A gene cassette and uses therefor
A recombinant cell with a gene cassette activatable by an external stimulus allows PCR-based assessment of plastic recycling history, addressing the challenges of cost and accuracy in existing methods, enhancing recycling efficiency and quality.
Patent Information
- Application Number
- GB2024009215
- Authority / Receiving Office
- GB · GB
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-06-26
- Publication Date
- 2026-01-07
AI Technical Summary
Existing methods for determining the number of times plastic has been recycled are prohibitively difficult and expensive, and there is a need for a scalable, cost-effective method to accurately assess the composition and recyclability of plastic mixtures.
A recombinant cell modified with a gene cassette that includes a promoter and recombinase sequences flanked by recognition sites, activatable by an external stimulus, allowing PCR analysis of amplicons to determine the number of times the cassette has been activated, thereby indicating the recycling history of plastic.
Enables accurate, cost-effective determination of plastic recycling history through PCR analysis, improving the sustainability of recycling efforts by optimizing plastic mixtures and identifying overly degraded plastics.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
FIELD OF THE INVENTION The present invention relates to a recombinant cell modified with a gene cassette activatable by an external stimulus, in which the size of the gene cassette sequence is reduced each time the gene cassette (or genetic circuit) is activated. Amplification of the cassette by PCR (Polymerase Chain Reaction) produces amplicons, the size of which corresponds to the number of times the gene cassette (or genetic circuit) has been activated. The recombinant cell and gene cassette find application in the field of polymer (particularly plastic and rubber) recycling as a counter for the number of times a plastic or rubber has been recycled. BACKGROUND OF THE INVENTION The recycling of plastic is a widespread process for managing waste and maximising the effective use of this essential non-renewable resource. Of all the methods of recycling plastic, 99% of plastic recycling is mechanical recycling (De Smet M. et al (2019) “A circular economy for plastics”; EU publication, ISBN 978-92-79-98429-7), wherein plastic waste is sorted, cleaned, granulated and extruded again into a new product (Ragaert K. et al (2017) Waste Management, 69: 24-58). However, compared to other recyclable materials such as metal and glass, plastics cannot be recycled indefinitely. Due to degradation caused by high temperatures and shear stresses during extrusion, the polymer chains within the plastic undergo depolymerisation and break down. This negatively impacts the material properties of the recycled plastic, producing an inferior, less effective product, with the problem worsening over time with repeated extrusions (Schyns Z.O.G. &Shaver M.P. (2021) Macromol. Rapid Commun., 42(3): 2000415). This effect is further compounded by the difficulties of sorting and sourcing plastics effectively to be recycled together, with items made of the same polymer often having different material properties due to their differing levels of degradation (Eriksen M.K. et al (2019) Waste Management, 96: 75-85). While the level of degradation varies across different polymers, plastics can only be effectively recycled a limited number of times before the polymer becomes too degraded. To counteract the drop in material quality, recycled plastics are often blended with virgin polymer. While this improves the material performance, this somewhat undermines the purpose of recycling, especially if recyclers overcompensate due to the unknown nature of heterogenous mixture of plastics being recycled. It is estimated that some producers of recycled polyethylene terephthalate (PET) only include 30% recycled PET, with the remaining 70% being virgin polymer (Schyns &Shaver supra). Other estimates are far lower, with some recycled PET bottles in Europe only containing 8.4% recycled PET (Demeester L. et al (2013) Manufacturing &Service Operations Management, 15(4)). Being able to determine easily and accurately how many times a given plastic has been recycled, and its relative population within a mixture of plastics to be recycled, would dramatically improve the sustainability of recycling efforts. With this information, batches of plastic may be combined appropriately and mixed with required virgin polymer in an optimised fashion. This would have the environmental and economic benefits of minimising the amount of virgin plastic required to produce a higher quality recycled product and allow overly-degraded plastics to be identified and removed from the workflow. This sentiment is echoed by corporations such as Nestle (https: / / www.nestle.com / sustainability / waste-reduction) and Kraft Heinz (https: / / news.kraftheinzcompany.com / press-releases-details / 2023 / Kraft-Heinz-Announces-Goal-to-Reduce-the-Use-of-Virgin-Plastic-Globally-by-20-Percent—or-more-than-100-Million-Pounds—by-2030 / default.aspx) who have committed to reducing their use of virgin polymers. Unilever has also made this commitment and additionally highlighted their challenges of sourcing recycled plastics of sufficient quality for consumer use (https: / / www.unilever.com / news / news-search / 2022 / why-cant-you-cut-your-use-of-virgin-plastic-faster / ). Following the implementation of the UK’s Plastic Packaging Tax regulations in 2022, that require plastic to be comprised of at least 30% recycled material to be tax-free (https: / / www.legislation.gov.uk / uksi / 2022 / 117 / introduction / made), there is growing economic and legal pressure to monitor the levels of recycled content within recycled plastics. Amidst a push towards a circular economy and concerns over “greenwashing” or attempts to circumvent legislation and associated costs, there is public discussion over transparency and accurate reporting within the plastic recycling industry (https: / / zerowasteeurope.eu / library / determining-recycled-content-with-the-mass-balance-approach-10-recommendations-for-development-of-methods-and-standards / ). The primary methods of analysing plastics to determine such information tend to be prohibitively difficult and expensive analytical techniques. These include (but are not limited to) various forms of spectroscopy (primarily Near-Infrared (NIR) and Fourier Transform Infrared (FTIR) Spectroscopy), chromatography, microscopy and thermogravimetric analysis (Eriksen et al supra; Larsen A.G. et al (2019) Waste Management, 96: 75-854). Therefore, there is a pressing need for a reliable method of analysing plastics that provides core information on the composition of the plastic, and one that is scalable, cost-effective, with a low technical barrier to entry. The idea of tracing plastic through its recycling journey is well known. There are two main types of traceability: physical and digital. Material traceability involves marking the product or packaging with a unique identifier that can be tracked throughout the supply chain. Digital traceability involves using software systems and databases to track the origin and journey of recycled plastics. Some companies, including Intertek, use analytical methods to determine composition and properties, using techniques including spectroscopy, microscopy, and chromatography. Schyns Z.O.G. et al ((2022) ACS Sustainable Chem. Eng., 10: 12659-12669) describe a fluorescence-based analytical technique to determine recycled content in plastic and (single use) packaging. However, such techniques are hindered by the inclusion of dyes in plastics and the ability of some plastics to auto-fl uoresce (Larder R R. &Hatton F.L. (2023) CS Polym. Au, 3(2): 182-201, both of which mask or reduce the ability to detect added fluorescence. The inclusion of biological entities, including enzymes and microorganisms, in plastics is also known, as is the ability of bacteria to withstand the harsh treatment applied to plastics during processing and forming. Examples of biological entities include those that degrade a polymer either over time or on activation by specific stimuli such as heat and salt. KR-A-1020220067790 discloses bacteria that are engineered to use plastic decomposition products as a main carbon source, instead of carbohydrates such as glucose and galactose. Described is a combination of a DNA-binding transcriptional