METHOD FOR DETECTION OF VIRULENT STRAINS OF VENTURIA INEQUALIS

Abstract

METHOD FOR DETECTING VIRULENT VENTURIA INAEQUALIS STRAINS The present invention relates to a method for detecting the presence of a virulent strain of Venturia inaequalis in a sample. This method is based on the identification of specific markers associated with virulent Venturia inaequalis strains. This detection method has several advantageous applications, such as determining geographical zones of virulence, making it possible, in particular, to assess the benefit of planting an orchard in this zone with varieties carrying the corresponding resistance gene, to assess whether fungicide treatment is necessary in an orchard, thus avoiding systematic preventive treatment, or to assess the health quality of an apple tree containing the Rvi6 resistance gene. Figure for the abstract: none

Description

Description of the invention: METHOD FOR DETECTION OF VIRULENT VENTURIA INAEQUALIS STRAINS Technical field The present invention relates to the detection of strains of Venturia inaequalis virulentes. State of the art Apple scab is one of the main fungal diseases of apple trees. The pathogen responsible for apple scab is an ascomycete fungus called Venturia inaequalis. Apple scab is characterized by the appearance of circular, black or brown spots on the surface of leaves, buds, fruit, and / or on the wood of infected fruit trees. Fruit and leaves are particularly susceptible to Venturia inaequalis. Scab is favored by humid weather in spring, at the time of bud break. The period of primary infection, linked to the projection of ascospores, begins in spring. Primary infections will lead to the development of spore-forming symptoms on young leaves and fruit. During rainy periods in spring and summer, spores projected by raindrops and wind will initiate secondary infections. In orchards, apple scab does not kill the affected tree, but it can significantly reduce its productivity and, above all, the quality of the fruit, since no scab is tolerated on fruit in distribution channels. To protect their apple orchards, growers resort to chemical control. Thus, whether in conventional or organic farming, controlling apple scab requires an average of 25 fungicide treatments per year, or even more in rainy years. To date, genetic control relies primarily on the use of a single resistance gene, the Rvi6 gene, which breeders introduced into certain varieties from the domestic species Malus floribunda. However, in some regions of Europe, the emergence of virulent strains of Venturia inaequalis has led to a loss of effectiveness of this resistance. To date, there is no way to detect the presence of Venturia inaequalis strains virulent against the Rvi6 resistance gene. Therefore, as a precautionary measure, preventative fungicide treatments are systematically applied during the high-risk period in spring to protect varieties carrying the Rvi6 gene. Similarly, some growers are hesitant to plant varieties carrying Rvi6 resistance because They have no information on the presence of virulent populations in their environment. There is therefore a real need to provide a method for detecting virulent Venturia inaequalis strains, preferably one that is rapid and easy to implement. Detailed description The inventors have succeeded in identifying and sequencing the avirulence gene AvrRvi6 of the fungus V. inaequalis, which interacts with the resistance gene Rvi6. Nucleotide modifications at this locus (mutations such as substitutions, insertions, and / or deletions) are responsible for the increased virulence of mutated strains. The inventors have indeed demonstrated a genetic polymorphism at the AvrRvi6 locus, as well as at its promoter, in 120 strains of Venturia inaequalis. Based on this polymorphism, the inventors have developed a method for detecting the presence of virulent Venturia inaequalis strains, which relies on the specific detection of the alleles and / or promoter of the AvrRvi6 gene that confer virulence to a strain. The detection method according to the invention has the advantage of being simple to implement and rapid, with results obtainable in a few days. Furthermore, the detection method according to the invention is sensitive and precise, particularly due to the use of technologies such as quantitative PCR (Polymerase Chain Reaction), especially isothermal quantitative PCR, LAMP (Loop-Mediated Amplification), and / or Qprobe, whether or not combined with the LAMP technique. The detection method according to the invention thus represents an essential decision-making tool for determining whether virulence is present at different scales (for example, within an orchard, a farm, a nursery, a country, or even a continent). The method according to the invention also makes a significant contribution to reducing fungicide use, (1) by allowing treatments to be applied only when the virulent population is present, thereby avoiding systematic preventative treatment, and (2) by encouraging growers to plant varieties carrying the Rvi6 resistance gene. The detection method according to the invention can also be used to check the quality of plants and to ensure, for example, that a plant containing the Rvi6 resistance gene is free from any contamination by a strain of Venturia inaequalis virulent towards the Rvi6 gene. A first object of the invention relates to a method for detecting the presence of a virulent strain of Venturiainaequalis in a sample, comprising: a. providing a sample capable of containing Venturia DNA aqualis, b. determine if the DNA present in the sample includes at least one poly- virulence morphism, c. If at least one virulence polymorphism is detected in step b), deduce that the sample provided in step a) includes a strain of Venturia in- virulent aequalis. The virulence polymorphism is preferably an allele comprising or consisting of a sequence selected from the group consisting of the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 and / or a promoter comprising or consisting of the sequence SEQ ID NO: 7 or SEQ ID NO: 8. Step a) of the process as defined above preferably comprises the following steps: 1. Provide a sample likely to include a strain of Venturia in- aqualis, ii. extract the DNA present in the sample provided in step (i), to obtain a sample likely to include Venturia inaequalis DNA. Step b) of the process as defined above preferably includes determining whether the DNA contains at least one virulence marker selected from the group consisting of: - a fragment of the sequence