is subjected to a PCR amplification step followed by the revelation of the results using an immunological strip. The results are obtained by detection via antibodies fixed on the strip of an antigenic marker fixed to the end of the amplified primers. This method does not require any DNA or RNA probe and allows a simple and rapid sequence of steps.

[0023] During a PCR, the primers used in the mixture can form polymers. As a general rule and in gel reading, this only induces a loss of efficiency of the system, more or less significant depending on the polymer formed. By On the other hand, when the technology uses immunological strip revelation, this also induces the formation of "false positives". In fact, the strip is capable of detecting a polymer, if it has the two necessary antigenic markers at each end of the dimer or polymer formed. In this case, a band will light up while the sample is negative.

[0024] Thus, to avoid the appearance of false positives and increase the reliability of the method, the inventors have unexpectedly demonstrated that the addition of interfering DNA acts significantly on the formation of polymers between primers, thus avoiding the appearance of aspecific bands responsible for false positives. Contrary to what the prior art teaches, the added interfering DNA is not linked here to a primer. The method is therefore robust and reliable.

[0025] Thanks to the use of interfering DNA, it is possible to increase the number of primers present in the mixture, while being able to avoid the appearance of false positives. Thus, the invention proposes to simultaneously detect 4 markers in the same PCR reaction by using two revealing bands for 2 markers each. This technology therefore provides access to a high-performance field diagnostic tool for appropriate decision-making.

[0026] The kit according to the invention is easy and quick to use, with the result being available in less than an hour. In addition, the kit has been designed to allow use by people without any laboratory experience, without special protective equipment and without risk to the environment or the handler (without toxic components). The result is presented in the form of strips and is easy to interpret (point of care quick diagnosis). DETAILED DESCRIPTION OF THE INVENTION

[0027] A first object of the invention relates to a method for detecting in the field the presence of a bio-aggressor of a crop comprising the steps of:

[0028] a. Taking a sample of leaf from the plant suspected of being infected, or of insect vectors of parasites, or of weeds present in the crop b. Extraction of DNA or RNA from said sample c. PCR amplification of said DNA or RNA sequences of the bio-aggressor to determine the presence of said bio-aggressor using a pair of specific primers making it possible to amplify a sequence characteristic of said bio-aggressor. d. Revelation on immunological strip of the presence of said bio-aggressor

[0029] in which the amplification step is carried out in the presence of interfering DNA complementary to the parts of the primers capable of forming polymers between them in order to avoid the formation of non-specific bands on the immunological strips responsible for false positives.

[0030] This method makes it possible to determine whether the plant suspected by the farmer of being attacked by a bio-aggressor is actually attacked by one or whether it is another pathology or a physiological problem of the plant. It also makes it possible to determine whether the bio-aggressor in question has resistance to a phytosanitary treatment. Thanks to several pairs of primers which are specific to the bio-aggressor and others specific to the main mutations responsible for one or more resistances to phytosanitary treatments, this method offers a complete diagnosis.

[0031] In a preferred embodiment of the invention, this method makes it possible to detect, in addition to the presence of a first bio-aggressor, the presence of at least one other bio-aggressor and / or to determine at least one characteristic associated with a bio-aggressor chosen from a resistance to a pesticide linked to the target, a multi-drug resistance, a resistance to heat, a resistance to drought or to humidity.

[0032] Thus, the method makes it possible to simultaneously obtain up to 4 results associated with the detection and / or characterization of one or more bio-aggressors from the same amplification reaction. In such an embodiment, the revelation will be carried out using two strips which will both be impregnated in the same amplification reaction mixture.

[0033] For the purposes of the invention, the term "bio-aggressor" means any biologically active agent responsible for damage to plants, such as viruses, bacteria, fungi or insects. This concept also includes weeds which "pollute" crops and reduce yields. The insect may be the bio-aggressor or be the vector of the bio-aggressor.

[0034] The term "phytopharmaceutical treatment" or "pesticide" means any preparation intended to protect plants and cultivated products from the nuisance of a bioaggressor by destroying them, or by using repellents in the case of insects.

[0035] "Interfering DNA" refers to small DNA sequences complementary to a part of a primer. This identified primer part can, in the event of a bad pairing during amplification, form polymers with the other primers. This then creates a false positive reading of the results on the strips. Thanks to this total complementarity to the corresponding primer part, the interfering DNA sequence will compete with the other primers and prevent the formation of polymers by avoiding pairing between them. These sequences are short, generally less than 15 nucleotides, for example of the order of ten nucleotides. The concentration of these interfering DNAs and the interfering DNA / primer ratio must be adapted so as not to harm the efficiency of the PCR.