repressor, a DNA-binding transcriptional isorepressor, and an ATP-dependent 6-phosphate fructokinase isopressor, the result of which is suppression of ATP-dependent 6-phosphofructokinase isozyme 1 and glucose-6-phosphate dehydrogenase, and a bacterial strain with a regulated carbon metabolism that decomposes polyethylene. CN-A-114181922 is directed to a modified esterase gene derived from hairy tofu and the resulting recombinant protein for digesting phthalates. The gene has an induction temperature of 16-30°C and the optimal reaction temperature of the recombinant protein is 35°C. US-A1-20170306336 describes synthetic genetic constructs comprising a series of genetic perturbation cassettes which may be used for scalable, sequential and controllable perturbation of multiple sets of endogenous genes. Each cassette comprises a recombinase, a gene element, a terminator and a pair of recombinase recognition sites. Such a recombinase or cassette encoding such a recombinase that mediates its own excision may be referred to as a suicide recombinase or a suicide cassette. A specific example of auto-degradable bacteria embedded in plastic is provided in co-pending International patent application number PCT / EP2023 / 087436. However, extension to other uses is, at the moment, limited. Accordingly, it is against this background that the present invention has been devised. While the invention finds use in a number of fields, it finds particular applicability in the field of plastics recycling. SUMMARY OF THE INVENTION In accordance with a first aspect of the invention, there is provided a recombinant cell modified to include a gene cassette, wherein the cassette comprises a promoter and one or more sequences for a recombinase followed by a terminator, the or each recombinase-terminator sequence being flanked by recognition sites specific for the recombinase, and wherein the cassette is activatable by an extracellular stimulus. In accordance with a second aspect of the invention, there is provided a method for determining the number of times a cell has been activated by an external stimulus in which the cell is genetically modified to include a gene cassette that is activatable by the external stimulus. The gene cassette comprises a promoter and one or more sequences for a recombinase followed by a terminator, the or each recombinase-terminator sequence being flanked by recognition sites specific for the recombinase. The method comprises a) exposing the cell to the external stimulus one or more times to activate expression of the gene cassette; and b) subjecting the resulting gene cassette to PCR and analysing the resulting PCR amplicons. On activation, a recombinase is expressed and excised from the gene cassette by its recognition sites, and the size or sizes of the PCR amplicons provides the number of recombinase sequences removed from and / or remaining in the cassette and correlates with the number of times the cassette has been activated. In accordance with a third aspect of the invention, there is provided a plastic or rubber comprising at least one recombinant cell as described herein. In accordance with a fourth aspect of the invention, there is provided a plastic or rubber mixture comprising: i) an amount of plastic or rubber comprising at least one recombinant cell as described herein that has been recycled one or more times, ii) an amount of plastic or rubber comprising at least one recombinant cell as described herein that has not been recycled and / or, iii) optionally an amount of plastic or rubber comprising at least one recombinant cell as described herein that has been recycled a different number of times to the plastic in i). In accordance with a fifth aspect of the invention, there is provided a method for determining the number of times a plastic or rubber has been recycled, the method comprising taking a sample of plastic or rubber comprising at least one recombinant cell as described herein; and carrying out PCR on the recombinant cell and analysing the resulting PCR amplicons. The size or sizes of the PCR amplicons provides the number of recombinase sequences removed from and / or remaining in the cassette and correlates with the number of times the cassette has been activated. In addition, the amount of the or each PCR amplicon correlates with an amount of plastic or rubber in the sample. DETAILED DESCRIPTION OF THE INVENTION The first aspect of the present invention encompasses a recombinant cell genetically modified to include a gene cassette, wherein the cassette comprises i) a promoter, and ii) one or more sequences for a recombinase followed by a terminator, the or each recombinase-terminator sequence being flanked by recognition sites specific for the recombinase, wherein the cassette is activatable by an external stimulus. Specifically, the cassette of the present invention may have the following structure: Promoter - [recombination site - recombinase - terminator - recombination site]x where x is 1 or more. Thus, when there is more than one recombinase, the recombinases share a single upstream promoter, and each recombinase sequence is loaded sequentially into the cassette, each recombinase sequence being flanked by its own recombination sites. In an example of the first aspect of the present invention, the cassette may have a free circular or linear structure, may be incorporated in a plasmid, or may be integrated into the genome of the cell. Where the cassette is integrated into a plasmid, a low copy plasmid has been found to be advantageous. This is because, if the cell includes other plasmids containing the same recombination sites, there is a potential for recombination to occur between, rather than within, plasmids potentially causing plasmids to be linked together. Where the gene cassette is integrated into the cellular genome, it is preferred if there is only one copy of the cassette per cell, again to mitigate against the potential for unwanted recombination to occur between sequences containing the same recombination sites. In a particular example, the cassette may have more than one recombinase sequence. For example, a cassette may include sequences for different tyrosine recombinases or different serine recombinases, or the cassette may include sequences for one or more tyrosine recombinase and one or more serine recombinase. An advantage to selecting serine integrases / recombinases instead of tyrosine recombinases is that, while serine integrases, such as BxBl, work in a similar way to tyrosine recombinases, they are unidirectional and convert their AttP / AttB recognition sites into AttL / AttR after recombination. However, all serine integrases have binding affinity for the same AttP / AttB sites, whereas tyrosine recombinases have their own unique sites (e.g., Cre to LoxP, Flp to FRT). Thus, there is a risk that serine integrases may excise parts elsewhere in the cassette, not just the sites flanking their own coding regions. However, protein engineering may be carried out to generate sequence specificity within Serine integrases to allow them to become useable within a cassette containing multiple serine integrases (Li H. et al (2018) J. Mol. Biol., 430(21): 4401-4418. Examples of suitable recombinases include Cre, Flp, Dre, Tre, KD, B2, and Vika. In another particular example, the number of recombinase sequences in the gene cassette may be equal to or more than the number of times the cell is expected to be activated. For example, the number of recombinase sequences in the gene cassette may be equal to or more than two, three, four, five, or six. In an alternative example, the number of recombinase sequences in the gene cassette may be at most ten, nine, eight, seven, or six. Because recombinase expression is transient, the risk of unwanted products is low. Tyrosine recombinases are, theoretically, reversible and so there remains a possibility for excised sequences to be reinserted by any residual recombinase protein. One way to mitigate against this is to use the recognition sites with mutated, rather than naturally occurring, sequences. For example, the recombination sites may be mutated to promote forward excision only. A specific example of such a feature is the use of mutated recognition sites such as Lox66 / Lox71, which produce a mutated Lox72 site after recombination. The mutated recombination site has a low binding affinity for Cre, heavily favouring a forward excision reaction and allowing multiple Lox reactions to occur in a genome in