SEQ ID NO: 1 comprising nucleotides 155 to 165 of said sequence SEQ ID NO: 1, - a fragment of the sequence SEQ ID NO: 2 comprising nucleotide 62 of said sequence SEQ ID NO: 2, - a fragment of the sequence SEQ ID NO: 3 comprising nucleotide 160 of said sequence SEQ ID NO: 3, - a fragment of the sequence SEQ ID NO: 4 comprising nucleotide 192 of said sequence SEQ ID NO: 4, - a fragment of the sequence SEQ ID NO: 5 comprising nucleotide 201 of said sequence SEQ ID NO: 5, - a fragment of the sequence SEQ ID NO: 6 comprising nucleotide 304 of said sequence SEQ ID NO: 6, - a fragment of the sequence SEQ ID NO: 7 comprising nucleotide 189, nucleotides 304 to 316 and / or nucleotides 480 to 490 of said sequence SEQ ID NO: 7, and - a fragment of the sequence SEQ ID NO: 8 comprising nucleotide 572 of said sequence SEQ ID NO: 8, nucleotide 706 of said sequence SEQ ID NO: 8, nucleotides 548 to 557 of said sequence SEQ ID NO: 8 and / or 15 consecutive nucleotides between nucleotides 139 to 420 of said sequence SEQ ID NO: 8. Another object of the invention relates to a method for the preventive and / or curative treatment of apple trees comprising the Rvi6 resistance gene allowing for a reduction in the frequency and / or quantity of plant protection product applied against Venturia in aequalis, comprising: implement steps a) to c) of the detection method as defined above, apply preventive and / or curative treatment if the sample provided in the step a) includes a virulent strain of Venturiainaequalis. Another object of the invention relates to a method for evaluating the quality of an apple tree seedling, comprising the following steps: implement steps a) to c) of the detection method as defined above, the sample provided in step a) being taken from the air around said plant and / or on all or part of said plant, if no virulence polymorphism is detected in step b), deduce that The plant is not contaminated by a virulent strain of Venturia inaequalis. including the virulence polymorphism sought in step b). Another object of the invention relates to a method for mapping the virulence of Venturiainaequalis comprising the following steps: implement steps a) to c) of the detection method as defined above, from at least two samples taken in geo- areas different graphs, deduce that the geographical area from which a sample originates including a virulent strain of Venturiainaequalis is an area of virulence and that the geographical area from which a sample originates including no virulent strain of Venturiainaequalis is an area free from virulence. Another object of the invention relates to a virulence marker comprising or consisting of: - a fragment of the sequence SEQ ID NO: 1 comprising nucleotides 155 to 165 of said sequence SEQ ID NO: 1, - a fragment of the sequence SEQ ID NO: 2 comprising nucleotide 62 of said sequence SEQ ID NO: 2, - a fragment of the sequence SEQ ID NO: 3 comprising nucleotide 160 of said sequence SEQ ID NO: 3, - a fragment of the sequence SEQ ID NO: 4 comprising nucleotide 192 of said sequence SEQ ID NO: 4, - a fragment of the sequence SEQ ID NO: 5 comprising nucleotide 201 of said sequence SEQ ID NO: 5, - a fragment of the sequence SEQ ID NO: 6 comprising nucleotide 304 of said sequence SEQ ID NO: 6, - a fragment of the sequence SEQ ID NO: 7 comprising nucleotide 189, nucleotides 304 to 316 and / or nucleotides 480 to 490 of said sequence SEQ ID NO: 7, or - a fragment of the sequence SEQ ID NO: 8 comprising nucleotide 572 of said sequence SEQ ID NO: 8, nucleotide 706 of said sequence SEQ ID NO: 8, nucleotides 548 to 557 of said sequence SEQ ID NO: 8 and / or 15 consecutive nucleotides between nucleotides 139 to 420 of said sequence SEQ ID NO: 8, said fragment comprising at least 15 nucleotides. Another object of the invention relates to a combination of at least two virulence markers, said markers being as defined above. Another object of the invention is a kit for the detection of the presence of a virulent strain of Venturiainaequalis in a sample, said kit comprising means for amplifying a marker as defined above or the markers of the combination as defined above. Another object of the invention relates to the use of a virulence marker as defined above, a combination of markers as defined above, or a kit as defined above, to detect the presence of a virulent strain of Venturia inaequalis or to determine whether a strain of Venturia inaequalis is virulent or avirulent, in particular to determine geographical areas of virulence, to assess whether fungicide treatment is necessary, to assess the quality of an apple tree and / or apple fruit, and / or to assess whether virulence is present in a given territory to help in the decision to plant or not apple varieties carrying the Rvi6 resistance gene. Venturia ü li "Apple scab" refers here to a fungal disease caused by the fungus Venturia inaequalis. Apple scab affects apple trees of the genus Malus. However, apple trees of the genus Malus containing the Rvi6 resistance gene are resistant to the so-called avirulent strains of Venturia inaequalis avrRvi6. The fungus Venturia inaequalis does indeed contain an avirulence gene AvrRvi6 In an avirulent strain of Ventaria inaequalis, the protein encoded by the avirulence gene AvrRvi6 is recognized directly or indirectly by the protein encoded by the resistance gene Rvi6 expressed by the apple tree, thus triggering a rapid defense response in the apple tree that prevents further development of this pathogen. The apple tree is then said to be "resistant". The term “Venturia inaequalis strain” refers here to a unique individual that can be distinguished by its genotype. The Venturia inaequalis strain can be in the form of spores or mycelium. The Venturia inaequalis strain is generally present on infected plants in the form of spots resulting from the presence of spores and mycelium. The terms "avirulent Venturia inaequalis strain" or "avirulent Venturia inaequalis strain" refer to a Venturia inaequalis strain containing an avirulence gene AvrRvi6 encoding a protein recognized directly or indirectly by the protein encoded by the apple tree's Rvi6 resistance gene. The terms "virulent strain of Venturia inaequalis" or "strain of Venturia inaequalis with a virulent character" refer here to a strain of Venturia inaequalis that is not recognized as a pathogen by an apple tree containing the Rvi6 resistance gene; such a strain is therefore responsible for disease on varieties carrying the Rvi6 gene. A virulent strain of Venturia inaequalis may include at least one mutation