L. monocytogenes detection

Abstract

A primer set comprising PCR primer pairs for detecting one or more Listeria monocytogenes multi-locus sequence type (MLST) or MLST-defined clonal complex types, and a kit comprising the primer set, an

Description

The present invention relates generally to the field of subtyping of bacterial strains, in particular to PCR primer pairs for detecting / identifying one or more Listeria monocytogenes multi-locus sequence typing (MLST) types or MLST-defmed clonal complex types. The invention also relates to methods for detecting one or more L. monocytogenes MLST types or MLST-defmed clonal complex types in a sample using said PCR primer pairs. L. monocytogenes is a species of pathogenic bacteria that causes a serious foodbome illness called listeriosis in human and animals. Consuming contaminated food, especially unpasteurised dairy products, raw vegetables, and certain ready-to-eat foods, can lead to infection in humans. Pregnant women, newborns, the elderly, and individuals with weakened immune systems are particularly susceptible to severe complications from listeriosis. As many as 20 to 30% of foodbome listeriosis infections in high-risk individuals may be fatal. However, only a few subtypes of A. monocytogenes are responsible for the majority of listeriosis cases, and certain subtypes may cause more severe listeriosis and / or a different disease course compared with others. Therefore, it is desirable to not merely be able to identify the presence or absence of L. monocytogenes in a sample (i.e. at the species level), but to be able to identify in particular the presence or absence one or more subtypes of L. monocytogenes, for example an MLST type or an MLST-defmed clonal complex type, so that an appropriate course of action may be taken, for example to prevent or treat disease in humans and animals. MLST is a sequence-based technique for classifying bacterial strains with precision beyond species level, based on variations m multiple genetic loci. In the method of MLST as applied to L. monocytogenes, the polynucleotide sequences of seven housekeeping genes -specifically the genes abcZ, bglA, cat, dap, dat, Idh, and IhkA - are amplified by PCR and then sequenced. The L. monocytogenes strain under investigation is then identified as belonging to a particular MLST type based on the combination of alleles possessed by that strain at particular loci within the seven aforementioned housekeeping genes. An MLST-defmed clonal complex type consists of multiple MLST types that share a certain level of genetic relatedness, for example a group of MLST types that are likely to have evolved from a common ancestor. There are certain drawbacks associated with classical MLST due to the need to obtain the sequences of all seven housekeeping genes which are each dispersed across several genomic locations. In particular, the process of obtaining these sequences is time consuming, expensive and requires special equipment and trained personnel, for example during the process of cleaning reads and assembling genomes. Therefore, there remains a need to provide improved means for the detection / identification off. monocytogenes subtypes. The present invention fulfils this need. The present inventors have identified PCR primer pairs, the PCR products of each of which have been newly-identified by the inventors as being specific to particular L. monocytogenes MLST type or MLST-derived clonal complex type. These PCR primer pairs advantageously allow for the presence or absence of a particular L monocytogenes MLST type or MLST-derived clonal complex type in a sample to be determined simply by subjecting the sample to PCR, and then visualizing or quantifying the PCR products, without the need for sequencing. Surprisingly, the MLST type or MLST- derived clonal complex type specific sequences targeted by the PCR primer pairs of the invention are not found within the above-mentioned seven housekeeping genes typically used for MLST typing. Thus, in a first aspect, the present invention provides a Listeria monocytogenes MLST type-specific or MLST-defined clonal complex type-specific primer pair, comprising PCR primers comprising the sequences of: [Primer Pair 1] [Primer Pair 2] [Primer Pair 3] [Primer Pair 4] [Primer Pair 5] [Primer Pair 6] [Primer Pair 7] [Primer Pair 8] [Primer Pair 9] [Primer Pair 10] [Primer Pair 11] [Primer Pair 12] [Primer Pair 13] [Primer Pair 14] [Primer Pair 15] [Primer Pair 16] [Primer Pair 17] [Primer Pair 18] [Primer Pair 19] [Primer Pair 20] [Primer Pair 21] [Primer Pair 22] [Primer Pair 23] SEQ ID NOs: 17 (ST876 forward) and 18 (ST876 reverse); SEQ ID NOs: 19 (ST87_7 forward) and 20 (ST87_7 reverse); SEQ ID NOs: 21 (ST87_9 forward) and 22 (ST87J reverse); SEQ ID NOs: 23 (ST87J 2 forward) and 24 (ST8 7 12 reverse); SEQ ID NOs: 1 (ST515 forward) and 2 (ST5 15 reverse); SEQ ID NOs: 3 (ST517 forward) and 4 (ST517 reverse); SEQ ID NOs: 65 (ST1247 1 forward) and 66 (ST1247 1 reverse); SEQ ID NOs: 67 (CC8 6 forward) and 68 (CC8 6 reverse); SEQ ID NOs: 69 (CC8 7 forward) and 70 (CC8 7 reverse); SEQ ID NOs: 71 (CC9 8 forward) and 72 (CC9J reverse); SEQ ID NOs: 73 (CC9_9 forward) and 74 (CC9_9 reverse); SEQ ID NOs: 75 (CC9 13 forward) and 76 (CC913 reverse); SEQ ID NOs: 5 (ST7 4 forward) and 6 (ST7 4 reverse); SEQ ID NOs: 7 (ST7 7 forward) and 8 (ST7 7 reverse); SEQ ID NOs: 9 (ST7 JO forward) and 10 (ST7 JO reverse); SEQ ID NOs: 11 (ST29 J forward) and 12 (ST29 J reverse); SEQ ID NOs: 13 (ST29 9 forward) and 14 (ST29 9 reverse); SEQ ID NOs: 15 (ST29J0 forward) and 16 (ST29 10 reverse); SEQ ID NOs: 25 (ST101_2 forward) and 26 (ST1012 reverse); SEQ ID NOs: 27 (ST1215 forward) and 28 (ST1215 reverse); SEQ ID NOs: 29 (ST 121J forward) and 30 (ST121J reverse); SEQ ID NOs: 31 (ST121J1 forward) and 32 (ST121J1 reverse); SEQ ID NOs: 33 (ST121 12 forward) and 34 (ST121 12 reverse); [Primer Pair 24] [Primer Pair 25] [Primer Pair 26] [Primer Pair 27] [Primer Pair 28] [Primer Pair 29] [Primer Pair 30] [Primer Pair 31] [Primer Pair 32] [Primer Pair 33] [Primer Pair 34] [Primer Pair 35] [Primer Pair 36] [Primer Pair 37] [Primer Pair 38] SEQ ID NOs: 35 (ST155 6 forward) and 36 (ST1556 reverse); SEQ ID NOs: 37 (ST155_10 forward) and 38 (ST15510 reverse); SEQ ID NOs: 39 (ST15512 forward) and 40 (ST15512 reverse); SEQ ID NOs: 41 (ST173 2 forward) and 42 (ST173_2 reverse); SEQ ID NOs: 43 (STI73_4 forward) and 44 (STI73_4 reverse); SEQ ID NOs: 45 (ST173_5 forward) and 46 (STI73 5 reverse); SEQ ID NOs: 47 (ST17311 forward) and 48 (ST17311 reverse); SEQ ID NOs: 49 (ST177_2 forward) and 50 (ST177_2 reverse); SEQ ID NOs: 51 (ST177 4 forward) and 52 (ST177 4 reverse); SEQ ID NOs: 53 (STI 77 14 forward) and 54 (STI77_14 reverse); SEQ ID NOs: 55 (ST425 6 forward) and 56 (ST425 6 reverse); SEQ ID NOs: 57 (ST425 12 forward) and 58 (ST425 12 reverse); SEQ ID NOs: 59 (ST4515 forward) and 60 (ST4515 reverse); SEQ ID NOs: 61 (ST4516 forward) and 62 (ST4516 reverse); or SEQ ID NOs: 63 (ST45110 forward) and 64 (ST45110 reverse). Preferably, in all aspects of the invention, the primer pair comprises PCR primers comprising the sequences of Primer Pair 2, 3, 4, 5, 6, 7, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38. Herein, where the term “MLST” is used, the term “ST” can alternatively be used. Herein, where the term “MLST-defmed clonal complex type” is used, the term “clonal complex type” or “clonal complex” or “CC” can alternatively be used. The present inventors identified each of the above-mentioned primer pairs as being advantageously capable of amplifying, in a PCR reaction, a polynucleotide sequence that is uniquely specific to one L. monocytogenes MLST type or MLST-derived clonal complex type. A novel and technically complex process was used to design the PCR primer pairs, as described further below. Full genome sequence reads of L monocytogenes strains were obtained from public Illumina sequencing data, and assigned into MLST types. Reads for which the MLST type could not be determined, or for which the species was determined to not be L. monocytogenes, were removed. Computational analysis of the full genome reads were performed, in which the sequences of all reads were split into short k-mers of at least 32 nucleotides in length, and the 32-mer k-mers were then screened to identify 32-mer k-mers that were specific for a given MLST type, k-mers were only selected for further computation if they occurred in at least 5 reads for a given MLST type, and if they did not occur in any read of a non-target MLST type. Once the MLST type-specific 32-mer k-mers had been identified, they were mapped onto the relevant MLST-typc genomic sequence in order to identify longer continuous sequences comprised of overlapping 32-mer k-mer sequences. These longer continuous sequences are also MLST-type specific, given that they are comprised of overlapping MLST-type specific 32-mers, and are termed “long k-mers” herein. Long k-mers of 60-1000 nucleotides in length were thereby identified, and subsequently used as targets against which PCR primer pairs were designed. The long k-mer sequences identified as described above were newly identified by the present inventors as being specific to a particular Z. monocytogenes MLST-type. The present inventors for the first time realised that such long k-mer sequences would be advantageous targets against which to design L. monocytogenes MLST-type specific PCR primer pairs. The inventors then designed primer pairs for amplifying the sequences of the L. monocytogenes MLST-type specific long k-mers that they had identified. Specifically, primer pairs against the long k-mers were designed that were 18 to 22 nucleotides in length, and in which the maximum difference between the melting points of the tw o primers within the primer pair (T m) was 3°C. 4964 primer pairs were identified in this way. A further in silico screen was performed to remove from the pool of primer pairs those that could theoretically amplify an off-target sequence, i.e. a sequence found within the genome of a different (non-target) MLST type. Full genome sequence reads of all Z. monocytogenes strains within the public Illumina sequencing database were used to screen against non-target MLST types. Thus, for further inclusion, primer pairs were required to meet at least one of the following conditions: a. at least one of the primers in the pair did not align to any non-target genome sequence; b. both primers in the pair did align with a non-target genome sequence, but the two genome sequences were not within a distance of 1-1000 nucleotides of each other; or c. both primers in the pair did align with a non-target type genome sequence, and both genome sequences were within 1-1000 nucleotides of each other, but wherein at least one of the primers does not align to the non-target type genome sequence with 100% complementarity, and wherein the non-complementary site(s) lie(s) within the six nucleotides at the 3' end of said at least one primer. As explained above, this process comprises a series of steps for identifying MLST-type specific long k-mers, and a series of steps for designing PCR primers against those long k-mers. In both series of steps, screens are performed to ensure that amplification of off-target sequences does not result. This double selection requirement for MLST-type specificity provides the 38 advantageously sensitive and specific PCR primer pairs of the invention. The sensitivity and specificity of primer pairs for a given MLST-type or MLST-defined clonal complex type was confirmed experimentally, as shown in the Examples. Each long type-specific k-mer is a single sequence, detection of which is indicative of the presence a specific MLST-type or MLST-derived clonal complex type. Detection may be performed by PCR using the specific primer pairs of the invention, and then visualizing or quantifying the products of the PCR, which is substantially less burdensome than conventional sequencing-based methods of MLST type identification. Advantageously, each long type-specific k-mer is only a single sequence that needs to be detected. The present invention therefore provides a detection method that is substantially less burdensome than conventional methods of MLST type identification, which involve the sequencing of the entire sequences of seven housekeeping genes. The primer pairs of the invention are specific for the following Listeria monocytogenes MLST-type or MLST-derived clonal complex type: A) MLST-type ST87 Primer Pair 1: SEQ ID NOs: 17 (ST87_6 forward) and 18 (ST87 6 reverse); Primer Pair 2: SEQ ID NOs: 19 (ST87 7 forward) and 20 (ST87 7 reverse); Primer Pair 3: SEQ ID NOs: 21 (ST87 9 forward) and 22 (ST87 9 reverse); Primer Pair 4: SEQ ID NOs: 23 (ST87_12 forward) and 24 (ST8712 reverse); B) MLST-type ST5 Primer Pair 5: SEQ ID NOs: 1 (ST515 forward) and 2 (ST515 reverse); Primer Pair 6: SEQ ID NOs: 3 (ST517 forward) and 4 (ST517 reverse); C) MLST-type ST1247 Primer Pair 7: SEQ ID NOs: 65 (ST 1247 1 forward) and 66 (ST12471 reverse); D) MLST-derived clonal complex type CC8 Primer Pair 8: SEQ ID NOs: 67 (CC8 6 forward) and 68 (CC8 6 reverse); Primer Pair 9: SEQ ID NOs: 69 (CC8 7 forward) and 70 (CC8 7 reverse); E) MLST-derived clonal complex type CC9 Primer Pair 10: SEQ ID NOs: 71 (CC9_8 forward) and 72 (CC'9 8 reverse); Primer Pair 11: SEQ ID NOs: 73 (CC9 9 forward) and 74 (CC9 9 reverse); Primer Pair 12: SEQ ID NOs: 75 (CC913 forward) and 76 (CC913 reverse); F) MLST-type ST7 Primer Pair 13: SEQ ID NOs: 5 (ST74 forward) and 6 (ST74 reverse); Primer Pair 14: SEQ ID NOs: 7 (ST7_7 forward) and 8 (ST7_7 reverse); Primer Pair 15: SEQ ID NOs: 9 (ST7 10 forward) and 10 (ST7 10 reverse); G) MLST-type ST29 Primer Pair 16: SEQ ID NOs: 11 (ST29 7 forw ard) and 12 (ST29 7 reverse); Primer Pair 17: SEQ ID NOs: 13 (ST299 forward) and 14 (ST299 reverse); Primer Pair 18: SEQ ID NOs: 15 (ST2910 forward) and 16 (ST2910 reverse); H) MLST-type ST101 Primer Pair 19: SEQ ID NOs: 25 (ST101_2 forward) and 26 (ST1012 reverse); I) MLST-tvpe STI21 Primer Pair 20: SEQ ID NOs: 27 (ST1215 forward) and 28 (ST1215 reverse); Primer Pair 21: SEQ ID NOs: 29 (ST1219 forward) and 30 (ST121_9 reverse); Primer Pair 22: SEQ ID NOs: 31 (ST121_11 forward) and 32 (ST 12 111 reverse); Primer Pair 23: SEQ ID NOs: 33 (ST12112 forward) and 34 (ST12112 reverse); J) MLST-tvpe STI55 Primer Pair 24: SEQ ID NOs: 35 (ST155 6 forward) and 36 (ST155 6 reverse); Primer Pair 25: SEQ ID NOs: 37 (ST15510 forward) and 38 (ST15510 reverse); Primer Pair 26: SEQ ID NOs: 39 (ST 155 12 forward) and 40 (ST 155 12 reverse); K) MLST-type ST 173 Primer Pair 27: SEQ ID NOs: 41 (ST173 2 forward) and 42 (ST173 2 reverse); Primer Pair 28: SEQ ID NOs: 43 (ST173 4 forward) and 44 (ST173 4 reverse); Primer Pair 29: SEQ ID NOs: 45 (ST173 5 forward) and 46 (ST1735 reverse); Primer Pair 30: SEQ ID NOs: 47 (STI 73 11 forward) and 48 (ST 173_11 reverse); L) MLST-tx pe ST 177 Primer Pair 31: SEQ ID NOs: 49 (ST1772 forward) and 50 (ST177 2 reverse); Primer Pair 32: SEQ ID NOs: 51 (ST177 4 forward) and 52 (ST177 4 reverse); Primer Pair 33: SEQ ID NOs: 53 (ST17714 forward) and 54 (ST17714 reverse); M) MLST-type ST425 Primer Pair 34: SEQ ID NOs: 55 (ST425 6 forward) and 56 (ST425 6 reverse); Primer Pair 35: SEQ ID NOs: 57 (ST425 12 forward) and 58 (ST425 12 reverse); N) MLST-type ST451 Primer Pair 36: SEQ ID NOs: 59 (ST451 5 forward) and 60 (ST451 _5 reverse); Primer Pair 37: SEQ ID NOs: 61 (ST451^6 forward) and 62 (ST45I Ji reverse); or Primer Pair 38: SEQ ID NOs: 63 (ST45 IIO forward) and 64 (ST45110 reverse). A PCR primer may comprise or consist of the nucleotide sequence represented by the SEQ ID NO recited herein. The sequences represented by the SEQ ID NOs recited herein provide optimal properties for generating PCR products, however it would be understood that longer primers comprising these sequences could be generated without significant change in performance. It is understood in the field that the length of a PCR primer can be varied depending on factors including the specific requirements of the PCR reaction and the target DNA sequence. Moreover, it is known in the field to design primers up of 30 nucleotides in length or even greater length. Thus, in embodiments, one, or more, or all or each of the primers in the primer pairs of the invention comprises (or consists of) a maximum of 100, 90, 80, 70, 60, 50, 40, 30, 29, 28, 27, 26, 25, 24, 23 or 22 nucleotides. Thus, in one aspect the present invention provides: A90) an MLST type ST87 specific PCR primer pair comprising: a PCR primer comprising the sequence of SEQ ID NO: 17 (ST87 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 18 (ST87 6 reverse); a PCR primer comprising the sequence of SEQ ID NO: 19 (ST87 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 20 (ST87 7 reverse); a PCR primer comprising the sequence of SEQ ID NO: 21 (ST87 9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 22 (ST87_9 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 23 (ST8712 forward), and a PCR primer comprising the sequence of SEQ ID NO: 24 (ST8712 reverse); or B90) an MLST type ST5 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 1 (ST515 forward), and a PCR primer comprising the sequence of SEQ ID NO: 2 (ST515 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 3 (ST517 forward), and a PCR primer comprising the sequence of SEQ ID NO: 4 (ST517 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 65 (ST12471 forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (ST1247 1 reverse); or D90) an MLST-defined clonal complex type CC8 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 67 (CC8 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 68 (CC8 6 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 69 (CC8 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 70 (CC8 7 reverse); or E90) an MLST-defined clonal complex type CC9 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 71 (CC9 8 forward), and a PCR primer comprising the sequence of SEQ ID NO: 72 (CC9 8 reverse); a PCR primer comprising the sequence of SEQ ID NO: 73 (CC9 9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 74 (CC9 9 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 75 (CC913 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC9 J 3 reverse); or F90) an MLST type ST7 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 5 (ST7 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 6 (ST7 4 reverse); a PCR primer comprising the sequence of SEQ ID NO: 7 (ST7 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 8 (ST7 7 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 9 (ST7 10 forward), and a PCR primer comprising the sequence of SEQ ID NO: 10 (ST710 reverse); or G90) an MLST type ST29 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 11 (ST29 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 12 (ST29 7 reverse); a PCR primer comprising the sequence of SEQ ID NO: 13 (ST29J) forward), and a PCR primer comprising the sequence of SEQ ID NO: 14 (ST29 9 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 15 (ST2910 forward), and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST2910 reverse); or H90) an MLST type STI 01 specific PCR primer pairs of the invention comprising a PCRprimer comprising the sequence ofSEQ ID NO: 25 (ST 1012 forward), and aPCR primer comprising the sequence ofSEQ ID NO: 26 (ST1012 reverse); or 190) an MLST type ST121 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 27 (ST1215 forward), and a PCR primer comprising the sequence of SEQ ID NO: 28 (ST121 5 reverse); a PCR primer comprising the sequence of SEQ ID NO: 29 (ST 121^9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 30 (ST1219 reverse); a PCR primer comprising the sequence of SEQ ID NO: 31 (ST12111 forward), and a PCR primer comprising the sequence of SEQ ID NO: 32 (ST 12111 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 33 (ST12112 forward), and a PCR primer comprising the sequence of SEQ ID NO: 34 (ST 121 _12 reverse); or J90) an MLST type STI55 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 35 (ST1556 forward), and a PCR primer comprising the sequence of SEQ ID NO: 36 (ST155 6 reverse); a PCR primer comprising the sequence of SEQ ID NO: 37 (ST15510 forward), and a PCR primer comprising the sequence of SEQ ID NO: 38 (ST 155 10 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 39 (STI55 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 40 (ST155 12 reverse); or K90) an MLST type ST173 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 41 (ST173 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 42 (STI 73 2 reverse); a PCR primer comprising the sequence of SEQ ID NO: 43 (STI 73 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 44 (ST173 4 reverse); a PCR primer comprising the sequence of SEQ ID NO: 45 (ST173 5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 46 (ST173 5 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 47 (ST17311 forward), and a PCR primer comprising the sequence of SEQ ID NO: 48 (ST 173 1 1 reverse); or L90) an MLST type ST 177 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 49 (ST177 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 50 (ST177 2 reverse); a PCR primer comprising the sequence of SEQ ID NO: 51 (ST177 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 52 (STI 77 4 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 53 (ST 177 14 forward), and a PCR primer comprising the sequence of SEQ ID NO: 54 (ST17714 reverse); or M90) an MLST type ST425 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 55 (ST425 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 56 (ST425 6 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 57 (ST425 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 58 (ST425 12 reverse); or N90) an MLST type ST451 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 59 (ST4515 forward), and a PCR primer comprising the sequence of SEQ ID NO: 60 (ST451^5 reverse); a PCR primer comprising the sequence of SEQ ID NO: 61 (ST4516 forward), and a PCR primer comprising the sequence of SEQ ID NO: 62 (ST4516 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 63 (ST45110 forward), and a PCR primer comprising the sequence of SEQ ID NO: 64 (ST45110 reverse). Preferably, the present invention