series without affecting or cross-reacting with each other (Shaw D. etal (2021) Microbial Biotechnology, 167(1)). Another or additional option for encouraging the transience of recombinase expression is to include a sequence for a degradation tag in the gene cassette. The inclusion of degradation tags helps induce degradation of recombinases after they have been transiently expressed which, in turn, reduces the likelihood of excised elements reintegrating into the cassette (McGuinness K.E. et al (2006) Molecular Cell, 22: 701-707). Natural degradation of excised DNA will occur due to its small size, whereas a main circuit plasmid or cellular genome will be maintained due to retention of an “origin of replication (ORI)” sequence. The extracellular stimulus encompasses a stimulus that is external to the recombinant cell and falls outside the normal operating ranges and environment of the cell. Such a stimulus need only activate the gene cassette incorporated in the cell, rather than activating a part or the whole of a stress cascade. Examples of external stimuli include chemical, pH, temperature (hot or cold), light, radiation, pressure, magnetic field, salinity and osmotic potential. In a particular example, the cassette may be activated by heat. In the context of the present invention, heat is a temperature that is above the normal operating temperature of the cell under biological conditions. In a particular example, the external stimulus may be a temperature of at least about 30°C, more preferably of at least about 32°C, still more preferably of at least about 34°C, for example of at least about 36 °C, e.g. of at least 37°C, 38°C, 40°C, or 42°C. Optionally, the external stimulus may be a temperature in the range of from about 30°C to about 60°C, more preferably of from about 35°C to about 50°C, e.g. of from 37°C to 42°C. In a further example, the external stimulus may be a temperature of at least about 45°C, more preferably of at least about 50°C, still more preferably of at least about 60°C, for example of at least about 70°C, e.g. of at least 80°C, 90°C, or 100°C. In a still further example, the external stimulus may be a temperature above about 100°C, preferably in a range of from about 150°C to about 320°C, or from about 400°C to about 600°C. In a specific example of the first aspect of the present invention, the cassette may further or additionally include a sequence for a heat shock promoter or a promoter and accompanying heat shock protein interacting elements. It will be appreciated that such sequences may be upstream and outside the cassette region flanked by the recombination sites. Heat shock proteins are endogenous proteins that enable cells to detect and respond to high temperatures. Alternatively or in addition, the cassette may further or additionally include a sequence for an RNA thermoswitch, a G-quadruplex thermoswitch or an RNA-based toehold switch AND gate. Due to the proximity of the ribosome binding site to the start of the coding sequence, any thermoswitch or toehold switch may need to be wholly within cassette region flanked by the recombination sites and, thus, will also be excised upon recombinase activation. A switch sequence is activated when the cell is exposed to heat, resulting in transcription of the recombinase and excision of the recombinase sequence from the gene cassette. RNA and G-quadruplex thermoswitches, sometimes referred to as thermometers, are activated by temperature rather than the binding of a protein or metabolite. As a result, the thermoswitch may be engineered to respond to a particular and specific temperature or temperature range at which the switch is activated. An example of an RNA thermoswitch is 4U, an RNA structure found in Salmonella, of which a specific example is T4UL (Kormann J. &Narberhaus F. (2012) Nature Reviews Microbiology 10: 255-265). Another way to achieve heat-specific activation is the use of a dual heat-shock promoter toehold switch system (Green A. A. et al (2014) Cell, 159(4): 925-939). Such a system has two heat-shock promoters and a toehold switch. The toehold switch acts as an AND gate for the two heat shock promoters and requires a strong enough signal that both heat shock promoters are activated together, reducing the likelihood of premature expression due to leaky promoter activity. In this way, the specificity of activation may be improved. In a further example in accordance with the first aspect of the present invention, bacteria, such as and including Escherichia coli and / or Bacillus subiiHs, may be selected as the recombinant cell. A specific example is the DH5-a or NEB Stable Competent strain of E. coli. The NEB Stable strain, in particular, includes mutations to reduce any naturally occurring recombination events that may occur when using repeated or inverted sequences. B. subtilis strain 168 is another suitable example, this strain being particularly suitable owing to its spore forming capabilities and resistance to heat. In a yet further example of the first aspect of the present invention, the gene cassette may also be designed as a “command circuit” to act on other genetic elements within the recombinant cell. For example, while Cre is expressed and excising itself, it may also excise a terminator elsewhere in the genome to turn on a gene. At the next heating step, Flp can invert that gene and turn it off again, while again turning on a different gene. In a second aspect, the present invention encompasses a method for determining the number of times a cell has been activated by an external stimulus. The cell is genetically modified to include a gene cassette, the cassette being activatable by the external stimulus and comprising a i) promoter, and ii) one or more sequences for a recombinase followed by a terminator, the or each recombinase-terminator sequence being flanked by recognition sites specific for the recombinase. The method comprises: i) exposing the cell to the external stimulus one or more times to activate expression of the gene cassette; and ii) subjecting the resulting gene cassette to polymerase chain reaction (PCR) and analysing the resulting amplicons. On activation of the gene cassette, a recombinase is expressed and excised from the cassette by its recognition sites. In addition, the size or sizes of the PCR amplicons provides the number of recombinase sequences removed from and / or remaining in the cassette and correlates with the number of times the cassette has been activated. Each time a recombinase is activated, it excises itself from the cassette and “loads up” the next recombinase to be expressed next time the cassette is activated. By using multiple recombinases (each roughly Ikb in length), the cassette gets shorter and shorter with every activation. By amplifying the cassette with PCR, the size of the amplicon will indicate the number of times the circuit has been activated. Figure lisa genetic circuit diagram detailing how recombinase activity causes a systematic decrease in the size of a genomic segment. PCR requires primers (short fragments of complementary DNA) designed to flank the recombinase / recognition / terminator circuit, so that when PCR is performed the cassette is copied exponentially. As recombinases are excised, the primers are brought closer and closer together as the cassette shrinks. The size of the cassette can then be measured using any appropriate method that enables the size of the amplified DNA region to be calculated. The size of the amplicon will be directly related to the number of recombinases remaining in the cassette, allowing the number of times activation has occurred to be measured. Examples of suitable analysis methods include electrophoresis, quantitative PCR, size exclusion chromatography or size exclusion spin columns. Electrophoresis (such as gel or capillary electrophoresis) is a particularly suitable method because it provides direct information on amplicon size. The coding sequence of the recombinase is roughly Ikb, giving a clear differentiation between amplicons when trying to determine cassette size. If unwanted recombination has occurred, amplicons larger than the cassette or plasmid’s known start size may simply be disregarded. An advantage of using PCR is that it is highly sensitive, meaning that the amount of recombinant cell needed could be very low. Testing this way also has a low barrier to market entry as PCR equipment and reagents may be bought relatively cheaply and used simply. Analysis using open-source software