Composition for the care of keratinous materials comprising at least indole-3-lactic acid, indole-3-carboxaldehyde, indole-3-acetic acid and an adjuvant, uses and process implementing the composition

Abstract

Composition for the care of keratinous materials comprising at least indole-3-lactic acid, indole-3-carboxaldehyde, indole-3-acetic acid and an adjuvant, uses and method implementing the composition. The present invention relates to a composition comprising, in a physiologically acceptable medium: at least indole-3-lactic acid; indole-3-carboxaldehyde; indole-3-acetic acid; and / or one of their salts; and at least one adjuvant.It also covers the use of such a composition to prevent a decrease and / or strengthen the skin barrier function in an individual, to improve skin hydration, to improve skin quality, particularly dry skin, to prevent and / or treat cosmetic signs associated with dry skin, particularly selected from tightness, itching, discomfort, dull complexion, skin roughness, and marked skin microrelief, and / or to prevent and / or treat pruritus, particularly pruritus in skin affected by a dermatological disorder such as atopic dermatitis, and / or to prevent and / or treat atopic dermatitis. A non-therapeutic cosmetic process for the care of keratinous materials, comprising at least one step of topical application of such a composition to said keratinous materials, is also covered. Figure for the abstract: None.

Description

Title of the invention: Composition for the care of keratin materials comprising at least indole-3-lactic acid, indole-3-carboxaldehyde, indole-3-acetic acid and an adjuvant, uses and method implementing the composition Technical field

[0001] The present invention relates to the use of a mixture of indoles to improve the barrier function and hydrate the skin.

[0002] More particularly, the present invention aims to provide a composition, in particular a cosmetic composition, in particular for the care of keratin materials, comprising, in a physiologically acceptable medium: - at least indole-3-lactic acid and / or one of its salts; indole-3-carboxaldehyde and / or one of its salts; and indole-3-acetic acid and / or one of its salts; and - at least one adjuvant chosen from the group consisting of fatty substances; organic solvents chosen from lower monoalcohols having from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether; ionic or non-ionic, hydrophilic or lipophilic thickeners; softeners; opacifiers; stabilizers; silicones; anti-foaming agents; perfumes; preservatives; anionic, cationic, non-ionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and their mixtures.

[0003] It also relates to the cosmetic use, in particular topical, of such a composition to prevent a reduction and / or strengthen the skin barrier function in an individual.

[0004] It also relates to the cosmetic use, in particular topical, of such a composition to improve the hydration of the skin.

[0005] It also relates to the cosmetic use, in particular topical, of such a composition to improve the quality of the skin, in particular dry skin.

[0006] It also relates to the cosmetic use, in particular topical, of such a composition for preventing and / or treating the cosmetic signs associated with dry skin, in particular chosen from tightness, itching, feelings of discomfort, dull complexion, roughness of the skin and marked microrelief of the skin.

[0007] It also concerns the cosmetic use, in particular topical, of such a composition for preventing and / or treating pruritus, in particular pruritus in skin affected by a dermatological disorder such as atopic dermatitis.

[0008] It also relates to the cosmetic use, in particular topical, of such a composition for preventing and / or treating atopic dermatitis.

[0009] Finally, it relates to a non-therapeutic cosmetic process for caring for keratin materials, in particular the skin, in particular dry skin, comprising the topical application to these keratin materials of such a composition. Prior art

[0010] The skin is a tissue whose cells are joined together and integral with each other. The cutaneous tissue forms an external covering including sebaceous or sweat glands, and hair follicles. The skin is a continually renewing epithelium. Renewal, or desquamation, is a coordinated and finely regulated process resulting in the elimination of superficial cells, in a manner that is imperceptible and invisible.

[0011] Human skin is made up of two compartments, namely a superficial compartment, the epidermis, and a deep compartment, the dermis.

[0012] The epidermis is conventionally divided into a basal layer of keratinocytes constituting the germinative layer of the epidermis, a so-called spinous layer consisting of several layers of polyhedral cells arranged on the germinative layers, one to three so-called granular layers consisting of flattened cells containing distinct cytoplasmic inclusions, the keratohyaline grains and finally, a set of upper layers called horny layers (or stratum corneum), consisting of keratinocytes at the terminal stage of their differentiation called comeocytes. The organization and especially the cohesion of these different cellular layers is made possible by a set of intercellular junctions including adherens junctions which participate in maintaining the homeostasis of the epithelial tissue. These adherens junctions are notably called desmosomes. Desmosomes are composed of transmembrane proteins of the cadherin family such as desmoglein. These junctions play an essential role in the structure, maintenance and architectural cohesion of the epidermis and allow the transmission and damping of mechanical forces exerted on the keratinocytes. These adherens junctions are found mainly in the intermediate layers of the epidermis up to the most superficial layers, namely the stratum corneum composed of corneocytes.

[0013] Corneocytes are anucleated cells mainly composed of a fibrous material containing cytokeratins, surrounded by a horny envelope consisting in particular of the protein filaggrin. Filaggrin aggregates the keratin filaments into macrofibrils in the lower part of the horny layer. When it approaches the On the skin surface, filaggrin is primarily degraded into free amino acids, which form a major part of a highly hygroscopic complex, the Natural Moisturing Factor (NMF). NMF is important for maintaining stratum corneum hydration and skin suppleness.

[0014] There is a constant production of new keratinocytes to compensate for the continuous loss of epidermal cells at the level of the horny layer according to a mechanism called desquamation.

[0015] However, an imbalance between the production of cells at the level of the basal layer and the rate of desquamation can in particular lead to the formation of scales on the surface of the skin.

[0016] Similarly, a deficiency in terminal differentiation of stratum corneum cells, for various reasons, can lead to the formation of large, thick, visible to the naked eye, clusters of cells called "squames", or in other situations, to a thinning of the stratum corneum.

[0017] Furthermore, a reduction in the entire junction system responsible for cell-cell cohesion has the direct consequence of reducing the effectiveness of the skin barrier function.

[0018] Thus, one or more of these internal factors may result in a fragility of the barrier properties of the epidermis, chronic dehydration of the stratum corneum, a loss of mechanical elasticity, tightness, as well as a lack of radiance and transparency of the skin.

[0019] At the same time, a fragility of the skin barrier can also occur in the presence of external aggressions, notably chosen from irritant agents (detergents, acids, bases, oxidants, reducers, concentrated solvents, harmful gases or fumes), thermal or climatic imbalances (cold, dryness, radiation), xenobiotics (undesirable microorganisms, allergens, pollutants).

[0020] One of the critical steps in the terminal differentiation process of the stratum corneum is the crosslinking of the protein precursors of the cornified envelope (CE). This phenomenon plays an essential role in the development and maintenance of skin cohesion, physical properties of the skin such as barrier function, and is a crucial step in the terminal differentiation process. The cornified envelope is an essential component of comeocytes.

[0021] Conventionally used moisturizing active ingredients, such as humectants, moisturizing polymers or occlusive fatty substances such as petroleum jelly, temporarily modify the surface properties of the skin. These active ingredients can lead to mechanical softening of the stratum corneum, an increase in its hydration state and / or an improvement in the microrelief of the skin by the formation of a film on the surface of the skin. However, these effects are not necessarily very long-lasting and disappear appear after cleansing the skin. In addition, these active ingredients can be removed by cleansing actions.

[0022] To overcome these drawbacks, it may be interesting to turn to active ingredients having a beneficial action on biological pathways and biomarkers involved in the skin barrier function.

[0023] In addition to the key factors involved in the skin barrier function mentioned above, which include filaggrin and adherens junctions (desmoglein), the metabolic pathway of tryptophan, namely the Aryl Hydrocarbon Receptor (AhR) pathway, is of particular interest. Indeed, this pathway is known to be involved in various skin disorders such as accelerated aging and inflammation (Parrado, C. et al. Front. Pharmacol. 10, (2019); Krutmann, J. Dermatol. Sci. 85, 152-161 (2017); Vogeley, C., Int. J. Mol. Sci. 20, (2019).- Hidaka, T., Front. Med. 6, (2019); Stockinger, B Annu. Rev. Immunol. 32, 403-432 (2014)).