provides: A100) an MLST type ST87 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 19 (ST877 forward), and a PCR primer comprising the sequence of SEQ ID NO: 20 (ST877 reverse); a PCR primer comprising the sequence of SEQ ID NO: 21 (ST879 forward), and a PCR primer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse); of a PCR primer comprising the sequence of SEQ ID NO: 23 (STS7 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 24 (ST87 12 reverse); or B100) an MLST type ST5 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 1 (ST515 forward), and a PCR primer comprising the sequence of SEQ ID NO: 2 (ST515 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 3 (ST5 17 forward). and a PCR primer comprising the sequence of SEQ ID NO: 4 (ST5 17 reverse); or C100) an MLST type ST1247 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 65 (ST1247 1 forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (ST1247 1 reverse); or E100) an MLST-defmed clonal complex type CC9 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 71 (CC98 forward), and a PCR primer comprising the sequence of SEQ ID NO: 72 (CC98 reverse); a PCR primer comprising the sequence of SEQ ID NO: 73 (CC99 forward), and a PCR primer comprising the sequence of SEQ ID NO: 74 (CC9 9 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 75 (CC9 13 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC913 reverse); or F100) an MLST type ST7 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 5 (ST7 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 6 (ST7 4 reverse); a PCR primer comprising the sequence of SEQ ID NO: 7 (ST7 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 8 (ST7 7 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 9 (ST710 forward), and a PCR primer comprising the sequence of SEQ ID NO: 10 (ST710 reverse); or G100) an MLST type ST29 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 13 (ST29 9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 14 (ST29 9 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 15 (ST2910 forward), and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST2910 reverse); or H100) an MLST type STI01 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 25 (ST 101 _1 forward), and a PCR primer comprising the sequence of SEQ ID NO: 26 (ST1012 reverse); or 1100) an MLST type ST121 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 27 (ST1215 forward), and a PCR primer comprising the sequence of SEQ ID NO: 28 (ST121_5 reverse); a PCR primer comprising the sequence of SEQ ID NO: 29 (ST 1219 forward), and a PCR primer comprising the sequence of SEQ ID NO: 30 (ST1219 reverse); a PCR primer comprising the sequence of SEQ ID NO: 31 (ST12111 forward), and a PCR primer comprising the sequence of SEQ ID NO: 32 (ST12111 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 33 (ST12112 forward), and a PCR primer comprising the sequence of SEQ ID NO: 34 (ST 12112 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 35 (ST1556 forward), and a PCR primer comprising the sequence of SEQ ID NO: 36 (ST155 6 reverse); a PCR primer comprising the sequence of SEQ ID NO: 37 (ST15510 forward), and a PCR primer comprising the sequence of SEQ ID NO: 38 (ST15510 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 39 (ST 155 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 40 (ST15512 reverse); or K100) an MLST type ST173 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 41 (ST173 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 42 (STI73_2 reverse); a PCR primer comprising the sequence of SEQ ID NO: 43 (ST 173 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 44 (ST1734 reverse); a PCR primer comprising the sequence of SEQ ID NO: 45 (ST1735 forward), and a PCR primer comprising the sequence of SEQ ID NO: 46 (ST173 5 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 47 (ST17311 forward), and a PCR primer comprising the sequence of SEQ ID NO: 48 (ST 173 11 reverse); or L100) an MLST type ST177 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 49 (ST177 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 50 (ST177_2 reverse); a PCR primer comprising the sequence of SEQ ID NO: 51 (ST177 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 52 (STI 77 4 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 53 (STI 77 14 forward), and a PCR primer comprising the sequence of SEQ ID NO: 54 (ST17714 reverse); or M100) an MLST type ST425 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 55 (ST425 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 56 (ST425 6 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 57 (ST425 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 58 (ST425 12 reverse); or N100) an MLST type ST451 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 59 (ST4515 forward), and a PCR primer comprising the sequence of SEQ ID NO: 60 (ST451_5 reverse); a PCR primer comprising the sequence of SEQ ID NO: 61 (ST451^6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 62 (ST4516 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 63 (ST45110 forward), and a PCR primer comprising the sequence of SEQ ID NO: 64 (ST45110 reverse). The aforementioned MLST and CC types are considered to be of particular importance to identify in samples, as explained below. L monocytogenes MLST type ST87 is one of the most common MLST types isolated from food products, food-associated environments, and sporadic listeriosis in China. ST87 is also associated with increased virulence and resistance to antibiotics. L. monocytogenes MLST type ST5 was one of the dominant L. monocytogenes MLST types isolated from a slaughterhouse in Jiangsu, China, and was found to exhibit high antimicrobial resistance and invasion characteristics, indicating a potential risk to food safety and human health. L. monocytogenes MLST type ST1247 was responsible for a prolonged multicountry outbreak across Denmark, Estonia, Finland, France, and Sweden. The outbreak resulted in 22 cases of listeriosis with five fatalities. L monocytogenes MLST-defined clonal complex type CC8 was responsible for an outbreak of nine cases of listeriosis caused by contaminated sandwiches served at NHS hospitals in England in 2019. Of the nine cases, seven were fatal. L. monocytogenes MLST-defined clonal complex type CC9 was found to have persisted in a meat processing facility for at least four years, and had resistance against the disinfectants benzalkonium chloride (BC) and peracetic acid. L monocytogenes MLST type ST7 was responsible for a severe outbreak in Central Italy from May 2015 to March 2016, causing 24 confirmed clinical cases. A study conducted in Chile found that ST7 isolates carried several virulence genes. L. monocytogenes MLST type ST29 was isolated from patients with invasive listeriosis in Italy from 2010 to 2016. A study in the Czech Republic found that ST29 was one of the most prevalent MLST types in vacuum-packed steak tartare samples. L monocytogenes MLST type ST101 was isolated from two human cases of invasive listeriosis in Austria in December 2017. A study in China isolated multiple ST101 strains from food products. L. monocytogenes MLST type STI21 is a common MLST type found in food production environments and was one of the dominant L. monocytogenes MLST types isolated from a slaughterhouse in Jiangsu, China. L monocytogenes MLST type STI55 is prevalent among clinical and food isolates and appears to be equally adapted to the conditions in food processing environments, as well as the host environment. An Austrian study found that ST155 was one of the most frequent MLST types among human isolates. L. monocytogenes MLST type ST 173 was responsible for several human clinical cases of listeriosis over a multiyear period in the Netherlands, likely resulting from fish product contamination. L. monocytogenes MLST type ST177 was isolated from a human case of invasive listeriosis in Austria in December 2017. L. monocytogenes MLST type ST425 was identified as a causative agent of invasive listeriosis when it was identified in disease cases in Russia during the COVID-19 pandemic. L monocytogenes MLST type ST451 poses a possible threat to public health, and is potentially widely distributed in the milk and dairy product sectors of Slovakia. A study m the Czech Republic found that ST451 was one of the prevalent MLST types in vacuum-packed steak tartare samples. Thus, in a further aspect the present invention provides a method for detecting one or more Listeria monocytogenes multi-locus sequence typing (MLST) types or MLST-defined clonal complex types in a sample, the method comprising: a) subjecting DNA isolated from said sample to a nucleic acid amplification reaction using one or more Listeria monocytogenes MLST type or MLST-defined clonal complex type-specific primer pairs of the invention; and b) detecting the product(s) of the nucleic acid amplification reaction. Alternatively viewed, the present invention provides a method for identifying one or more Listeria monocytogenes multi-locus sequence typing (MLST) types or MLST-defined clonal complex types in a sample, the method comprising: a) subjecting DNA isolated from said sample to a nucleic acid amplification reaction using one or more Listeria monocytogenes MLST type or MLST-defined clonal complex type-specific primer pairs of the invention; and b) detecting the product(s) of the nucleic acid amplification reaction. Alternatively viewed, the present invention provides a method for detecting a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type in a sample, the method comprising: a) subjecting DNA isolated from said sample to a nucleic acid amplification reaction using a Listeria monocytogenes MLST type or MLST-defined clonal complex type-specific primer pair of the invention; and b) detecting the product(s) of the nucleic acid amplification reaction. Alternatively viewed, the present invention provides a method for identifying a Listeria monocytogenes multi-locus sequence typing (MLST) types or MLST-defmed clonal complex type in a sample, the method comprising: a) subjecting DNA isolated from said sample to a nucleic acid amplification reaction using a Listeria monocytogenes MLST type or MLST-defmed clonal complex type-specific primer pair of the invention; and b) detecting the product(s) of the nucleic acid amplification reaction. In another aspect, the invention provides a method for detecting one or more Listeria monocytogenes multi-locus sequence typing (MLST) types or MLST-defmed clonal complex types in a sample, the method comprising: a) subjecting DNA isolated from said sample to a nucleic acid amplification reaction using a primer set of the invention; and b) detecting the product(s) of the nucleic acid amplification reaction. Alternatively viewed, the present invention provides a method for identifying one or more Listeria monocytogenes multi-locus sequence typing (MLST) types or MLST-defmed clonal complex types in a sample, the method comprising: a) subjecting DNA isolated from said sample to a nucleic acid amplification reaction using a primer set of the invention; and b) detecting the product(s) of the nucleic acid amplification reaction. Primer sets of the invention are described elsewhere herein. hr embodiments, step b) comprises: bi) performing gel electrophoresis on the products of the nucleic acid amplification reaction; and bii) visualizing the products of the nucleic acid amplification reaction in the form of DNA bands of a specific size on the gel; wherein the size of each product of the nucleic acid amplification visualized on the gel is indicative of the presence of one Listeria monocytogenes MLST type or MLST-defmed clonal complex type in the sample. In embodiments, the nucleic acid amplification reaction is performed by PCR. Preferably, the PCR is quantitative PCR and step b) comprises quantifying the products of the nucleic acid amplification reaction. hi embodiments, the gel electrophoresis is agarose gel electrophoresis. In embodiments, the detection comprises quantification of the amplification product(s) (e.g. PCRproduct(s)). Preferably, the quantification comprises the use of a quantitative technique or semi-quantitative technique. Preferably, said technique is (or uses) real-time PCR, digital PCR, fluorometry, spectrophotometry or gel electrophoresis. Clearly, tire use of a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type-specific PCR primer pair permits detection / identification of the Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type for which it is specific; these are outlined above. A primer set of the invention may comprise a single PCR primer pair specific for each MLST or CC type of interest (i.e. each “target'’ MLST or CC type). However, it is of course equally possible for a primer set to comprise multiple PCR primer pairs that are specific for any one (or more) given target MLST or CC type. The “sample” according to present methods is not particularly limited. L. monocytogenes contamination of food and beverage products is a significant problem in the field, and a food, or a portion thereof, can therefore represent a sample from which DNA is derived for testing in the method of the invention. The sample may be a food (or piece thereof). The food may be meat (e.g. raw, cooked or cured meat), fish (e.g. raw, smoked or cured fish,), shellfish (e.g. raw or cooked shellfish), cheese, salad, fruit, or milk. The sample may also be a soil, water (e.g. wastewater), sewage, silage, or animal faeces sample. The sample may be a liquid or liquified sample. Further still, L. monocytogenes may be found on solid surfaces, e.g. on food processing equipment and food packaging materials. Thus, in embodiments the sample is obtained from a solid surface, e.g. a surface of food processing equipment or food packaging material. The sample obtained may be a swabbed sample. The sample may be a non-purified sample, or a partially or fully purified sample. Preferably, the nucleic acid amplification reaction is a polymerase chain reaction (PCR). PCR requires the use of a pair of primers, namely a forward primer and a reverse primer. One primer, typically, the “forward” primer is complementaiy to the antisense strand of the target double-stranded DNA sequence, while the other primer, typically the “reverse” primer, is complementary to the sense strand of the target double-stranded DNA sequence. The primers anneal to the target sequence to which they are complementary. Both primers flank the target DNA sequence to be amplified. Each of the primer pairs of the invention comprises one forward primer and one reverse primer. Nucleic acid amplification reactions, e.g. PCR, are well known in the art, and it would be within the competencies of the person of ordinary skill in the art to select and optimise the PCT reaction mixture, and the specific steps and conditions of the method for their desired purposes. For instance, the person of ordinary skill in the art can readily select temperatures, heating durations, number of cycles, concentrations of components of the reaction mixture, etc., in order to perform a successful reaction. Nonetheless, exemplary embodiments are provided below. In embodiments, the nucleic acid amplification reaction comprises a denaturation step, an annealing step, and an extension step. In embodiments, the denaturation temperature is from about 90°C to about 100°C, more preferably from about 94°C to about 98°C, more preferably about 94°C or about 95°C, more preferably about 95°C. In embodiments, the annealing temperature is from about 50°C to about 70°C, more preferably from about 55°C to about 65°C, more preferably about 60°C. In embodiments, the extension temperature is from about 60°C to about 80°C, more preferably from about 65°C to about 75°C, more preferably from about 70°C to about 75°C, more preferably about 72°C. In embodiments, the number of cycles (e.g. cycles of PCR) is from about 20 cycles to about 100 cycles, more preferably about 30 cycles. In embodiments, the concentration of DNA (or DNA derived from the sample of interest) in the PCR reaction mixture is from about 0.1 to about 500 ng / pl, more preferably from about 0.5 to about 500, 100, 50 or 25 ng / pl, more preferably about 0.5 ng / pl. In embodiments, the PCR reaction mixture comprises magnesium chloride. The concentration of magnesium chloride (MgCb) in the PCR reaction mixture may be from about 1 mM to about 5 mM, more preferably from about 1 mM to about 4.5 mM, more preferably from about 1.5 mM to about 4.5 mM, more preferably from about 1.5 mM to about 2 mM, more preferably about 1.5 mM. In embodiments, the PCR reaction mixture comprises a DNA polymerase (e.g. Taq polymerase). In embodiments, the concentration of DNA polymerase (e.g. Taq polymerase) in the PCR reaction mixture is from about 5 units / ml to about 50 units / mL more preferably from about 10 units / ml to about 40 units / ml, or from about 20 units / ml to about 30 units / ml, more preferably about 25 units / ml. In embodiments, the PCR reaction mixture deoxynucleotide trisphosphates (dNTP). In embodiments, the concentration of deoxynucleotide trisphosphates (dNTP) in the PCR reaction mixture is from about 80 pM to about 800 pM, more preferably from about 160 pM to about 600 pM, more preferably from about 200 pM to about 400 pM, more preferably about 300 pM. In embodiments, the concentration of each type-specific primer or primer pair, or the total concentration of all type-specific primers or primer pairs, in the PCR reaction mixture is about 0.5 nM to about 1000, more preferably about 0.5 nM to about 500, 200, 100, 50, 20, 10, 5, 2 or 1.5 nM, more preferably about 1 nM to about 2 nM, more preferably about 1 nM or about 1.5 nM. In embodiments, the concentration of primer pair of the invention, or each primer thereof, or the total concentration of all primers or primer pairs, in the PCR reaction mixture is from about 0.5 nM to about 1000 nM, more preferably from about 0.5 nM to about 500, 200, 100, 50, 20, 10, 5, 2 or 1.5 nM, more preferably from about 1 nM to about 2 nM, more preferably about 1 nM or about 1.5 nM. Before subjecting the sample to PCR, extraction or purification of the genomic DN A in the sample may be performed. Accordingly, genomic DNA may be extracted from the sample by a standard extraction or purification method known in the art. The methods of the invention comprise a step of detecting the product(s) of the nucleic acid amplification reaction, i.e. the amplification product(s). The amplification product(s) may be detected by any convenient means, which are well-known in the field and within the competencies of the person of ordinary skill in the art. A vast number of detection techniques are routinely employed as standard laboratory techniques and the literature has descriptions of more specialized approaches. Detection may be visualization or quantification (i.e. determination of the amount (level) of the amplification product(s)). At its simplest, the amplification product may be detected by visual inspection, e.g. by subjecting the amplification product(s) to gel electrophoresis and then visualizing the gels. Different amplification products may be detected on such gels by their differing sizes. Where it is desired to detect a plurality of amplification products by visualizing in this way, i.e. based on band size on a gel, it is desirable to use a combination of primer pairs which produce PCR products of differing sizes, so that the different products are distinguishable on the gel. However, other methods can be used to detect amplification products which do not require an amplification product size distribution. For example, gel electrophoresis can still be used, but instead of detecting the amplification product visually based on band size, the amplification product can be detected using hybridization e.g. Southern blot, or by excision of the band following by sequencing thereof. Detection may also be achieved using a quantitative or semi-quantitative method, suitable methods are well-known in the field, and any suitable method may be used. For example any of the quantitative or semi-quantitative methods described below may be used. Detection may comprise quantification of the amplification product(s). The quantification of the amplification products may be used to calculate to original concentration of the target nucleic acid. Quantification can thus be used for example to provide an estimate of the prevalence of a particular MLST or CC type in a sample. The quantification may be performed, for instance, using (or a step comprising the use of) real-time PCR. Real-time PCR monitors the amplification of DNA during PCR in real-time using fluorescent probes, allowing quantification in the exponential phase. The amplification can be performed in the presence of amplification product-specific DNA probes consisting of oligonucleotides that are labelled with a fluorescent reporter, which permit detection only after hybridization of the probe with its complementary sequence, for example as may be used in quantitative or real-time PCR. One fluorescent reporter-based amplification technique is TaqMan real time PCR. TaqMan real time PCR is a technique that uses a fluorescent probe (called “TaqMan”) to detect the amplified product. The TaqMan probe consists of an oligonucleotide with a fluorescent dye at one end and a quencher at the other end. The probe hybridizes to a target sequence between the primers and is cleaved by the polymerase during the extension step, releasing the dye from the proximity of the quencher and thus generating fluorescence. Alternatively, the quantification may be performed using digital PCR (dPCR). In digital PCR, a sample is partitioned into many individual PCR reactions (e.g. individual droplets, in the case of droplet dPCR). In effect, the original reaction is turned into many binary reactions. After counting the positive microreactions, statistics can be used to then determine the absolute quantity of the target molecule. Alternatively, the quantification may be performed by analysing the concentration of the PCR product after the PCR protocol has been performed. The concentration of the original sample may then be calculated by comparison with reference samples of known