such as ImageJ (see Schneider C. A. et al (2012) Nature Methods, 9: 671-675) may be used to determine the relative proportions of each “recombination state”. The use of open-source software further minimises cost as commercial licences are not required. In a particular example of the second aspect of the present invention, the cell may be one or more species of bacteria, such as Escherichia coli and / or Bacillus subtilis. It will be appreciated that the cell may be a single strain or, where there are multiple cells, more or different strains may be selected. In another particular example, the external stimulus may be heat as defined and described herein above. In yet another particular example, the gene cassette may be as defined and described herein. In a further example, the number of recombinase sequences in the gene cassette may be equal to or more than the number of times the cell is expected or able to be activated. Optionally, the number of times is as defined above. In a third aspect, the present invention resides in a plastic or rubber comprising at least one recombinant cell as defined and described herein. The term “plastic” encompasses a synthetic or semi-synthetic material made from organic polymers such as and including polyethylene, PVC, nylon, etc., that can be moulded into shape while soft, and then set into a rigid or slightly elastic form. The term “plastic” may also encompass thermoplastic polymers. A plastic may also be defined as a solid material that contains as an essential ingredient one or more high molecular mass polymers and which is formed (shaped) during either manufacture of the polymer or the fabrication into a finished product by heat and / or pressure. Examples of thermoplastic polymers include acrylic, polyester polypropylene, polystyrene and nylon. A plastic may also be in the form of a filament, film, sheet, nurdle, or membrane. Commonly used plastics for films, sheets and membranes include polyethylene (PE), polypropylene (PP), polyvinyl chloride (PVC), polystyrene (PS) and polyethylene terephthalate (PET). The term “rubber” encompasses elastic polymers derived from tropical plants, also called India rubber, latex, Amazonian rubber, caucho, or caoutchouc, as well as synthetic and semi-synthetic variants and mimics thereof and mixtures thereof. Optionally, the at least one recombinant cell may be selected from one or more strains of bacteria, such as Escherichia coli and / or Bacillus subtilis as described herein. The third aspect of the present invention may be expanded to a fourth aspect encompassing a plastic mixture comprising: i) an amount of plastic or rubber comprising at least one recombinant cell as described and defined herein that has been recycled one or more times, ii) an amount of plastic or rubber comprising at least one recombinant cell as described and defined herein that has not been recycled and / or, iii) optionally an amount of plastic or rubber comprising at least one recombinant cell as described and defined herein that has been recycled a different number of times to the plastic or rubber in i). In other words, the present invention also resides in a method to determine the composition of a mixture of plastics or rubber, as well as how many times they can been recycled. For example, bacterial strains could be plastic or rubber specific (e.g., a polypropylene strain, a PET strain, etc). In this way an informed decision may be made about how much virgin plastic / rubber to include within a production batch, reducing the amount of virgin plastic / rubber required, thereby improving the efficacy of plastic / rubber recycling. The invention also enables the detection of batches of plastic / rubber that have been recycled too many times and removing those batches from the recycling workflow, thereby improving product quality. No additional cellular activity is required. The recombinant cell(s) simply sit(s) as a probe within the plastic(s) / rubber and may be designed to be as inert as possible and use as little cellular mass as possible while still carrying out its function. An advantage of the gene cassette of the present invention is that it may be embedded within and incorporated into plastic / rubber at the stage of producing nurdles, films, sheets, membranes or filaments. Other probes and functionalities may be additionally included in the plastic without disturbing the gene cassette of the present invention and its intended function. For example, the plastic or rubber may additionally include cellular material and / or means that enable autodegradation of the plastic / rubber, such as the mechanism described in co-pending International patent application number PCT / EP2023 / 087436. In a fifth aspect, the present invention also resides in a method for determining the number of times a plastic or rubber has been recycled. The method comprises: i) taking a sample of plastic or rubber comprising at least one recombinant cell as described or defined herein, or a mixture of plastic or rubber comprising at least one recombinant cell as described or defined herein; and ii) carrying out PCR on the recombinant cell(s) and analysing the resulting amplicons. The size or sizes of the PCR amplicons provides the number of recombinase sequences removed from and / or remaining in the cassette and correlates with the number of times the cassette has been activated. In addition, the amount of the or each PCR amplicon correlates with an amount of plastic / rubber in the sample. In this way, the number of times a plastic / rubber has been extruded / recycled may be determined or counted, and the composition of a mixture of different plastics / rubbers may also be determined. The method of the invention is simple, cost effective and quantitative, may be used on mixed samples, and will not be affected by additional colourants within plastics and rubbers. Depending on the plastic / rubber and / or sample size, the sample may need to be reduced in size or digested in some way, either partially or wholly, to enable the PCR active components to access the recombinant cell(s). For example, cutting or grinding of the sample into smaller or smaller pieces may be appropriate. The use of PCR as a means of testing is important to this invention. The alternative is to include markers. Expressing fluorescent proteins as a marker of recyclability would increase the metabolic burden for a cell, require more recombinant cells to be included to provide a strong signal, and fluorescence spectrophotometers capable of scanning for multiple excitation / emission wavelengths for different proteins are expensive. By having to perform limited actions only at the time of heating means the signal is permanent and robust without needing to be maintained, allowing the recombinant cell to stay as dormant as possible. Additionally, many plastics are dyed or exhibit autofluorescent properties even if they are transparent. By not relying on any visual or fluorescent reporters there are fewer limitations to the plastic with which this invention may be used. In the context of plastic and rubber recycling, each activation (heating, e.g. plastic extrusion) makes the cassette shorter until it has surpassed the number of times a plastic / rubber can be feasibly recycled (i.e., run out of recombinase sections). Where there is a mixture of plastics / rubbers with a different recycling history, the cassette sequences will now also mismatch. A mixed sample of, say, 30% never-recycled and 70% twice-recycled plastic will produce amplicons of different sizes when amplified by PCR despite using the same primers. These amplicons will also be represented proportionally when analysed. Where electrophoresis is used for analysis, it is the intensity of the resulting bands that may be used to determine relative quantities of different amplicons. For example, a 4kb band provides 30% of the total intensity, while a 2kb band provides 70% of the total intensity. In this way, the composition of a mixture of plastics / rubbers may be calculated and inform the amount of virgin plastic / rubber to be added. Where there is more than one strain of recombinant cells in the plastic(s) / rubber(s), each strain may have primers and / or binding regions that are unique for that strain. The difference strains may then be tested individually as separate PCR reactions per primer set or multiplexed. The present invention will now be described with reference to the following non-limiting examples and figures, in