[0036] In a preferred embodiment, the duplex format, i.e. two results (2 bands) on the same strip, the detection on the strip is carried out using:

[0037] a. The presence of antibodies fixed on the strip and forming three distinct bands, each band consisting of antibodies specific for a particular antigenic marker b. the presence of a specific antigenic marker at the 5' end of one of the sense or antisense primers and the presence of an antigenic marker common to all pairs of primers at the 5' end of the other primer, said markers being recognized by an antibody specific to one of the bands of the strip c. antibodies capable of binding to the antigenic marker common to all primer pairs and carrying a revelation system.

[0038] In a particular embodiment, the method comprises two of the three bands making it possible to reveal respectively the presence of the bio-aggressor in the sample, the existence of resistance of the latter to pesticides and the third is a control of the functionality of the revelation system.

[0039] The antigenic markers can be chosen from markers well known to those skilled in the art such as biotin, digoxigenin, F AM, etc.

[0040] In a preferred embodiment, the detection method according to the invention is applied to the detection of multi-resistance to antifungals (also called “Multi-Drug-Resistence” or MDR) of the pathogen Zymo-Septoria tritici, responsible for Septoria, in particular on straw cereals such as soft wheat, durum wheat and barley; the PCR amplification uses a mixture comprising the following sequences:

[0041] • A pair of specific primers making it possible to detect the presence of said bioaggressor comprising the sequences SEQ ID NO.1 and SEQ NO ID.2 • A pair of primers allowing the detection of multi-resistance comprising a primer of sequence SEQ ID NO.3 not specific to multi-resistance and a primer chosen from: • a primer of sequence SEQ ID NO.4 specific to multi-resistance I; • a primer of sequence SEQ ID NO.5 specific to multi-resistance II; • a primer of sequence SEQ ID NO.6 specific to multi-resistance III;

[0042] • Two interfering DNAs of sequences SEQ ID NO.7 and SEQ ID NO.8.

[0043] Multi-resistance I, II and III of the pathogen Zymo-Septoria tritici is determined respectively using the following sequences:

[0044] - sequence SEQ ID NO.4 - sequence SEQ ID NO.5 - sequence SEQ ID NO.6

[0045] each in association with the primer of sequence SEQ ID NO.3.

[0046] This method makes it possible to determine on straw cereals, such as soft wheat, barley and durum wheat, the presence of the pathogen Zymo-Septoria tritici and to determine whether this pathogen has multi-resistance induced by a mutation. The interfering DNAs of DNA sequences SEQ ID NO.7 and SEQ ID NO.8 make it possible to neutralize the formation of polymers, responsible for the loss of efficiency of the PCR method when reading the results on gel and the appearance of false positives when reading the results on strips.

[0047] A second subject of the invention relates to a kit for detecting the presence of a bio-aggressor suitable for use in the field comprising:

[0048] • A lyophilized PCR reaction mixture comprising:

[0049] - a pair of specific primers making it possible to amplify a sequence characteristic of said bio-aggressor - interfering DNAs complementary to the parts of the primers capable of forming polymers between them - a polymerase amplification enzyme

[0050] • At least one immunological revelation strip making it possible to reveal the presence of said bioaggressor

[0051] In order to provide a more complete diagnosis, in a preferred embodiment of the invention the kit also comprises at least one other pair of primers making it possible either to detect the presence of another bio-aggressor, or to determine at least one characteristic associated with a bio-aggressor chosen from a resistance to a pesticide linked to the target, a multi-drug resistance, a resistance to heat, a resistance to drought or to humidity.

[0052] In a particular embodiment, the kit makes it possible to detect the presence of a bio-aggressor and the characterization of a resistance of this bio-aggressor to a pesticide; in this kit, the PCR mixture comprises, in addition to the pair of specific primers making it possible to amplify a sequence characteristic of said bio-aggressor and the relevant DNAs, one or more pairs of specific primers making it possible to amplify at least one mutation responsible for resistance to a pesticide in the bio-aggressor. In this configuration, the strip comprises three distinct bands formed by the fixation of antibodies specific to a particular antigenic marker, namely respectively:

[0053] • an antibody specific to an antigenic marker located at the 5' end of one of the primers allowing the amplification of a sequence specific to the bioaggressor, • an antibody specific to an antigenic marker located at the 5' end of a primers allowing the amplification of a resistance-specific sequence • an antibody specific to an antigenic marker common to all pairs of primers allowing the bands to be revealed.