[0024] It is also known to be essential for the integrity of the skin barrier (Haas, K. et al. J. Invest. Dermatol. 136, 2260-2269 (2016)) and its activation, in particular by the CYP1A1 and / or OVOL1 genes, makes it possible to improve the skin barrier in the context of atopic dermatitis (Furue, M., Hashimoto-Hachiya, A. & Tsuji, G. Int. J. Mol. Sci. 20, (2019)).

[0025] Thus, there is a need to identify new active agents that can stimulate not only the tryptophan metabolic pathway, namely the Aryl Hydrocarbon Receptor (AhR) pathway, but also the stimulation of the expression of filaggrin and / or adherens junctions such as desmoglein.

[0026] There is a need for active ingredients that enable the skin, particularly dry skin, to maintain its role as a barrier function.

[0027] There is a need for active ingredients that can prevent the reduction and / or strengthen the skin barrier function in an individual.

[0028] There is also a need for active ingredients to improve skin hydration.

[0029] There is also a need for active ingredients that can improve the quality of the skin, particularly dry skin.

[0030] There is also a need for active ingredients that can prevent and / or treat the cosmetic signs associated with dry skin, in particular chosen from tightness, itching, feelings of discomfort, dull complexion, roughness of the skin and marked microrelief of the skin.

[0031] There is also a need for active agents allowing the prevention and / or treatment of pruritus, in particular pruritus in skin affected by a dermatological disorder such as atopic dermatitis.

[0032] There is also a need for active ingredients enabling prevention and / or treatment of atopic dermatitis. Statement of the invention

[0033] The present invention aims to solve the aforementioned technical problems.

[0034] Indeed, the inventors have now discovered that a mixture of indoles according to the present invention makes it possible to overexpress the genes for the activation of the AhR pathway (in particular the CYP1A1 and / or OVOL1 genes described by Furue et al. Int. J. Mol. Sci. 20, (2019)) and the genes for the stimulation of epidermal differentiation (FLG - Fi-laggrin, and / or DSG1 - Desmoglein 1), and thus to prevent the reduction and / or strengthen the skin barrier function in an individual. It is therefore of interest in improving the barrier function and hydration of the skin. Summary of the invention

[0035] Thus, according to a first aspect, the present invention relates to a composition, in particular a cosmetic composition, in particular for the care of keratin materials, comprising, in a physiologically acceptable medium: - at least indole-3-lactic acid and / or one of its salts; indole-3-carboxaldehyde and / or one of its salts; and indole-3-acetic acid and / or one of its salts; and - at least one adjuvant chosen from the group consisting of fatty substances; organic solvents chosen from lower monoalcohols having from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether; ionic or non-ionic, hydrophilic or lipophilic thickeners; softeners: opacifiers; stabilizers; silicones; anti-foaming agents; perfumes; preservatives; anionic, cationic, non-ionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and their mixtures.

[0036] By "polyol" suitable for the invention is meant a compound of alkyl type, linear, branched or cyclic, saturated or unsaturated, bearing on the alkyl chain at least two -OH functions, in particular at least three -OH functions, and more particularly at least four -OH functions.

[0037] The polyols suitable for the formulation of a composition according to the present invention are in particular those having in particular from 2 to 32 carbon atoms, preferably from 3 to 16 carbon atoms.

[0038] As illustrated in the examples below, the Applicant has surprisingly discovered that a composition according to the invention, comprising at least indole-3-lactic acid and / or one of its salts; indole-3-carboxaldehyde and / or one of its salts; and indole-3-acetic acid and / or one of its salts, makes it possible to overexpress the genes for activating the AhR pathway (in particular the CYP1A1 and / or 0V0L1 genes) and stimulate differentiation (FLG - Filaggrin and / or DSG1 - Desmoglein), and thus to prevent the reduction and / or strengthen the barrier function of the skin. This discovery is the basis of the present invention (see for example Hoober JK, Eggink LL. Int J Mol Sci. 2022 Jan 27;23(3):1455).

[0039] Filaggrin (FLG) is indeed a major structural protein involved in the skin surface barrier. Mutations in the gene encoding filaggrin are the most important risk factors for skin diseases. Approximately 50% of patients with atopic dermatitis carry loss-of-function mutations in filaggrin. Esparza-Gordillo et al. (Curr Opin Allergy Clin Immunol. 2010 Oct;10(5):418-26) reported that 10-20% of people in industrialized countries suffer from atopic dermatitis, with a strong predisposition in children when the mother is a carrier of an FLG mutation. The FLG gene mutation is also associated with ichthyosis vulgaris, which is a common skin disease characterized by dry, scaly skin, with a prevalence of at least one case per 250 people.

[0040] Furthermore, DSG1 encodes desmoglein 1, a major constituent of desmosomes, which connect the cell surface to the keratin cytoskeleton and play a crucial role in maintaining epidermal integrity and barrier function. Mutations causing SAM syndrome (Severe Dermatitis-Multiple Allergies-Metabolic Cachexia Syndrome), a psoriasiform dermatitis, result in a lack of membrane expression of DSG1, leading to a loss of cell-cell adhesion (Oh, J. et al. Nature 514, 59-64 (2014)). Desmoglein 1 deficiency results in severe dermatitis, multiple allergies, and loss of metabolism (Samuelov L et al. Nat Genet. 2013 Oct;45(10):1244-1248; Lisa M Godsel et al. J Clin Invest. 2022 Feb 1;132(3):el44363.).

[0041] These two proteins are therefore key in the role of barrier to the skin.

[0042] A composition according to the invention may further comprise tryptamine and / or one of its salts, in particular in a content of at least 0.00001% by weight relative to the total weight of the composition, and more particularly of at least 0.0001% by weight relative to the total weight of the composition.

[0043] A composition according to the invention may furthermore be characterized in that it comprises: - a content of indole-3-lactic acid, and / or one of its salts, of at least 0.00001% by weight relative to the total weight of the composition, in particular of at least 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-carboxaldehyde, and / or one of its salts, of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-acetic acid, and / or one of its salts, of at least 0.000002% by weight relative to the total weight of the composition, in particular of at least 0.00001% by weight relative to the total weight of the composition.

[0044] A composition according to the invention may be such that the sum of the contents of indole-3-lactic acid, indole-3-carboxaldehyde and indole-3-acetic acid, and / or one of their salts, represents at least 0.0001% by weight relative to the total weight of the composition.

[0045] A composition according to the invention may be such that the sum of the contents of indole-3-lactic acid, indole-3-carboxaldehyde and indole-3-acetic acid, and / or one of their salts, is between 0.0001% and 10% by weight, in particular between 0.0001% and 1%, more particularly between 0.0001% and 0.1%, even more particularly between 0.0001% and 0.01% by weight relative to the total weight of the composition, such as for example 0.00011% by weight relative to the total weight of the composition.

[0046] A composition according to the invention may further comprise: - a content of indole-3-lactic acid, and / or one of its salts, ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly ranging from 0.0001% to 0.1%, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, in particular 0.0001% by weight relative to the total weight of the composition; - a content of indole-3-carboxaldehyde, and / or one of its salts, ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight, more particularly ranging from 0.0001% to 0.1%, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, in particular 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-acetic acid, and / or one of its salts, ranging from 0.000002% to 10% by weight, in particular ranging from 0.00001% to 1% by weight, more particularly ranging from 0.00001% to 0.1% by weight, even more particularly ranging from 0.00001% to 0.01% by weight relative to the total weight of the composition, in particular 0.00001% by weight relative to the total weight of the composition.

[0047] A composition according to the invention may comprise a content of tryptamine and / or one of its salts of at least 0.00001% by weight relative to the total weight of the composition, and more particularly of at least 0.0001% by weight relative to the total weight of the composition.