which: Figure 1: A genetic circuit diagram illustrating a decrease in the size of a gene cassette in accordance with the present invention on recombinase activity. Figure 2: Production of a polycaprolactone (PCL) filament containing T4UL-T7 sfGFP DH5a E. coli. Figure 2a) Loading of control PCL and T4UL-T7 E. coli coated pellets into the hopper of a 3Devo Composer filament extruder. Figure 2b) Demonstration of PCL filament extrusion from the nozzle of the 3Devo Composer. Figure 2c) Comparison of Control and T4UL-T7 E. coli PCL filament. Figure 2d) Fragments of strongly fluorescent bacterial filament used for shaping into discs. Figure 2e) Control PCL discs vs T4UL-T7 E. coli PCL. Figure 3: Chemically-inducible Cre Recombinase testing insert in accordance with the present invention. Figure 3a) Genetic diagram of insert layout containing different genetic elements. Figure 3b) Gel electrophoresis of In vitro Cre recombinase assay. Figure 4: In vivo testing of arabinose-inducible Cre recombinase in accordance with the present invention. Figure 4a) Gel electrophoresis of colony PCR from arabinose-exposed DH5a E. coli. Figure 4b) Raw fluorescence kinetics of sfGFP expression. Figure 4c) sfGFP intensity / mScarlet intensity kinetics. Figure 4d) Fluorescence spectra of sfGFP and mScarlet referenced against OD600. Figure 5: Genetic diagrams of heat controllable inserts of the present invention, in which each insert contains T7 polymerase under the control of a different heat sensitive genetic element, sfGFP under the control of a T7 promoter, and mScarlet under the control of a constitutively active ProD promoter. Figure 5a) Heat shock promoter insert. Figure 5b) RNA Thermoswitch (RNAT) or G-Quadruplex (GQ) insert. Figure 5c) Dual heat shock promoter toehold switch. Figure 6: Heat shock T7-sfGFP results: Figure 6a) Full results. Figure 6b) Zoomed in y-axis of same results. Figure 7: Kinetics of heat-sensitive genetic elements. Figure 7a) 4U riboswitch kinetics. Figure 7b) Theo-4U-Lys riboswitch kinetics. Figure 7c) HtrA promoter kinetics. Figure 7d) DnaK / IbpA Toehold Switch Kinetics. Figure 7e) Compiled 40°C for all elements, normalised to starting values. Figure 71) Compiled 18°C kinetics for all elements, normalised to starting values. Figure 8: Genetic diagram of Arabinose inducible Cre recombinase flanked by LoxP sites insert. Figure 9: Arabinose inducible LoxP flanked Cre results. Figure 9a) Gel electrophoresis of colony PCR from arabinose-exposed NEB Stable AraBAD-Cre E. coli. Figure 9b) End results of growth in M9 minimal media + / - arabinose. Figure 9c) Spectra of NEB Stable sfGFP and mScarlet referenced against cell density determined through Nanodrop UV-vis spectroscopy. Figure 8d) Spectra of DH5a sfGFP and mScarlet referenced against OD600 cell density determined through Nanodrop UV-vis spectroscopy. Figure 10: Genetic diagram of RNA thermoswitch controllable Cre recombinase flanked by LoxP sites insert. Figure 11: Heat inducible LoxP flanked Cre results. Figure Ila) Gel electrophoresis of colony PCR from NEB Stable T4UL-Cre E. coli grown at either 18°C for 72 hours or 37°C for 24 hours. Figure 11b) End results of growth in M9 minimal media + / - arabinose. Figure 11c) Spectra of NEB Stable sfGFP and mScarlet referenced against OD600 cell density at different temperatures determined through Nanodrop UV-vis spectroscopy. Figure 12: Photograph showing control PCL compared to a PCL filament coated with pelleted T4UL-T7 sfGFP E. coli. Figure 13: Fluorescence scanning of T4UL-T7 E. coli embedded within PCL. Figure 13a) Picture of 96 well plate, loaded with control blank PCL discs (column 1), T4UL-T7 PCL (column 2), T4UL in LB media grown at 18°C, and blank LB media. Figure 13b) Raw sfGFP and mScarlet spectral data of control blank PCL discs and T4UL-T7 E. coli PCL discs. Figure 13c) Raw sfGFP and mScarlet spectral data of blank LB media and T4UL-T7 E. coli in LB media. Figure 13d) Spectral data of T4UL-T7 E. coli in PCL and LB. Figure 13e) High-density T4UL-T7 E. coli PCL vs T4UL-T7 E. coli in LB media. Figure 13f) High-density T4UL-T7 E. coli PCL vs T4UL-T7 E. coli in 18°C LB media sfGFP intensity / mScarlet intensity. Figure 14: cPCR of T4UL-T7 E. coli embedded within PCL plastic. Figure 15: Gel electrophoresis of PCR containing varying ratios of Cre Shortened template. Figure 15a) is a screenshot of ImageJ Gel Analysis tool that was used to select gel lanes. Figure 15b) is an example of an ImageJ Gel analysis tool output. Peaks were manually sealed by drawing additional lines to close off each peak, then the “wand” tool was used to measure the area within each peak (area coloured in light grey). Figure 15c) shows the output of ImageJ based quantification of band intensity and reported percentage of proportions of each DNA species vs expected proportions based on PCR template input. Figure 16: Quantification of relative ratios of Cre shortened DNA templates. Figure 16a) Screenshot of ImageJ Gel Analysis tool being used to select gel lanes. Figure 16b) ImageJ Gel analysis tool output. Figure 16c) Output of ImageJ based quantification of band intensity and reported percentage of proportions of each DNA species vs expected proportions based on PCR template input. Figure 17: Design of an expanded heat-activated recombinase cassette. METHODS Sequences Parts: sfGFP ATGAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAG ATGGTGATGTTAATGGGCACAAATTTTCTGTCCGTGGAGAGGGTGAAGGTGATGC TACAAACGGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTT CCGTGGCCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTA TCCGGATCACATGAAACGTCATGACTTTTTCAAGAGTGCCATGCCTGAAGGTTAT GTACAGGAACGCACTATATCTTTCAAAGATGACGGGACCTACAAGACGCGTGCT GAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAGGGTATTG ATTTTAAAGAAGATGGAAACATTCTTGGACACAAACTCGAGTACAACTTTAACTC ACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTT CAAAATTCGCCACAACGTTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAA CAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGT CGACACAATCTGTCCTTTCGAAAGATCCTAACGAAAAGCGTGACCACATGGTCCT TCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAA (SEQ ID NO: 1) SsrA Degradation Tag GCTGCTAACGACGAAAACTACGCTGACGCTTCT (SEQ ID NO:2) m Scarlet ATGGTCAGCAAAGGAGAAGCGGTGATCAAAGAGTTCATGCGTTTTAAAGTGCAT ATGGAGGGAAGCATGAATGGCCATGAGTTTGAAATCGAGGGGGAAGGGGAAGG ACGCCCATATGAAGGCACACAGACGGCAAAATTGAAGGTGACCAAAGGTGGGC A JL JL JL JL JL JL J JL xjl JL xjL JL JL JL JL JL ^^y xjl JL JL JL x -L JL JL x 1. Ay JL JL JL y x TTCATCAAGCACCCCGCTGATATTCCAGATTACTATAAGCAATCTTTTCCAGAGG GTTTCAAATGGGAGCGTGTTATGAACTTCGAGGATGGCGGAGCTGTTACGGTTAC TCAGGATACCTCGCTGGAGGATGGTACGCTGATCTATAAAGTAAAGTTACGCGG CACGAATTTCCCTCCAGACGGTCCTGTCATGCAGAAAAAAACGATGGGTTGGGA AGC GT C A AC GG AGCGTTT GT AC CC GGA AGAT GGC GT GTT GA A AGGT GAT ATT A A GATGGCTCTTCGCCTTAAGGATGGGGGGCGCTACTTAGCTGATTTCAAAACCACA TACAAAGCGAAGAAGCCAGTACAGATGCCTGGTGCGTACAATGTTGACCGCAAA TTGGACATCACAAGTCACAATGAGGATTACACTGTGGTCGAGCAGTATGAGCGT AGTGAAGGTCGCCACTCTACGGGCGGAATGGATGAGCTGTACAAGTAA (SEQ ID NO:3) Cre Recombinase ATGTCAAATTTATTAACTGTTCATCAGAACTTACCAGCTCTTCCGGTGGACGCAA CGTCTGACGAGGTGCGTAAAAACTTAATGGATATGTTCCGTGATCGTCAAGCTTT TTCGGAACACACCTGGAAGATGCTTTTATCCGTGTGCCGTTCATGGGCAGCGTGG TGTAAACTTAATAACCGCAAGTGGTTTCCAGCAGAACCGGAAGATGTACGTGAC TACTTGTTGTACCTGCAAGCGCGCGGCTTAGCCGTAAAAACCATTCAGCAGCACC TGGGTCAATTAAACATGTTACACCGCCGCTCTGGCTTACCCCGTCCCAGCGATTC CAATGCGGTTAGTTTAGTGATGCGTCGCATTCGCAAGGAGAACGTTGACGCCGG CGAACGCGCCAAGCAGGCCCTGGCCTTTGAACGCACCGATTTTGATCAGGTGCGT TCCTTGATGGAAAATTCAGATCGCTGTCAGGACATTCGCAACTTAGCTTTTCTGG GAATTGCTTACAATACCCTTTTACGCATTGCGGAAATCGCACGTATCCGTGTCAA GG A C A TT A GPPGP A PPG A CGG A GGTPGP A TGTT A A TCP ATA TTGGGPGT AC A A A A»_J A—J 2 A 2 A A JL 2 A A-J A—z A—z A—-- 2a A—-- A_J 2 A A_J A_J 2 A A__J A__J A A— / A»_J A—- 2 A JL A_J JL JL 2 A. ZA JL A—*' 2 A JL 2 a A A. A_J A_J A-J A— / A-J A. 2 A 2 AZA 2 A GACCCTGGTGAGTACGGCGGGCGTGGAAAAGGCCTTATCACTGGGAGTGACGAA GTTGGTGGAGCGCTGGATCTCTGTTTCCGGCGTAGCCGACGACCCCAATAATTAC TTGTTTTGTCGTGTGCGTAAAAACGGCgtagcagccccgtcggcaacgtcgcaac TGTCTACCCGTGCTCTTGAAGGGATTTTTGAGGCAACGCACCGCCTGATCTATGG A GCA A AGGAPGATTPTGGAP A APGTTATPTTGP ATGGTPAGGTP ATAGTGPGPG 2 A A_J 2 A2 A2 A A_J A_J 2 A x_ / A*_J 2 A A A. A. A_J A_J 2 A 2 A2 A A_ / A»J A A 2 A A. A—z A. A. A_J A—-' 2 A A. A_J A»J A A—*' 2 A A»_J A_J A. A—z 2 A A 2 A A-J A. A-J A—*' A*_J A—*' A»_J CGTAGGTGCGGCACGCGACATGGCCCGTGCCGGCGTGAGCATCCCTGAGATCAT GCAGGCAGGAGGCTGGACCAATGTGAATATCGTTATGAACTACATTCGTAATCT GGACTCCGAGACCGGCGCGATGGTCCGTTTACTTGAAGATGGAGACTAG (SEQ ID NO:4) BBaK 1223006 6xHis-Tag GTGCACCACCACCACCATCACGTGTAA (SEQ ID NO:5) T7 RNA Polymerase ATGAACACGATTAACATCGCTAAGAACGACTTCTCTGACATCGAACTGGCTGCTA TCCCGTTCAACACTCTGGCTGACCATTACGGTGAGCGTTTAGCTCGCGAACAGTT GGCCCTTGAGCATGAGTCTTACGAGATGGGTGAAGCACGCTTCCGCAAGATGTTT GAGCGTCAACTTAAAGCTGGTGAGGTTGCGGATAACGCTGCCGCCAAGCCTCTC ATCACTACCCTACTCCCTAAGATGATTGCACGCATCAACGACTGGTTTGAGGAAG TGAAAGCTAAGCGCGGCAAGCGCCCGACAGCCTTCCAGTTCCTGCAAGAAATCA A GGz^GG a a GPPGT A GPGT A P A TP A CC A TT A A GA PP A PTPTGGPTTGPPT A A CC A 2 X A_J A_ / A_f A_f 2 A. ZA. A-J A*_ / A~*^ A 2 A A*_J A*_J JL 2 A A—2 A JL A*_ / 1. A A~*^ 2 A JL JL 2 A Z A A*_J 2 A 2 A A A A_J A_J JL JL A*_J A—JL 2 A 2 A A~*^ 2 A GTGCTGAC A ATAC A ACCGTTC AGGCTGTAGC A AGP GT A ATCGGTCGGGCC ATTG A Aw—-- JL A_J 2 A A_2 A2 A JL 2 XA— / 2 A2 A A—-' A—J JL JL A—2 A A-J A-J A JL 2 A^k—J Aw—-- 2 A2 A A_J A—A-J 2 A2 A JL Aw—-- A—J A—J A A—A-J A-J A-J A—2 A A JL A»_J AGGACGAGGCTCGCTTCGGTCGTATCCGTGACCTTGAAGCTAAGCACTTCAAGA AAAACGTTGAGGAACAACTCAACAAGCGCGTAGGGCACGTCTACAAGAAAGCAT TTATGCAAGTTGTCGAGGCTGACATGCTCTCTAAGGGTCTACTCGGTGGCGAGGC GTGGTCTTCGTGGCATAAGGAAGACTCTATTCATGTAGGAGTACGCTGCATCGAG ATGCTCATTGAGTCAACCGGAATGGTTAGCTTACACCGCCAAAATGCTGGCGTAG TAGGTCAAGACTCTGAGACTATCGAACTCGCACCTGAATACGCTGAGGCTATCGC AACCCGTGCAGGTGCGCTGGCTGGCATCTCTCCGATGTTCCAACCTTGCGTAGTT CCTCCTAAGCCGTGGACTGGCATTACTGGTGGTGGCTATTGGGCTAACGGTCGTC GTCCTCTGGCGCTGGTGCGTACTCACAGTAAGAAAGCACTGATGCGCTACGAAG ACGTTTACATGCCTGAGGTGTACAAAGCGATTAACATTGCGCAAAACACCGCAT GGA A A ATCAACA AGA A AGTCCT AGCGGTCGCC A ACGTA ATCACCAAGTGGAAGC x^J 2Jk2Jk2Jk2jk JL x^y 2 >k2Ik x_^ 2Jk2Ik xJ 2Jk2Jk2jk JL x_> x-y JL 2 Ik x_J x-x xJ x-J JL x_> x_> x—' 2 Ik 2 Jkx-y JL 2Ik 2 Ik JL x_^ 2 Jk x_> x—' 2 jl2Ik x_J JL x_J x_J 2 Ik 2 V. xJ x-x ATTGTCCGGTCGAGGACATCCCTGCGATTGAGCGTGA AGA ACTCCCGATGA A AC 2 k JL JL x_J JL X— / X— / x-J x-J JL x»J 2 Jk x»J x»_J 2 Jl x_ / J. jk JL x—x—z JL x__J ^x-^ x»J 2 Ik JL JL 2 Jk x-J x_J JL x_J 2 Jl2Jl x-J 2 >k2 JL x—x-J 2 Jk JL x-J 2 3l2 >k2 Ik x^—-- CGGAAGACATCGACATGAATCCTGAGGCTCTCACCGCGTGGAAACGTGCTGCCG CTGCTGTGTACCGCAAGGACAAGGCTCGCAAGTCTCGCCGTATCAGCCTTGAGTT CATGCTTGAGCAAGCCAATAAGTTTGCTAACCATAAGGCCATCTGGTTCCCTTAC AACATGGACTGGCGCGGTCGTGTTTACGCTGTGTCAATGTTCAACCCGCAAGGTA ACGATATGACCAAAGGACTGCTTACGCTGGCGAAAGGTAAACCAATCGGTAAGG AAGGTTACTACTGGCTGAAAATCCACGGTGCAAACTGTGCGGGTGTCGATAAGG TTCCGTTCCCTGAGCGCATCAAGTTCATTGAGGAAAACCACGAGAACATCATGGC TTGCGCTAAGTCTCCACTGGAGAACACTTGGTGGGCTGAGCAAGATTCTCCGTTC TGCTTCCTTGCGTTCTGCTTTGAGTACGCTGGGGTACAGCACCACGGCCTGAGCT ATAACTGCTCCCTTCCGCTGGCGTTTGACGGGTCTTGCTCTGGCATCCAGCACTTC TCCGCGATGCTCCGAGATGAGGTAGGTGGTCGCGCGGTTAACTTGCTTCCTAGTG AAACCGTTCAGGACATCTACGGGATTGTTGCTAAGAAAGTCAACGAGATTCTAC AAGCAGACGCAATCAATGGGACCGATAACGAAGTAGTTACCGTGACCGATGAGA ACACTGGTGAAATCTCTGAGAAAGTCAAGCTGGGCACTAAGGCACTGGCTGGTC AATGGCTGGCTTACGGTGTTACTCGCAGTGTGACTAAGCGTTCAGTCATGACGCT firiCTT ACGGGTCC A A AGAGTTCGGCTTCCGTC A AC A AGTGCTGGA AGAT ACC ATT x»_J x-J x JL JL 2 jkx-J x-J JL ^X-^ 2 *.2 jl2 jl 2 jl x*_J JL JL x-J JL JL xy JL 2 jl2 Jkx—2 Lx jl x-J JL x»J ^x~^ JL x-J x—J 2 jl2 Jk 2 Jk JL 2 k x_ / ^x-^ 2 Jk JL JL CAGCCAGCTATTGATTCCGGCAAGGGTCTGATGTTCACTCAGCCGAATCAGGCTG CTGGATACATGGCTAAGCTGATTTGGGAATCTGTGAGCGTGACGGTGGTAGCTGC GGTTGAAGCAATGAACTGGCTTAAGTCTGCTGCTAAGCTGCTGGCTGCTGAGGTC AAAGATAAGAAGACTGGAGAGATTCTTCGCAAGCGTTGCGCTGTGCATTGGGTA ACTCCTGATGGTTTCCCTGTGTGGCAGGAATACAAGAAGCCTATTCAGACGCGCT TGAACCTGATGTTCCTCGGTCAGTTCCGCTTACAGCCTACCATTAACACCAACAA AGATAGCGAGATTGATGCACACAAACAGGAGTCTGGTATCGCTCCTAACTTTGTA CACAGCCAAGACGGTAGCCACCTTCGTAAGACTGTAGTGTGGGCACACGAGAAG TACGGAATCGAATCTTTTGCACTGATTCACGACTCCTTCGGTACCATTCCGGCTG ACGCTGCGAACCTGTTCAAAGCAGTGCGCGAAACTATGGTTGACACATATGAGT CTTGTGATGTACTGGCTGATTTCTACGACCAGTTCGCTGACCAGTTGCACGAGTC TC A ATTGGAC A A A ATGCC AGC ACTTCCGGCTA A AGGTA ACTTGA ACCTCCGTGAC A X— / xXxX A A X—B X—B xX^k—' xXxXxX x X X. X—B X*_y X*_y x X X—B X—xx x_y X X X»—' X—' X—B X—B X*_y JL x XxXxXX—B X—B X xX xX X»—' JL X. X—B x Xx xXx X*_y JL X—z X*_z X*_J X X—B xX,X*_y ATCTTAGAGTCGGACTTCGCGTTCGCGTAA (SEQ ID NO:6) AraC ATGGCTGAAGCGCAAAATGATCCCCTGCTGCCGGGATACTCGTTTAATGCCCATC TGGTGGGGGGTTTA ACGCCGATTGAGGCC A ACGGTTATCTCGATTTTTTT ATCGA X X—B X—J X. X—B X—B X— / X*_J X*_J X—B X X X x X.x XX*—' X—J X*_y X— / X—B x X X. X. X*_J x X X*_J X—B X— / X—x -ZXx XX*_y X—J X—J X X <Z X X. X»—' X X»—' X—B ZX X. JL JL JL JL JL X ZX X X»—' X—B x X CCGACCGCTGGGAATGA A AGGTTATATTCTCA ATCTC ACC ATTCGCGGTC AGGGG X*_> X— / X—B ZXX— / X*_y X—<1 X*_z X X__J X—*B X—B X Xx X JL X—B ZXZXx XX—B X—B JL X ZX X ZX X X. X—z JL X—ZXZX JL X—✓ JL X—✓ ZXX—X—Z X JL JL X—X—B X—X__B X—J X X—✓ ZXX—B X—B X—B X—B GTGGTGAAAAATCAGGGACGAGAATTTGTTTGCCGACCGGGTGATATTTTGCTGT TCCCGCCAGGAGAGATTCATCACTACGGTCGTCATCCGGAGGCTCGCGAATGGT ATCACCAGTGGGTTTACTTTCGTCCGCGCGCCTACTGGCATGAATGGCTTAACTG GCCGTCAATATTTGCCAATACGGGGTTCTTTCGCCCGGATGAAGCGCACCAGCCG CATTTGAGCGACCTGTTTGGGG A A ATG ATTA ACGCGGGGG A AGGGGA AGGGGGG -Z X JL JL JL X— / x XX—B X—B x X X—JL X__B JL JL JL X__B X—B X—B x Xx Xx X X X—x X JL JL x Xx XX—X—B X*—B X—B X—*B X*_ / x Xx XX—B X—B X—B X—B x Xx X X__B X—B X—*B X*_ / X—B X*_x TATTCGGAGCTGCTGGCGATAAATCTGCTTGAGCAATTGTTACTGCGGCGCATGG AAGCGATTAACGAGTCGCTCCATCCACCGATGGATAATCGGGTACGCGAGGCTT GTCAGTACATCAGCGATCACCTGGCAGACAGCAATTTTGATATCGCCAGCGTCGC ACAGCATGTTTGCTTGTCGCCGTCGCGTCTGTCACATCTTTTCCGCCAGCAGTTAG GGATTAGGGTGTTA AGCTGGCGGGAGGACGA AGGTATG AGGG AGGGGA AGGTGG TTTTGAGCACCACCCGGATGCCTATCGCCACCGTCGGTCGCAATGTTGGTTTTGA CGATCAACTCTATTTCTCGCGGGTATTTAAAAAATGCACCGGGGCCAGCCCGAGC GAGTTCCGTGCCGGTTGTGAAGAAAAAGTGAATGATGTAGCCGTCAAGTTGTCAT AA (SEQ ID NO:7) OR2-OR1 TAACACCGTGCGTGTTGACAATTTTACCTCTGGCGGTGATAATGGTTGC (SEQ ID NO :8) IbpA AAAATAACATCATCATTACGTCGCACTGTGGCGGCTATCGCACTTTAACGTTTCG TGCTGCCCCCTCAGTCTATGCAATAGACCATAAACTGCAAAAAAAAGTCCGCTG ATAAGGCTTGAAAAGTTCATTTCCAGACCCATTTTTACATCG (SEQ ID NO:9) DnaK ATGCCTTGGCTGCGATTCATTCTTTATATGAATAAAATTGCTGTCAATTTTACGTC TTGTCCTGCCATATCGCGAAATTTCTGCGCAAAAGCACAAAAAATTTTTGCATCT CCCCCTTGATGACGTGGTTTACGACCCCATTTAGTAGTCAACCGCAGTGAGTGAG TCTGCAAAAAAATGAAATTGGGCAGTTGAAACCAGACGTTTCGCCCCTATTACA GACTCACAACCACATGATGACCGAATA (SEQ ID NO: 10) HtrA TCGGAACTTCAGGCTATAAAACGAATCTGAAGAACACAGC (SEQ ID NO: 11) T7 Promoter CAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAG (SEQ ID NO: 12) ProD CACAGCTAACACCACGTCGTCCCTATCTGCTGCCCTAGGTCTATGAGTGGTTGCT GGATAACTTTACGGGCATGCATAAGGCTCGTATAATATATTCAGGGAGACCACA ACGGTTTCCCTCTACAAATAATTTTGTTTAACTTT (SEQ ID NO: 13) pKAT CATTATTGCAATTAATAAACAACTAACGGACAATTCTACCTAACA (SEQ ID NO: 14) AraBAD AAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGTCTTTTACTG GCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAA AGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGC AGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCAT TTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACT GTTTCTCCAT (SEQ ID NO: 15) T500 terminator GOGAGOTOGAGr A A AGOOCGOOGA A AGGOGGGCTTTTOTGT tWO ID NO 1 2 a JL J 2jL / .£ lb. 2V. / Jk ^k—J J i 3k 2 *.2 Ik. ^k—^k_J J JL JL JL JL JL JL I k—3 ,1. / JL JL-^' -L 3 • a A2 J BBa_B1002 Terminator CGCAAAAAACCCCGCTTCGGCGGGGTTTTTTCGC (SEQ ID NO: 17) BBa_B0015 Terminator CCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTA TCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGT GGGCCTTTCTGCGTTTATA (SEQ ID NO: 18) SoxR Terminator AAAACAAACTAAAGCGCCCTTGTGGCGCTTTAGTTTT (SEQ ID NO: 19) T7 Terminator CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG (SEQ ID NO:20) LoxP ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO:21) Lox66 ATAACTTCGTATAATGTATGCTATACGAACGGTA (SEQ ID NO:22) Lox71 TACCGTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO:23) g710 Ribosome Binding Site AGCTAGCAATAATTTTGTTTAACTTTAAGAAGGAGATATACC (SEQ ID NO:24) Toehold Switch - Ribosome Binding Site GGGTCTTATCTTATCTATCTCGTTTATCCCTGCATACAGAAACAGAGGAGATATG CAATGATAAACGAGAACCTGGCGGCAGCGCAAAAG (SEQ ID NO:25) Toehold Switch - Complementary Activation Sequence GGGACTGACTATTCTGTGCAATAGTCAGTAAAGCAGGGATAAACGAGATAGATA AGATAAGATAG (SEQ ID NO:26) G2LL G-Quadruplex GGGAAGGAGGGTGTGC (SEQ ID NO:27) G3_U2 G-Quadruplex GGGTTGGGAAGGAGGGTTGGG (SEQ ID NO:28) 4U Thermoswitch GTTGAACTTTTGAATAGTGATTCAGGAGGTTA (SEQ ID NO:29) Theo-4U-Lys Thermoswitch AAGTGATACCAGCATCGTCTTGATGCCCTTGGCAGCACTTCAGAAATCTCTGAAG TGCTGTTTTTTTTCTCGAGGTTGAACTTTTGAATAGTGATTCAGGAGGTTAATG (SEQIDNO:30) Primers: T7 Block 1 FWD GGTACTGCCGGGCCTCTT (SEQ ID NO:31) T7 Block 1 REV TGTTTGTGTGCATCAATCTCGCTATC (SEQ ID NO:32) T7 Block 2 FWD ATAGCGAGATTGATGCACACAAAC (SEQ ID NO:33) T7 Block 2 REV Tr’r’ / ^ / ^ a T^ / ^z^nr / ^nr / "'' / "'' / '"'' a a nr / ctt / a tta m / a.