[0054] The kit may comprise 2 immunological strips to be used simultaneously to reveal 4 results from the same amplification. These results are chosen from the detection of the presence of at least one bio-aggressor and the determination of at least one characteristic associated with a bio-aggressor chosen from a target-related pesticide resistance, multi-drug resistance, heat resistance, resistance to drought or humidity. This type of kit comprising 4 markers is efficient and very informative for the user, while having a limited cost due to the fact that these 4 results are obtained in a single operation. The use of interfering DNA is particularly crucial to avoid the appearance of false positives linked to the complexity of the PCR mixture (high number of primers).

[0055] In a particularly preferred embodiment, the kit is applied to the detection of multi-drug resistance of the fungus Zymo-Septoria tritici responsible for Septoria, in particular in straw cereals such as soft wheat, barley and durum wheat, in which said freeze-dried PCR mixture comprises:

[0056] • The primers for detecting the presence of said pathogen are of sequence SEQ ID NO.1 and SEQ NO ID.2 • The primers allowing the detection of multi-resistance comprise a primer of sequence SEQ ID NO.3 not specific to multi-resistance and a primer chosen from: • a primer of sequence SEQ ID NO.4 specific to multi-resistance I; • a primer of sequence SEQ ID NO.5 specific to multi-resistance II; • a primer of sequence SEQ ID NO.6 specific to multi-resistance III;

[0057] • The interfering DNAs are of sequences SEQ ID NO.7 and SEQ ID NO.8

[0058] The revealing strip, in duplex format, comprises three distinct bands formed by the fixation of antibodies specific to a particular antigenic marker, namely respectively:

[0059] - an antibody specific to an antigenic marker located at the 5' end of one of the primers allowing the amplification of a specific sequence of Zymo-Septoria tritici, - an antibody specific to an antigenic marker located at the 5' end of one of the primers allowing the amplification of a specific sequence of a re pesticide resistance, particularly multi-resistance - an antibody specific to an antigenic marker common to all primer pairs allowing the bands to be revealed.

[0060] The invention also relates to a method for detecting in the field the presence of a bio-aggressor in a crop and possibly one of its resistances of interest using a kit as defined above, and comprising the following steps:

[0061] A) Taking a sample of a leaf suspected of being infected, or of insect vectors of parasites, or of weeds present in the crop

[0062] B) Extraction of DNA or RNA from said sample

[0063] C) Introduction of the extracted DNA or RNA into a tube containing the lyophilized PCR mixture as defined previously

[0064] D) Carrying out a PCR amplification (between 30 and 40 cycles)

[0065] E) Introduction of one or two immunological strips for impregnation into the tube containing the amplicons to reveal whether the bio-aggressor is present and possibly whether it presents resistance of interest.

[0066] Resistances of interest include target-related pesticide resistance, multi-drug resistance, heat resistance, drought resistance, or humidity resistance.

[0067] In a preferred embodiment, duplex format, this method is applied to the detection of the presence of the pathogen Zymo-Septoria tritici and its resistance to fungicides. BRIEF DESCRIPTION OF THE FIGURES

[0068] [fig.l]Figure 1: Schematic representation of the steps of the method for detecting a bio-aggressor according to the invention.

[0069] [fig.2]Figure 2: General principle of immunological strip revelation. EXAMPLES

[0070] EXAMPLE 1: Detection and characterization of strains of the pathogen Zymo-septoria tritici with revelation of two markers

[0071] The present invention is illustrated using the following example and presents a particular embodiment of the invention, namely the application of the method for the detection and characterization of strains of the pathogen Zymo-septoria tritici.

[0072] A synthetic representation of the steps of the method is presented in Figure 1.

[0073] Amplification of specific sequences of the pathogen Zymo-Septoria tritici in straw cereals such as soft wheat, barley and durum wheat, is carried out by the PCR method. This method is known to those skilled in the art. The specific elements developed within the framework of the present invention are the primers and the DNA in- interfering factors described below.

[0074] For the amplification of the pathogen Zymo-Septoria tritici:

[0075] - Sense primer SEP_F1: 5'- [5' Digoxigenin] GCCTTCCTACCCCACCATGT -3' (SEQ ID NO.l) Antisense primer SEP_R1: 5'- [5' 6-FAM] CCTGAATCGCGCATCGTTA -3' (SEQ ID NO.2)

[0076] For the amplification of a mutation inducing resistance to MDR type fungicides:

[0077] - Non-specific MDR1 sense primer for multi-resistance: 5'-[5'BiotinTEG]TACGAGACGAGAAAAAAGACAG -3' (SEQ ID NO.3) - MDR2 antisense primer specific for multidrug resistance 1: 5'- [5' 6-FAM]GTCCTAATCGGGTAAAAGA -3' (SEQ ID NO.4) - MDR3 antisense primer specific for multidrug resistance II: 5'- [5' 6-FAM]CCCCTAAGGTCAAAGAA -3' (SEQ ID NO.5) - MDR4 antisense primer specific for multidrug resistance III: 5'- [5' 6-FAM] GGTAGGCTTGGCACTC -3' (SEQ ID NO.6)

[0078] For the addition of interfering DNAs:

[0079] - iDNA 1 5'- GGGTAGGA -3' (SEQ ID NO.7) iDNA 2 5'- ACGATGCG -3' (SEQ ID NO.8)

[0080] The composition of the PCR mixture is detailed in Table 1.