concentration. Such detection methods include for example spectrophotometry and fluorometry. In spectrophotometry, the concentration of DNA is determined by measuring the absorption of UV and / or visible light by the DNA, wherein the absorbance is proportional to the concentration. An exemplary' spectrophotometer suitable for this purpose is NanoDrop (Thermofisher). In fluorometry, the concentration of DNA is determined using fluorescent dyes that specifically bind to double-stranded DNA, with fluorescence intensity correlating to DNA concentration. An exemplary fluorometer suitable for this purpose is Qubit (Thermofisher). The quantification may be fully quantitative (for example using methods described above), or may be semi-quantitative. For example, the DNA concentration can be determined semi-quantitatively by subjecting the PCR mixture, after the PCR protocol has completed, to gel electrophoresis, and measuring the thickness or intensity of the band on the gel corresponding to the PCR product of interest. A greater thickness or intensity indicates a greater concentration of PCR product. The quality of primer pairs may be quantified by two metrics known as “specificity” and “sensitivity”. As used herein, the "specificity" of a primer pair for its target MLST type or MLST-defined clonal complex type is a measure of the extent to which the primer pair produces a clearly detectable PCR product of the correct size only after probing a sample comprising the target MLST type or MLST-defined clonal complex type, and not after probing samples that do not comprise the target MLST type or MLST-defined clonal complex type. Thus, when a primer pair is 100% specific for its target MLST type or MLST-defined clonal complex type, it is meant that, in 100% of experimental assays in which DNA of L. monocytogenes of a nontarget MLST type or MLST-defined clonal complex type is subjected to PCR with the primer pair, no clearly detectable PCR product of the correct size is detected. Specificity may be calculated as: Specificity = (True Negatives) / (True Negatives + False Positives). Specificity may also be referred to as the “true negative rate”. As used herein, the "sensitivity" of a primer pair for its target MLST type or MLST-defined clonal complex type is a measure of the extent to which the primer pair produces a clearly detectable PCR product of the correct size after probing a sample comprising the target MLST type or MLST-defined clonal complex type. Thus, when a primer pair is 100% sensitive for its target MLST type or MLST-defined clonal complex type, it is meant that, in 100% of experimental assays in which DNA of L. monocy togenes of a target MLST type or MLST-defined clonal complex type is subjected to PCR with the primer pair, clearly detectable PCR product of the correct size is detected. Sensitivity' may be calculated as follows: Sensitivity = (True Positives) / (True Positives + False Negatives). Sensitivity may also be referred to as the “true positive rate”. It is desirable for MLST type-specific, MLST-defined clonal complex type-specific, or bacterial species-specific primer pairs to have at least 90% specificity for said MLST type, MLST-defined clonal complex type, or bacterial species, respectively. All primer pairs of the invention derived from the methodology described herein demonstrate specificity and sensitivity above 90%, with a majority' of the primer pairs of the invention demonstrating 100% specificity and sensitivity. The type-specific primer pairs of the invention thus provide high quality assays for the detection of particular L. monocytogenes MLST types and MLST-defined clonal complex types. In another aspect, the invention provides a kit comprising a (i.e. one or more) primer pair(s) of the invention. In embodiments, the kit comprises (or further comprises) a PCR buffer solution, deoxynucleotide trisphosphates (dNTP), and / or a DNA polymerase. In embodiments, the DNA polymerase is Tag polymerase. In embodiments, the kit comprises (or further comprises), magnesium chloride (MgCL). In embodiments, the kit comprises (or further comprises) a pipette, electrophoresis gel material, and / or an instruction manual for the kit. The above-described MLST type and MLST-defmed clonal complex type specific PCR primer pairs have particularly advantageous utility in the context of primer sets, i.e. sets of a plurality of said PCR primer pairs, wherein each primer pair within a primer set is specific for a different MLST type or MLST-defmed clonal complex type. Such primer sets permit the simultaneous detection / identification / discrimination of multiple different MLST types and MLST-defmed clonal complex ty pes within a sample. By ‘‘simultaneously” is meant following the performance of a single nucleic acid amplification experiment. In another aspect, the invention provides a primer set comprising a least two, preferably at least three, more preferably at least 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13, most preferably 14 of the above-mentioned Listeria monocytogenes MLST type or MLST-defmed clonal complex type specific PCR primer pairs, wherein each primer pair is specific for a different Listeria monocytogenes MLST type or MLST-defmed clonal complex type as described elsewhere herein. Alternatively viewed, the primer sets of the invention comprise at least two, preferably at least three, more preferably at least 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13, most preferably 14 Listeria monocytogenes MLST type or MLST-defmed clonal complex type specific PCR primer pairs as defined in paragraphs A90) to N90), wherein each primer pair is specific for a different Listeria monocytogenes MLST type or MLST-defmed clonal complex type. Preferably, the primer sets of the invention comprise at least two, preferably at least three, more preferably at least 4, 5, 6, 7, 8, 9, 10, 11, or 12, most preferably 13 Listeria monocytogenes MLST type or MLST-defmed clonal complex type specific PCR primer pairs as defined in paragraphs A100) to N100), wherein each primer pair is specific for a different Listeria monocytogenes MLST type or MLST-defmed clonal complex type. In the primer sets of the invention, the primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types. Thus, in another aspect, the invention provides a primer set comprising 2 (or more), 3 (or more), 4 (or more), 5 (or more), 6 (or more), 7 (or more), 8 (or more), 9 (or more), 10 (or more), 11 (or more), 12 (or more), 13 (or more), or 14 (or more), preferably 14, of the following PCR primer pairs, wherein each primer pair is specific for a different Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type ST87 specific PCR primer pair of paragraph A90; a MLST type ST5 specific PCR primer pair of paragraph B90; a MLST type ST1247 specific PCR primer pair of paragraph C90; a MLST-defined clonal complex type CC8 specific PCR primer pair of paragraph D90; a MLST-defined clonal complex type CC9 specific PCR primer pair of paragraph E90; a MLST type ST7 specific PCR primer pair of paragraph F90; a MLST type ST29 specific PCR primer pair of paragraph G90; a MLST type STI 01 specific PCR primer pair of paragraph H90; a MLST type ST121 specific PCR primer pair of paragraph 190; a MLST type ST155 specific PCR primer pair of paragraph J90; a MLST type ST173 specific PCR primer pair of paragraph K90; a MLST type ST 177 specific PCR primer pair of paragraph L90; a MLST type ST425 specific PCR primer pair of paragraph M90; and a MLST type ST451 specific PCR primer pair of paragraph N90; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. In a preferred embodiment, the invention provides a primer set comprising 2 (or more), 3 (or more), 4 (or more), 5 (or more), 6 (or more), 7 (or more), 8 (or more), 9 (or more), 10 (or more), 11 (or more), 12 (or more), or 13 (or more), preferably 13, of the following PCR primer pairs, wherein each primer pair is specific for a different Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type ST87 specific PCR primer pair of paragraph A100; a MLST type ST5 specific PCR primer pair of paragraph Bl 00; a MLST type ST1247 specific PCR primer pair of paragraph C100; a MLST-defined clonal complex type CC9 specific PCR primer pair of paragraph El 00; a MLST type ST7 specific PCR primer pair of paragraph Fl 00; a MLST type ST29 specific PCR primer pair of paragraph G100; a MLST type ST101 specific PCR primer pair of paragraph H100; a MLST type STI 21 specific PCR primer pair of paragraph 1100; a MLST type ST155 specific PCR primer pair of paragraph J100; a MLST type STI 73 specific PCR primer pair of paragraph K100; a MLST type ST177 specific PCR primer pair of paragraph L100; a MLST type ST425 specific PCR primer pair of paragraph Ml 00; and a MLST type ST451 specific PCR primer pair of paragraph N100; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. It should be noted that although for time and cost-saving purposes a single primer pair per MLST or CC type may be used in the primer set of the invention, it is of course possible to use multiple PCR primer pairs per MLST or CC type. For example, a primer set of the invention may include multiple primer pairs from one or more of the paragraphs A90 to N90, orAlOO toNlOO. The particular MLST types and / or MLST-defined clonal complex types which are of most interest for the user to identify may depend on the particular circumstances of the user. For example, certain MLST types and / or MLST-defined clonal complex types may be suspected of having relatively higher prevalence in particular biological samples or geographical locations. For instance, MLST types ST87, ST5 and ST1247 may be of particular importance in certain circumstances. It may be beneficial to additionally identify the presence or absence of one or more of MLST-defined clonal complex types CC8 and CC9, and MLST type ST7. It may also be beneficial to additionally identify the presence or absence of one or more of the other MLST types described herein. Thus, in another aspect, the invention provides a primer set comprising the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multilocus sequence typing (MLST) type or MLST-defined clonal complex type: A90) an MLST type ST87 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 17 (ST87 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 18 (ST87_6 reverse); a PCR primer comprising the sequence of SEQ ID NO: 19 (ST87 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 20 (ST87 7 reverse); a PCR primer comprising the sequence of SEQ ID NO: 21 (STS 7 9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse); or a PCR primer comprising the sequence of SEQ ID NO:23 (ST8712 forward), and a PCR primer comprising the sequence of SEQ ID NO: 24 (ST87_12 reverse); and / or B90) an MLST type ST5 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: I (ST5 l 5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 2 (ST515 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 3 (ST517 forward), and a PCR primer comprising the sequence of SEQ ID NO: 4 (ST517 reverse); and / or C90) an MLST type ST 1247 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 65 (ST 1247 1 forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (ST12471 reverse); and wherein said primer set is for detecting one or more of said MLST ty pes or MLST-defined clonal complex types. Alternatively viewed, the present invention provides a primer set comprising the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type ST87 specific PCR primer pair of paragraph A90; and / or a MLST type ST5 specific PCR primer pair of paragraph B90; and / or a MLST type ST1247 specific PCR primer pair of paragraph C90; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. In embodiments, the primer set further comprises a MLST-defined clonal complex type CC8 specific PCR primer pair of paragraph D90; and / or a MLST-defined clonal complex type CC9 specific PCR primer pair of paragraph E90; and / or a MLST type ST7 specific PCR primer pair of paragraph F90; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. In embodiments, the primer set further comprises a MLST type ST29 specific PCR primer pair of paragraph G90; and / or a MLST type ST101 specific PCR primer pair of paragraph H90; and / or a MLST type ST121 specific PCR primer pair of paragraph 190; and / or a MLST type ST155 specific PCR primer pair of paragraph J90; and / or a MLST type STI 73 specific PCR primer pair of paragraph K90; and / or a MLST type ST177 specific PCR primer pair of paragraph L90; and / or a MLST type ST425 specific PCR primer pair of paragraph M90; and / or a MLST type ST451 specific PCR primer pair of paragraph N90; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. Preferably, the invention provides a primer set comprising the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type ST87 specific PCR primer pair of paragraph A100; and / or a MLST type ST5 specific PCR primer pair of paragraph B100; and / or a MLST type STI 247 specific PCR primer pair of paragraph C100; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. Preferably, the primer set further comprises a MLST-defined clonal complex type CC9 specific PCR primer pair of paragraph El 00; and / or a MLST type ST7 specific PCR primer pair of paragraph Fl 00; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. Preferably, the primer set further comprises a MLST type ST29 specific PCR primer pair of paragraph G100; and / or a MLST type ST101 specific PCR primer pair of paragraph H100; and / or a MLST type ST121 specific PCR primer pair of paragraph 1100; and / or a MLST type ST155 specific PCR primer pair of paragraph J100; and / or a MLST type ST173 specific PCR primer pair of paragraph K100; and / or a MLST type ST177 specific PCR primer pair of paragraph L100; and / or a MLST type ST425 specific PCR primer pair of paragraph M100; and / or a MLST type ST451 specific PCR primer pair of paragraph N100; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. It is demonstrated herein that a primer set of the invention comprising 4 type-specific primer pairs (referred to herein as “4-plex”) or 5 type-specific primer pairs (referred to herein as “5-plex”), wherein each primer pair is specific for a different MLST type and / or MLST-defmed clonal complex type, may be successfully incubated with a DNA from a biological sample in order to identify the presence or absence of the 4 or 5 target MLST types and / or MLST-defmed clonal complex types in the biological sample in a single PCR assay (i.e. experiment or “run”). Thus, in another aspect, the invention provides a primer set comprising 4 (or more) or 5 (or more) of the following PCR primer pairs wherein each primer pair is specific for a different Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type ST87 specific PCR primer pair of paragraph A90; a MLST type ST5 specific PCR primer pair of paragraph B90; a MLST type ST 1247 specific PCR primer pair of paragraph C90; a MLST-defmed clonal complex type CC8 specific PCR primer pair of paragraph D90; a MLST-defmed clonal complex type CC9 specific PCR primer pair of paragraph E90; a MLST type ST7 specific PCR primer pair of paragraph F90; a MLST type ST29 specific PCR primer pair of paragraph G90; a MLST type ST101 specific PCR primer pair of paragraph H90; a MLST type ST 121 specific PCR primer pair of paragraph 190; a MLST type ST155 specific PCR primer pair of paragraph J90; a MLST type STI 73 specific PCR primer pair of paragraph K90; a MLST type ST177 specific PCR primer pair of paragraph L90; a MLST type ST425 specific PCR primer pair of paragraph M90; a MLST type ST451 specific PCR primer pair of paragraph N90; and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types. In a preferred embodiment, the invention provides a primer set comprising 4 (or more) or 5 (or more) of the following PCR primer pairs, wherein each primer pair is specific for a different Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defmed clonal complex type: a MLST type ST87 specific PCR primer pair of paragraph A100; a MLST type ST5 specific PCR primer pair of paragraph Bl 00; a MLST type ST 1247 specific PCR primer pair of paragraph Cl 00; a MLST-defined clonal complex type CC9 specific PCR primer pair of paragraph El 00; a MLST type ST7 specific PCR primer pair of paragraph Fl 00; a MLST type ST29 specific PCR primer pair of paragraph G100; a MLST type ST101 specific PCR primer pair of paragraph Hl 00; a MLST type ST121 specific PCR primer pair of paragraph 1100; a MLST ty pe ST155 specific PCR primer pair of paragraph J100; a MLST ty pe ST173 specific PCR primer pair of paragraph K100; a MLST type ST177 specific PCR primer pair of paragraph L100; a MLST type ST425 specific PCR primer pair of paragraph M100; a MLST type ST451 specific PCR primer pair of paragraph N100; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. More particularly, the aforementioned 4-plex and 5-plex primer sets demonstrated herein consisted of: a first 5 primer set (5-plex) comprising primer pairs of the invention specific for types ST87, CC9, ST7, ST29 and ST173; a second 5 primer set (5-plex) comprising primer pairs of the invention specific for types ST5, CC8, ST121, ST155 and ST451; and a 4 primer set (4-plex) comprising primer pairs of the invention specific for types ST1247, ST101, ST177 and ST425. Thus, in another aspect, the invention provides a primer set comprising or consisting of the following PCR primer pairs, wherein each primer pair is specific for different a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type ST87 specific PCR primer pair of paragraph A90; a MLST-defined clonal complex type CC9 specific PCR primer pair of paragraph E90; a MLST type ST7 specific PCR primer pair of paragraph F90; a MLST type ST29 specific PCR primer pair of paragraph G90; and a MLST type ST173 specific PCR primer pair of paragraph K90; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. In a preferred embodiment, the invention provides a primer set comprising or consisting of the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type ST87 specific PCR primer pair of paragraph A100; a MLST-defined clonal complex type CC9 specific PCR primer pair of paragraph E100. a MLST type ST7 specific PCR primer pair of paragraph Fl 00; a MLST type ST29 specific PCR primer pair of paragraph G100; and a MLST type ST173 specific PCR primer pair of paragraph K100; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. In another aspect, the invention provides a primer set comprising or consisting of the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type ST5 specific PCR primer pair of paragraph B90; a MLST-defined clonal complex type CC8 specific PCR primer pair of paragraph D90; a MLST type ST121 specific PCR primer pair of paragraph 190; a MLST type ST155 specific PCR primer pair of paragraph J90; and a MLST type ST451 specific PCR primer pair of paragraph N90; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. In a preferred embodiment, the invention provides a primer set comprising or consisting of the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type ST5 specific PCR primer pair of paragraph Bl 00; a MLST type ST121 specific PCR primer pair of paragraph 1100; a MLST type ST155 specific PCR primer pair of paragraph J100; and a MLST ty pe ST451 specific PCR primer pair of paragraph N100; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. In another aspect, the invention provides a primer set comprising or consisting of the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type ST 1247 specific PCR primer pair of paragraph C90; a MLST type ST101 specific PCR primer pair of paragraph H90; a MLST type STI 77 specific PCR primer pair of paragraph L90; and a MLST type ST425 specific PCR primer pair of paragraph M90; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. In a preferred embodiment, the invention provides a primer set comprising or consisting of the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type STI 247 specific PCR primer pair of paragraph Cl 00; a MLST type ST101 specific PCR primer pair of paragraph Hl 00; a MLST type STI 77 specific PCR primer pair of paragraph LI 00; and a MLST type ST425 specific PCR primer pair of paragraph M100; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. More particularly, the first aforementioned 5-plex primer set demonstrated herein comprises the primer pairs ST87_9 (SEQ ID NOs: 21 and 22), CC913 (SEQ ID NOs: 75 and 76), ST7 4, ST2910 (SEQ ID NOs: 15 and 16) and ST173_5 (SEQ ID NOs: 45 and 46); the second aforementioned 5-plex primer set demonstrated herein comprises the primer pairs ST517 (SEQ ID NOs: 3 and 4), CC8_7 (SEQ ID NOs: 69 and 70), ST1219 (SEQ ID NOs: 29 and 30), STI55 6 (SEQ ID NOs: 35 and 36) and ST45 ty5 (SEQ ID NOs: 59 and 60); and the aforementioned 4-plex primer set demonstrated herein comprises the primer pairs ST 1247 I (SEQ ID NOs: 65 and 66), ST1012 (SEQ ID NOs: 25 and 26), STI 77 2 (SEQ ID NOs: 49 and 50), and ST425 6 (SEQ ID NOs: 55 and 56). These particular 4-plex and 5-plex primer sets comprise particularly advantageous combinations of primer pairs because each primer pair results in the production of a PCR product of a different size, which means that the presence of each product (and thus the presence of each corresponding type) can be easily detected by gel electrophoresis. Thus, in another aspect, the invention provides a primer set comprising or consisting of the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defmed clonal complex type: an MLST type ST87 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 21 (ST879 forward), and a PCR primer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse); an MLST-defmed clonal complex type CC9 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 75 (CC913 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC9 I3 reverse); an MLST type ST7 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 5 (ST7 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 6 (ST7 4 reverse); an MLST type ST29 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 15 (ST2910 forward). and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST29 J0 reverse); and an MLST type ST173 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 45 (ST1735 forward), and a PCR primer comprising the sequence of SEQ ID NO: 46 (ST173 5 reverse); and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types. In another aspect, the invention provides a primer set comprising the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defmed clonal complex type: an MLST type ST5 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 3 (ST517 forward), and a PCR primer comprising the sequence of SEQ ID NO: 4 (ST5_17 reverse); an MLST-defmed clonal complex type CC8 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 69 (CC8 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 70 (CC8 7 reverse); an MLST type STI21 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 29 (ST1219 forward), and a PCR primer comprising the sequence of SEQ ID NO: 30 (STI219 reverse); an MLST type STI55 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 35 (ST155 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 36 (ST155 6 reverse); and an MLST type ST451 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 59 (ST451_5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 60 (ST4515 reverse); and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. In another aspect, the invention provides a primer set comprising the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defmed clonal complex type: an MLST type ST1247 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 65 (ST1247 1 forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (ST1247 1 reverse); an MLST type STI01 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 25 (ST 1012 forward), and a PCR primer comprising the sequence of SEQ ID NO: 26 (ST1012 reverse); an MLST type STI77 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 49 (ST177 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 50 (ST177_2 reverse); and an MLST type ST425 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 55 (ST425 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 56 (ST425 6 reverse); and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types. It is demonstrated herein that a primer set comprising 14 type-specific primer pairs of the invention, wherein each primer pair is specific for a different MLST type and / or MLST-defmed clonal complex type, may be successfully incubated with a DNA from a biological sample in order to identify the presence or absence of the 14 target MLST types and / or MLST-defmed clonal complex types in the biological sample in a single PCR run. This primer set can be referred to as a 14-plex, or when combined with a universal primer, a 15-plex. Thus, in another aspect, the invention provides a primer set comprising or consisting of the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type ST87 specific PCR primer pair of paragraph A90; a MLST type ST5 specific PCR primer pair of paragraph B90; a MLST type ST1247 specific PCR primer pair of paragraph C90; a MLST-defined clonal complex type CC8 specific PCR primer pair of paragraph D90; a MLST-defined clonal complex type CC9 specific PCR primer pair of paragraph E90; a MLST type ST7 specific PCR primer pair of paragraph F90; a MLST type ST29 specific PCR primer pair of paragraph G90; a MLST type STI 01 specific PCR primer pair of paragraph H90; a MLST type ST121 specific PCR primer pair of paragraph 190; a MLST type ST155 specific PCR primer pair of paragraph J90; a MLST type ST173 specific PCR primer pair of paragraph K90; a MLST type ST177 specific PCR primer pair of paragraph L90; a MLST type ST425 specific PCR primer pair of paragraph M90; and a MLST type ST451 specific PCR primer pair of paragraph N90; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. In a preferred embodiment, the invention provides a primer set comprising or consisting of the following PCR primer pairs, wherein each primer pair is specific for a Lisle ria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type: a MLST type ST87 specific PCR primer pair of paragraph A100; a MLST type ST5 specific PCR primer pair of paragraph Bl 00; a MLST type ST 1247 specific PCR primer pair of paragraph Cl 00; a MLST-defined clonal complex type CC9 specific PCR primer pair of paragraph E100; a MLST type ST7 specific PCR primer pair of paragraph Fl 00; a MLST type ST29 specific PCR primer pair of paragraph G100; a MLST type ST101 specific PCR primer pair of paragraph H100; a MLST type STI 21 specific PCR primer pair of paragraph 1100; a MLST type ST155 specific PCR primer pair of paragraph J100; a MLST type STI 73 specific PCR primer pair of paragraph K100; a MLST type ST177 specific PCR primer pair of paragraph L100; a MLST type ST425 specific PCR primer pair of paragraph M100; and a MLST type ST451 specific PCR primer pair of paragraph N100; and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. More particularly, the 15-plex primer set demonstrated herein comprises the 14 type-specific primer pairs: ST879 (SEQ ID NOs: 21 or 22), ST5 17 (SEQ ID NOs: 3 and 4), ST1247 1 (SEQ ID NOs: 65 and 66), CC86 (SEQ ID NOs: 67 and 68), CC913 (SEQ ID NOs: 75 and 76), ST7 4 (SEQ ID NOs: 5 and 6), ST2910 (SEQ ID NOs: 15 and 16), ST 1012 (SEQ ID NOs: 25 and 26), ST121 9 (SEQ ID NOs: 29 and 30), ST155 6 (SEQ ID NOs: 35 and 36), STI73_5 (SEQ ID NOs: 45 and 46), STI 77 J (SEQ ID NOs: 49 and 50), ST425 6 (SEQ ID NOs: 55 and 56) and ST451 5 (SEQ ID NOs: 59 and 60). This particular combination of primer pairs is particularly advantageous because each primer pair results in the production of a PCR product of a different size, which means that the presence of each product (and thus the presence of each corresponding type) can be easily detected by gel electrophoresis. Thus, in another aspect, the invention provides a primer set comprising or consisting of the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defmed clonal complex type: an MLST type ST87 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 21 (STS 7 9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse); an MLST type ST5 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 3 (ST517 forward), and a PCR primer comprising the sequence of SEQ ID NO: 4 (ST517 reverse); an MLST type ST1247 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 65 (STI247 1 forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (ST1247 J reverse); an MLST-defmed clonal complex ty pe CC8 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 67 (CC8 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 68 (CC8 6 reverse); an MLST-defmed clonal complex type CC9 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 75 (CC9 13 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC9 13 reverse); an MLST type ST7 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 5 (ST74 forward), and a PCR primer comprising the sequence of SEQ ID NO: 6 (ST7_4 reverse); an MLST type ST29 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 15 (ST29 10 forward), and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST2910 reverse); an MLST type STI01 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 25 (ST1012 forward), and a PCR primer comprising the sequence of SEQ ID NO: 26 (STI012 reverse); an MLST type ST 121 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 29 (ST121_9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 30 (ST1219 reverse); an MLST type STI55 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 35 (ST155 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 36 (ST155_6 reverse); an MLST type ST173 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 45 (ST 173 5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 46 (ST173 5 reverse); an MLST type STI77 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 49 (ST177 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 50 (ST177_2 reverse); an MLST type ST425 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 55 (ST425 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 56 (ST425 6 reverse); and an MLST type ST451 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 59 (ST4515 forward), and a PCR primer comprising the sequence of SEQ ID NO: 60 (ST4515 reverse); and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types. The primer sets of the invention may further comprise one or more universal primer pairs. By universal primer pair is meant a primer pair that is a Listeria monocytogenes species specific PCR primer pair. A universal primer pair is thus a primer pair which targets a genomic DNA region that is present in all strains of L. monocytogenes, i.e. it is an L. monocytogenes species-specific primer pair. The methods of the invention may further comprise the inclusion of a universal primer pair in the nucleic acid amplification reaction. A universal primer pair may be used to confirm that the sample comprises L. monocytogenes. A universal primer pair can therefore be added to a primer set in order to provide further support for positive results using the typespecific primer pairs of the invention. L. monocytogenes species-specific universal primer pairs are known in the art, and so it will be appreciated that any such universal (i.e. L. monocytogenes species-specific) primer pair could be used in the method or included in the primer sets of the invention. The present inventors have designed three universal primer pairs named Univ_3 (SEQ ID NOs: 77 and 78), lm\ 6 (SEQ ID NOs: 79 and 80) and Univ_7 (SEQ ID NOs: 81 and 82), which are further provided as aspects of the invention. Univ6 (SEQ ID NOs: 79 and 80) is especially preferred. Preferably, the Listeria monocytogenes species specific PCR primer pair primer pair comprises a PCR primer comprising the sequence of SEQ ID NO: 77 (Univ_3 forward), and a PCR primer comprising the sequence of SEQ ID NO: 78 (Univ_3 reverse); a PCR primer comprising the sequence of SEQ ID NO: 79 (Uni\6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 80 (Lni\ 6 reverse); or a PCR primer comprising the sequence of SEQ ID NO: 81 (Univ_7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 82 (Univ_7 reverse). More preferably, the Listeria monocytogenes species specific PCR primer pair primer pair comprises a PCR primer comprising the sequence of SEQ ID NO: 79 (Uni\ 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 80 (Univ O reverse). In the context of the present invention, the universal primers described herein do not have a specificity value, because they are not intended to be specific for a particular MLST type or MLST-defined clonal complex type. The use of the term “sensitivity” applies similarly to the universal primers disclosed herein. In particular, the “sensitivity” of a universal primer pair described herein is a measure of the ability of the primer pair to produce a clearly detectable PCR product of the correct size after probing a sample comprising DNA from L. monocytogenes (of any strain). Thus, when a universal primer pair described herein is 100% specific, it is meant that, in 100% of experimental assays in which DNA of L. monocytogenes (of any strain) is subjected to PCR with the primer pair clearly detectable PCR product of the correct size is detected. In another aspect, the invention provides a kit comprising the primer set of the invention. Preferred and optional features of the methods and kits described elsewhere herein apply mutatis mutandis to these methods and kits. 5 The Table below provides primer pairs of the invention. The pairs can be determined by their names. In particular, name of each primer in a pair is identical aside from the final letter of the name, which is used to designate whether the primer is the forward primer (L) or the reverse primer (R) of the pair. All nucleotide sequences are recited herein from 5' to 3' in line with convention in this technical field. Table A : SEQ ID NO: Primer Sequence (5' to 3') Length Tm GC% PCR product length (nt) 1 ST515L CCAGTGATCCACAACCCGAA 20 59.964 55 571 2 ST5J5JI G A TGTT A GC A GG GTGT A—* X A A A-J A A A-x A A-J xA A—* X A A^J A— / A—z A A-J A 20 60.036 55 571 3 ST5J7J. ACATTGCTGCGACACTCAGA 20 59.966 50 786 4 ST517R ACGGCTTGGAAACGAAAAGC 20 59.97 50 786 5 ST74L GATGCGAAGGTAGGGTTGCT 20 60.108 55 124 6 ST74R TGCTGACCACCACCAAAAGA 20 59.743 50 124 7 ST7_7_L TCACTTCCGATACGCAGAGC 20 59.899 55 285 8 ST7_7_R AGGGAATCCAGTGCGTCTTG 20 60.036 55 285 9 ST7I0L CCGGCATTTTTGGAATTCCCA 21 59.722 47.619 159 10 ST7K^ TCTTCGGCAGGGTTAACCAT 20 59.011 50 159 11 ST29 7 L GCCGATATTCGCGCAACATT 20 60.041 50 125 12 ST297R AGGTTGCCAGTACGGACTTG 20 59.965 55 125 13 ST29 9 L ACGGAGGTGCAAAGTGGAAT 20 59.89 50 788 14 ST29 9 R TACGTCCGTGAAAGGCATCG 20 60.457 55 788 15 ST29I0L TGCTGGAGGTTTTAGCGAGG 20 60.036 55 569 16 ST29I0R ATGCAAGAAAAATCGCGCGT 20 60.11 45 569 17 ST876L GGGGGATAGGTGGTA AGAGG A~x A—J A~x A-J xA A xA A—* A-x A A-J A-J A xAxA A-J xA A-J A-x 20 60.319 60 140 18 ST87 6 R GATATCTAGCCCGAGTGCCG 20 59.829 60 140 19 ST87 7 L ATGTTGATGAGAACCCGCGT 20 60.036 50 122 20 ST87 7 R CCCGGTTCCAAAGCTACCAT 20 60.034 55 122 21 ST87 9 L CGCCGTATCAACCATGCTTC 20 59.695 55 289 22 ST87_9_R AACGAAAACAAGGGAAGCGC 20 59.97 50 289 23 ST87J2L GGTGA AGATGTGGAGGAGGT A-x A-' A AJ x AxA A-x x A A A-x A ^<J A-x x A A-x A-xX A A-x A-x A 20 59.963 55 568 24 ST87I2R TGGGTGGTGGA A AGAGATGG a A-J aJ Ax 1 AJ Ax 1 AJ xJ jgax^A-xaAJ gaaJxa J aJ AJ 20 60.035 55 568 25 ST1012L TCGAGGCTGGTGAAACAAGT 20 59.532 50 71 26 ST1012R TCCTGTTGCAACGCTCTCTT 20 59.893 50 71 27 ST1215L TGTGCGGAAGGAGTTTGGAG 20 60.25 55 78 28 ST1215R TCGTTTAACCCGCCTCGAAA 20 59.967 50 78 29 ST121_9_L GGCGTTCAAAATGTGGCTGA 20 59.686 50 138 30 ST121_9_R TGAACGCATAACCCCGCTAA 20 59.75 50 138 31 ST121_11_L A ATCA A AGrrcrCTCGrTAC ZZIk JL >lZ■■X 11 x—' JL Xk-z A J~ Il »k-' 20 60.107 55 368 32 ST12111R CTTTGGTGTGAACTCGCGTG 20 60.042 55 368 33 ST12112L ATCCGCATATTTCGAGCCCC 20 60.322 55 243 34 ST12112R ACAGTGGAAGGGGCAAAAGT 20 59.738 50 243 35 ST1556L CATGTGAGATGCCACCCTCA 20 59.746 55 245 36 ST 155 6 R GGGCCAAAACTTCCCCTTCT 20 60.179 55 245 37 ST155_10_L ACGTTTCAGACCGTCAAGCT 20 59.896 50 429 38 STI5510R CCTCCACAATCACTCGGCTT 20 60.036 55 429 39 ST15512L AATCGCCAAAGTGCACCAAC 20 59.968 50 666 40 ST15512R AACCGAACGAAAACAAGGCG 20 59.972 50 666 41 ST1732L GGTAAAGCTGGAACGGGGAA 20 59.963 55 811 42 ST1732R ACTCACATTGATCGGCGGTT 20 60.036 50 811 43 ST173_4_L ATTGGCTTGCGGTCAGATGA 20 60.035 50 624 44 STI734_R GGCATCGTCCGGAATTTTCG 20 59.972 55 624 45 ST173_5_L AACCGACTTGGCTTTGTGGA 20 60.107 50 482 46 ST1735R ACCTCGATAGCAGCAATCGG 20 59.967 55 482 47 ST17311L TGTGCGTACCTAGGTGGAGA 20 59.961 55 350 48 ST17311R GGCGCATTTGGAAGATGGTC 20 59.899 55 350 49 ST1772L CAAGCAACTACACCCACGGA 20 60.25 55 154 50 ST177_2_R TTGTCATTAGCCCCGCCTTT 20 59.961 50 154 51 STI774_L A G ( A A r TC CGGTT A C A GGTG Z Lx_J >lZit JL K-' XkJ JL JL J~ Ik x> z>L JL x«J 20 59.965 55 485 52 ST177_4_R CTTCACGCCGTCCTCGAATA 20 59.9 55 485 53 ST17714L CAGCTACGGTTGAGTGGGAG 20 60.109 60 788 54 ST17714R TTGCTCCGGTTTTTGCTTCG 20 59.97 50 788 55 ST425_6_L GGGTTTGGTGGGTAACTGGT 20 59.813 55 680 56 ST4256R CTGCTTCGTTTCTCTGGGGA 20 59.678 55 680 57 ST425J2L TTTATCGCAGAACCAGCCGT 20 60.037 50 152 58 ST425J2JI CGCGGTGAAAAACTAGTGCC 20 60.11 55 152 59 ST451 5 L TTGCAAGGGTATCCACCGTC JL JL XkJ ' -I- L.Z X XkJ *k-J A Z X A x-z’ XyZ >k * X—* X—I A X--" 20 60.036 55 641 60 ST451_5_R AGCAAAAGCACCGGCAAATT 20 59.893 45 641 61 ST4516L TTGCGGTGTCATCTCTACCC 20 59.465 55 559 62 ST4516R TAAGACTCGCGCATGTTGCT 20 60.39 50 559 63 ST45110L ATGCCATTAACGACGCTGGA 20 60.108 50 156 64 ST45110R ATTTCATCCGCACGCCAAAG 20 59.829 50 156 65 STI247 IJ. CCTGCGTCTGTGATTATGCA 20 58.34 50 409 66 ST12471R CTCCTTCGTCCGAGTCATTC 20 57.8 55 409 67 CC86L ATCGTGCAGGCGAAACAGTA 20 60.038 50 131 68 CC86R GATAAACCTGTCACCGCCCA 20 60.036 55 131 69 CC87L GCCGGAAGTGTTTTTCTCATGT 22 59.707 45.455 430 70 CC87R TCGAGTTGCAACTAGTACGGA 21 58.846 47.619 430 71 CC98L GGTGGTTCTGGTCTTGCCTT 20 60.179 55 261 72 CC9 8 R ACCGGATCTGTTTGTTCGATTG 22 59.258 45.455 261 73 AGGGAGCGGAAAACTTCTAAGT 22 59.362 45.455 327 74 CC99R TCGGCTTGTTCGGCATACTT 20 60.037 50 327 75 CC913L TGAGTCTCGCTTGTTGCCTT 20 59.893 50 670 76 CC913R ATGCCTTGCACTTGGGCTAT 20 60.033 50 670 77 Univ_3_L GGATTGGAGCGAATAAGTTGGC 22 78 Univ 3 R GGATGAGTTCTCAGCCGCAA 20 79 Utuv6L TCCACGGTGACTTAACGCAA 20 80 Umv6R ATTGGCCTGCAAATGCTTCG 20 81 Univ_7_L CAGTTGGTAGAGCAATCGGC 20 82 Univ_7_R TCCACAGGCAGGACTCGAA 19 The invention will be further described with reference to the following non-limiting Examples in which: Figure 1 shows the workflow for the design of type-specific PCR primers as performed in Example 4. Figure 2 shows the 1.5% agarose gel images for the 15-plex experiment of Example 6. The numbers 1 to 51 indicate the isolate of Table 1 with which the 15-plex primer set was incubated. EXAMPLES Example 1 : Methodology Datasets: The long type-specific k-mers, each specific to one of 17 different MLST ty pes (designated ST) (ST5, ST7, ST8, ST9, ST29, ST37, ST87, ST101, ST121, ST155, ST173, ST177, ST425, ST451, ST551, ST580, ST1247), were identified starting from a large public Illumina database containing the genome sequences of L. monocytogenes strains. Among them were ST1247 isolates, which received widespread resonance in Estonian press in 2019. For experimental validation of the long type-specific k-mers and the associated primer pairs, the inventors obtained a panel of 51 samples (i.e. genome sequences from 51 isolates) of the 17 different MLST types mentioned above (3 for each MLST type). For each of the 17 MLST types, there were three isolates, thus providing a total of 51 samples (Table 1). DNA samples of isolates were obtained from the Estonian Veterinary' and Food Laboratory (https: / / www.vetlab.ee / et). where the MLST types of these samples had been previously determined by genome sequencing. These samples of L. monocytogenes were collected in Estonia. Determination of MLST types To determine the MLST types of the downloaded public strains that were used in the method, the reads were cleaned of low-quality nucleotides and adapter sequences were removed. For this, the fastp program (Chen et al., 2018, “fastp: an ultra-fast all-in-one FASTQ pre-processor.”, Bioinformatics, Sep 1 ;34(17):i884-i890) was used with the following parameters: minimum reading length 50 nucleotides (—length required 50), average quality 30 (—cut mean quality) 30), —cut_tail —cutj'ront — detect adapter for_pe. In the next step, the purified reads were assembled with SPAdes (Prjibelski et al., 2020, “Using SPAdes De Novo Assembler”, Curr Protoc Bioinformatics, Jun;70(l):E102.) into genomic contig sequences using the —isolate parameter. Samples with a longest contig of <50,000 nucleotides and an average sequencing coverage of less than 20 were filtered out from the results. The final step was the determination of the MLST type by the MLST (https: / / github.com / tseemaim / mlst) program, for which the default parameters and the PubMLST dataset (https: / / pubmlst.org / ) containing >2300 different MLST types of L. monocytogenes were used. Table 1. DNA isolates (samples) used Isolate (sample) number MLST type or MLST-defined clonal complex type 1 to 3 ST87 4 to 6 ST8 7 to 9 ST9 10 to 12 ST37 13 to 15 ST155 16 to 18 ST101 19 to 21 ST121 22 to 24 ST5 25 to 27 ST551 28 to 30 ST580 31 to 33 ST177 34 to 36 ST451 37 to 39 ST173 40 to 42 ST425 43 to 45 ST7 46 to 48 ST29 49 to 51 ST1247 Example 2 : Identification of short type-specific k-mers After assigning MLST types to all samples loaded in the database, the inventors searched for short type-specific k-mers. The inventors extracted from the Illumina database up to 10 samples for each MLST type, to a total number of 155 samples. For MLST types ST173, ST580 and ST1247, the inventors used fewer than 10 samples, since there were simply no more samples in the database forthose MLST types. Figure 3 shows the structure of the workflow, by which it was possible to create lists of short type-specific k-mers of samples from targets and non-targets. One of the types was chosen as the target, and the rest remained among the non-targets. Tire work consisted of the following stages: 1. As a first step, the inventors created a list of short k-mers for each of the 155 samples. The inventors used the Genometester4 package program glistmaker, for which the length of the k-mer was set to 32 nucleotides (—wordlength 32). 2. To create a common list of non-targets, the Genometester4 package program w as used with glistcompare parameters —union and a frequency limit value of 5 (—cutoff 5) for short k-mers. The frequency limit value excludes very rare (<5 times) short k-mers, which are most likely sequencing errors. The result was a combined list of all possible short k-mers represented in non-target sample readings. 3. Similarly to the above, using the Genometester4 package program glistcompare, a list of short k-mers was created with the parameters —intersection and the frequency limit value of short k-mers 5 (—cutoff 5), which selects k-mers definitively present in all readings of a given MLST type, i.e. those short k-mers that were not represented in all samples were removed. This was necessary in order to eliminate short k-mers which are present only in a particular sample and are therefore not characteristic of all members of a given type. Hie result was a common list of short k-mers for each type (17) target samples. 