^ a\ iCrCrCCrAiCrC ICrlCkjCrAAi ID rNO.34) Cre Block 1 REV ACATTAAGTCCCCACAGTATCAAGTTTC (SEQ IDNO:35) Cre Block 1 Shorten ing / Change FWD ATGTCAAATTTATTAACTGTTCATCAGAAC (SEQ ID NO:36) Cre Block 2-1 FWD ACTTGATACTGTGGGGACTTAATG (SEQ ID NO:37) Cre Block 2-1 REV TACCCTTTAACTCGATACGATTAACA (SEQ ID NO:3 8) Cre Block 2-2 FWD GTTAATCGTATCGAGTTAAAGGGTATTG (SEQ ID NO:39) Cre Block 2-2 REV GCTTCACAACTTGGGCAAG (SEQ ID NO:40) Cre Block 3 FWD CCATCGCTTGCCCAAGTT (SEQ ID NO:41) Cre Block 3 REV TGGCGATGCTGTCGGAAT (SEQ IDNO:42) Cre Activity Region Screening FWD GACGGAGGTCGCATGTTAAT (SEQ ID NO:43) Cre Activity Region Screening REV TGATCACCGCTTCTCCTTTG (SEQ ID NO:44) T7 Polymerase Screening FWD CAATGGGACCGATAACGAAGTA (SEQ ID NO:45) T7 Polymerase Screening REV CAGCGAACTGGTCGTAGAAA (SEQ ID NO:46) sfGFP Screening FWD GGGTGAAGGTGATGCTACAA (SEQ ID NO:47) sfGFP Screening REV ACAGGTAATGGTTGTCTGGTAAA (SEQ ID NO:48) mScarlet Screening FWD CCCGCTGATATTCCAGATTACT (SEQ ID NO:49) mScarlet Screening REV CGACCTTCACTACGCTCATAC (SEQ ID NO:50) Cre Screening FWD CAGCAGAACCGGAAGATGTA (SEQ ID NO: 51) Cre Screening REV CTCGGAGTCCAGATTACGAATG (SEQ ID NO:52) pBR322 Insert Screening Primer FWD CTGTAGGCATAGGCTTGGTTAT (SEQ ID NO:53) pBR322 Insert Screening Primer REV TAGTCGATAGTGGCTCCAAGTA (SEQ ID NO:54) T7 Promoter change FWD ATGAACACGATTAACATCGCTAAGA (SEQ ID NO:55) Lox P Removal FWD AGCTAGCAATAATTTTGTTTAACTTTAAG (SEQ ID NO:56) Lox P Removal REV GATATCGCAACCATTATCACCG (SEQ ID NO:57) Cre Change Plasmid 4U FWD CAGGAGGTTAATGTCAAATTTATTAACTGTTCATCAGAAC (SEQ ID NO:58) Cre Change Plasmid T4UL FWD GAGGTTAATGATGTCAAATTTATTAACTGTTCATCAGAAC (SEQ IDNO:59) Cre Change Plasmid REV CGGCAGTACCATTAAAGCTTATCGATGATAAGCTGTC (SEQ ID NO:60) Ribo / Lox Insertion FWD AAGCTTTAATGGTACTGCCGGGCCTCT (SEQ ID NO:61) Ribo / Lox Insertion REV AATTTGACATTAACCTCCTGAATCACTATTCAAAAGTTC (SEQ ID NO:62) Ribo / Lox Insertion Variant REV AATTTGACATCATTAACCTCCTGAATCACTATTCAAAAGT (SEQ ID NO:63) Cre / Riboswitch FWD Screening Plasmid CTTGCGGGATGAATTCCATTATT (SEQ ID NO:64) Ara / LoxP Insertion FWD ACCCGTTTTTAAGGAGGTAAAAAAT (SEQ ID NO:65) Ara / LoxP Insertion REV ATGGAGAAACAGTAGAGAGTTGC (SEQ ID NO:66) dsDNA Fragments: T7 Block #1- DnaK Toehold Switch T7 polymerase (partial) GGTACTGCCGGGCCTCTTGCGGGATGAATTCATGCCTTGGCTGCGATTCATTCTTT ATATGAATAAAATTGCTGTCAATTTTACGTCTTGTCCTGCCATATCGCGAAATTTC TGCGCAAAAGCACAAAAAATTTTTGCATCTCCCCCTTGATGACGTGGTTTACGAC CCCATTTAGTAGTCAACCGCAGTGAGTGAGTCTGCAAAAAAATGAAATTGGGCA GTTGAAACCAGACGTTTCGCCCCTATTACAGACTCACAACCACATGATGACCGAA TAGGGTCTTATCTTATCTATCTCGTTTATCCCTGCATACAGAAACAGAGGAGATA TGCAATGATAAACGAGAACCTGGCGGCAGCGCAAAAGATGAACACGATTAACAT CGCTAAGAACGACTTCTCTGACATCGAACTGGCTGCTATCCCGTTCAACACTCTG GCTGACC ATTACGGTGAGCGTTTAGCTCGCGA ACAGTEGGCCCTTGAGC ATGAGT CTTACGAGATGGGTGAAGCACGCTTCCGCAAGATGTTTGAGCGTCAACTTAAAG CTGGTGAGGTTGCGGATAACGCTGCCGCCAAGCCTCTCATCACTACCCTACTCCC TAAGATGATTGCACGCATCAACGACTGGTTTGAGGAAGTGAAAGCTAAGCGCGG CAAGCGCCCGACAGCCTTCCAGTTCCTGCAAGAAATCAAGCCGGAAGCCGTAGC GTACATCACCATTAAGACCACTCTGGCTTGCCTAACCAGTGCTGACAATACAACC GTTCAGGCTGTAGCAAGCGCAATCGGTCGGGCCATTGAGGACGAGGCTCGCTTC GGTCGTATCCGTGACCTTGAAGCTAAGCACTTCAAGAAAAACGTTGAGGAACAA CTCAACAAGCGCGTAGGGCACGTCTACAAGAAAGCATTTATGCAAGTTGTCGAG GCTGACATGCTCTCTAAGGGTCTACTCGGTGGCGAGGCGTGGTCTTCGTGGCATA AGGAAGACTCTATTCATGTAGGAGTACGCTGCATCGAGATGCTCATTGAGTCAAC CGGAATGGTTAGCTTACACCGCCAAAATGCTGGCGTAGTAGGTCAAGACTCTGA GACTATCGAACTCGCACCTGAATACGCTGAGGCTATCGCAACCCGTGCAGGTGC GCTGGCTGGCATCTCTCCGATGTTCCAACCTTGCGTAGTTCCTCCTAAGCCGTGG ACTGGCATTACTGGTGGTGGCTATTGGGCTAACGGTCGTCGTCCTCTGGCGCTGG TGCGTACTCACAGTAAGAAAGCACTGATGCGCTACGAAGACGTTTACATGCCTG AGGTGTACAAAGCGATTAACATTGCGCAAAACACCGCATGGAAAATCAACAAGA AAGTCCTAGCGGTCGCCAACGTAATCACCAAGTGGAAGCATTGTCCGGTCGAGG ACATCCCTGCGATTGAGCGTGAAGAACTCCCGATGAAACCGGAAGACATCGACA TGAATCCTGAGGCTCTCACCGCGTGGAAACGTGCTGCCGCTGCTGTGTACCGCAA GGACAAGGCTCGCAAGTCTCGCCGTATCAGCCTTGAGTTCATGCTTGAGCAAGCC AATAAGTTTGCTAACCATAAGGCCATCTGGTTCCCTTACAACATGGACTGGCGCG GTCGTGTTTACGCTGTGTCAATGTTCAACCCGCAAGGTAACGATATGACCAAAGG ACTGCTTACGCTGGCGA A AGGTA A ACCA ATCGGTA AGGA AGGTTACTACTGGCT xA A— / A A_J A— / A A xA A_—' A_J A A—x A—J xA.x AxA A-J A-J JL xAx Ax A A—x x AY A JL A_ / A_J A_J JL Y Ax A A_J A.J x AY. A A»_J A»_J JL JL x A A—x JL Y Ax_ / A A-J A—x A. GAAAATCCACGGTGCAAACTGTGCGGGTGTCGATAAGGTTCCGTTCCCTGAGCG CATCAAGTTCATTGAGGAAAACCACGAGAACATCATGGCTTGCGCTAAGTCTCC ACTGGAGAACACTTGGTGGGCTGAGCAAGATTCTCCGTTCTGCTTCCTTGCGTTC TGCTTTGAGTACGCTGGGGTACAGCACCACGGCCTGAGCTATAACTGCTCCCTTC CGCTGGCGTTTGACGGGTCTTGCTCTGGCATCC AGC ACTTCTCCGCGATGCTCCG AGATGAGGTAGGTGGTCGCGCGGTTAACTTGCTTCCTAGTGAAACCGTTCAGGAC ATCTACGGGATTGTTGCTAAGAAAGTCAACGAGATTCTACAAGCAGACGCAATC AATGGGACCGATAACGAAGTAGTTACCGTGACCGATGAGAACACTGGTGAAATC TCTGAGAAAGTCAAGCTGGGCACTAAGGCACTGGCTGGTCAATGGCTGGCTTAC GGTGTTACTCGCAGTGTGACTAAGCGTTCAGTCATGACGCTGGCTTACGGGTCCA AAGAGTTCGGCTTCCGTCAACAAGTGCTGGAAGATACCATTCAGCCAGCTATTGA TTCCGGCAAGGGTCTGATGTTCACTCAGCCGAATCAGGCTGCTGGATACATGGCT AAGCTGATTTGGGAATCTGTGAGCGTGACGGTGGTAGCTGCGGTTGAAGCAATG AACTGGCTTAAGTCTGCTGCTAAGCTGCTGGCTGCTGAGGTCAAAGATAAGAAG ACTGGAGAGATTCTTCGCAAGCGTTGCGCTGTGCATTGGGTAACTCCTGATGGTT TCCCTGTGTGGCAGGAATACAAGAAGCCTATTCAGACGCGCTTGAACCTGATGTT CCTCGGTCAGTTCCGCTTACAGCCTACCATTAACACCAACAAAGATAGCGAGATT GATGCACACAAACA (SEQ ID NO:67) T7 Block #2 - End of T7 Pol, BBa_B1002 Terminator, IbpA Trigger, T7 sfGFP, ProD mScarlet ATAGCGAGATTGATGCACACAAACAGGAGTCTGGTATCGCTCCTAACTTTGTACA CAGCCAAGACGGTAGCCACCTTCGTAAGACTGTAGTGTGGGCACACGAGAAGTA CGGAATCGAATCTTTTGCACTGATTCACGACTCCTTCGGTACCATTCCGGCTGAC GCTGCGAACCTGTTCAAAGCAGTGCGCGAAACTATGGTTGACACATATGAGTCTT GTGATGTACTGGCTGATTTCTACGACCAGTTCGCTGACCAGTTGCACGAGTCTCA ATTGGACAAAATGCCAGCACTTCCGGCTAAAGGTAACTTGAACCTCCGTGACATC TTAGAGTCGGACTTCGCGTTCGCGTAACGCAAAAAACCCCGCTTCGGCGGGGTTT TTTCGCAAAATAACATCATCATTACGTCGCACTGTGGCGGCTATCGCACTTTAAC GTTTCGTGCTGCCCCCTCAGTCTATGCAATAGACCATAAACTGCAAAAAAAAGTC CGCTGATAAGGCTTGAAAAGTTCATTTCCAGACCCATTTTTACATCGGGGACTGA CTATTCTGTGCAATAGTCAGTAAAGCAGGGATAAACGAGATAGATAAGATAAGA TAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTT TTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCG GGTGGGCCTTTCTGCGTTTATACCCGCGAAATTAATACGACTCACTATAGGGGGT AATCGCTTATCCCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGGAGTA CATATGAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAAT TAGATGGTGATGTTAATGGGCACAAATTTTCTGTCCGTGGAGAGGGTGAAGGTG ATGCTACAAACGGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACC TGTTCCGTGGCCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCC GTTATCCGGATCACATGAAACGTCATGACTTTTTCAAGAGTGCCATGCCTGAAGG TTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGACCTACAAGACGCG TGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAGGGT ATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAACTCGAGTACAACTTTA ACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTA ACTTCAAAATTCGCCACAACGTTGAAGATGGTTCCGTTCAACTAGCAGACCATTA TCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTAC CTGTCGACACAATCTGTCCTTTCGAAAGATCCTAACGAAAAGCGTGACCACATGG TCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTA CAAATCCGGACTCAGATCTCGAGCGGCGAACGACGAAAACTACTCTGAAAACTA CGCGGACGCGTCTTAGAAGCTTCTAGCATAACCCCTTGGGGCCTCTAAACGGGTC TTG A GGGGTTTTTTGC C C GGGC C A TC GC TTGC C C A A GTTGTG A A GC A C A GCT A A C A A A-J 2AA-J A-J A-J A-J JL A A A A A A—-' A—-' 2A A A»J A. A. A— / A— / £A2AA»J A A ^k-J A. A-J 2 A2AA-J 2 A A— / £AA*_J A—*' A 2 A2 AA_ / ACCACGTCGTCCCTATCTGCTGCCCTAGGTCTATGAGTGGTTGCTGGATAACTTT ACGGGCATGCATAAGGCTCGTATAATATATTCAGGGAGACCACAACGGTTTCCCT CTACAAATAATTTTGTTTAACTTTGATCGCATGGTTGCTACTAGAGAAAGAGGAG AAATACTAGATGGTCAGCAAAGGAGAAGCGGTGATCAAAGAGTTCATGCGTTTT AAAGTGCATATGGAGGGAAGCATGAATGGCCATGAGTTTGAAATCGAGGGGGAA GGGG A A GGACGCCC ATA TG A A GGC AC AC AG A CGGC A A A A TTG A A GGTG A CC A A A»_J A—J A-J A-J 2 A2 A A-J A-J 2 A A—A»J ✓ Aw—-- Aw—-- 2 A JL 2 A JL X_J 2 A2 A X_J A*_J 2 A ^k—2 A ^k—s £ A A-J 2 A X_J X_J A—2 A2 A 2 A2 A A JL X_J 2 A2 A X_J A-J JL X_J 2 A A~x £ A2 A AGGTGGGCCGCTGCCTTTTTCGTGGGATATTCTGTCTCCCCAGTTTATGTACGGTT CTCGCGCATTCATCAAGCACCCCGCTGATATTCCAGATTACTATAAGCAATCTTT TCCAGAGGGTTTCAAATGGGAGCGTGTTATGAACTTCGAGGATGGCGGAGCTGTT ACGGTTACTCAGGATACCTCGCTGGAGGATGGTACGCTGATCTATAAAGTAAAG TTACGCGGCACGA ATTTCCCTCC AGACGGTCCTGTC ATGCAGA AAA A A ACGATG JL JL 2 A A^ A_J A_J A-J x 2 AAx ^k-J £ A 2 A JL JL JL A—-' x A—-' JL A—-' A—-* £ A ^k-J £ AAx A-J JL A—-' JL X_J JL 2 A A ^k-J A~x 2 A A-J 2 A2 A 2 A2 A2 A2 A2 A A»J 2 A A ^k_J GGTTGGGAAGCGTCAACGGAGCGTTTGTACCCGGAAGATGGCGTGTTGAAAGGT GATATTAAGATGGCTCTTCGCCTTAAGGATGGGGGGCGCTACTTAGCTGATTTCA AAACCACATACAAAGCGAAGAAGCCAGTACAGATGCCTGGTGCGTACAATGTTG ACCGCAAATTGGACATCACAAGTCACAATGAGGATTACACTGTGGTCGAGCAGT A TG A GC GT A GTG A AGGTCGCC ACTCTACGGGCGGA ATGGATGAGCTGTAC A AGT AAGCGGCCAACGATGAAAACTATTCTGAAAACTATGCGGATGCGTCTTAATAAG GACGAGCCTCAGACTCCAGCGTAACTGGACTGAAAACAAACTAAAGCGCCCTTG TGGCGCTTTAGTTTTGTTCCGGATCCATCGTCCATTCCGACAGCATCGCCA (SEQ ID NO:68) Cre