[0048] A composition according to the invention may in particular be such that the mass ratio [indole-3-lactic acid and / or one of its salts / indole-3-carboxaldehyde and / or one of its salts] is between 0.5 and 50, in particular between 1 and 10, in particular 1.

[0049] A composition according to the invention may in particular be such that the mass ratio [indole-3-carboxaldehyde and / or one of its salts / indole-3-acetic acid and / or one of its salts] is between 0.5 and 150, in particular between 1 and 100, more particularly between 1 and 10, in particular 1 or 10.

[0050] A composition according to the invention may in particular be such that the mass ratio [indole-3-lactic acid and / or one of its salts / indole-3-acetic acid and / or one of its salts] is between 0.5 and 50, in particular between 1 and 10, in particular 1.

[0051] A composition according to the invention may in particular be such that the mass ratio [indole-3-lactic acid and / or one of its salts / indole-3-carboxaldehyde and / or one of its salts / indole-3-acetic acid and / or one of its salts] is between 1:1:1 and 10:10:1.

[0052] A composition according to the invention may in particular be such that the mass ratio [indole-3-lactic acid and / or one of its salts / indole-3-carboxaldehyde and / or one of its salts / indole-3-acetic acid and / or one of its salts / tryptamine and / or one of its salts] is between 1:1:1:1 to 10:10:1:10, preferably between 1:1:1:1 to 10:10:1:1.

[0053] In particular, a composition according to the invention may comprise a culture supernatant, or a fraction of culture supernatant, of at least one bacterial strain of the species Staphylococcus epidermidis chosen from the group consisting of bacteria deposited with the CNCM under the order numbers 1-5689 (deposited by L'Oréal with the CNCM on June 3, 2021), 1-5904 (deposited by L'Oréal with the CNCM on September 21, 2022), 1-5691 (deposited by L'Oréal with the CNCM on June 3, 2021), I-5693 (deposited by L'Oréal with the CNCM on June 3, 2021), 1-5694 (deposited by L'Oréal with the CNCM on June 7, 2021) and 1-5695 (deposited by L'Oréal with the CNCM on June 7, 2021).

[0054] A composition according to the invention may in particular be adapted to topical administration.

[0055] The invention also relates to the cosmetic use, in particular topical use, of a composition according to the invention to prevent a reduction and / or strengthen the skin barrier function in an individual. An individual within the meaning of the present invention is preferably a human being.

[0056] The invention further relates to the cosmetic use, in particular topical use, of a composition according to the invention to improve the hydration of the skin.

[0057] The invention relates to the cosmetic use, in particular topical use, of a composition according to the invention to improve the quality of the skin, in particular dry skin.

[0058] Dry skin appears rough to the touch and appears covered in scales and is mainly manifested by a feeling of tightness and / or tension. Dry skin is in fact generally accompanied by flaking.

[0059] On a physiological level, dry skin is often associated with a drop in the skin's hydration level and an alteration of the barrier function, measured by insensible water loss. On a sensory level, it is characterized by sensations of tightness and / or skin tension.

[0060] Dry skin, also called "xerosis", can appear at any age, and may not be linked to a pathological condition.

[0061] The invention also relates to the cosmetic use, in particular topical use, of a composition according to the invention for preventing and / or treating the cosmetic signs associated with dry skin, in particular chosen from tightness, itching, feelings of discomfort, dull complexion, roughness of the skin and marked microrelief of the skin.

[0062] The invention further relates to the cosmetic use, in particular topical use, of a composition according to the invention for preventing and / or treating pruritus, in particular pruritus in skin affected by a dermatological disorder such as atopic dermatitis.

[0063] The invention also relates to the cosmetic use, in particular topical use, of a composition according to the invention for preventing and / or treating atopic dermatitis.

[0064] In the implementations of a composition according to the invention, the composition may in particular be adapted to topical administration.

[0065] Finally, the invention also relates to a non-therapeutic cosmetic process for caring for keratin materials, in particular the skin, in particular dry skin, comprising the topical application to these keratin materials of a composition according to the invention.

[0066] Other characteristics, aspects and advantages of the invention will appear on reading the detailed description which follows. Brief description of the drawings

[0067] [Fig.l] represents the quantification of the concentrations of total indoles in the culture supernatants of 6 of the strains tested, namely the reference strains CNCM 1-5689, 1-5904, 1-5691, 1-5693, 1-5694 and 1-5695 - namely the sum of the concentrations of ILA (indole-3-lactic acid), lAld (Indole-3-carboxaldehyde), IAA (indole-3-acetic acid) and Tryptamine.

[0068] Abscissa: from left to right: control, CNCM 1-5694, CNCM 1-5695, CNCM 1-5693, CNCM 1-5904, CNCM 1-5689 and CNCM 1-5691.

[0069] Ordinate: total indoles (Indoles) in pmol / mL.

[0070] [Fig.2] represents the expression results of the Ahr pathway markers (CYP1A1) and barrier function (FLG) in keratinocytes stimulated by FILA at different concentrations. GAPDH is a constitutive reference gene of NHEKs.

[0071] Abscissa: from left to right: 0.005pM ILA; 0.5pM ILA; 5pM ILA; 50pM ILA and 250pM ILA. For each concentration, the bars from left to right represent GAPDH, FLG then CYP1A1.

[0072] Ordinate: percentage (%) of expression of GAPDH, FLG and CYP1A1 mRNAs relative to GAPDH.

[0073] [Fig.3] represents the expression results of the Ahr pathway markers (CYP1A1) and barrier function (FLG) in keratinocytes stimulated by IAld at different concentrations. GAPDH is a constitutive reference gene of NHEKs.

[0074] Abscissa: from left to right: 0.005pM IAld; 0.5pM IAld; 5pM IAld; 50pM IAld and 250pM IAld. For each concentration, the bars from left to right represent GAPDH, FLG then CYP1A1.

[0075] Ordinate: percentage (%) of expression of GAPDH, FLG and CYP1A1 mRNAs relative to GAPDH.

[0076] [Fig.4] represents the expression results of the Ahr pathway markers (CYP1A1) and barrier function (FLG) in keratinocytes stimulated by IAA at different concentrations. GAPDH is a constitutive reference gene of NHEKs.

[0077] Abscissa: from left to right: 0.005pM IAA; 5pM IAA; 50pM IAA and 250pM IAA. For each concentration, the bars from left to right represent GAPDH, FLG then CYP1A1.

[0078] Ordinate: percentage (%) of expression of GAPDH, FLG and CYP1A1 mRNAs relative to GAPDH.

[0079] [Fig.5] represents the expression results of the Ahr pathway markers (CYP1A1) and barrier function (FLG) in keratinocytes stimulated by tryptamine at different concentrations. GAPDH is a constitutive reference gene of NHEKs.

[0080] Abscissa: from left to right: 0.005pM Tryptamine; 0.5pM Tryptamine; 5pM Tryptamine; 50pM Tryptamine and 250pM Tryptamine. For each concentration, the bars from left to right represent GAPDH, FLG then CYP1A1.

[0081] Ordinate: percentage (%) of expression of GAPDH, FLG and CYP1A1 mRNAs relative to GAPDH.

[0082] [Fig.6] represents the expression results of the Ahr pathway markers (CYP1A1) and barrier function (FLG) in keratinocytes stimulated by 1:1:1:1 mixtures of ILA, Ald, IAA and Tryptamine, at doses of 0.5 (4 x 0.5 pM), 5 (4 x 5 pM) or 50pM (4 x 50 pM) per compound. GAPDH is a constitutive reference gene of NHEKs.

[0083] Abscissa: from left to right: 4 x 0.5 pM mixture; 4 x 5 pM mixture; 4 x mixture 50 pM. For each concentration, the bars from left to right represent GAPDH, FLG and then CYP1A1.

[0084] Ordinate: percentage (%) of expression of GAPDH, FLG and CYP1A1 mRNAs relative to GAPDH.