4. Next, the inventors compared the common list of each type with the combined list of non-targets (from the other 16 MLST types) to exclude short k-mers that are also present in types other than the target. To do this, the inventors used the Genometester4 package program with the glistcompare parameter —difference. The result was a list of short type-specific k-mers, whose members did not appear in any sample of the other 16 MLST types and were at the same time represented in all samples of the target type under study. As a result of the analysis, the inventors identified short type-specific k-mers for all MLST types and MLST-defined clonal complex types, as shown in the fourth column in Table 2 below. Hie median number of short type-specific k-mers per type was 47,007. Table 2 MLST type or MLST-defined clonal complex type Number of samples in database Number of samples used Short typespecific k-mers (32 nt) Long typespecific k-mers (>60 nt) PCR primer pairs for long type-specific k-mers (PCR product 60-1000 nt) PCR primer pairs after filtering tested in the Examples ST5 3119 10 161122 1928 984 2 ST7 1431 10 64594 687 307 3 ST8* 569 10 153 1 0 0 St9# 1445 10 47 0 0 0 ST29 252 10 39010 440 206 3 ST37 269 10 46426 444 202 0 ST87 345 10 103565 1302 704 4 ST101 187 10 32327 429 195 1 ST121 623 10 100178 828 492 4 ST155 1367 10 85948 627 296 3 ST 173 5 5 107450 689 319 4 ST 177 13 10 57056 574 262 3 ST425 24 10 41904 444 201 2 ST451 163 10 52729 694 315 3 ST551* 35 10 789 18 3 0 ST580# 2 2 1694 24 6 0 ST1247* 8 8 618 11 5 1 CC8* 612 28 65936 581 253 2 CC9# 1447 12 47007 533 214 3 *MLST types ST8, ST551 and ST1247 are part of MLST-defmed clonal complex type CC8. Thus, the combined set of samples used in the workflow for ST8, ST551 and ST 1247 were used in the workflow for CC8. #MLST types ST9 and ST580 are part of MLST-defmed clonal complex type CC9. Thus, the combined set of samples used in the workflow for ST9 and ST580 were used in the workflow for CC9. Example 3 : Identification of universal k-mers The inventors determined that it would be beneficial to identify genomic regions 5 indicative of the presence of L. monocytogenes in a sample, regardless of the MLST type or MLST-defmed clonal complex type: in other words, to find universal regions that are shared by all known L monocytogenes samples. For this task, the inventors were referenced 27,221 samples of purified readings and, using the Genometester4 package program glistcompare. create a common list of k-mers with —intersection and k-mer frequency limit value 5 (—cutoff 5). Example 4 : Design of type-specific PCR primers The PCR primer design workflow is graphically described in Figure I. The work consisted of the following stages: 1. In order to find type-specific genome regions for which PCR primers could be designed, the short type-specific k-mers had to be placed on genome sequencing and the corresponding coordinates had to be output. For this purpose, the NCBI BLAST (Altschul et al., 1997, “Gapped BLAST and PSI-BLAST: anew generation of protein database search programs”, Nucleic Acids Res, Sep 1:25( 17):3389-402) package program used a blastn alignment percentage of 100 (-pcrc identity 100) and a query-' sequence coverage percentage of 100 (-qcovhsp_perc 100). 2. Next, the short type-specific k-mers which overlapped with one another were merged into longer regions based on coordinates. Considering the recommended minimum (two primer lengths) and maximum (<1000 nucleotide) product lengths for the PCR methodology, tire inventors set the range to 60-1000. Shorter regions or single-positioned k-mers were removed from the selection. The result was a median value of 551 long ty pe-specific k-mers across all types in Table 2. 3. For each long type-specific k-mer, the inventors tried to design PCR primers with the Primer3 program (Koressaar et al., 2018, “Primer3_masker: integrating masking of template sequence with primer design software”, Bioinformatics, Jun 1:34(11):1937-1938). In general, they used the program parameters with default values except for the primer length (minimum 18, optimal 20, maximum 22 nucleotides), the maximum difference between the melting points of the primer pair (T m) of 3°C and the product length range of 60-1000 nucleotides. The result was 4964 primer pairs as a median number of 214. 4. Although type-specific k-mers do not occur with 100% identity in any non-target ty pe genome, the two sequences can differ by just one nucleotide. For this reason, the inventors launched a new NCBI BLAST package program blastn search, where they aligned all type-specific PCR primers to genomic sequences of non-target types. More specifically, for each MLST or CC type of Table 2, the inventors randomly selected 20 assembled full genome sequences from 27,221 samples, and a separate blast index was created for each MLST or CC type. The final primer pairs were then aligned against all other (i.e. non-target) MLST or CC type blast indexes. Because the inventors also allowed alignments with less than 100 percent in the search, they only defined the 100 (-qcov hsp perc 100) parameter for the percentage coverage of the query sequence. 5. The result files were analyzed, and final primer pairs were selected only if satisfying the following conditions: a. if at least one mate did not give alignments to any non-target genome of the type; b. if both primers in the pair did provide alignment from a non-target type's genome, but not a distance between 1-1000 nucleotides; or c. if both primers in the pair did provide alignment from a non-target type genome and a distance between 1 and 1000 nucleotides, but the difference (mutation) lies within the last six nucleotides at the 3' end of at least one primer. In the case of MLST types ST8, ST9, ST551 and ST580, it was not possible to find a sufficient number of specific regions against which to design PCR primers. MLST types ST8, ST551 and ST1247 are part of the MLST-defined clonal complex type CC8. MLST types ST9 and ST580 are part of the MLST-defined clonal complex type CC9. Based on this, the inventors collated the samples of the aforementioned MLST ty pes under the corresponding MLST-defined clonal complex type, and to repeat the methodology, wherein instead of searching for long k-mers specific for an MLST type, the long k-mers specific to the MLST-defined clonal complex type were identified, and primer pairs were designed for them. In total, 38 type-specific primer pairs were filtered for and tested in the subsequent Examples. The inventors also identified three pairs of universal primers (for confirming the presence of L. monocytogenes at the species level). NCBI's BLAST package blastn program was used to confirm that the primer pairs provided 100% identity against all other (i.e. non-target) MSLT and CC type blast indexes as generated in step 4. Example 5 : PCR single-plex experiments The inventors conducted laboratory experiments to assess the properties of the 38 type-specific PCR primer pairs that the inventors had designed and selected (Table A). Single-plex reactions (where only one primer pair is used at a time) were conducted with each primer pair in the presence of DNA from the 51 different L. monocytogenes isolates samples (Table 1). The 51 isolates consisted of three different isolates for each of 17 different MLST types and MLST-defined clonal complex types. The results of these single-plex reactions are shown in Table 3, in which each cell represents one single-plex reaction. The operation of the universal primers was similarly assessed and under the same reaction conditions. Single-plex reaction ingredients and protocol: 10 pl reaction volume: lOx buffer (Solis Biodyne) Ipl 25 mM MgC12 (Solis Biodyne)0,6 pl 2.5 mM dNTP mix (Solis Biodyne) 1.2 pl HotFirePol (Solis Biodyne) 0.1 pl MQ water 5,1 pl Primers (lOnM (5 F+5 R))l pl DNA (5ng / pl) 1 p.1 PCR protocol: 95°C 15 min 95°C 30 s, 60°C 30 s, 72°C 40 s -+ 30X 72°C 10 min 4°C forever The results of the reactions were visualized on 1.5% agarose gel. The results of the single-plex PCR tests can be seen in Table 3 in tabular form. A total of 41 different primer pairs were tested on 51 different DNA samples (Isolates 1 -51 of Table 1). Three primer pairs were universal primers (Univ_3 (SEQ ID NOs: 77 and 78), Univ_6 (SEQ ID NOs: 79 and 80), L'ni\ 7 (SEQ ID NOs: 81 and 82), and the remaining 38 were type-specific primer pairs. Boxes labelled (+) represent the detection of a clear PCR product of the correct size on the gel after probing the indicated DNA sample with the indicated primer pair. Empty boxes indicate the lack of a clearly detectable PCR product of the correct size on the gel after probing the indicated DNA sample with the indicated primer pair. As shown in Table 3, 2091 PCR single-plex experiments were carried out, of which 2081 (99.52%) were successful, i.e. gave the expected result (true positive or true negative). This demonstrates the advantageous utility of the primer pairs on an individual basis and m the context of primer sets. Table 3 - Results of single-plex tests. Isolate Numbers 1 to 51 indicate the isolates (samples) of Table 1.+ = clear PCR product of the correct size detected. Empty) box = clear PCR product of the correct size not detected. Isolate No. —> 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Primer Pair | ST5J5 ST5J7 ST74 ST7_7 ST7_10 ST29_7 + + + ST29_9 ST29J0 ST87 6 + + + ST877 + + + ST879 + + + ST87_12 + + + ST101_2 + + + ST1215 ST1219 ST121_11 ST12112 ST 15 56 + + + ST15510 + + + ST155_12 + + + ST173_2 ST173_4 ST 173 J ST17311 ST177_2 ST177_4 ST17714 ST425_6 ST425J2 ST451J ST451 6 ST45110 ST1247_1 CC8_6 + + + + CC8_7 + + + + CC9 8 + + + CC9 9 + + + CC9 13 + + + Univ_3 + + + + + + + + + + + + + + + + + Univ_6 + + + + + + + + + + + + + + + + + + Univ_7 + + + + + + + + + + + + + + + + + + Isolate No. —> 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Isolate No. —» 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 ST515 + + + ST5_17 + + + ST7 4 ST7 7 ST7I0 ST297 ST29_9 ST29_10 ST876 + + + ST87_7 STS 7 9 ST87J2 ST101_2 ST121_5 + + + ST121_9 + + + ST12111 + + + ST12112 + + + ST 155^6 STI55JO ST15512 ST173_2 ST173_4 ST173_5 ST17311 ST 177 2 + + + ST 177_4 + + + ST17714 + + + ST425_6 ST42512 ST451_5 + + + ST4516 + + + ST451_10 + + + STI247J CC8_6 + + + CC8_7 + + + CC9_8 + + + CC9_9 + + + CC913 + + + Uni\3 + + + + + + + + + + + + + + + + + + Univ6 + + + + + + + + + + + + + + + + + + Univ_7 + + + + + + + + + + + + + + + + + + Isolate No. —► 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 Isolate No. —► 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 ST515 ST5_17 ST7_4 + + + ST7 7 + + + ST7J0 + + + ST29_7 + + + ST29_9 + + + ST29_10 + + + ST87_6 ST877 ST87 9 ST87J2 ST1012 ST121_5 ST121_9 ST12111 ST121_12 STI55 6 ST 155 10 ST15512 ST173_2 + + + ST173_4 + + + ST173_5 + + + ST17311 + + + STI77 2 ST177_4 ST17714 ST425_6 + + + ST42512 + + + ST451_5 ST4516 ST451_10 ST1247J + + + CC8_6 + + + CC8_7 + + + CC9_8 CC9_9 CC9_13 Univ3 + + + + + + + + + + + + + + + Univ_6 + + + + + + + + + + + + + + + Univ_7 + + + + + + + + + + + + + + Isolate No. —► 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 Almost all of the primer pairs resulted in clear, detectable PCR product of the correct size when, and only when, probing a sample containing the MLST / CC type against which the primer pair was specifically designed, which demonstrates the markedly high specificity and sensitivity of the primer pairs. Primer pairs CC86 and ST876 produced a detectable PCR product when probing a sample containing the MLST / CC type against which the primer pair was specifically designed, and also produced faintly detectable and / or incorrectly sized PCR products when probing 1 to 3 other samples. Given the faint and / or incorrectly sized signal, this does not detract from the utility of the primer pairs as MLST or CC type specific primer pairs. Primer pairs CC8 6 and CC8 7 produced a detectable PCR product following application to isolates 4 to 6 (containing ST 8), isolates 25-27 (containing ST 551) and isolates 49 to 51 (containing ST 1247), all of which are part of the MLST-defined clonal complex type CC8, as well as isolate 7 (containing ST 9). Primer pairs CC9 8, CC9 9, and CC913 produced a detectable PCR product following application to isolates 7 to 9 (containing ST 9), and isolates 28-30 (containing ST 580), all of which are part of the MLST-defined clonal complex type CC9. Primer pair ST29 7 produced a detectable PCR product following application to isolates 46 to 48 (containing ST 29) and also isolates 1 to 3 (containing ST 87). Primer pair ST87 6 produced a detectable PCR product following application to isolates 1 to 3 (containing ST 87), and also isolates 22 to 24 (containing ST 5). As expected, the species specific Universal primer pairs produced detectable signal after probing substantially all isolates. The specificity and sensitivity values of the primer pairs are provided in Table 4. The column of specificity of the table indicates the ability of the primer pair to distinguish a particular type from the rest, that is, the primer pair must not give a PCR product on any other type. Sensitivity indicates how well the primer pair identified the correct type. All primer pairs demonstrated specificity and sensitivity above 90%. Table 4 - Specificity and Sensitivity value of each primer pair Primer pair Specificity (%) Sensitivity (%) ST5 15 100 100 ST5 17 100 100 ST7 4 100 100 ST7 7 100 100 ST7 10 100 100 ST29 7 94 100 ST29 9 100 100 ST29 10 100 100 ST87 6 94 100 ST87 7 100 100 ST87 9 100 100 ST87 12 100 100 ST101 2 100 100 ST121 5 100 100 ST121 9 100 100 ST121 11 100 100 ST121 12 100 100 ST155 6 100 100 ST155 10 100 100 ST155 12 100 100 ST173 2 100 100 ST173 4 100 100 ST173 5 100 100 ST173 11 100 100 ST177 2 100 100 ST177 4 100 100 ST177 14 100 100 ST425 6 100 100 ST425 12 100 100 ST451 5 100 100 ST451 6 100 100 ST451 10 100 100 ST1247 1 100 100 CC8 6 98 100 CC8 7 98 100 CC9 8 100 100 CC9 9 100 100 pro 13 100 100 Univ 3 NA 98 Univ 6 NA 100 Univ 7 NA 98 Example 6 : PCR multiplex experiments In multiplex PCR experiments, the desired number of primer pairs are mixed together (as a primer set) in one reaction. In practice, bands of several products may be detected on a single gel, so it is advantageous if the lengths of the PCR products of different primer pairs are different enough to be discriminated visually. 4-plex and 5-plex experiments The inventors prepared three different primer sets, each comprising 4 or 5 pairs of primers. To do this, based on the results of previous single-plex experiments, the inventors selected primer pairs whose product lengths would be sufficiently distinguishable from each other (Table 5). The inventors also checked with the MultiPLX (Kaplinski et al., 2005, “MultiPLX: automatic grouping and evaluation of PCR primers”, Bioinformatics, Volume 21, Issue 8, Pages 1701-1702) program (parameters -cutoffl -3.0 -cutoff? -JO -cutoff3 -13.0) that primer pairs do not create strong secondary structures among themselves, which can negatively affect the success of PCR. As a result, the inventors formed three different sets of primers, with five pairs of primers in two and four in one (Table 5). For the reaction, mixtures of 4 or 5 pairs of primers were mixed together and experiments were carried out on the DNA of all 51 isolates. Table 5 - Primer pairs and expected product lengths used in the 4-plex and 5-plex test Primer Set Primer pair PCR product length (nt) Primer Set I ST7_4 124 ST87_9 289 STI 73 J 482 ST2910 569 CC9_13 670 Primer Set II ST121_9 138 ST155_6 245 CC87 430 ST451J5 641 ST5_17 786 Primer Set III ST101_2 71 ST177_2 154 ST1247_1 409 ST425 6 680 5-plex reaction ingredients and protocol: 10 pl reaction volume: lOx buffer (Solis Biodyne) 1 pl 25 mM MgC12 (Solis Biodyne) 0,6 pl 2.5 mM dNTP mix (Solis Biodyne) 1.2 pl Hot Fire Pol (Solis Biodyne)0,l pl MQ water 4.6 pl Primers (4-5 pairs mixed together)(10nM)1.5pl DNA (5ng / pl) 1 pl PCR protocol: 95°C 15 min 95°C 30 s, 58°C 30 s, 72°C 40 s 3IX 72°C 10 min 4°C forever The results of the reactions were visualized on 1.5% agarose gel. The results of the 5-plex multiplex PCR experiment can be seen in Table 6. Table 6 - Results of 5-plex tests. Isolate Numbers 1 to 51 indicate the isolates (samples) of Table 1. + = clear PCR product of the correct size detected. Empty box = clear PCR product of the correct size not detected. Isolate No. -+ 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Set I + + + + + + Set II + + + + + + + Set III + + + Univ_6 + + + + + + + + + + + + + + + + + + Isolate No. -+ 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 Set I + + + Set II + + + + + + + + + + + + Set III + + + Univ_6 + + + + + + + + + + + + + + + + + + Isolate No. -+ 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 Set I + + + + + + + + + Set II + + + Set III + + + + + + Univ_6 + + + + + + + + + + + + + + + As shown in Table 6, Primer Sets I, II and III produced clearly detectable PCR products of the expected sizes after incubation with isolates comprising the target MLST types against which the primer pairs within said sets were specifically designed. The sensitivity of the primer sets is demonstrated as being 100%; all prescribed types MLST types are correctly recognized. In Primer Set I, primer pair CC913 produced a detectable PCR product following application to isolates 7 to 9 (containing ST 9), and isolates 28 to 30 (containing ST 580), all of which are part of the MLST-defined clonal complex type CC9. In Pnmer Set II, primer pairs CC8 7 produced a detectable PCR product following application to isolates 4 to 6 (containing ST 8), isolates 25-27 (containing ST 551) and isolates 49 to 51 (containing ST 1247), all of which are part of the MLST-defined clonal complex type CC8. Primer Sets I and III demonstrate 100% specificity; no detectable PCR product of the correct size was detected following probing of isolates comprising non-target MLST types. Primer Set II demonstrates 98% specificity; primer pair CC8 7 (SEQ ID NOs: 69 and 70) being known from the single-plex experiments to produce a detectable PCR product of the correct size when probing isolate 7. The universal primer pair successfully produced detectable PCR product of the correct size after probing all isolates. As expected, the species specific Universal primer pairs produced detectable signal after probing substantially all isolates. 15-plex experiments Based on the success of the previous 5-plex experiments, the inventors designed a multiplex PCR reaction with a primer set comprising 14 pairs of primers, plus a universal primer pair. The primer set comprised the primer pairs of Primer Sets I, II and III described above, but with one modification. Primer pair CC8 7 (SEQ ID NOs: 69 and 70) was replaced in the primer set by primer pair CC8 6 (SEQ ID NOs: 67 and 68), since the length of the PCR product generated using the CC8 6 primer pair (131 nucleotides) was more easily discriminated on a gel from the other primer pair PCR products than the length of the PCR product generated using the CC8_7 primer pair, see Table 7. The inventors mixed together the 14 primer pairs with the best-working universal primer pair - Univ_6 (SEQ ID NOs: 79 and 80) - and confirmed that PCR products of the correct length are formed for all 51 isolates. Table 7 - Primer pairs and expected product lengths used in the 15-plex test Primer pair PCR product length (nt) MLST type primer pair is designed to specifically target Isolate No. Containing target MLST type ST517 786 ST 5 22 to 24 ST74 124 ST 7 43 to 45 ST29_10 569 ST 29 46 to 48 ST8 7_9 289 ST 87 1 to 3 ST101_2 71 ST 101 16 to 18 ST121_9 138 ST 121 19 to 21 ST155_6 245 ST 155 13 to 15 ST173_5 482 ST 173 37 to 39 ST177_2 154 ST 177 31 to 33 ST425 6 680 ST 425 40 to 42 ST451J 641 ST 451 34 to 36 STI247J 409 ST 1247 49 to 51 CC86 131 ST 8 4 to 6 ST 551 25 to 27 ST 1247 49 to 51 CC913 670 ST 9 7 to 9 ST 580 28 to 30 Uni\6 327 All All 15-plex reaction ingredients and protocol: 5 10 pl reaction volume: lOx buffer (Solis Biodyne) 1 pl 25 mM MgC12 (Solis Biodyne) 0,6 pl 2.5 mM dNTP mix (Solis Biodyne) 1.2 pl Hot Fire Pol (Solis Biodyne)0,l pl 10 MQ water 4.5 pl Primers (14 pairs mixed together)(10nM)1.5pl Primer Univ_6 (lOnM) 0,1 pl DNA (5ng / pl) 1 pl 15 PCR protocol: 95°C 15 min 95°C 30 s, 58°C 30 s, 72°C 40 s 3IX 72°C 10 min 4°C forever The results of the reactions were visualized on 1.5% agarose gel. The result of the 15-plex PCR experiment can be seen in the gel image in Figure 2. In the central part of the gel, a horizontal line of bands can be observed. These are the PCR products produced by the universal primer pair; as expected, a clear band is observed after probing each isolate with the primer set due to this universal primer pair. Note that none of the primer pairs in this primer set is specific for ST 37, which is present in isolates 10 to 12. As shown in Figure 2, no detectable PCR product resulted following probing of isolates 10 to 12 with the 14-plex primer set, other than the PCR product generated by the universal primer pair. For the majority of isolates probed, the primer set comprises a single primer pair that is specific for the MLST type present in the isolate. This is set out m Table 7 above. Indeed, when the primer set was used to probe the majority of isolates, two detectable PCR products results - one generated by the primer pair speicfic for the MLST type present in that isolate, and one generated by the universal primer pair. The primer set comprises two primer pairs that are capable of targetting ST1247, which is present in isolates 49-51. This MLST type is detected by the ST 1247-specific primer pair ST 1247 1 (PCR product size 407 nt) (SEQ ID NOs: 65 and 66), and the CC8-specific primer pair CC86 (product size 131 nt) (SEQ ID NOs: 67 and 68), since ST1247 is comprised within MLST-defined clonal complex type CC8. As shown in Figure 2, probing of each of isolates 49 to 51 led to the generation of three detectable PCR products, one generated by the universal primer pair, one by primer pair ST 1247 and one gener ated by primer pair CC8 6. Thus, in Figure 2, in all lanes of the gel, a PCR product generated by the universal primer pair and a PCR product generated by the appropriate type-specific primer pair(s) can be seen. The 15 primer pairs are an advantageous primer set, permitting analysis of a sample in a single PCR experiment using all 15 primer pairs simultaneously in order to detect, with 100% specificity and sensitivity, the presence of any one or more of the MLST and clonal complex types targetted by the primer pairs. This is achieved by the rigorous, novel and complex design process of the PCR primer pairs, and the selection of 15 primer pairs that generate PCR products of visually distinguishable size. Thus, the present inventors have used a computational methodology to design PCR primers advantageously capable of distinguishing L. monocytogenes strains at the MLST and MLST-defined clonal complex level. The designed primers have been produced and experimentally tested on L. monocytogenes isolates, and have been demonstrated to have 5 advantageous specificity and sensitivity--, both as individual primer pairs and as primer sets comprising multiple primer pairs. The utility of the primer pairs in primer sets has been demonstrated using 4-plex, 5-plex and 15-plex primer sets.