in the avirulence gene AvrRvi6 and / or in the promoter of the avirulence gene AvrRvi6, resulting in the absence of protein expression and / or a protein that is no longer recognized by the protein encoded by the resistance gene Rvi6. The term "locus" refers to a fixed position of a gene or genetic marker on a chromosome. The term "allele" here refers to a variant of a gene located at a given locus. By "polymorphism conferring a virulent (or avirulent) character" or "virulence (or avirulence) polymorphism", we mean here an allele and / or a promoter sequence conferring a virulent (or avirulent) character to a strain of Venturia inaequalis. An allele conferring virulence to a strain of Venturia inaequalis at the AvrRvi6 locus includes or consists, for example, of a sequence selected from the group consisting of the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. The SEQ ID NO: 1 sequence includes a substitution at nucleotide 139, in particular by the presence of nucleotide A instead of nucleotide G, and a deletion of nucleotides 155 to 309 for example compared to the SEQ ID NO: 15 sequence. The sequence SEQ ID NO: 2 is characterized by the presence of a substitution at nucleotide 62, specifically the presence of nucleotide C instead of nucleotide G, a substitution at nucleotide 139, specifically the presence of nucleotide A instead of nucleotide G, a substitution at nucleotide 237, specifically the presence of nucleotide C instead of nucleotide T, and a substitution at nucleotide 279, in particular by the presence of the nucleotide A instead of T. The SEQ ID NO: 3 sequence is characterized by the presence of a substitution at nucleotide 139, in particular by the presence of nucleotide A instead of nucleotide G, a substitution at nucleotide 160, in particular by the presence of nucleotide C instead of nucleotide T and by the presence of a substitution at nucleotide 279, in particular by the presence of nucleotide A instead of nucleotide T. The SEQ ID NO: 4 sequence is characterized by the presence of a substitution at nucleotide 139, in particular by the presence of nucleotide A instead of nucleotide G, a substitution at nucleotide 192, in particular by the presence of nucleotide A instead of C, a substitution at nucleotide 219, in particular by the presence of nucleotide G instead of nucleotide A and a substitution at nucleotide 279, in particular by the presence of nucleotide A instead of nucleotide T. The SEQ ID NO: 5 sequence is characterized by the presence of a substitution at nucleotide 139, in particular by the presence of nucleotide A instead of nucleotide G, a substitution at nucleotide 201, in particular by the presence of nucleotide C instead of nucleotide T and a substitution at nucleotide 279, in particular by the presence of nucleotide A instead of nucleotide T. The SEQ ID NO: 6 sequence is characterized by the presence of a substitution at nucleotide 304, in particular by the presence of the nucleotide G instead of the nucleotide T. An example of an allele conferring an avirulent character to a strain of Venturia_in- aequalis at the AvrRvi6 locus is an allele comprising or consisting of the sequence SEQ ID NO: 15. A promoter conferring virulence to a strain of Venturia inaequalis at the AvrRvi6 locus includes or consists, for example, of the sequence SEQ ID NO: 7 or SEQ ID NO: 8. The SEQ ID NO: 7 sequence is characterized by the presence of a substitution at nucleotide 189, in particular by the presence of nucleotide A instead of nucleotide G, by the presence of three deletions of nucleotides 309 to 311, in particular by the deletion of nucleotides A, T and A and by the insertion of 5 nucleotides at position 484, in particular nucleotides G, A, A, T and A. The SEQ ID NO: 8 sequence is characterized by the presence of a 281 nucleotide insertion at nucleotide 139, a deletion of nucleotides 552 to 555, a substitution at nucleotide 572, in particular by the presence of nucleotide A instead of C and a substitution of nucleotide 706, in particular by the presence of nucleotide G instead of A. An example of a promoter conferring an avirulent character to a strain of Venturia inaequalis at the AvrRvi6 locus is an allele comprising or consisting of the sequence SEQ ID NO: 14. Virulence marker, marker for the presence of Venturia inaequalis, combination of markers The present invention also relates to a virulence marker, a marker for Venturia inaequalis, and / or a combination of at least two virulence markers and, optionally, at least one marker for the presence of V. inaequalis. A "virulence marker" is defined herein as a polynucleotide whose sequence corresponds to a region present at the avirulence locus of a virulent Venturia inaequalis strain, but different from the avirulence locus of avirulent Venturia inaequalis strains. A virulence marker comprises, for example, at least one nucleotide mutation (substitution, addition, and / or deletion) relative to the sequence present in an avirulent Venturia inaequalis strain. Table 1 lists the single nucleotide polymorphisms (SNPs) and / or deletions present in alleles comprising or consisting of sequences SEQ ID NO: 1 to SEQ ID NO: 6. The position of the SNP or deletion is shown relative to sequence SEQ ID NO: 15. [Table 1] Deletion 155-309 | [x The present invention thus relates to a virulence marker comprising or consisting of: a fragment of the SEQ ID NO: 1 sequence comprising nucleotides 155 to 165 of said sequence SEQ ID NO: 1, preferably including the nu- cleotides 155 to 180 of said sequence SEQ ID NO: 1, said marker being specifically specific to the SEQ sequence allele ID NO: 1, a fragment of the SEQ ID NO: 2 sequence comprising nucleotide 62 of said sequence, said marker being in particular specific to the allele of SEQ sequence ID NO: 2, a fragment of the SEQ ID NO: 3 sequence comprising nucleotide 160 of said sequence, said marker being in particular specific to the allele of SEQ sequence ID NO: 3, a fragment of the SEQ ID NO: 4 sequence comprising nucleotide 192 of said sequence, said marker being in particular specific to the allele of SEQ sequence ID NO: 4, a fragment of the SEQ ID NO: 5 sequence comprising nucleotide 201 of said sequence, said marker being in particular specific to the allele of SEQ sequence ID NO: 5, a fragment of the SEQ ID NO: 6 sequence comprising nucleotide 304 of said sequence, said marker being in particular specific to the allele of SEQ sequence ID NO: 6, a fragment of the SEQ ID NO: 7 sequence comprising nucleotide 189, nucleotides 304 to 316 and / or nucleotides 