[0085] [Fig.7] represents the expression results of the markers of the Ahr pathway (CYP1A1) and of the barrier function (FLG) in keratinocytes stimulated by two compositions comprising respectively (i) 5pM of ILA, 0.5pM of IAld and 0.5pM of IAA (5+0.5+0.5 pM) or (ii) 5pM of ILA, 0.5pM of IAld and 5pM of IAA (5+0.5+5 pM). GAPDH is a constitutive reference gene of NHEKs.

[0086] Abscissa: from left to right: 5+0.5+0.5 pM mixture; 5+0.5+5 pM mixture. For each concentration, the bars from left to right represent GAPDH, FLG then CYP1A1.

[0087] Ordinate: percentage (%) of expression of GAPDH, FLG and CYP1A1 mRNAs relative to GAPDH. Detailed description Composition according to the invention

[0088] A composition according to the invention is preferably cosmetic.

[0089] The composition according to the invention is preferentially suitable for topical application to keratin materials, in particular to the skin, and therefore comprises a physiologically acceptable medium, i.e. compatible with the skin.

[0090] By "cosmetic" is meant a composition compatible with keratin materials, in particular the skin, mucous membranes and appendages. The composition according to the invention is non-therapeutic.

[0091] By “keratin materials” is meant in particular the skin, mucous membranes, fibers, eyelashes and appendages.

[0092] By "the skin" is meant the entire skin of the body, and preferably the skin of the face, scalp, décolleté, neck, arms and forearms, or even more preferably, the skin of the face (in particular the forehead, nose, cheeks, chin), décolleté and neck.

[0093] For the purposes of the present invention, the term "physiologically acceptable" means a medium having a pleasant color, odor and feel and which does not generate unacceptable discomfort, i.e. tingling, tightness, likely to discourage the user from applying this composition.

[0094] As used herein, the terms "treat" and "treatment" are intended to mean the alleviation of symptoms associated with a specific disorder or condition and / or the elimination of said symptoms as well as the complete disappearance of the disorder or condition in question.

[0095] In the context of the present invention, the terms "prevent" and "prevention" designate the reduction to a lesser degree of the risk or probability of occurrence of a given phenomenon.

[0096] The present invention thus makes it possible to confer beneficial properties on the skin, in particular in a lasting manner, in particular: effective barrier function; moisturizing effect; elasticity and smooth texture of the skin; surface morphology with low roughness, good cohesion of the tissues and an improvement in the visual appearance of the skin.

[0097] Physiologically, dry skin is often associated with a decrease in the skin's hydration level and an alteration of the barrier function, measured by transepidermal water loss. Sensory-wise, it is characterized in particular by a feeling of tightness; itching; feelings of discomfort and / or skin tension. For obvious reasons, these manifestations are sources of discomfort.

[0098] A composition according to the invention thus proves to be particularly effective for treating conditions of skin dryness, for treating dry skin, for treating itching and / or tightness associated with dry skin, for physiologically restoring a suitable state of hydration to the stratum corneum, for treating dry hypo-seborrheic skin, for improving the comfort of dry skin, or for combating the dull and / or atonic appearance of the skin resulting from its drying out.

[0099] As indicated above, a composition according to the invention comprises (i) indole-3-lactic acid (ILA) and / or one of its salts; (ii) indole-3-carboxaldehyde (IAD) and / or one of its salts and (iii) indole-3-acetic acid (IAA) and / or one of its salts.

[0100] The term “salt” of an indole according to the invention means a salt formed by an inorganic or organic acid or an inorganic or organic base.

[0101] Examples of acid salts include sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, isonicotinate, lactate, salicylate, tartrate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gent-tisinate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, aspartate, and glutamate salts.

[0102] Examples of basic salts include alkali metal hydroxides such as sodium, potassium, and lithium; alkaline earth metal hydroxides such as calcium and magnesium; other metal hydroxides, such as aluminum and zinc; ammonia and organic amines such as unsubstituted or hydroxy-substituted mono-, di-, or tri-alkylamines; dicyclohexylamines; tributylamines; pyridine; N-methyl-N-ethylamine; diethylamine; triethylamine; mono-, bis-, or tris-(2-hydroxy-alkylamines) such as mono-, bis-, or tris-(2-hydroxyethyl)amine, 2-hydroxy-tert-butylamine, tris- (hydroxymethyl)methylamine; N,N-di-alkyl-N-(hydroxyalkyl)-amines, such as N,N-dimethyl-N-(2-hydroxyethyl)amine; N-methyl-D-glucamine; and amino acids such as arginine and lysine.

[0103] An indole salt according to the invention is preferably a basic salt, and in particular a sodium or potassium salt.

[0104] According to a variant, in the composition according to the invention, the indole-3-acetic acid is in the form of a base salt, preferably in the form of an inorganic base salt, more preferably in the form of an alkali metal salt such as sodium, potassium and lithium, even more preferably in the form of a sodium salt.

[0105] According to a variant, in the composition according to the invention, indole-3-carboxaldehyde is present in non-salified form.

[0106] According to a variant, in the composition according to the invention, indole-3-lactic acid is present in non-salified form or in the form of a base salt, preferably in the form of an inorganic base salt, more preferably in the form of an alkali metal salt such as sodium, potassium and lithium, even more preferably in the form of a sodium salt; preferably indole-3-lactic acid is present in non-salified form.

[0107] A composition according to the invention preferably comprises (i) indole-3-lactic acid (ILA) or one of its salts; (ii) indole-3-carboxaldehyde (lAld) or one of its salts and (iii) indole-3-acetic acid (IAA) or one of its salts.

[0108] The indole-3-lactic acid (ILA) of a composition according to the invention is of the following formula (I):

[0109] [Chem.l] (I)

[0110] A composition according to the invention may comprise a content of indole-3-lactic acid, and / or one of its salts, of at least 0.00001% by weight relative to the total weight of the composition, and in particular of at least 0.0001% by weight relative to the total weight of the composition.

[0111] A composition according to the invention may comprise a content of indole-3-lactic acid, and / or one of its salts, of at least 0.001% by weight relative to the total weight of the composition, and in particular of at least 0.005% by weight relative to the total weight of the composition.

[0112] A composition according to the invention may comprise a content of indole-3-lactic acid and / or one of its salts, of less than 10% by weight relative to the total weight of the composition, in particular of less than 1% by weight, more particularly of less than 0.1% by weight, even more particularly of less than 0.01% by weight relative to the total weight of the composition.

[0113] A composition according to the invention may comprise a content of indole-3-lactic acid, and / or one of its salts, ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly ranging from 0.0001% to 0.1%, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, such as 0.0001% by weight relative to the total weight of the composition.

[0114] The indole-3-carboxaldehyde (1Ald) of a composition according to the invention is of the following formula (II):

[0115] [Chem.2]

[0116] A composition according to the invention may comprise a content of indole-3-carboxaldehyde (1Ald), and / or one of its salts, of at least 0.00001% by weight relative to the total weight of the composition, and in particular of at least 0.0001% by weight relative to the total weight of the composition.

[0117] A composition according to the invention may comprise a content of indole-3-carboxaldehyde, and / or one of its salts, of at least 0.001% by weight relative to the total weight of the composition, and in particular of at least 0.004% by weight relative to the total weight of the composition.

[0118] A composition according to the invention may comprise a content of indole-3-carboxaldehyde and / or one of its salts, of less than 10% by weight relative to the total weight of the composition, in particular of less than 1% by weight, more particularly of less than 0.1% by weight, even more particularly of less than 0.01% by weight relative to the total weight of the composition.

[0119] A composition according to the invention may comprise a content of indole-3-carboxaldehyde, and / or one of its salts, ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight, more particularly ranging from 0.0001% to 0.1%, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, such as 0.0001% by weight relative to the total weight of the composition.

[0120] The indole-3-acetic acid (IAA) of a composition according to the invention is of formula (III) following:

[0121] [Chem.3] (III)

[0122] A composition according to the invention may comprise a content of indole-3-acetic acid (IAA), and / or one of its salts, of at least 0.000002% by weight relative to the total weight of the composition, and in particular of at least 0.00001% by weight relative to the total weight of the composition.