[0081] [Tables 1] Reagent Volume Taq Promega GoTaq 5pi SEP_F 0.25pl at 5pM SEP_R 0.25pl at 5pM MDR1_F 0.3pl at 5pM MDR2_R 0.3pl at 5pM MDR3_R 0.3pl at 5pM MDR4_R 0.3pl at 5pM iDNA 1 0.4pl at 20pM iDNA 2 0.4pl at 20pM

[0082] Table 1: PCR mix for the detection of Zymo-Septoria tritici and MDR resistance in this pathogen

[0083] The method is implemented by following the following protocol using a kit according to the invention:

[0084] 1. - Taking a sample of a leaf showing a symptom of infection

[0085] 2 - DNA extraction

[0086] 3 - Rehydration of the lyophilized pellet of the PCR mixture with a rehydration buffer dration and addition of the DNA extract from the sample

[0087] 4 - Amplification of the sequences by PCR; for this step, a Jeulin® machine battery-operated (9 tubes) was used. It can be used near the field.

[0088] The PCR program used is as follows:

[0089] 95°C 3 minutes

[0090] 95°C 3 seconds

[0091] 60°C 20 seconds x 40 cycles

[0092] 5 - Revelation of the result on a nitrocellulose strip on which are fixed antibodies capable of recognizing the antigenic markers located at the ends of the primers amplified by impregnating the strip with the mixture obtained.

[0093] The principle of revealing the result on a strip is illustrated in Figure 2.

[0094] EXAMPLE 2: Detection and characterization of strains of the pathogen Fusarium with revelation of 4 markers using 2 strips

[0095] This example illustrates the application of the method to the simultaneous detection of 4 markers to respond to a complex problem using a simple, rapid and inexpensive test, usable near fields.

[0096] In practice, 2 strips are introduced into the same tube from the same PCR reaction to reveal 4 markers; this is a quadruplex format. It can be used to address the following problem:

[0097] - On wheat and corn, Fusarium is very common and causes very serious damage. significant on the foliage, the roots causing significant lodging. In addition, these Fusarium ssp. produce mycotoxins, some of which are lethal to humans and animals when their levels in food exceed certain limits (cumulative effects in tissues such as the liver, for example, nervous tissue, etc.;

[0098] - These Fusarium produce Trichothecene type mycotoxins (deoxynivalenol = DON, Nivalenol, T2 and HT2, Zearalenone, Fumonisin, etc.).

[0099] In the presence of Fusarium in a wheat field, it is possible to characterize the strains for their resistance to certain fungicides and simultaneously know the type of mycotoxins they can produce. With 4 markers available, it is possible to:

[0100] o use 2 markers for fungicide resistance (TSR and MDR or equivalent) and 2 markers for the most toxic types of mycotoxins such as DON and Zearalenone for example.

[0101] o If the 2 fungicide resistance markers indicate that it is possible to eff effectively eliminate cefusarium, the harvest will be usable for food even if the mycotoxin markers are positive;

[0102] o If both fungicide resistance markers indicate that Cefusarium cannot be effectively eliminated, the harvest will be usable for food even if the mycotoxin markers are negative; on the other hand, the harvest will have to be destroyed if one of the mycotoxin markers is positive.

Claims

Claims

1. Method for detecting in the field the presence of a bio-aggressor of a crop comprising the steps of: a. Taking a sample of leaf of the plant suspected of being infected, or of insect vectors of parasites, or of weeds present in the crop b. Extraction of the DNA or RNA of said sample c. Amplification by PCR of said DNA or RNA sequences of the bio-aggressor to determine the presence of said bio-aggressor using a pair of specific primers making it possible to amplify a sequence characteristic of said bio-aggressor d. Revealing on an immunological strip the presence of said bio-aggressor in which the amplification step is carried out in the presence of interfering DNA complementary to the parts of the primers capable of forming polymers between them in order to avoid the formation of aspecific bands on the immunological strips responsible for false positives.