480 to 490 of said sequence SEQ ID NO: 7, said marker being notably specific to the promoter of sequence SEQ ID NO: 7, or a fragment of the SEQ ID NO: 8 sequence comprising nucleotide 572 of said sequence SEQ ID NO: 8, nucleotide 706 of said sequence SEQ ID NO: 8, nucleotides 548 to 557 of said sequence SEQ ID NO: 8 and / or 15 consecutive nucleotides between nucleotides 139 and 420 of said sequence SEQ ID NO: 8, said marker being in particular specific to SEQ sequence promoter ID NO: 8. The present invention relates, for example, to a virulence marker as defined above comprising or consisting of: - a fragment of the sequence SEQ ID NO: 1 comprising nucleotides 155 to 165 of said sequence SEQ ID NO: 1, preferably comprising nucleotides 155 to 180 of said sequence SEQ ID NO: 1, - a fragment of the sequence SEQ ID NO: 2 comprising (i) nucleotide 62 and (ii), optionally, nucleotide 139, nucleotide 237 and / or nucleotide 279 of said sequence SEQ ID NO: 2, - a fragment of the sequence SEQ ID NO: 3 comprising (i) nucleotide 160 and (ii), optionally, nucleotide 139 and / or nucleotide 279 of said sequence SEQ ID NO: 3, - a fragment of the sequence SEQ ID NO: 4 comprising (i) nucleotide 192 and (ii), optionally, nucleotide 139, nucleotide 219 and / or nucleotide 279 of said sequence SEQ ID NO: 4, - a fragment of the SEQ ID NO: 5 sequence comprising (i) nucleotide 201 and (ii), optionally, nucleotide 139 and / or nucleotide 279 of said SEQ ID sequence NO: 5, - a fragment of the sequence SEQ ID NO: 6 comprising nucleotide 304 of said sequence SEQ ID NO: 6, - a fragment of the sequence SEQ ID NO: 7 comprising nucleotides 189, nucleotides 304 to 316 and / or nucleotides 480 to 490 of said sequence SEQ ID NO: 7, or - a fragment of the sequence SEQ ID NO: 8 comprising nucleotide 572 of said sequence SEQ ID NO: 8, nucleotide 706 of said sequence SEQ ID NO: 8, nucleotides 548 to 557 of said sequence SEQ ID NO: 8 and / or 15 consecutive nucleotides between nucleotides 139 to 420 of said sequence SEQ ID NO: 8. The term "fragment" here refers to a polynucleotide of at least 5 nucleotides in length, preferably at least 8 nucleotides, and more preferably at least 10 nucleotides, for example at least 15 or at least 20 nucleotides. The fragment is preferably 50 nucleotides or less in size, preferably 40 nucleotides or less, for example 30 nucleotides or less. A fragment as defined above preferably comprises at least 15 nucleotides. By "sequence fragment SEQ ID NO: X", we mean a fragment consisting of consecutive nucleotides of a polynucleotide of sequence SEQ ID NO: X. The present invention thus relates, for example, to a virulence marker comprising or consisting of: a polynucleotide comprising or consisting of nucleotides 155 to 180 of the SEQ sequence ID NO: 1, a polynucleotide comprising or consisting of nucleotides 52 to 72 of the SEQ sequence ID NO: 2, a polynucleotide comprising or consisting of nucleotides 150 to 170 of the sequence of the sequence SEQ ID NO: 3, a polynucleotide comprising or consisting of nucleotides 182 to 202 of the SEQ sequence ID NO: 4, a polynucleotide comprising or consisting of nucleotides 191 to 211 of the SEQ sequence ID NO: 5, a polynucleotide comprising or consisting of nucleotides 294 to 314 of the SEQ sequence ID NO: 6, a polynucleotide comprising or consisting of nucleotides 180 to 200, nucleotides 304 to 316 and / or nucleotides 480 to 490 of the sequence SEQ ID NO: 7, or a polynucleotide comprising or consisting of nucleotides 562 to 582, nucleotides 696 to 716, nucleotides 548 to 557 and / or 15 nucleotides consecutive nucleotides between 139 and 420 of the sequence SEQ ID NO: 8. By "marker of the presence of V. inaequalis", we mean here a polynucleotide whose sequence corresponds to a region present in all strains of Venturia inaequalis. A marker of the presence of V. inaequalis that could be used is, for example, a polynucleotide comprising all or part of the sequence encoding V. inaequalis actin, a polynucleotide comprising all or part of the sequence encoding a V. inaequalis elongation factor, or a polynucleotide comprising all or part of the V. inaequalis housekeeping gene RPLA. A preferred marker for the presence of V. inaequalis is a polynucleotide comprising all or part of the V. inaequalis housekeeping gene RPLA. The present invention thus relates to a marker for the presence of Venturia inaequalis comprising or consisting of the sequence SEQ ID NO: 9 or a fragment of the sequence SEQ ID NO: 9. A marker for the presence of Venturia inaequalis is, for example, the polynucleotide corresponding to nucleotides 1243 to 1419 of the sequence SEQ ID NO: 9. An example of a primer pair for amplifying a marker for the presence of Venturia inaequalis, in particular the housekeeping gene RPL4, consists of the forward primer of sequence SEQ ID NO: 10 (TTCAATCTGCTCTCCGAGGT) and the reverse primer of sequence SEQ ID NO: 11 (CTAATGCCTTTGGCTTCTCG). The present invention also relates to a combination of at least two virulence markers and, optionally, at least one marker for the presence of V. inaequalis. The virulence markers and / or the marker of the presence of V. inaequalis of said combination are in particular as defined above. The combination of at least two virulence markers and, optionally, at least one marker of the presence of V. inaeqgualis may, for example, include: at least 2 virulence markers, preferably at least 4 markers of virulence, preferably at least 6 virulence markers, for example 6, 7, 8 or at least 8 virulence markers and Optionally, one or at least one marker of the presence of V. inaequalis. A preferred combination of at least two virulence markers and, optionally, at least one marker of the presence of V. inaequalis may include: 8 virulence markers, for example: a polynucleotide comprising or consisting of nucleotides 155 to 180 of the SEQ sequence ID NO: 1, a polynucleotide comprising or consisting of nucleotides 52 to '72 of the SEQ sequence ID NO: 2, a polynucleotide comprising or consisting of nucleotides 150 to 170 of the sequence of the sequence SEQ ID NO: 3, a polynucleotide comprising or consisting of nucleotides 182 to 202 of sequence SEQ ID NO: 4, a polynucleotide comprising or consisting of nucleotides 191 to 211 of sequence SEQ ID NO: 5, a polynucleotide comprising or consisting of nucleotides 294 to 314 of the SEQ sequence ID NO: 6, a polynucleotide comprising or consisting of nucleotides 180 to 200, nucleotides 304 to 316 and / or nucleotides 480 to 490 of the SEQ sequence ID NO: 7, and a polynucleotide comprising