[0123] A composition according to the invention may comprise a content of indole-3-acetic acid (IAA), and / or one of its salts, of at least 0.001% by weight relative to the total weight of the composition, and in particular of at least 0.004% by weight relative to the total weight of the composition.

[0124] A composition according to the invention may comprise a content of indole-3-acetic acid and / or one of its salts, of less than 10% by weight relative to the total weight of the composition, in particular of less than 1% by weight, more particularly of less than 0.1% by weight, even more particularly of less than 0.01% by weight relative to the total weight of the composition.

[0125] A composition according to the invention may comprise a content of indole-3-acetic acid, and / or one of its salts, ranging from 0.000002% to 10% by weight, in particular ranging from 0.00001% to 1% by weight, more particularly ranging from 0.00001% to 0.1% by weight, even more particularly ranging from 0.00001% to 0.01% by weight relative to the total weight of the composition, such as 0.00001% by weight relative to the total weight of the composition.

[0126] An indole-3-acetic acid (IAA) may in particular be present, in whole or in part, in the form of a base salt, preferably an alkaline salt, more preferably a sodium salt in a composition according to the invention.

[0127] In a composition according to the invention, the sum of the contents of indole-3-lactic acid (and / or one of its salts), indole-3-carboxaldehyde (and / or one of its salts) and indole-3-acetic acid (and / or one of its salts) may represent at least less than 0.0001% by weight relative to the total weight of the composition, in particular at least 0.00011% by weight relative to the total weight of the composition.

[0128] A composition according to the invention may in particular be such that the mass ratio [indole-3-lactic acid and / or one of its salts / indole-3-carboxaldehyde and / or one of its salts] is between 0.5 and 50, in particular between 1 and 10, such as 1.

[0129] A composition according to the invention may in particular be such that the mass ratio [indole-3-carboxaldehyde and / or one of its salts / indole-3-acetic acid and / or one of its salts] is between 0.5 and 150, in particular between 1 and 100, more particularly between 1 and 10 such as 1 or 10.

[0130] A composition according to the invention may in particular be such that the mass ratio [indole-3-lactic acid and / or one of its salts / indole-3-acetic acid and / or one of its salts] is between 0.5 and 50, in particular between 1 and 10, such as 1.

[0131] A composition according to the invention may in particular be such that the mass ratio [indole-3-lactic acid and / or one of its salts / indole-3-carboxaldehyde and / or one of its salts / indole-3-acetic acid and / or one of its salts] is between 1:1:1 and 10:10:1.

[0132] In particular, a composition according to the invention may comprise: - a content of indole-3-lactic acid, and / or one of its salts, ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly ranging from 0.0001% to 0.1%, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, such as 0.0001% by weight relative to the total weight of the composition; - a content of indole-3-carboxaldehyde, and / or one of its salts, ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight, more particularly ranging from 0.0001% to 0.1%, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, such as 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-acetic acid, and / or one of its salts, and in particular a content of sodium salt, ranging from 0.000002% to 10% by weight, in particular ranging from 0.00001% to 1% by weight, more particularly ranging from 0.00001% to 0.1% by weight, even more particularly ranging from 0.00001% to 0.01% by weight relative to the total weight of the composition, such as 0.00001% by weight relative to the total weight of the composition.

[0133] A composition according to the invention may further comprise Tryptamine and / or one of its salts.

[0134] Tryptamine has the following formula (IV):

[0135] [Chem.4] (IV)

[0136] Tryptamine and / or one of its salts may be present in a composition according to the invention in a content of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition.

[0137] A composition according to the invention may comprise a content of Tryptamine and / or one of its salts, of less than 10% by weight relative to the total weight of the composition, in particular of less than 1% by weight, more particularly of less than 0.1% by weight, even more particularly of less than 0.01% by weight relative to the total weight of the composition.

[0138] A composition according to the invention may comprise a content of Tryptamine and / or one of its salts ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly ranging from 0.0001% to 0.1%, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, such as 0.0001% by weight relative to the total weight of the composition.

[0139] In particular, a composition according to the invention may comprise: - a content of indole-3-lactic acid, and / or one of its salts, ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly ranging from 0.0001% to 0.1%, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, such as 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-carboxaldehyde, and / or one of its salts, ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight, more particularly ranging from 0.0001% to 0.1%, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, such as 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-acetic acid, and / or one of its salts, and in particular a content of sodium salt, ranging from 0.000002% to 10% by weight, in particular ranging from 0.00001% to 1% by weight, more particularly ranging from 0.00001% to 0.1% by weight, even more particularly ranging from 0.00001% to 0.01% by weight relative to the total weight of the composition, such as 0.00001% by weight relative to the total weight of the composition; and - a content of tryptamine and / or one of its salts ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly ranging from 0.0001% to 0.1%, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, such as 0.0001% by weight relative to the total weight of the composition.

[0140] In a composition according to the invention, the sum of the contents of indole-3-lactic acid (and / or one of its salts), indole-3-carboxaldehyde (and / or one of its salts), indole-3-acetic acid (and / or one of its salts) and tryptamine (and / or one of its salts) may represent at least 0.0003% by weight relative to the total weight of the composition.

[0141] A composition according to the invention may in particular be such that the mass ratio [indole-3-lactic acid and / or one of its salts / indole-3-carboxaldehyde and / or one of its salts / indole-3-acetic acid and / or one of its salts / tryptamine and / or one of its salts] is between 1:1:1:1 to 10:10:1:10, preferably between 1:1:1:1 to 10:10:1:1.

[0142] A composition according to the invention may in particular comprise a culture supernatant, or a fraction of culture supernatant, of at least one bacterial strain producing indole-3-lactic acid and / or one of its salts, indole-3-carboxaldehyde and / or one of its salts and indole-3-acetic acid and / or one of its salts, as well as optionally tryptamine and / or one of its salts, and in particular also tryptamine and / or one of its salts.

[0143] A composition according to the invention may in particular comprise a culture supernatant, or a fraction of culture supernatant, of at least one bacterial strain of the species Staphylococcus epidermidis producing indole-3-lactic acid and / or one of its salts, indole-3-carboxaldehyde and / or one of its salts and indole-3-acetic acid and / or one of its salts, as well as optionally tryptamine and / or one of its salts, and in particular also tryptamine.

[0144] Thus, a composition according to the invention preferably comprises a culture supernatant, or a fraction of culture supernatant, of at least one bacterial strain of the species Staphylococcus epidermidis chosen from the group consisting of bacteria deposited at the CNCM under the order numbers 1-5689, 1-5904, 1-5691, 1-5693, 1-5694 and 1-5695.

[0145] A composition according to the invention further comprises at least one adjuvant chosen from the group consisting of fatty substances; organic solvents chosen from lower monoalcohols having from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether; ionic or non-ionic, hydrophilic or lipophilic thickeners; softeners; opacifiers; stabilizers; silicones; antifoaming agents; perfumes; preservatives; anionic, cationic, non-ionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof.

[0146] Such an adjuvant may represent from 0.0001% to 20%, preferably from 0.01% to 10% and better still, from 0.1% to 5% by weight, relative to the total weight of the composition.

[0147] Of course, the person skilled in the art will take care to choose this or these adjuvants and / or their quantity in such a way that the advantageous properties of the indole derivatives of the composition according to the invention are not, or not substantially, altered by the envisaged addition.

[0148] According to one embodiment, a composition according to the invention may comprise water.

[0149] In particular, a composition according to the invention may comprise from 20% to 90% by weight, preferably from 30% to 60% by weight of water, relative to the total weight of the composition.

[0150] The composition according to the invention may further comprise at least one additional cosmetic active ingredient.

[0151] It may in particular be at least one active ingredient for the care of dry skin such as glycerol or urea.

[0152] By the expression "additional active", is meant, in the context of the present invention, a compound which has by itself, that is to say does not require the intervention of an external agent to activate it.