Claims

1. A primer set comprising the following PCR primer pairs, wherein each primer pair is specific fora Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defmed clonal complex type:A) an MLST type ST87 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 17 (ST87_6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 18 (ST87 6 reverse);a PCR primer comprising the sequence of SEQ ID NO: 19 (ST87 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 20 (ST87 7 reverse);a PCR primer comprising the sequence of SEQ ID NO: 21 (ST87 9 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 23 (ST8712 forward), and a PCR primer comprising the sequence of SEQ ID NO: 24 (ST8712 reverse);and / orB) an MLST type ST5 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 1 (ST5 I 5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 2 (ST5 15 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 3 (ST517 forward), and a PCR primer comprising the sequence of SEQ ID NO: 3 (ST517 reverse);and / orC) an MLST type ST 1247 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 65 (ST1247J forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (ST1247 1 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types.

2. Hie primer set of claim 1, further comprising:D) an MLST-defmed clonal complex type CC8 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 67 (CC8 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 68 (CC8 6 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 69 (CC8 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 70 (CC8 7 reverse);and / orE) an MLST-defmed clonal complex type CC9 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 71 (CC98 forward), and a PCR primer comprising the sequence of SEQ ID NO: 72 (CC98 reverse);a PCR primer comprising the sequence of SEQ ID NO: 73 (CC99 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 74 (CC9 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 75 (CC9 13 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC913 reverse);and / orF) an MLST type ST7 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 5 (ST7 4 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 6 (ST7 4 reverse);a PCR primer comprising the sequence of SEQ ID NO: 7 (ST7 7 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 8 (ST7_7 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 9 (ST710 forward), and a PCR primer comprising the sequence of SEQ ID NO: 10 (ST710 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types.

3. The primer set of claim 1 or claim 2, further comprising:G) an MLST type ST29 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 11 (ST29 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 12 (ST29 7 reverse);a PCR primer comprising the sequence of SEQ ID NO: 13 (ST299 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 14 (ST29 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 15 (ST2910 forward), and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST2910 reverse);and / orH) an MLST type STI01 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 25 (ST 1012 forward), and a PCR primer comprising the sequence of SEQ ID NO: 26 (ST 1012 reverse);and / orI) an MLST type ST121 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 27 (ST1215 forward), and a PCR primer comprising the sequence of SEQ ID NO: 28 (ST1215 reverse);a PCR primer comprising the sequence of SEQ ID NO: 29 (STI 219 forward), and aPCR primer comprising the sequence of SEQ ID NO: 30 (ST121 _9 reverse);a PCR primer comprising the sequence of SEQ ID NO: 31 (ST12111 forward), and aPCR primer comprising the sequence of SEQ ID NO: 32 (ST12111 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 33 (ST12112 forward), and a PCR primer comprising the sequence of SEQ ID NO: 34 (ST121 _12 reverse);and / orJ) an MLST type STI55 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 35 (ST155 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 36 (ST 155 6 reverse);a PCR primer comprising the sequence of SEQ ID NO: 37 (ST15510 forward), and a PCR primer comprising the sequence of SEQ ID NO: 38 (ST155_10 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 39 (STI 55 12 forward), and aPCR primer comprising the sequence of SEQ ID NO: 40 (ST15512 reverse);and / orK) an MLST type ST173 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 41 (ST173 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 42 (STI 73 2 reverse);a PCR primer comprising the sequence of SEQ ID NO: 43 (STI 73 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 44 (ST173 4 reverse);a PCR primer comprising the sequence of SEQ ID NO: 45 (ST173 5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 46 (ST173 5 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 47 (ST17311 forward), and a PCR primer comprising the sequence of SEQ ID NO: 48 (ST 173 11 reverse);and / orL) an MLST type ST177 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 49 (ST177 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 50 (ST177 2 reverse);a PCR primer comprising the sequence of SEQ ID NO: 51 (ST177 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 52 (STI77 4 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 53 (ST 177 14 forward), and a PCR primer comprising the sequence of SEQ ID NO: 54 (ST17714 reverse);and / orM) an MLST type ST425 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 55 (ST425 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 56 (ST425 6 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 57 (ST425 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 58 (ST425 12 reverse);and / orN) an MLST type ST451 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 59 (ST4515 forward), and a PCR primer comprising the sequence of SEQ ID NO: 60 (ST4515 reverse);a PCR primer comprising the sequence of SEQ ID NO: 61 (ST451^6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 62 (ST4516 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 63 (ST45110 forward), and a PCR primer comprising the sequence of SEQ ID NO: 64 (ST45110 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types.