or consisting of nucleotides 562 to 582, nucleotides 696 to 716, nucleotides 548 to 557 and / or 15 nu- consecutive nucleotides between nucleotides 139 and 420 of the SEQ sequence ID NO: 8, and Optionally, a marker for the presence of V. inaequalis, for example a marker of the presence of Venturia inaequalis comprising or consisting of the sequence SEQ ID NO: 9 or a fragment of the sequence SEQ ID NO: 9 as defined above. The present invention relates particularly to a method for detecting the presence of a virulent strain of Venturiainaequalis in a sample, comprising: a) provide a sample likely to include Venturia inaequalis DNA b) determine whether the DNA present in the sample includes at least one virulence polymorphism and, optionally, at least one marker of the presence of V. inaequalis, (c) If at least one virulence polymorphism is detected in step (b), deduce that the sample provided in step (a) contains a virulent strain of Venturiainaequalis. Step (a) Step a) includes or consists of providing a sample that may include Venturia inaequalis DNA. The phrase "likely to contain DNA" means that the starting sample may not contain a strain of Venturia inaequalis, in which case no Venturia inaequalis DNA will be present in the sample. The presence of Venturia inaequalis in the sample can be verified in step b) by determining the presence of at least one marker of the presence of V. inaequalis. In a preferred embodiment, step a) of providing a sample likely to contain Venturia inaequalis DNA comprises the following steps: (i) provide a sample likely to include at least one strain of Venturia inaequalis, (ii) extract the DNA present in the sample provided in step (i), to obtain a sample likely to include Venturia inaequalis DNA. The sample likely to include at least one strain of Venturia inaequalis may be taken by any method well known to a person skilled in the art. A sample likely to contain at least one strain of Venturia inaequalis can be collected from the air, for example using one or more spore traps, particularly placed near an apple tree, such as in the center of an orchard or nursery, or distributed across the surface of an orchard or on the ground, and / or collected from apple tree leaves and / or fruit. DNA can, for example, be extracted from symptomatic tissues, such as fruit and / or leaf tissue. The strain(s) of Venturia inaequalis are preferably present in the sample in the form of spores and / or mycelium, for example on or in plant tissues (leaves and / or fruits). The sample likely to include at least one strain of Venturia inaequalis therefore preferably includes spores of Venturia inaequalis and / or one or more apple tree tissues. DNA extraction is carried out by any suitable method well known to those skilled in the art, for example using a commercial DNA extraction kit or a manual extraction method, such as DNA extraction with CTAB (hexadecyltrimethylammonium bromide). Step b) Step b) includes or consists of determining whether the DNA present in the sample includes at least one virulence polymorphism and, optionally, a marker of the presence of V. inaequalis. The virulence polymorphism is preferably an allele comprising or consisting of a sequence selected from the group consisting of the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 or a promoter comprising or consisting of the sequence SEQ ID NO: 7 or SEQ ID NO: 8. In a preferred embodiment, step b) thus includes determining whether the DNA present in the sample includes an allele comprising or consisting of the sequence SEQ ID NO: 1, an allele comprising or consisting of SEQ ID NO: 2, an allele comprising or consisting of SEQ ID NO: 3, an allele comprising or consisting in SEQ ID NO: 4, an allele comprising or consisting of SEQ ID NO: 5, an allele comprising or consisting of SEQ ID NO: 6, a promoter comprising or consisting of the sequence SEQ ID NO: 7 and / or a promoter comprising or consisting of the sequence SEQ ID NO: 8. In a preferred embodiment, the presence of at least one virulence polymorphism in said DNA is determined by the presence of at least one virulence marker, in particular a virulence marker as defined above or a combination of virulence markers as defined above. Preferably, step b) thus includes determining whether said DNA includes at least one virulence marker, in particular a virulence marker as defined above or a combination of virulence markers as defined above. The method according to the invention thus advantageously allows for the specific detection of an allele or promoter conferring a virulent character. Step b) as defined above preferably includes a step to check for the presence of DNA from a strain of Venturia inaequalis. This step of checking for the presence of DNA from a strain of Venturia inaequalis includes, for example, determining whether the DNA present in the sample is Venturia inaequalis DNA. This step of checking for the presence of DNA from a Venturia inaequalis strain includes, for example, determining whether a sequence common to virulent and avirulent strains is present in the sample, for example the sequence of an RPL4 housekeeping gene. The marker for the presence of V. inaequalis is therefore used as a control marker in the detection method defined above. The marker for the presence of V. inaequalis is, for example, a polynucleotide comprising all or part of the sequence of the RPL4 gene of V. inaequalis, for example comprising all or part of the sequence SEQ ID NO: 9. In order to determine whether the DNA present in the sample includes at least one virulence polymorphism, any technique well known to those skilled in the art may be used, such as sequencing all or part of the promoter sequence of the avrulence gene AvrRvi6 and / or the sequence of the allele present at the AvrRvi6 locus and / or a DNA amplification technique, preferably isothermal amplification. Non-limiting examples of DNA amplification include PCR, quantitative PCR, isothermal quantitative PCR, LAMP (Loop-Mediated Amplification) and / or Qprobe combined or not with the LAMP technique, RPA (Recombinase Polymerase Amplification). The LAMP method is an isothermal amplification method that exhibits a very high level of specificity, due to the use of 6 primers, and is generally very rapid. Amplification detection using the LAMP method can be performed by electrophoresis, turbidimetry, electrochemistry, or colorimetry. The RPA method is an isothermal amplification method performed at low temperature. Detection of the amplification by the RPA method is often