[0153] The additional active agent that can be used in the compositions of the invention can in particular be chosen from desquamating agents, soothing agents, anti-irritant agents, anti-aging agents, healing agents, anti-bacterial agents, vitamins, and mixtures thereof in all proportions.

[0154] The additional active ingredient used in the composition according to the invention may represent from 0.0001% to 20%, preferably from 0.01% to 10% and better still, from 0.1% to 5% by weight, relative to the total weight of the composition.

[0155] Of course, those skilled in the art will take care to choose this or these possible additional compounds and / or their quantity in such a way that the advantageous properties of the composition according to the invention are not, or not substantially, altered by the envisaged addition.

[0156] A composition according to the invention can be presented in all the ga- lenics normally used in the cosmetic field.

[0157] It may be in particular in the form of an aqueous, hydroalcoholic, optionally gelled solution, a dispersion of the lotion type, optionally two-phase, an oil-in-water or water-in-oil or multiple emulsion, an aqueous gel, or even a dispersion of oils in an aqueous phase, in particular using spherules, these spherules being able to be polymeric particles or better, lipid vesicles of the ionic and / or non-ionic type. It may be of a more or less fluid liquid consistency.

[0158] Preferably, a composition according to the invention is distinguished from compositions intended essentially as detergents for the skin, hair and / or mucous membranes, such as soaps, shampoos and shower gels for washing and / or cleaning.

[0159] A composition according to the invention is preferentially suitable for topical administration.

[0160] Thus, a composition according to the invention can comprise all the constituents usually used in the application and topical administration envisaged.

[0161] A composition according to the invention may advantageously be in the form of an emulsion, in particular obtained by dispersing an aqueous phase in a fatty phase (W / O) or a fatty phase in an aqueous phase (O / W), of liquid or semi-liquid consistency of the milk type, or of soft consistency, or even of multiple emulsion (W / O / W or O / W / O). These compositions are prepared according to the usual known methods.

[0162] More particularly, a composition according to the invention may be intended for topical application and preferably may be in the form of an emulsion, preferably an oil-in-water emulsion. Preferably, such an emulsion is not intended to be rinsed after application.

[0163] A composition according to the invention is preferably intended to be applied to skin.

[0164] Preferably, the skin is the skin of the face, scalp, décolleté, neck, arms or forearms, or even more preferably, the skin of the face (in particular the forehead, nose, cheeks, chin), décolleté and neck.

[0165] The pH of said composition is advantageously less than or equal to 8, preferably ranging from 4 to 7, even better ranging from 4.5 to 6.5.

[0166] The composition may alternatively have the form of a care or makeup product for the face and / or body, and be packaged for example in the form of a cream in a pot or a fluid in a tube or in a pump bottle or in a dropper bottle.

[0167] The composition according to the invention can be manufactured by any known process gener- commonly used in the cosmetic field.

[0168] The ingredients are mixed before being shaped, in the order and under conditions easily determined by those skilled in the art.

[0169] According to a particular embodiment of the invention, other agents intended to enhance the appearance and / or texture of the skin may also be added to the composition according to the invention. Uses and methods

[0170] According to one of its aspects, the present invention relates to the cosmetic use, in particular topical use, of a composition according to the invention to prevent a reduction and / or strengthen the skin barrier function in an individual.

[0171] According to another of its aspects, the present invention relates to the cosmetic use, in particular topical use, of a composition according to the invention to improve the hydration of the skin.

[0172] The present invention further relates to the cosmetic use, in particular topical use, of a composition according to the invention for improving the quality of the skin, in particular dry skin.

[0173] The present invention further relates to the cosmetic use, in particular topical use, of a composition according to the invention for preventing and / or treating the cosmetic signs associated with dry skin, in particular chosen from tightness, itching, feelings of discomfort, dull complexion, roughness of the skin and marked microrelief of the skin.

[0174] An object of the present invention further relates to the cosmetic use, in particular topical use, of a composition according to the invention for preventing and / or treating pruritus, in particular pruritus in skin affected by a dermatological disorder such as atopic dermatitis.

[0175] It also relates to the cosmetic use, in particular topical, of such a composition for preventing and / or treating atopic dermatitis.

[0176] According to another of its aspects, the present invention relates to a non-therapeutic cosmetic process for caring for keratin materials, in particular the skin, in particular dry skin, comprising the topical application to these keratin materials of a composition according to the invention.

[0177] The cosmetic uses and methods considered according to the invention are non-therapeutic.

[0178] The cosmetic uses and methods of the invention are preferably implemented by administering topically a composition according to the invention.

[0179] Topical administration consists of the external application to the skin of cosmetic compositions according to the usual techniques for using these compositions.

[0180] By way of illustration, the cosmetic use or process according to the invention may be implemented by topical application, for example daily, of at least one composition according to the invention, which may for example be formulated in the form of a cream, gel, serum, lotion, emulsion or cleansing milk, preferably in the form of an emulsion.

[0181] The application can be repeated for example 1 to 2 times daily over a day or more and generally over a prolonged period of at least 4, or even 4 to 15 weeks, with, where appropriate, one or more periods of interruption.

[0182] According to one embodiment, the application is daily (once a day) and generally over a prolonged period of at least 4, or even 4 to 15 weeks, with, where appropriate, one or more periods of interruption.

[0183] According to one embodiment, the cosmetic treatment method according to the invention may comprise a single application.

[0184] Throughout the description, including the claims, the expressions "between ... and ..." and "ranging from ... to ..." must be understood inclusively, unless otherwise specified.

[0185] The following examples illustrate the present invention without limiting its scope.

[0186] In the examples, unless otherwise indicated, the temperature is ambient (20°C), and expressed in degrees Celsius, and the pressure is atmospheric pressure. Examples MATERIALS AND METHODS

[0187] Origin of strains, CNCM names and cultivation methods

[0188] The selected 8 Staphylococcus epidermidis strains were collected from normal healthy subjects. Samples were obtained by the swab method as previously described, for example, in Leung, MHY et al. Changes of the human skin microbiota upon chronic exposure to polycyclic aromatic hydrocarbon pollutants. Microbiome 8, 100 (2020). The collected bacteria were isolated on Tryptone Soy Agar (TSA) and stored as frozen stocks.

[0189] These eight strains are as follows: the strain of Staphylococcus epidermidis (S. epidermidis) deposited by L'Oréal with the CNCM on June 3, 2021 under accession number CNCM 1-5689 (1-5689), the strain of Staphylococcus epidermidis (S. epidermidis) deposited by L'Oréal with the CNCM on September 21, 2022 under accession number CNCM 1-5904 (1-5904), the strain of Staphylococcus epidermidis (S. epidermidis) deposited by L'Oréal with the CNCM on June 3, 2021 under accession number CNCM 1-5691 (1-5691), the strain of Staphylococcus epidermidis (S. epidermidis) deposited by L'Oréal with the CNCM on June 3 2021 under the CNCM accession number 1-5693 (1-5693), the strain of Staphylococcus epidermidis (S. epidermidis') deposited by L'Oréal with the CNCM on June 7, 2021 under CNCM accession number 1-5694 (1-5694) and the strain of Staphylococcus epidermidis (S. epidermidis) deposited by L'Oréal with the CNCM on June 7, 2021 under CNCM accession number 1-5695 (1-5695).

[0190] The bacterial strains were cultured either in TSB (Tryptic Soy Broth) or in KSFM (keratinocyte serum-free medium) using classical microbiology methods. Keratinocyte culture and treatment

[0191] Normal primary human neonatal epidermal keratinocytes (NHEKs) (CellnTec) were cultured in CnT-57 supplemented medium (CellnTec) containing bovine pituitary extract (BPE) at 37°C and 5% CO2. NHEKs were cultured to approximately 90% confluence in keratinocyte-SFM medium (Gibco, Life Tech. Corp., Grand Island, USA) supplemented with EGF 0.035 pg / pL and BPE 12.4 mg / mL (Gibco) 24 hours before treatments. For bacterial supernatant treatments, NHEKs were treated with 50% (v / v) sterilized bacterial supernatant at final concentration in KSFM medium and incubated for 14 hours, and then NHEKs were harvested for RNA extraction. At the end of treatment, media were collected for IL-8 quantification (IL-8 DuoSet ELISA, R&D Systems) and cytotoxicity assay (CyQuantTM LDH cytotoxicity assay, Thermo Fisher), and cells were harvested for quantitative real-time PCR assay.RT-PCR quantitative .