2. A method according to claim 1 further enabling the presence of at least one other bio-aggressor to be detected and / or at least one characteristic associated with a bio-aggressor to be determined, chosen from target-related pesticide resistance, multi-drug resistance, heat resistance, drought resistance or humidity resistance.

3. Method according to one of claims 1 or 2 making it possible to simultaneously obtain up to 4 results associated with the detection and / or characterization of one or more bio-aggressors using two strips in the same test.

4. Method according to one of the preceding claims in which the bio-aggressor to be detected is the fungus Zymo-Septoria tritici, responsible for Septoria, in particular on straw cereals such as soft wheat, barley and durum wheat and in which the PCR amplification is carried out using a mixture comprising the following sequences: - A pair of specific primers making it possible to detect the presence of said fungus comprising the sequences SEQ ID NO.1 and SEQ NO ID.2 - A pair of primers making it possible to detect a multi- drug comprising a primer of sequence SEQ ID NO.3 not specific for multi-resistance and a primer chosen from: - a primer of sequence SEQ ID NO.4 specific for multi-resistance I; - a primer of sequence SEQ ID NO.5 specific for multi-resistance II; - a primer of sequence SEQ ID NO.6 specific for multi-resistance III; - Two interfering DNAs of sequences SEQ ID NO.7 and SEQ ID NO.

8.

5. Kit for detecting the presence of a bio-aggressor suitable for use in the field comprising: o A lyophilized PCR reaction mixture comprising: - a pair of specific primers making it possible to amplify a sequence characteristic of said bio-aggressor - interfering DNAs complementary to the parts of the primers capable of forming polymers between them - a polymerase amplification enzyme o At least one immunological revelation strip making it possible to reveal the presence of said bio-aggressor.

6. Kit according to claim 5 wherein said PCR mixture further comprises at least one other pair of primers making it possible either to detect the presence of another bio-aggressor, or to determine at least one characteristic associated with a bio-aggressor chosen from a resistance to a pesticide linked to the target, a multi-drug resistance, a resistance to heat, a resistance to drought or to humidity.

7. Kit according to claim 6 for detecting the presence of a bioaggressor and characterizing a resistance of this bioaggressor to a pesticide in which: - The PCR mixture further comprises one or more pairs of specific primers for amplifying at least one mutation responsible for resistance to a pesticide in the bioaggressor - The strip comprises three distinct bands formed by the binding of antibodies specific for a particular antigenic marker, namely respectively: o an antibody specific for an antigenic marker located at the 5' end of one of the primers allowing the amplification of a specific sequence of the bioaggressor, o an antibody specific for an antigenic marker located at the 5' of one of the primers allowing the amplification of a specific sequence of a resistance or an antibody specific to an antigenic marker common to all the pairs of primers allowing the bands to be revealed.

8. Kit according to one of claims 5 to 7, comprising 2 immunological strips to simultaneously reveal 4 results from the same amplification, said results being chosen from the detection of the presence of at least one bio-aggressor and the determination of at least one characteristic associated with a bio-aggressor chosen from a resistance to a pesticide linked to the target, a multi-drug resistance, a resistance to heat, a resistance to drought or to humidity.

9. Kit according to one of claims 5 to 8 applied to the detection of multi-drug resistance of the fungus Zymo-Septoria tritici responsible for Septoria, in particular in straw cereals such as soft wheat, barley and durum wheat, in which said freeze-dried PCR mixture comprises: - The primers for detecting the presence of said pathogen are of sequence SEQ ID NO.1 and SEQ NO ID.2 - The primers for detecting multi-resistance comprise a primer of sequence SEQ ID NO.3 not specific for multi-resistance and a primer chosen from: • a primer of sequence SEQ ID NO.4 specific for multi-resistance I; • a primer of sequence SEQ ID NO.5 specific for multi-resistance II; • a primer of sequence SEQ ID NO.6 specific for multi-resistance III; - The interfering DNAs are of sequences SEQ ID NO.7 and SEQ ID NO.8

10. Method for field detection of the presence of a bio-aggressor in a crop and possibly of one of its resistances of interest using a kit as defined in one of claims 5 to 9, and comprising the following steps: A) Taking a sample of a leaf suspected of being infected, or of insect vectors of parasites, or of a weed present in the crop B) Extraction of DNA or RNA from said sample C) Introduction of the extracted DNA or RNA into a tube containing said freeze-dried PCR mixture D) Carrying out PCR amplification E) Introduction of one or two immunological strip(s) for impregnation into the tube containing the amplicons to reveal whether the bioaggressor is present and possibly whether it presents resistance of interest.

Images