carried out by fluorescence, using, for example, fluorescent probes or intercalating agents. When a DNA amplification technique is used, at least one pair of primers capable of amplifying a virulence marker as defined above and, optionally, at least one pair of primers capable of amplifying a marker of the presence of V. inaequalis as defined above, is / are used. The primer pair capable of amplifying a virulence marker allows, for example, obtaining: an amplified fragment from the DNA of a virulent strain, but not to starting from the DNA of an avirulent strain, an amplified fragment from the DNA of an avirulent strain, but not to starting from the DNA of a virulent strain, or an amplified fragment from the DNA of a virulent strain of a size different from that amplified from the DNA of an avirulent strain. The sense primer and / or the antisense primer can, for example, hybridize at the level of a virulence marker, in particular when the polymorphism at the level of said marker results from one or more substitutions and / or deletions and / or insertions of nucleotide. Alternatively, the sense primer and / or the antisense primer can hybridize around a virulence marker, particularly when the polymorphism at said marker results from at least one deletion and / or addition of nucleotide(s). It is possible to use a pair of primers to determine the presence of a given virulence marker. In an advantageous embodiment, the same pair of primers can be used to determine the presence of several given virulence markers, for example by amplifying fragments of different sizes. The markers of virulence and presence of V. inaequalis are notably as defined above. Step c) In step c), if at least one virulence polymorphism is detected in step b), it is inferred that the sample provided in step a) includes a virulent strain of Venturia in- aequalis. In step c), if a marker for the presence of V. inaequalis is detected but none of the virulence polymorphisms are detected in step b), it is deduced that the sample provided in step a) does not include a virulent Venturiainaequalis strain corresponding to the virulence polymorphisms tested. If no DNA from a Venturia inaequalis strain is detected in the sample, then the sample does not include a Venturia inaequalis strain. Preventive and / or curative treatment method for apple trees The present invention also relates to a method for the preventive and / or curative treatment of apple trees comprising the Rvi6 resistance gene, making it possible in particular to reduce the frequency and / or quantity of plant protection product applied against Venturia inaequalis, comprising: the implementation of steps a) to c) of the method as defined above detection of the presence of a virulent strain of Venturiainaequalis in a sample, and the application of preventive and / or curative treatment if the sample provided to step a) includes a virulent strain of Venturiainaequalis. The method for detecting the presence of a virulent strain of Venturiainaequalis according to the invention can thus serve as a decision-making tool to determine whether the application of preventive and / or curative treatment is necessary. Preventive and / or curative treatment is preferably carried out around the area from which the sample was taken, for example in a nursery, in the orchard or on the farm around the area from which the sample was taken where other trees carrying the Rvi6 resistance gene are planted. Preventive and / or curative treatment includes, for example, the application of an appropriate plant protection product against Venturia inaequalis, such as, for example, a fungicide. The fungicide is chosen, for example, from a copper-based fungicide or a fungicide belonging to the strobilurin or anilinopyrimidine family. The present invention also relates to a method for evaluating the quality of an apple tree seedling, particularly before its commercialization, comprising the following steps: the implementation of steps a) to c) of the method as defined above detection of the presence of a virulent strain of Venturiainaequalis in a sample, the sample provided in step a) being taken from the air around said plant and / or on all or part of said plant, and if no virulence polymorphism is detected in step b), deduce that The plant is not contaminated by a virulent strain of Venturia inaequalis. including the virulence polymorphism sought in step b). In the above method, if (i) no allele comprising or consisting of the sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, and no promoter comprising or consisting of the sequences SEQ ID NO: 7 and SEQ ID NO: 8 is detected in step a) and (ii) if DNA from a strain of Venturia inaequalis is detected in the sample, it is inferred that the plant is not contaminated by a virulent strain of Venturia inaequalis comprising the virulence polymorphism. Geographic mapping method for the virulence of Venturia inaequalis The present invention also relates to a method for mapping the virulence of Venturiainaequalis comprising the following steps: implement steps a) to c) of the method as defined above of detection of the presence of a virulent strain of Venturiainaequalis in a sample, from at least two samples taken from areas different geographical areas, - to deduce that the geographical area from which a sample containing a virulent strain of Venturiainaequalis originates is a virulence zone and that the geographical area from which a sample not containing a virulent strain of Venturiainaequalis originates is a virulence-free zone. The geographical area can, for example, be an orchard, a farm, a production basin, a region, a country, a continent and / or an island. Ki î ] , he of Venturia i lis virul The present invention also relates to a kit for detecting the presence of a virulent strain of Venturia inaequalis in a sample, said kit comprising means for amplifying at least one virulence marker as defined above and, optionally, at least one marker of the presence of Venturia inaequalis as defined above. The kit may, for example, include means to amplify the markers of the combination of at least two virulence markers and, optionally, at least one marker of the presence of V. inaequalis as defined above. The means of amplifying a marker include, for example, at least one pair of primers specific to said marker(s) and are, for example, as defined above. Use of a ma irul, a combination of virulence markers, or the kit for detecting the presence of a Venturia inavi strain The present invention also relates to the use of a