[0192] Total RNA was extracted from keratinocytes using the RNeasy Micro Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol with additional DNAse treatment (Rnase-Free Dnase Set, Qiagen). RNA concentration was determined using a NanodropTM (Nanodrop 1000, Thermo Scientific). iScript cDNA Synthesis (Biorad) was used to synthesize cDNA. mRNA levels were measured with the StepOnePlusTM Real-Time PCR System (Applied Biosystems™) and SYBR Green Master Mix (Biorad). Quantitative PCR (qPCR) data were analyzed using the 2-AACt quantification method with GAPDH (glyceraldehyde-3-phosphate dehydrogenase) for eukaryotic cells and GyrB (DNA gyrase subunit B) for staphylococcus as an endogenous control. Primers for FLG, IVL, KLK7, DSG1, CDSN, Ki67, DEFB4, STAT6, OVOL1, OVOL2 were provided by Biorad, other primer sequences are shown in the following: Target gene CYP1A1: sense primer (5'-3') of sequence SEQ ID NO: 1: CAGCT-CAGCTCAGTACCTCA (SEQ ID NO: 1) and antisense primer (3'-5') of sequence SEQ ID NO: 2: CTTGAGGCCCTGATTACCCA (SEQ ID NO: 2). Target gene GyrB Se: sense primer (5'-3') of sequence SEQ ID NO: 3: GTTG-TAATTGAGAAAGACAATTG (SEQ ID NO: 3) and antisense primer (3'-5') of sequence SEQ ID NO: 4: TACAGTTAAGATAACTTCGACAG (SEQ ID NO: 4). Quantification of AhR metabolites / ligands

[0193] Preparation: 5-Hydroxyindole acetic acid-d5, Serotonin-d4, Indole-3-acetic acid-d4, Kynurenic acid-d5, Melatonin-d4, Piconilic acid-d3, Tryptamine-d4, and Xanthurenic acid-d4, were purchased from Santa Cruz Bio-technology. 3-Hydroxyanthranilic acid-d4, 3-Hydroxykynurenine-13C2-15N, 5-Hydroxytryptophan-d4, Indole-3-acetamide-d5, Kynurenine-d4, and Tryptophan-d5 were purchased from Toronto Research Chemicals.

[0194] Stock solutions of the labeled analytes were prepared in water with 0.1% formic acid and the final concentrations were chosen to correspond to the estimated concentrations of the endogenous metabolites.

[0195] Metabolite extraction: Metabolites were extracted from 50 qL of collected medium as described above. After adding the above-mentioned preparations (100 qL) and 300 qL of MeOH, the samples were mixed for 15 s and homogenized at -20 °C for 30 min. After centrifugation at 5000 rpm for 10 min at -4 °C, 350 qL of supernatant was collected and concentrated under N2 flow. The residues were reconstituted in 100 qL of Me0H / H2O (1:9) and transferred to a 96-well plate for LC-HRMS analysis.

[0196] Instrumentation: Analyses were performed as previously described in Lefèvre, A. et al.. Talanta 195, 593-598 (2019). Briefly, 2 qL were injected into the LC-MS (XEVO-TQ-XS, Waters®). A Kinetex C18 xb column (1.7 qm x 150 mmx 2.1 mm, temperature 55 °C) associated with a gradient of two mobile phases (Phase A: Water + 0.5% formic acid; Phase B: MeOH + 0.5% formic acid) at a flow rate of 0.4 mL / min were used.

[0197] For each metabolite, calibration curves were used to determine the concentrations of each metabolite in the samples. Statistical analysis

[0198] All experiments were performed with at least three biological replicates. Data are presented as mean ± SEM. GraphPad Prism (version 7.0; GraphPad Software, La Jolla, CA). Data were analyzed with the Kruskal-Wallis test followed by Dunn's test. Results are considered statistically significant when p < 0.05.

[0199] Example 1: Selection of 6 strains of Staphylococcus epidermidis on the basis of their secretion of indole in culture supernatants

[0200] This selection of Staphylococcus epidermidis strains is based on their secretion of indoles into culture supernatants when grown alone and the ability of the supernatant to activate the AhR pathway and skin barrier function genes.

[0201] Multiple single strains are grown in TSB for 16 hours, then the supernatant is collected to first quantify indole metabolites, then process keratinocytes and perform RT-qPCR analysis of targeted genes according to the protocols detailed above. Results

[0202] Quantification of indole concentrations in culture supernatants indicated a concentration greater than 443 pmol / mL of total indoles - namely the sum of the concentrations of ILA (indole-3-lactic acid), lAld (Indole-3-carboxaldehyde), IAA (indole-3-acetic acid) and Tryptamine - for 6 of the strains tested, namely the previously indicated reference strains I-5689, I-5904, I-5691, I-5693, I-5694 and I-5695 (See Table 1 below and [Fig.l]).

[0203] [Tables 1] Conditions Indole-3-lactic acid (pmol / mL) Indole-3-carb oxaldehyde (pmol / mL) Indole-3-acetic acid (pmol / mL) Tryptamine (pmol / mL) Sum Indoles (pmol / mL ) Culture Medium NHEKs (KSFM) <2.75 9.25 <1.6 1.91 11.156 Culture Medium NHEKs (KSFM + TSB (50 / 50 v / v)) <2.75 9.43 <1.6 1.98 11.414 CNCM 1-5694 190.46 231.61 82.75 <0.145 504.82 CNCM 1-5695 249.14 95.95 143.74 207.53 696.35 CNCM 1-5693 291.95 133.91 96.45 <0.145 522.306 CNCM 1-5904 241.91 184.47 145.61 <0.145 571.99 CNCM 1-5689 237.28 300.25 101.96 <0.145 639.496 CNCM 1-5691 548.05 175.11 165.88 5.70 894.748

[0204] Table 1

[0205] The supernatants of each of these strains lead not only to an overexpression of CYP1A1 (> 2.7 times) but also to an overexpression of OVOL1 compared to untreated cells.

[0206] [Tables2] Conditions Mean mRNA expression level of CYP1A1 gene vs. GAPDH (constituent reference gene of NHEKs) Control- (untreated NHEKs) 1 CNCM 1-5694 5.418 CNCM 1-5695 4.678 CNCM 1-5693 6.594 CNCM 1-5689 8.987 CNCM 1-5904 36.81 CNCM 1-5691 6.308

[0207] Table 2

[0208] [Tables3] Conditions Average mRNA expression level of OVOL1 gene vs. GAPDH reference gene constituting NHEKs) Control- (untreated NHEKs) 1 CNCM 1-5694 1.498 CNCM 1-5695 1.65 CNCM 1-5693 2.258 CNCM 1-5689 1.46 CNCM 1-5904 4.974 CNCM 1-5691 1.52

[0209] Table 3

[0210] Example 2: Particular compositions of indoles mimicking the presence of the bacteria and maintaining the skin barrier function.

[0211] This example describes indole compositions that activate the AhR pathway and maintain skin barrier function.

[0212] An effective mixture of indoles is a composition that leads to the overexpression of the genes for the activation of the AhR pathway (specifically the CYP1A1 and 0V0L1 genes described by Furue et al. Int. J. Mol. Sci. 20, (2019)) and the stimulation of differentiation (FLG - Filaggrin).

[0213] No cytotoxicity and no inflammation (IL8) were measured with any of the indoles or indole mixtures tested.