4. The primer set of any one of the preceding claims, comprising the following primer pairs:A) an MLST type ST87 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 19 (ST87 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 20 (ST87 7 reverse);a PCR primer comprising the sequence of SEQ ID NO: 21 (ST87_9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 23 (ST87 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 24 (ST8712 reverse);and / orB) an MLST type ST5 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 1 (ST5 15 forward), and a PCR primer comprising the sequence of SEQ ID NO: 2 (ST5 15 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 3 (ST517 forward), and a PCR primer comprising the sequence of SEQ ID NO: 4 (ST517 reverse);and / orC) an MLST type ST 1247 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 65 (ST 1247 1 forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (STI 247 1 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types.

5. The primer set of claim 4, further comprising:E) an MLST-defmed clonal complex type CC9 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 71 (CC9 8 forward), and a PCR primer comprising the sequence of SEQ ID NO: 72 (CC9 8 reverse);a PCR primer comprising the sequence of SEQ ID NO: 73 (CC99 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 74 (CC9 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 75 (CC913 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC9 13 reverse):and / orF) an MLST type ST7 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 5 (ST7 4 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 6 (ST7 4 reverse);a PCR primer comprising the sequence of SEQ ID NO: 7 (ST7 7 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 8 (ST7 7 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 9 (ST7 I 0 forward), and a PCR primer comprising the sequence of SEQ ID NO: 10 (ST710 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types.

6. The primer set of claim 4 or claim 5, further comprising:G) an MLST type ST29 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 13 (ST29 9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 14 (ST299 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 15 (ST2910 forward), and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST2910 reverse);and / orH) an MLST type STI01 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 25 (ST1012 forward), and aPCR primer comprising the sequence of SEQ ID NO: 26 (ST1012 reverse);and / orI) an MLST type ST121 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 27 (ST12ty5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 28 (ST1215 reverse);a PCR primer comprising the sequence of SEQ ID NO: 29 (ST1219 forward), and a PCR primer comprising the sequence of SEQ ID NO: 30 (ST1219 reverse);a PCR primer comprising the sequence of SEQ ID NO: 31 (ST12111 forward), and a PCR primer comprising the sequence of SEQ ID NO: 32 (ST12111 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 33 (ST 12 tyl2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 34 (STI21 _12 reverse);J) an MLST type STI55 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 35 (ST155 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 36 (ST155 6 reverse);a PCR primer comprising the sequence of SEQ ID NO: 37 (STI 55 10 forward), and a PCR primer comprising the sequence of SEQ ID NO: 38 (ST 155 10 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 39 (STI5512 forward), and a PCR primer comprising the sequence of SEQ ID NO: 40 (ST15512 reverse);and / orK) an MLST type ST173 specific PCR primer pair comprisinga PCRprimer comprising the sequence of SEQ ID NO: 41 (STI73 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 42 (STI 73 2 reverse);a PCR primer comprising the sequence of SEQ ID NO: 43 (ST173 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 44 (ST173 4 reverse);a PCR primer comprising the sequence of SEQ ID NO: 45 (ST173 5 forward), and a PCR primer comprising die sequence of SEQ ID NO: 46 (ST173 5 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 47 (ST 173_11 forward), and a PCR primer comprising the sequence of SEQ ID NO: 48 (ST 173J1 reverse);and / orL) an MLST type ST177 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 49 (ST177 2 forward), and a PCR primer comprising die sequence of SEQ ID NO: 50 (ST177 2 reverse);a PCR primer comprising the sequence of SEQ ID NO: 51 (ST 177 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 52 (STI77 4 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 53 (ST17714 forward), and a PCR primer comprising the sequence of SEQ ID NO: 54 (ST17714 reverse);and / orM) an MLST type ST425 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 55 (ST425 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 56 (ST425 6 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 57 (ST425 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 58 (ST425 12 reverse);and / orN) an MLST type ST451 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 59 (ST451_5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 60 (ST451_5 reverse);a PCR primer comprising the sequence of SEQ ID NO: 61 (ST4516 forward), and a PCR primer comprising the sequence of SEQ ID NO: 62 (ST4516 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 63 (ST45110 forward), and a PCR primer comprising the sequence of SEQ ID NO: 64 (ST451 10 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types.

7. A primer set comprising the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type:A) an MLST type ST87 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 17 (ST87 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 18 (ST87 6 reverse);a PCR primer comprising the sequence of SEQ ID NO: 19 (ST87 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 20 (ST87 7 reverse);a PCR primer comprising the sequence of SEQ ID NO: 21 (ST87_9 fonvard), and a PCRprimer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 23 (ST87 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 24 (ST8712 reverse);andE) an MLST-defined clonal complex type CC9 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 71 (CC9 8 fonvard), and a PCR primer comprising the sequence of SEQ ID NO: 72 (CC9 8 reverse);a PCR primer comprising the sequence of SEQ ID NO: 73 (CC9 9 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 74 (CC9 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 75 (CC913 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC913 reverse);andF) an MLST type ST7 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 5 (ST7 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 6 (ST7 4 reverse);a PCR primer comprising the sequence of SEQ ID NO: 7 (ST7 7 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 8 (ST7 7 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 9 (ST7J 0 forward), and a PCR primer comprising the sequence of SEQ ID NO: 10 (ST7 I0 reverse);andG) an MLST type ST29 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 11 (ST29 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 12 (ST29 7 reverse);a PCR primer comprising the sequence of SEQ ID NO: 13 (ST29 9 fonvard), and a PCR primer comprising the sequence of SEQ ID NO: 14 (ST29 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 15 (ST2910 forward), and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST2910 reverse);andK) an MLST type ST173 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 41 (STI73 2 fonvard), and a PCR primer comprising the sequence of SEQ ID NO: 42 (STI 73 2 reverse);a PCR primer comprising the sequence of SEQ ID NO: 43 (ST173 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 44 (ST173 4 reverse);a PCR primer comprising the sequence of SEQ ID NO: 45 (ST173 5 forward), and a PCR primer comprising die sequence of SEQ ID NO: 46 (ST173 5 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 47 (ST 173_11 forward), and a PCR primer comprising the sequence of SEQ ID NO: 48 (ST 173J1 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types.

8. The primer set of claim 7, comprising the following primer pairs:A) an MLST type ST87 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 21 (ST87 9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse);andE) an MLST-defined clonal complex type CC9 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 75 (CC913 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC9 I3 reverse);andF) an MLST type ST7 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 5 (ST7 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 6 (ST7 4 reverse);andG) an MLST type ST29 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 15 (ST29 10 forward), and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST2910 reverse);andK) an MLST type ST173 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 45 (ST173 5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 46 (STI73_5 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types.

9. A primer set comprising the following PCR primer pairs, wherein each primer pair is specific for a. Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type:B) an MLST type ST5 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 1 (ST515 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 2 (ST515 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 3 (ST517 forward), and a PCR primer comprising the sequence of SEQ ID NO: 4 (ST517 reverse);andD) an MLST-defmed clonal complex type CC8 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 67 (CC8 6 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 68 (CC8 6 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 69 (CC8 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 70 (CC8 7 reverse);andI) an MLST type STI2I specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 27 (ST1215 forward), and a PCR primer comprising the sequence of SEQ ID NO: 28 (ST121_5 reverse);a PCR primer comprising the sequence of SEQ ID NO: 29 (ST1219 forward), and a PCR primer comprising the sequence of SEQ ID NO: 30 (ST1219 reverse);a PCR primer comprising the sequence of SEQ ID NO: 31 (ST121 _11 forward), and aPCR primer comprising the sequence of SEQ ID NO: 32 (ST 12111 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 33 (STI2112 forward), and aPCR primer comprising the sequence of SEQ ID NO: 34 (ST12112 reverse);andJ) an MLST type STI55 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 35 (ST155 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 36 (ST 155 6 reverse);a PCR primer comprising the sequence of SEQ ID NO: 37 (ST15510 forward), and aPCR primer comprising the sequence of SEQ ID NO: 38 (ST15510 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 39 (ST15512 forward), and a PCR primer comprising the sequence of SEQ ID NO: 40 (ST155 12 reverse);andN) an MLST type ST451 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 59 (ST4515 forward), and a PCR primer comprising the sequence of SEQ ID NO: 60 (ST4515 reverse);a PCR primer comprising the sequence of SEQ ID NO: 61 (ST4516 forward), and a PCR primer comprising the sequence of SEQ ID NO: 62 (ST451^6 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 63 (ST451_10 forward), and a PCR primer comprising the sequence of SEQ ID NO: 64 (ST45110 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types.

10. The primer set of claim 9, comprising the following primer pairs:B) an MLST type ST5 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 3 (ST5 17 forward), and a PCR primer comprising the sequence of SEQ ID NO: 4 (ST517 reverse);andD) an MLST-defmed clonal complex type CC8 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 69 (CC8 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 70 (CC8 7 reverse);andI) an MLST type STI21 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 29 (ST1219 forward), and a PCR primer comprising the sequence of SEQ ID NO: 30 (ST1219 reverse);andJ) an MLST type STI55 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 35 (ST155 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 36 (ST155 6 reverse);andN) an MLST type ST451 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 59 (ST451_5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 60 (ST451_5 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types.

11. A primer set comprising the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defmed clonal complex type:C) an MLST type ST 1247 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 65 (ST1247 1 forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (ST1247 1 reverse);andH) an MLST type STI01 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 25 (ST1012 forward), and a PCR primer comprising the sequence of SEQ ID NO: 26 (ST1012 reverse);andL) an MLST type ST177 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 49 (ST 177 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 50 (ST177 2 reverse);a PCR primer comprising the sequence of SEQ ID NO: 51 (ST177 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 52 (ST177 4 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 53 (ST17714 forward), and a PCR primer comprising the sequence of SEQ ID NO: 54 (ST17714 reverse);andM) an MLST type ST425 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 55 (ST425 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 56 (ST425 6 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 57 (ST425 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 58 (ST425 12 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types.

12. The primer set of claim 11, comprising the following primer pairs:C) an MLST type ST 1247 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 65 (ST1247 1 forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (ST 1247 1 reverse);anda PCR primer comprising the sequence of SEQ ID NO: 25 (ST1012 forward), and a PCR primer comprising the sequence of SEQ ID NO: 26 (ST101_2 reverse);andL) an MLST type STI 77 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 49 (STI 77 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 50 (ST177 2 reverse);andM) an MLST type ST425 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 55 (ST425 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 56 (ST425 6 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types.

13. The primer set of any one of the preceding claims, comprising the following primer pairs:A) an MLST type ST87 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 17 (ST87 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 18 (ST87 6 reverse);a PCR primer comprising the sequence of SEQ ID NO: 19 (ST87 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 20 (ST87 7 reverse);a PCR primer comprising the sequence of SEQ ID NO: 21 (ST87 9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 23 (STS 7 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 24 (ST87 12 reverse);andB) an MLST type ST5 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 1 (ST515 forward), and a PCR primer comprising the sequence of SEQ ID NO: 2 (ST515 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 3 (ST517 forward). and a PCR primer comprising the sequence of SEQ ID NO: 4 (ST5 17 reverse);andC) an MLST type ST 1247 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 65 (ST1247 1 forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (ST1247 1 reverse);anda PCR primer comprising the sequence of SEQ ID NO: 67 (CC86 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 68 (CC8 6 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 69 (CC8 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 70 (CC8 7 reverse);andE) an MLST-defined clonal complex type CC9 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 71 (CC9 8 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 72 (CC9 8 reverse);a PCR primer comprising the sequence of SEQ ID NO: 73 (CC9 9 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 74 (CC9 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 75 (CC9 13 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC913 reverse);andF) an MLST type ST7 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 5 (ST7 4 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 6 (ST7 4 reverse);a PCR primer comprising the sequence of SEQ ID NO: 7 (ST7 7 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 8 (ST77 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 9 (ST710 forward), and a PCR primer comprising the sequence of SEQ ID NO: 10 (ST710 reverse);andG) an MLST type ST29 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 11 (ST29 7 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 12 (ST29 7 reverse);a PCR primer comprising the sequence of SEQ ID NO: 13 (ST29 9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 14 (ST299 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 15 (ST2910 forward),and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST29 10 reverse);andH) an MLST type STI01 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 25 (ST1012 forward), and a PCR primer comprising the sequence of SEQ ID NO: 26 (ST1012 reverse);andI) an MLST type STI21 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 27 (ST121_5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 28 (ST1215 reverse);a PCR primer comprising the sequence of SEQ ID NO: 29 (ST1219 forward), and a PCR primer comprising the sequence of SEQ ID NO: 30 (ST1219 reverse);a PCR primer comprising the sequence of SEQ ID NO: 31 (ST12111 forward), and a PCR primer comprising the sequence of SEQ ID NO: 32 (ST121 11 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 33 (ST 12112 forward), and a PCR primer comprising the sequence of SEQ ID NO: 34 (ST12112 reverse);andJ) an MLST type STI55 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 35 (ST155 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 36 (ST155 6 reverse);a PCR primer comprising the sequence of SEQ ID NO: 37 (ST 15 5 10 forward), and a PCR primer comprising the sequence of SEQ ID NO: 38 (ST15510 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 39 (ST15512 forward), and a PCR primer comprising the sequence of SEQ ID NO: 40 (ST15512 reverse);andK) an MLST type ST173 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 41 (STI 73 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 42 (ST173 2 reverse);a PCR primer comprising the sequence of SEQ ID NO: 43 (ST173 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 44 (ST173 4 reverse);a PCR primer comprising the sequence of SEQ ID NO: 45 (ST173 5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 46 (STI 73 5 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 47 (ST 173 11 forward), and a PCR primer comprising the sequence of SEQ ID NO: 48 (ST17311 reverse);andL) an MLST type ST177 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 49 (ST177 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 50 (ST177 2 reverse);a PCR primer comprising the sequence of SEQ ID NO: 51 (ST 177 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 52 (ST177 4 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 53 (ST17714 forward), and a PCR primer comprising the sequence of SEQ ID NO: 54 (ST17714 reverse);andM) an MLST type ST425 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 55 (ST425 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 56 (ST425 6 reverse);a PCR primer comprising the sequence of SEQ ID NO: 57 (ST425 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 58 (ST425 12 reverse);andN) an MLST type ST451 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 59 (ST451_5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 60 (ST4515 reverse);a PCR primer comprising the sequence of SEQ ID NO: 61 (ST4516 forward), and a PCR primer comprising the sequence of SEQ ID NO: 62 (ST4516 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 63 (ST45110 forward), and a PCR primer comprising the sequence of SEQ ID NO: 64 (ST451^10 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types.

14. The primer set of claim 13, comprising the following PCR primer pairs:A) an MLST type ST87 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 21 (ST87_9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse);B) an MLST type ST5 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 3 (ST517 forward), and a PCR primer comprising the sequence of SEQ ID NO: 4 (ST517 reverse);C) an MLST type ST 1247 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 65 (ST 1247 1 forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (ST12471 reverse);D) an MLST-defined clonal complex type CC8 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 67 (CC86 forward), and a PCR primer comprising the sequence of SEQ ID NO: 68 (CC8 6 reverse);E) an MLST-defined clonal complex type CC9 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 75 (CC9_13 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC9 13 reverse);F) an MLST type ST7 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 5 (ST7 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 6 (ST7 4 reverse);G) an MLST type ST29 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 15 (ST29 10 forward), and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST29 10 reverse);H) an MLST type STI01 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 25 (ST1012 forward), and a PCR primer comprising the sequence of SEQ ID NO: 26 (ST101_2 reverse);I) an MLST type ST121 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 29 (ST 1219 forward), and a PCR primer comprising tire sequence of SEQ ID NO: 30 (ST 1219 reverse);J) an MLST type STI55 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 35 (ST155 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 36 (ST 155 6 reverse);K) an MLST type ST173 specific PCR primer pair comprisinga PCRprimer comprising the sequence of SEQ ID NO: 45 (STI73 5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 46 (ST 173 5 reverse);L) an MLST type STI77 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 49 (ST177 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 50 (ST177 2 reverse);M) an MLST type ST425 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 55 (ST425 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 56 (ST425 6 reverse);andN) an MLST type ST451 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 59 (ST4515 forward), and a PCR primer comprising the sequence of SEQ ID NO: 60 (ST4515 reverse);and w herein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types.