virulence marker as defined above, a combination of at least two virulence markers and, optionally, at least one marker of the presence of V. inaequalis as defined above, and / or a kit as defined above to detect the presence of a virulent strain of Venturia inaequalis or to determine if a strain of Venturia inaequalis is virulent or avirulent. The use as defined above allows, for example, to determine geographical areas of virulence or avirulence, to assess whether a fungicide treatment is necessary, to assess the quality of an apple tree and / or apple fruit, for example before marketing in France or for export, and / or to assess whether virulence is present in a given territory to help in the decision to plant or not apple varieties carrying the Rvi6 resistance gene. Other features and advantages of the invention will become clearer from the following examples, which are given by way of illustration and not limitation. Sequence listing The SEQ ID NO: 1 sequence is the sequence of an allele conferring a virulent characteristic, such as that present in strain 2199, The SEQ ID NO: 2 sequence is the sequence of an allele conferring a virulent character, such as is present in the NL24 strain. The SEQ ID NO: 3 sequence is the sequence of an allele conferring a virulent character, such as is present in strain 1180. The SEQ ID NO: 4 sequence is the sequence of an allele conferring a virulent character, such as is present in strain 2476. The SEQ ID NO: 5 sequence is the sequence of an allele conferring a virulent character, such as is present in strain 1153. The SEQ ID NO: 6 sequence is the sequence of an allele conferring a virulent character, such as is present in strain 08M205. The SEQ ID NO: 7 sequence is an example of a virulent AvrRvi6 gene promoter sequence, as seen in strain 1286. The SEQ ID NO: 8 sequence is an example of a virulent AvrRvi6 gene promoter sequence, as seen in strain 2207. The sequence SEQ ID NO: 9 is the sequence of the housekeeping gene RPL4 of Venturia in-aequalis. The SEQ ID NO: 10 and 11 sequences correspond respectively to the sense and antisense primer sequences of a primer pair used for the detection of the RPLA housekeeping gene of Venturia inaequalis. The SEQ ID NO: 12 and 13 sequences correspond respectively to the sense and antisense primer sequences of a primer pair used for the detection of a virulent strain of Venturia inaequalis. The SEQ ID NO: 14 sequence is an example of an AvrRvi6 gene promoter sequence conferring an avirulent character, as present in strain EUBO4. The SEQ ID NO: 15 sequence is the sequence of an allele conferring a trait avirulent, as present in the EUBO4 strain. Figures [Fig. 1] Figure 1 shows the results of quantitative PCR amplification of the genomic DNA of the avirulent strain EUBO4 at the AvrRvi6 locus using SEQ ID primers NO: 12 and 13. The different curves correspond to a dilution range. The signal obtained in RFU (Relative Fluorescence Units) is given as a function of the number of PCR cycles. [Fig. 2] Figure 2 shows the results of quantitative PCR amplification of DNA from virulent strain 2199 at the AvrRvi6 locus using SEQ ID primers NO: 12 and 13. The different curves correspond to a dilution range. The signal obtained in RFU (Relative Fluorescence Units) is given as a function of the number of PCR cycles. [fig.3] Fig.3 shows the melting curves of the amplicons of the AvrRvi6 locus in the virulent strain 2199 and the avirulent strain EUBC4 using primers SEQ ID NO: 12 and 13. The signal obtained in —d(RFU) / dT is given as a function of temperature in Celsius. EXAMPLES Example 1: Analysis of polymorphism at the avirulence locus (RRVi6) Materials and Methods The avirulence gene AvrRvi6, which interacts with the resistance gene Rvi6, was cloned, and then the allelic polymorphism at the AvrRvi6 locus and at its promoter was analyzed on 150 strains of V. inaegualis from orchards and wild apple trees. Results This analysis has made it possible to highlight different polymorphisms associated with the virulent character and different polymorphisms associated with the avirulent character of Venturia inaequalis. Sequences SEQ ID NO: 1 to 6 are examples of alleles conferring virulence. Sequences SEQ ID NO: 7 and 8 are examples of AvrRvi6 promoter sequences associated with virulence. This polymorphism analysis showed that the virulent strains detected in European orchards have alleles at the AvrRvi6 locus shared by Malus present in uncultivated areas, thus confirming that wild apple trees are the reservoirs of virulence responsible for this bypassing of resistance. Furthermore, the absence of observed new cases of resistance bypass in orchards means that it is possible to develop a tool to specifically and comprehensively detect virulence against the resistance gene Rvi6 in apple orchards from alleles identified within the virulent population present in the uncultivated compartment. Example 2: Method for detecting the presence of a virulent strain of Venturia inaequalis Materials and methods The genomic DNA of the strain to be tested is extracted from spores. The extraction is carried out according to the protocol of the Nucleospin Food kit (Macherey Nagel). The AvrRvi6 locus is detected by quantitative PCR using the following reaction mixture for a reaction: 3.75ul MesaBlue 2X (Eurogentec) 0.3 July primer application at 10uM (i.e. final concentration = 200 nM) of sequence SEQ ID NO: 12: CGATCCTTTTCGCACAGTCT (Eurofins) 0.3 μl of antisense primer at 10uM of sequence SEQ ID NO: 13: CTCAGTTG- CATTGGCTTCGT (Eurofins) 3 ul diluted genomic DNA of Venturia inaequalis Qsp 15ul H,0 The quantitative PCR program used is as follows (using a Biorad CFX connect instrument): 1. 95°C 5 minutes 2.95°C 3 seconds 3. 60°C 1 minute + license plate reading 4. Repeat steps 2 to 3, 39 times 5. Melting curve from 55°C to 90°C in steps of 0.5°C / 5s + license plate reading Results The results obtained are presented in figures | to 3. Figures 1 and 2 show that the method used allows the alleles of the avirulent strain B04 and the virulent strain 2199 to be amplified respectively at the AvrRvi6 locus. Figure 3 shows that the fusion curves of the two alleles are different, reflecting a nucleotide deletion in the virulent strain compared to the avirulent strain. The virulence allele carried by strain 2199 differs from the avirulence allele carried by strain B04 by a deletion of 155 base pairs. The detection method according to the invention therefore makes it possible to detect the presence of a virulent strain of Venturia inaequalis.