[0214] A. Different concentrations were first tested, according to the protocol indicated previously, for the four indoles alone, namely: 0.005 pM; 0.5 pM; 5 pM; 50 pM; or 250 pM for ILA, IAld, and Tryptamine; 0.005 pM; 5 pM; 50 pM; or 250 pM for IAA.

[0215] The expression results of the Ahr pathway markers (CYP1A1) and barrier function (FLG) in keratinocytes stimulated by indoles alone are represented in [Fig.2] (ILA), [Fig.3] (lAld), [Fig.4] (IAA) and [Fig.5] (Tryptamine).

[0216] Thus, except for ILA for which the minimum active concentration is approximately 50 pM, the other three indoles, when used alone, each have a minimum active concentration of 250 pM.

[0217] B. Different mixtures of these indoles were also tested according to the protocol indicated above.

[0218] a. First, a 1:1:1:1 mixture of ILA, lAld, IAA and Tryptamine, at doses of 0.5, 5 or 50pM per compound (i.e. 3 experiments at total indole concentrations of 2, 20 and 200pM).

[0219] The results obtained are represented in [Fig.6].

[0220] Unexpectedly, a minimal active concentration of this mixture is observed from 20 pM (5 pM of ILA + 5 pM of IAld + 5 pM of IAA + 5 pM of Tryptamine).

[0221] This concentration is the concentration necessary to obtain an activity which was only obtained with the individual compounds from 50 pM for ILA and 250 pM for the other 3 indoles.

[0222] We therefore surprisingly observe a superiority of this composition compared to the individual compounds.

[0223] b. Different mixtures comprising ILA, IAld and IAA were also tested according to the protocol indicated previously.

[0224] Thus, two compositions comprising respectively (i) 5pM of ILA, 0.5pM of IAld and 0.5pM of IAA or (ii) 5pM of ILA, 0.5pM of IAld and 5pM of IAA were tested.

[0225] The results obtained are represented in [Fig.7].

[0226] Unexpectedly, a minimal active concentration of this mixture is observed from 10.5 pM (5 pM of ILA + 0.5 pM of IAld + 5 pM of IAA in the form of sodium salt).

[0227] This concentration is the concentration necessary to obtain an activity which was only obtained with the individual compounds from 50 pM for ILA and 250 pM for the other 3 indoles. This activity is also obtained despite the absence of Tryptamine.

[0228] We therefore surprisingly observe a superiority of this composition compared to the individual compounds.

Claims

Claims

1. Composition, in particular cosmetic, in particular for the care of keratin materials, comprising, in a physiologically acceptable medium - at least indole-3-lactic acid and / or one of its salts; indole-3-carboxaldehyde and / or one of its salts; and indole-3-acetic acid and / or one of its salts; and - at least one adjuvant chosen from the group consisting of fatty substances; organic solvents chosen from lower monoalcohols having from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether; ionic or non-ionic, hydrophilic or lipophilic thickeners; softeners; opacifiers; stabilizers; silicones; anti-foaming agents; perfumes; preservatives;anionic, cationic, non-ionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof.;

2. A composition according to claim 1, further comprising tryptamine and / or one of its salts.

3. Composition according to claim 1 or 2, characterized in that it comprises: - a content of indole-3-lactic acid, and / or one of its salts, of at least 0.00001% by weight relative to the total weight of the composition, in particular of at least 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-carboxaldehyde, and / or one of its salts, of at least 0.00001% by weight relative to the total weight of the composition, in particular of at least 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-acetic acid, and / or one of its salts, of at least 0.000002% by weight relative to the total weight of the composition, in particular of at least 0.00001% by weight relative to the total weight of the composition.

4. A composition according to any one of claims 1 to 3, wherein the sum of the contents of indole-3-lactic acid, indole-3-carboxaldehyde and indole-3-acetic acid, and / or one of their salts, represents at least 0.0001% by weight relative to the total weight of the composition.

5. Composition according to any one of claims 1 to 4, characterized in that it comprises: - a content of indole-3-lactic acid, and / or one of its salts, ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly ranging from 0.0001% to 0.1%, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, in particular 0.0001% by weight relative to the total weight of the composition; - a content of indole-3-carboxaldehyde, and / or one of its salts, ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight, more particularly ranging from 0.0001% to 0.1%, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, in particular 0.0001% by weight relative to the total weight of the composition;and - a content of indole-3-acetic acid, and / or one of its salts, ranging from 0.000002% to 10% by weight, in particular ranging from 0.00001% to 1% by weight, more particularly ranging from 0.00001% to 0.1% by weight, even more particularly ranging from 0.00001% to 0.01% by weight relative to the total weight of the composition, in particular 0.00001% by weight relative to the total weight of the composition.;

6. Composition according to any one of claims 2 to 5, in which the content of tryptamine and / or one of its salts is at least 0.00001% by weight relative to the total weight of the composition, and more particularly at least 0.0001% by weight relative to the total weight of the composition.

7. Composition according to any one of claims 1 to 6, characterized in that the mass ratio [indole-3-lactic acid and / or one of its salts / indole-3-carboxaldehyde and / or one of its salts] is between 0.5 and 50, in particular between 1 and 10, in particular 1.

8. Composition according to any one of claims 1 to 7, characterized in that the mass ratio [indole-3-carboxaldehyde and / or one of its salts / indole-3-acetic acid and / or one of its salts] is between 0.5 and 150, in particular between 1 and 100, more particularly between 1 and 10, in particular 1 or 10.

9. Composition according to any one of claims 1 to 8, characterized in that the mass ratio [indole-3-lactic acid and / or one of its salts / indole-3-acetic acid and / or one of its salts] is between 0.5 and 50, in particular between 1 and 10, in particular 1.

10. Composition according to any one of claims 1 to 9, characterized in that the mass ratio [indole-3-lactic acid and / or one of its salts / indole-3-carboxaldehyde and / or one of its salts / indole-3-acetic acid and / or one of its salts] is between 1:1:1 and 10:10:

1.

11. Composition according to any one of claims 2 to 10, characterized in that the mass ratio [indole-3-lactic acid and / or one of its salts / indole-3-carboxaldehyde and / or one of its salts / indole-3-acetic acid and / or one of its salts / tryptamine and / or one of its salts] is between 1:1:1:1 to 10:10:1:10, preferably between 1:1:1:1 to 10:10:1:

1.

12. Composition according to any one of claims 1 to 11, the composition comprising a culture supernatant, or a fraction of culture supernatant, of at least one bacterial strain of the species Staphylococcus epidermidis chosen from the group consisting of bacteria deposited at the CNCM under the order numbers 1-5689, 1-5904, 1-5691, 1-5693, 1-5694 and 1-5695.

13. A composition according to any one of claims 1 to 12, the composition being suitable for topical administration.

14. Cosmetic use, in particular topical use, of a composition according to any one of claims 1 to 13 to prevent a reduction and / or strengthen the skin barrier function in an individual.

15. Cosmetic use, in particular topical, of a composition according to any one of claims 1 to 13 to improve the hydration of the skin.

16. Cosmetic use, in particular topical, of a composition according to any one of claims 1 to 13 for improving the quality of the skin, in particular dry skin.

17. Non-therapeutic cosmetic use, in particular topical, of a composition according to any one of claims 1 to 13 for preventing and / or treating the cosmetic signs associated with dry skin, in particular chosen from tightness, itching, feelings of discomfort, dull complexion, roughness of the skin and marked microrelief of the skin.

18. Non-therapeutic cosmetic use, in particular topical, of a composition according to any one of claims 1 to 13, for preventing and / or treating pruritus, in particular pruritus in skin affected by a dermatological disorder such as atopic dermatitis.

19. Composition according to any one of claims 1 to 13, for its use in the prevention and / or treatment of atopic dermatitis.

20. Cosmetic use according to any one of claims 10 to 18, or composition for its use according to claim 19, wherein the composition is suitable for topical administration.

21. Non-therapeutic cosmetic process for caring for keratin materials, in particular the skin, in particular dry skin, comprising the topical application to these keratin materials of a composition according to any one of claims 1 to 13.

Images