15. A primer set comprising the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defined clonal complex type:A) an MLST type ST87 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 19 (ST87 7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 20 (ST87 7 reverse);a PCR primer comprising the sequence of SEQ ID NO: 21 (ST879 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 23 (ST8712 forward), and a PCR primer comprising the sequence of SEQ ID NO: 24 (ST87 I2 reverse);anda PCR primer comprising the sequence of SEQ ID NO: 1 (ST515 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 2 (ST515 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 3 (ST517 forward), and a PCR primer comprising the sequence of SEQ ID NO: 4 (ST5_17 reverse);andC) an MLST type ST 1247 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 65 (ST1247 1 forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (ST1247 1 reverse);andE) an MLST-defmed clonal complex type CC9 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 71 (CC9 8 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 72 (CC98 reverse);a PCR primer comprising the sequence of SEQ ID NO: 73 (CC9 9 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 74 (CC9 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 75 (CC913 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC9 13 reverse);andF) an MLST type ST7 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 5 (ST7 4 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 6 (ST7 4 reverse);a PCR primer comprising the sequence of SEQ ID NO: 7 (ST7 7 forward), and a PCRprimer comprising the sequence of SEQ ID NO: 8 (ST7 7 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 9 (ST7 10 forward), and a PCR primer comprising the sequence of SEQ ID NO: 10 (ST710 reverse);andG) an MLST type ST29 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 13 (ST299 forward), and a PCRprimer comprising tire sequence of SEQ ID NO: 14 (ST29 9 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 15 (ST29 J o forward),and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST2910 reverse);andH) an MLST type STI01 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 25 (ST1012 forward), and a PCR primer comprising tire sequence of SEQ ID NO: 26 (STI 012 reverse);anda PCR primer comprising the sequence of SEQ ID NO: 27 (ST1215 forward), and a PCR primer comprising the sequence of SEQ ID NO: 28 (ST121_5 reverse);a PCR primer comprising the sequence of SEQ ID NO: 29 (ST1219 forward), and a PCR primer comprising the sequence of SEQ ID NO: 30 (STI21 9 reverse);a PCR primer comprising the sequence of SEQ ID NO: 31 (ST 121_11 forward), and a PCR primer comprising the sequence of SEQ ID NO: 32 (ST12111 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 33 (ST12112 forward), and a PCR primer comprising the sequence of SEQ ID NO: 34 (ST12112 reverse);andJ) an MLST type STI55 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 35 (STI 55 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 36 (ST155 6 reverse);a PCR primer comprising the sequence of SEQ ID NO: 37 (ST15510 forward), and a PCR primer comprising the sequence of SEQ ID NO: 38 (ST15510 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 39 (ST15512 forward), and a PCR primer comprising the sequence of SEQ ID NO: 40 (ST 155 12 reverse);andK) an MLST type STI73 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 41 (ST173 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 42 (ST173 2 reverse);a PCR primer comprising the sequence of SEQ ID NO: 43 (ST1734 forward), and a PCR primer comprising the sequence of SEQ ID NO: 44 (STI 73 4 reverse);a PCR primer comprising the sequence of SEQ ID NO: 45 (STI 73 5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 46 (ST1735 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 47 (ST17311 forward), and a PCR primer comprising the sequence of SEQ ID NO: 48 (ST17311 reverse);andL) an MLST type ST 177 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 49 (ST 177 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 50 (ST177 2 reverse);a PCR primer comprising the sequence of SEQ ID NO: 51 (ST177 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 52 (ST177 4 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 53 (ST17714 forward), and a PCR primer comprising the sequence of SEQ ID NO: 54 (ST 177 14 reverse);anda PCR primer comprising the sequence of SEQ ID NO: 55 (ST425 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 56 (ST425 6 reverse);a PCR primer comprising the sequence of SEQ ID NO: 57 (ST425 12 forward), and a PCR primer comprising the sequence of SEQ ID NO: 58 (ST425_12 reverse);andN) an MLST type ST451 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 59 (ST4515 forward), and a PCR primer comprising the sequence of SEQ ID NO: 60 (ST4515 reverse);a PCR primer comprising the sequence of SEQ ID NO: 61 (ST4516 forward), and a PCR primer comprising the sequence of SEQ ID NO: 62 (ST451^6 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 63 (ST45110 forward), and a PCR primer comprising the sequence of SEQ ID NO: 64 (ST45110 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defined clonal complex types.

16. The primer set of any one of the preceding claims, further comprising a Listeria monocytogenes species specific PCR primer pair.

17. Hie primer set of claim 16, wherein the Listeria monocytogenes species specific PCR primer paircomprisesa PCR primer comprising the sequence of SEQ ID NO: 77 (Univ_3 forward), and a PCR primer comprising the sequence of SEQ ID NO: 78 (L'niv3 reverse);a PCR primer comprising the sequence of SEQ ID NO: 79 (Unn _6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 80 (Univ_6 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 81 (Univ_7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 82 (Univ_7 reverse).

18. Hie primer set of claim 16 or claim 17, wherein the Listeria monocytogenes species specific PCR primer pair comprisesa PCR primer comprising the sequence of SEQ ID NO: 79 (Univ_6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 80 (Univ_6 reverse).

19. The primer set of any one of the preceding claims, wherein each primer consists of a maximumof 100, 90, 80, 70, 60, 50 or 40 nucleotides.

20. A kit comprising the primer set of any one of the preceding claims, wherein said kit optionally further comprises a PCR buffer solution, deoxynucleotide trisphosphates (dNTP), and / or DNA polymerase.

21. A method for detecting one or more Listeria monocytogenes multi-locus sequence typing (MLST) types or MLST-defmed clonal complex types in a sample, the method comprising: a) subjecting DNA isolated from said sample to a nucleic acid amplification reaction using the primer set of any one of claims 1 to 19, or using the kit of claim 20; andb) detecting the products of the nucleic acid amplification reaction.

22. The method of claim 21, wherein the nucleic acid amplification reaction is performed by PCR.

23. The method of claim 21 or claim 22, wherein step b) comprises:bi) performing gel electrophoresis on the products of the nucleic acid amplification reaction; andbii) visualizing the products of the nucleic acid amplification reaction in the form of DNA bands of a specific size on the gel;wherein the size of each product of the nucleic acid amplification visualized on the gel is indicative of the presence of one Listeria monocytogenes MLST type or MLST-defmed clonal complex type in the sample.

24. Hie method of claim 22, wherein the PCR is quantitative PCR and step b) comprises quantifying the products of the nucleic acid amplification reaction.

25. A Listeria monocytogenes MLST type-specific or MLST-defmed clonal complex type-specific primer pair, comprising PCR primers comprising the sequences of:SEQ IDNOs: 17 (ST876 forward) and 18 (ST87 6 reverse);SEQ ID NOs: 19 (ST87 J forward) and 20 (ST87 J reverse);SEQ ID NOs: 21 (ST87 9 forward) and 22 (ST87 9 reverse);SEQ ID NOs: 23 (ST8712 forward) and 24 (ST8712 reverse);SEQ IDNOs: 1 (ST515 forward) and 2 (ST515 reverse);SEQ ID NOs: 3 (ST517 forward) and 4 (ST517 reverse);SEQ ID NOs: 65 (ST1247 1 forward) and 66 (ST1247 1 reverse);SEQ ID NOs: 67 (CC8 6 forward) and 68 (CC8 6 reverse);SEQ ID NOs: 69 (CC8 J forward) and 70 (CC8 J reverse);SEQ ID NOs: 71 (CC9 8 forward) and 72 (CC9 8 reverse);SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs SEQ ID NOs73 (CC9_9 forward) and 74 (CC9_9 reverse);75 (CC9_13 forward) and 76 (CC9_13 reverse);5 (ST7 4 forward) and 6 (ST7 4 reverse);7 (ST7 7 forward) and 8 (ST7 7 reverse);9 (ST7J0 forward) and 10 (ST7J0 reverse);11 (ST29 7 forward) and 11 (ST29 7 reverse);13 (ST29 9 forward) and 14 (ST29 9 reverse);15 (ST2910 forward) and 16 (ST2910 reverse);25 (ST1012 forward) and 26 (ST1012 reverse);27 (ST121 _5 forward) and 28 (ST 1215 reverse);29 (ST1213 forward) and 30 (ST 1213 reverse);31 (ST12111 forward) and 32 (ST12111 reverse);33 (ST121_12 forward) and 34 (ST121_12 reverse);35 (ST155 6 forward) and 36 (ST155 6 reverse);37 (ST15510 forward) and 38 (ST155_10 reverse);39 (STI55 12 fonvard) and 40 (ST 155 12 reverse);41 (STI73 2 forward) and 42 (STI73 J reverse);43 (ST173 4 fonvard) and 44 (ST173 4 reverse);45 (ST173 5 forward) and 46 (ST173 5 reverse);47 (ST173_11 forward) and 48 (ST173_11 reverse);49 (ST177 2 forward) and 50 (ST177_2 reverse);51 (STI 773 forward) and 52 (ST 1773 reverse);53 (STI77 14 forward) and 54 (STI77 14 reverse);55 (ST425_6 fonvard) and 56 (ST425 6 reverse);57 (ST425_12 forward) and 58 (ST425_12 reverse);59 (ST4515 forward) and 60 (ST4515 reverse);61 (ST4516 forward) and 62 (ST4516 reverse); or63 (ST45 L10 fonvard) and 64 (ST45130 reverse).Amendments to the Claims have been filed as follows:07 08 2477CLAIMS1. A primer set comprising the following PCR primer pairs, wherein each primer pair is specific for a Listeria monocytogenes multi-locus sequence typing (MLST) type or MLST-defmed clonal complex type:A) an MLST type ST87 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 21 (ST87_9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse);andE) an MLST-defmed clonal complex type CC9 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 75 (('(‘9 13 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC913 reverse);andF) an MLST type ST7 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 5 (ST7 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 6 (ST7 4 reverse);andG) an MLST type ST29 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 15 (ST2910 forward), and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST2910 reverse);andK) an MLST type ST173 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 45 (STI 73 5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 46 (ST1735 reverse);and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types.

2. Hie primer set of claim 1, comprising the following PCR primer pairs:A) an MLST type ST87 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 21 (ST87 9 forward), and a PCR primer comprising the sequence of SEQ ID NO: 22 (ST87 9 reverse);B) an MLST type ST5 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 3 (ST517 forward), and a PCR primer comprising the sequence of SEQ ID NO: 4 (ST5 17 reverse);C) an MLST type ST 1247 specific PCR primer pair comprising07 08 24a PCR primer comprising the sequence of SEQ ID NO: 65 (ST12471 forward), and a PCR primer comprising the sequence of SEQ ID NO: 66 (ST1247 1 reverse);D) an MLST-defined clonal complex type CC8 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 67 (CC8 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 68 (CC8 6 reverse);E) an MLST-defined clonal complex type CC9 specific PCR primer pair comprising a PCR primer comprising the sequence of SEQ ID NO: 75 (CC913 forward), and a PCR primer comprising the sequence of SEQ ID NO: 76 (CC913 reverse);F) an MLST type ST7 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 5 (ST7 4 forward), and a PCR primer comprising the sequence of SEQ ID NO: 6 (ST7 4 reverse);G) an MLST ty pe ST29 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 15 (ST2910 forward), and a PCR primer comprising the sequence of SEQ ID NO: 16 (ST2910 reverse);H) an MLST type STI01 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 25 (ST101_2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 26 (ST 1012 reverse);I) an MLST ty pe ST121 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 29 (ST1219 forward), and a PCR primer comprising the sequence of SEQ ID NO: 30 (ST1219 reverse);J) an MLST type STI55 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 35 (ST 155 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 36 (ST155 6 reverse);K) an MLST type STI73 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 45 (ST173 5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 46 (ST173 5 reverse);L) an MLST type STI 77 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 49 (STI 77 2 forward), and a PCR primer comprising the sequence of SEQ ID NO: 50 (STI 77 2 reverse);M) an MLST type ST425 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 55 (ST425 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 56 (ST425 6 reverse);andN) an MLST type ST451 specific PCR primer pair comprisinga PCR primer comprising the sequence of SEQ ID NO: 59 (ST451_5 forward), and a PCR primer comprising the sequence of SEQ ID NO: 60 (ST4515 reverse);07 08 24and wherein said primer set is for detecting one or more of said MLST types or MLST-defmed clonal complex types.

3. The primer set of claim 1 or claim 2, further comprising a Listeria monocytogenes speciesspecific PCR primer pair.

4. Tire primer set of claim 3, wherein the Listeria monocytogenes species specific PCR primer pair comprisesa PCR primer comprising the sequence of SEQ ID NO: 77 (Univ_3 forward), and a PCR primer comprising the sequence of SEQ ID NO: 78 (Lm\3 reverse);a PCR primer comprising the sequence of SEQ ID NO: 79 (Univ_6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 80 (Univ_6 reverse); ora PCR primer comprising the sequence of SEQ ID NO: 81 (Univ_7 forward), and a PCR primer comprising the sequence of SEQ ID NO: 82 (Univ_7 reverse).

5. The primer set of claim 3 or claim 4, wherein the Listeria monocy togenes species specific PCR primer pair comprisesa PCR primer comprising the sequence of SEQ ID NO: 79 (Univ 6 forward), and a PCR primer comprising the sequence of SEQ ID NO: 80 (Univ_6 reverse).

6. The primer set of any one of the preceding claims, wherein each primer consists of a maximum of 100, 90, 80, 70, 60, 50 or 40 nucleotides.

7. A kit comprising the primer set of any one of the preceding claims, wherein said kit optionallyfurther comprises a PCR buffer solution, deoxynucleotide trisphosphates (dNTP), and / or DNA polymerase.

8. A method for detecting one or more Listeria monocytogenes multi-locus sequence typing (MLST) types or MLST-defmed clonal complex types in a sample, the method comprising:a) subjecting DNA isolated from said sample to a nucleic acid amplification reaction using the primer set of any one of claims 1 to 6, or using the kit of claim 7; andb) detecting the products of the nucleic acid amplification reaction.

9. The method of claim 8, wherein the nucleic acid amplification reaction is performed by PCR.

10. The method of claim 8 or claim 9, wherein step b) comprises:CM 00bi) performing gel electrophoresis on the products of the nucleic acid amplification reaction; andbii) visualizing the products of the nucleic acid amplification reaction in the form of DNA bands of a specific size on the gel;wherein the size of each product of the nucleic acid amplification visualized on the gel is indicative of the presence of one Listeria monocytogenes MLST type or MLST-defmed clonal complex type in the sample.

11. Hie method of claim 9, wherein the PCR is quantitative PCR and step b) comprises quantifying the products of the nucleic acid amplification reaction.Application No: GB2400075.4 Examiner: Dr Sam StokesClaims searched: 1-8, 13, 14, and 16-25, in part Date of search: 12 June 2024Patents Act 1977: Search Report under Section 17Documents considered to be relevant:Category Relevant to claims Identity of document and passage or figure of particular relevance X 1-8, 13, 14, and 16-25 Journal of clinical microbiology, vol. 42, no. 8, 2004, M. Doumith et al., Differentiation of the Major Listeria monocytogenes Serovars by Multiplex PCR, pages 3819-3822. X 1-8, 13, 14, and 16-25 WO 2022 / 141940 Al (INST OF MICROBIOLOGY GUANGDONG ACADEMY OF SCIENCES GUANGDONG DETECTION CENTER OF MICROBIOLOGY) X 1-8, 13, 14, and 16-25 LWT, vol. 116, 2019, Chen Moutong et al., Rapid detection of Listeria monocytogenes sequence type 121 strains using a novel multiplex PCR assay, article no. 108474. X 1-8, 13, 14, and 16-25 Current Microbiology, vol. 70, no. 5, 2015, Li Jinquan et al., Genotypic Analyses and Virulence Characterization of Listeria monocytogenes Isolates from Crayfish (Procambarus clarkii), pages 704-709. X 1-8, 13, 14, and 16-25 Food Control, vol. 127, no. 108118, 2021, Qifan Sun et al, Distribution, contamination routes, and seasonal influence of persistent Listeria monocytogenes in a commercial fresh Hypsizigus marmoreus production facility, pages 1-8Categories:X Document indicating lack of novelty or inventive step A Document indicating technological background and / or state of the art. Y Document indicating lack of inventive step if P Document published on or after the declared priority date but combined with one or more other documents of same category. before the filing date of this invention. & Member of the same patent family E Patent document published on or after, but with priority' date earlier than, the filing date of this application.Field of Search:International Classification:Subclass Subgroup Valid From C12Q 0001 / 689 01 / 01 / 2018 C12N 0001 / 20 01 / 01 / 2006 C12Q 0001 / 6809 01 / 01 / 2018Application No: GB2400075.4 Examiner: Dr Sam StokesClaims searched: 1-11 Date of search: 23 August 2024Patents Act 1977Further Search Report under Section 17Documents considered to be relevant:Category Relevant to claims Identity of document and passage or figure of particular relevance A - Frontiers in microbiology, vol. 10, 2019, Zhang Xiaoai et al., Isolation and Characterization of Clinical Listeria monocytogenes in Beijing, China, 2014-2016., page 981. See whole document, especially abstract, page 3 first full paragraph, and figure 1. A Food Microbiology, vol. 27, no. 1, 2010, Parisi A et al., Amplified Fragment Length Polymorphism and Multi-Locus Sequence Typing for high-resolution genotyping of Listeria monocytogenes from foods and the environment, pages 101-108. See whole document, especially abstract and Methods, especially sections 2.

2. and 2.3, and page 104.Categories:X Document indicating lack of novelty or inventive step A Document indicating technological background and / or state of the art. Y Document indicating lack of inventive step if combined with one or more other documents of same category'. P Document published on or after the declared priority' date but before the filing date of this invention. & Member of the same patent family E Patent document published on or after, but with priority date earlier than, the filing date of this application.Field of Search:International Classification:Subclass Subgroup Valid From C12Q 0001 / 689 01 / 01 / 2018 C12N 0001 / 20 01 / 01 / 2006 C12Q 0001 / 6809 01 / 01 / 2018

Images