Claims

Demands

1. Method for detecting the presence of a Venturia strain in- virulent aequalis in a sample, comprising: a. provide a sample likely to include DNA from Venturia inaequalis, b. determine if the DNA present in the sample includes at minus a virulence polymorphism, c. if at least one virulence polymorphism is detected at Step b), deduce that the sample provided in step a) includes a virulent strain of Venturiainaequalis, characterized in that the virulence polymorphism is an allele comprising or consisting of a selected sequence from the group consisting of the sequence SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 or one promoter comprising or consisting of the sequence SEQ ID NO: 7 or SEQ ID NO:

8.

2. Method according to claim 1, characterized in that step b) includes determining whether the DNA contains at least one marker of virulence selected from the group consisting of: a fragment of the SEQ ID NO: 1 sequence comprising the nu- cleotides 155 to 165 of said sequence SEQ ID NO: 1, a fragment of the SEQ ID NO: 2 sequence comprising the nu- cleotide 62 of said sequence SEQ ID NO: 2, a fragment of the SEQ ID NO: 3 sequence comprising the nu- cleotide 160 of said sequence SEQ ID NO: 3, a fragment of the SEQ ID NO: 4 sequence including the nu- cleotide 192 of said sequence SEQ ID NO: 4, a fragment of the SEQ ID NO: 5 sequence comprising the nu- cleotide 201 of said sequence SEQ ID NO: 5, a fragment of the SEQ ID NO: 6 sequence including the nu- cleotide 304 of said sequence SEQ ID NO: 6, a fragment of the SEQ ID NO: 7 sequence including the nu- cleotide 189, nucleotides 304 to 316 and / or nucleotides 480 to 490 of said sequence SEQ ID NO: 7, and a fragment of the SEQ ID NO: 8 sequence including the nu- nucleotide 572 of said sequence SEQ ID NO: 8, the nucleotide 706 of said sequence SEQ ID NO: 8, nucleotides 548 to 557 of said sequence SEQ ID NO: 8 and / or 15 nucleotides consecutive included between nucleotides 139 to 420 of said SEQ sequence ID NO:

8.

3. A method for the preventive and / or curative treatment of apple trees comprising the Rvi6 resistance gene allowing a reduction in the frequency and / or the quantity of plant protection product applied against Venturia inaequalis, including: implement steps a) to c) of the method according to the re- demand 1 or 2, Apply an appropriate plant protection product against Venturia inaequalis if the sample provided in step a) includes a virulent strain of Venturiainaequalis.

4. Method for evaluating the quality of an apple tree seedling, comprising the following steps: implement steps a) to c) of the method according to the re- claim 1 or 2, the sample provided in step a) being taken from the air around said plant and / or on all or part of said plant, if no virulence polymorphism is detected at the stage b) deduce that the plant is not contaminated by a strain of virulent Venturia inaequalis including the poly- virulence morphism sought in step b).

5. Method for mapping the virulence of Venturiainaequalis including the following steps: implement steps a) to c) of the method according to the re- claim 1 or 2, based on at least two samples taken from different geographical areas, to deduce that the geographical area from which a sample including a strain of Venturiainaequalis virulent is a zone of virulence and that the geo- zone graph from which a sample is taken not including no virulent strain of Venturiainaequalis is an area free from virulence.

6. Kit for the detection of the presence of a strain of Venturiainaequalis virulent in a sample, said kit including means for amplify at least one virulence marker, said virulence marker comprising or consisting of: a fragment of the SEQ ID NO: 1 sequence comprising the nu- cleotides 155 to 165 of said sequence SEQ ID NO: 1, a fragment of the SEQ ID NO: 2 sequence comprising the nu- cleotide 62 of said sequence SEQ ID NO: 2, a fragment of the SEQ ID NO: 3 sequence comprising the nu- cleotide 160 of said sequence SEQ ID NO: 3, a fragment of the SEQ ID NO: 4 sequence including the nu- cleotide 192 of said sequence SEQ ID NO: 4, a fragment of the SEQ ID NO: 5 sequence comprising the nu- cleotide 201 of said sequence SEQ ID NO: 5, a fragment of the SEQ ID NO: 6 sequence including the nu- cleotide 304 of said sequence SEQ ID NO: 6, a fragment of the SEQ ID NO: 7 sequence including the nu- cleotide 189, nucleotides 304 to 316 and / or nucleotides 480 to 490 of said sequence SEQ ID NO: 7, or a fragment of the SEQ ID NO: 8 sequence including the nu- nucleotide 572 of said sequence SEQ ID NO: 8, the nucleotide 706, nucleotides 548 to 557 of said SEQ ID sequence NO: 8 and / or 15 consecutive nucleotides included between the nu- cleotides 139 to 420 of said sequence SEQ ID NO: 8, said fragment comprising at least 15 nucleotides, and said means to amplify a virulence marker including at minus a pair of specific primers for said marker.

7. Use of a kit according to claim 6, to detect the presence of a virulent strain of Venturiainaequalis or to determine if a Venturia inaequalis strain is virulent or avirulent, preferably to determine geographical areas of virulence, to assess whether fungicide treatment is necessary, to assess the quality of an apple tree and / or apple fruit and / or to assess whether virulence is present in a given territory to help in the decision to plant or not apple varieties carrying the Rvi6 resistance gene.