Block #1-1 - AraC / AraBAD + Cre P06956 with BBa K 1223006 His Tag + BBa B 1002 Term GGTACTGCCGGGCCTCTTGCGGGATGAATTCTTATGACAACTTGACGGCTACATC ^TC^TTTTTCTTC^^CCOOC^QO^CTCOCTCOOOCTOOCCCCOOTCC^ tttttAAAtAcccGcGAGAAAtAGAGttGAtcGtcAAAAccAAcAttGcGAccG ACGGTGGCGATAGGCATCCGGGTGGTGCTC A A A AGCAGCTTCGCCTGGCTGATA 2 A A- / A_J A_J JL A*_J A*_J A—A-J 2 A A £ A A*_J 2 A JL A—A—A-J A-J A-J A A»J A»J A A-J A—JL A—2 A2 A2 A2 A 2 A A~x JL JL A—A A-J A-J JL £ A A 2 A CGTTGGTCCTCGCGCC AGCTTA AGACGCTA ATCCCTA ACTGCTGGCGGA A A AGAT GTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAA AATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATT ATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCCGCAGTAACAAT TGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGG CGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGG GCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGCCA GTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGG ATGACGACCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGG TCGGCAAACAAATTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTG AGATTGAGAATATAACCTTTCATTCCCAGCGGTCGGTCGATAAAAAAATCGAGA TAACCGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAG TATCCCGGCAGCAGGGGATCATTTTGCGCTTCAGCCATACTTTTCATACTCCCGC CATTCAGAGAAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGT CTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTC TGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATA ATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGC CATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAAC TCTCTACTGTTTCTCCATACCCGTTTTTAAGGAGGTAAAAAATGTCAAATTTATTA ACTGTTCATCAGAACTTACCAGCTCTTCCGGTGGACGCAACGTCTGACGAGGTGC GTAAAAACTTAATGGATATGTTCCGTGATCGTCAAGCTTTTTCGGAACACACCTG GAAGATGCTTTTATCCGTGTGCCGTTCATGGGCAGCGTGGTGTAAACTTAATAAC CGC A AGTGGTTTCC AOCAGA ACCOOA AGATGTACGTGACTACTTGTTGT ACCTGC A_x V*_x xjLxx. JL A*_J JL JL JL A*_x x_x xx. x_J A— / J. x. xjLx A, A-x A»J A»J x A. xA. A_J x A JL A_J JL xxAx A*_J JL A»J xA A*_x JL x A x*_x JL JL A-J JL JL A_J JL x A A*_x \x JL A_J A AGCGCGCGGCTTAGCCGTA AAA ACCATTCAGCAGCACCTGGGTCA ATTAAACA x AxA A*_J A_x A-J x*_x A-J A_J A_J JL JL .£ A A—J A*_x A*—-- A_J JL x AxAxAxAxA x*_x x*_x x A JL JL x*_x x A A_J A_x x AA-J V*_x A A-x x*_x JL A»_J JL x jlx JL JL X JLX JLx TGTTACACCGCCGCTCTGGCTTACCCCGTCCCAGCGATTCCAATGCGGTTAGTTT AGTGATGCGTCGCATTCGCAAGGAGAACGTTGACGCCGGCGAACGCGCCAAGCA GGCCCTGGCCTTTGAACGCACCGATTTTGATCAGGTGCGTTCCTTGATGGAAAAT TCAGATCGCTGTCAGGACATTCGCAACTTAGCTTTTCTGGGAATTGCTTACAATA CCCTTTTACGCATTGCGGA A ATCGC ACGTATCCGTGTC A AGGA CATT A GCCGC AC ^k-x JL JL JL JL x jLV*_x ^—x x x. JL JL V*_x J J x jlx lx >l JL V*_x J ^k-x x jl^k-x ^k-J JL x l JL A_x A_x JL JL \*_x x jlx jl x jLV*_xx l JL JL x l A_x *_x ^k-J Ax x x A-_x CGACGGAGGTCGCATGTTAATCCATATTGGGCGTACAAAGACCCTGGTGAGTAC GGCGGGCGTGGAAAAGGCCTTATCACTGGGAGTGACGAAGTTGGTGGAGCGCTG GATCTCTGTTTCCGGCGTAGCCGACGACCCCAATAATTACTTGTTTTGTCGTGTGC GTAAAAACGGCGTAGCAGCCCCGTCGGCAACGTCGCAACTGTCTACCCGTGCTCT TGAAGGGATTTTTGAGGCAACGCACCGCCTGATCTATGGAGCAAAGGACGATTC TGGA C A A CGTT ATCTTGC A TGGTC AGGTC ATA GTGCGCGCGT A GGTGCGGC ACGC JL ^k—J ^k—J x ■. A-.' x xX x. A_x JL JL x x JL ^k-x JL JL ^k—J ^k~x x x. JL JL x_x zxV_J ^k-J JL A~x X i. JL x x x_J JL x*_x A__J A_x A—- ^k—J JL x jk^k—J JL A_x A_x x x A—- ^k-x GACATGGCCCGTGCCGGCGTGAGCATCCCTGAGATCATGCAGGCAGGAGGCTGG ACCAATGTGAATATCGTTATGAACTACATTCGTAATCTGGACTCCGAGACCGGCG CGATGGTCCGTTTACTTGAAGATGGAGACTAGGTGCACCACCACCACCATCACGT GTAACGCAAAAAACCCCGCTTCGGCGGGGTTTTTTCGCGATTTGTGATGGCCGCC AGGTCGAAACTTGATACTGTGGGGACTTAATGT (SEQ ID NO:69) Cre Block #2-1 - LoxP sfGFP Left: ACTTGATACTGTGGGGACTTAATGTTAACACCGTGCGTGTTGACAATTTTACCTCT GGCGGTGATAATGGTTGC GATATC ATAACTTCGTATAATGTATGCTATACGAAG TTATAGCTAGCAATAATTTTGTTTAACTTTAAGAAGGAGATATACC ATGAGCAA AGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGAT GTTAATGGGCACAAATTTTCTGTCCGTGGAGAGGGTGAAGGTGATGCTACAAAC GGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCGTGGC CAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTATCCGGAT CACATGAAACGTCATGACTTTTTCAAGAGTGCCATGCCTGAAGGTTATGTACAGG AACGCACTATATCTTTCAAAGATGACGGGACCTACAAGACGCGTGCTGAAGTCA AGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAGGGTA (SEQ ID NO:70) Cre Block #2-2 - LoxP sfGFP + BBa_M0052 Degradation Tag Right: GTTAATCGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTTG GACACAAACTCGAGTACAACTTTAACTCACACAATGTATACATCACGGCAGACA AACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACGTTGAAGATG GTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCC TGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGTCCTTTCGAAAGAT CCTAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGA TTACACATGGCATGGATGAGCTCTACAAAGCTGCTAACGACGAAAACTACGCTG ACGCTTCTTAACCGAGCTCGAGCAAAGCCCGCCGAAAGGCGGGCTTTTCTGT GG GCATGCTGAGCATAACTTCGTATAATGTATGCTATACGAAGTTATCCATCGCTTG CCCAAGTTGTGAAGC (SEQ ID NO:71) Cre Block #2-3 - Lox66 sfGFP Left: ACTTGATACTGTGGGGACTTAATGTTAACACCGTGCGTGTTGACAATTTTACCTCT GGCGGTGATAATGGTTGC GATATC ATAACTTCGTATAATGTATGCTATACGAAG GGTAAGCTAGCAATAATTTTGTTTAACTTTAAGAAGGAGATATACC ATGAGCAA AGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGAT GTTAATGGGCACAAATTTTCTGTCCGTGGAGAGGGTGAAGGTGATGCTACAAAC GGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCGTGGC CAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTATCCGGAT CACATGAAACGTCATGACTTTTTCAAGAGTGCCATGCCTGAAGGTTATGTACAGG AACGCACTATATCTTTCAAAGATGACGGGACCTACAAGACGCGTGCTGAAGTCA AGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAGGGTA (SEQ IDNO:72) Cre Block #2-4 Lox71 sfGFP + BBa_M0052 Degradation Tag Right: GTTAATCGTATCGAGTTAAAGGGTATTGATTTTAAAGAAGATGGAAACATTCTTG GACACAAACTCGAGTACAACTTTAACTCACACAATGTATACATCACGGCAGACA AACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACGTTGAAGATG GTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCC TGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGTCCTTTCGAAAGAT CCTAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGA TTACACATGGCATGGATGAGCTCTACAAA GCTGCTAACGACGAAAACTACGCTG ACGCTTCTTAACCGAGCTCGAGCAAAGCCCGCCGAAAGGCGGGCTTTTCTGT GG GCATGCTGAGCTACCGTTCGTATAATGTATGCTATACGAAGTTATCCATCGCTTG CCCAAGTTGTGAAGC (SEQ ID NO:73) Cre Block #3 - ProD - mScarlet - SoxR: CCATCGCTTGCCCAAGTTGTGAAGCACAGCTAACACCACGTCGTCCCTATCTGCT GCCCTAGGTCTATGAGTGGTTGCTGGATAACTTTACGGGCATGCATAAGGCTCGT ATAATATATTCAGGGAGACCACAACGGTTTCCCTCTACAAATAATTTTGTTTAAC TTTGATCGCATGGTTGCTACTAGAGAAAGAGGAGAAATACTAGATGGTCAGCAA AGGAGAAGCGGTGATCAAAGAGTTCATGCGTTTTAAAGTGCATATGGAGGGAAG CATGAATGGCCATGAGTTTGAAATCGAGGGGGAAGGGGAAGGACGCCCATATGA a ggc acacagac ggc aaaattgaa ggtg a cc a a a ggtgggc c gc tgc c tttttc y A—J A—J xxAy xjl x—' JL. V—J x JL / x—B x—J x JLxjLxjlxjl JL JL A—J i Tl.1. x x—B x—B JL x—J xjL x— / J. jLxJlxjL. x_J J JL x—B x—B x—B x— / x_J A— / JL A—J JL JL JL JL JL > GTGGGATATTCTGTCTCCCCAGTTTATGTACGGTTCTCGCGCATTCATCAAGCACC CCGCTGATATTCCAGATTACTATAAGCAATCTTTTCCAGAGGGTTTCAAATGGGA GCGTGTTATGAACTTCGAGGATGGCGGAGCTGTTACGGTTACTCAGGATACCTCG CTGGAGGATGGTACGCTGATCTATAAAGTAAAGTTACGCGGCACGAATTTCCCTC CAGAC'GGTC'rTGTCATGC'AGA A A A A A ACGATGGGTTGGGA AGCGTC A ACGGAGC x1L V—J x 1L x_> V—J V—J JL x_> X—-* JL x—B JL x—' x JL JL X—J x_> x jl x_J x jlxjlx jlx jlx 3lx jlx jl x jL JL JL JL x iLx jL JL x jlx jl kJ x V. GTTTGT A CCCGG A AGA TGGCGTGTTG A A A GGTG A T A TT A A GA TGGC'TCTTCGCCT JL JL JL JL x JLX—A—J x—* x 3lx 3l^l_J x jl JL x—J A—J A»_z A—J JL A—J JL JL A»J ^^.1. jlx jl^l—J A—J JL A—J y A, JL J. A JL JL x Ax A^l—J x A JL A—J x—<1 A»_^ JL A—✓ JL JL A—✓ A—* A—A—JL TAAGGATGGGGGGCGCTACTTAGCTGATTTCAAAACCACATACAAAGCGAAGAA GCCAGTACAGATGCCTGGTGCGTACAATGTTGACCGCAAATTGGACATCACAAG TCACAATGAGGATTACACTGTGGTCGAGCAGTATGAGCGTAGTGAAGGTCGCCA CTCTACGGGCGGAATGGATGAGCTGTACAAGTAAGCGGCCAACGATGAAAACTA TTCTGAAAACTATGCGGATGCGTCTTAATAAGGACGAGCCTCAGACTCCAGCGTA ACTGGACTGAAAACAAACTAAAGCGCCCTTGTGGCGCTTTAGTTTTGTTCCGGAT CCATCGTCCATTCCGACAGCATCGCCA (SEQ ID NO:74) OR1 / 2 G2LL - T7 Pol Change GGTACTGCCGGGCCTCTTGCGGGATGAATTCTAACACCGTGCGTGTTGACAATTTT ACCTCTGGCGGTGATAATGGTTGCGATATCAGCTAGCAATAATTTTGTTTAACTTTG GGAAGGAGGGTGTGCATGAACACGATTAACATCGCTAAGA (SEQ ID NO:75) OR1 / 2 G3U2 - T7 Pol Change GGTACTGCCGGGCCTCTTGCGGGATGAATTCTAACACCGTGCGTGTTGACAATTTT ACCTCTGGCGGTGATAATGGTTGCGATATCAGCTAGCAATAATTTTGTTTAGGGTTG GGAAGGAGGGTTGGGATGAACACGATTAACATCGCTAAGA (SEQ ID NO:76) DnaK_g710 RBS - T7 Pol Change GGTACTGCCGGGCCTCTTGCGGGATGAATTCATGCCTTGGCTGCGATTCATTCTTTA TATGAATAAAATTGCTGTCAATTTTACGTCTTGTCCTGCCATATCGCGAAATTTCTG CGCAAAAGCACAAAAAATTTTTGCATCTCCCCCTTGATGACGTGGTTTACGACCCC ATTTAGTAGTCAACCGCAGTGAGTGAGTCTGCAAAAAAATGAAATTGGGCAGTTG AAACCAGACGTTTCGCCCCTATTACAGACTCACAACCACATGATGACCGAATAAG CTAGCAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGAACACGATTAACAT CGCTAAGA (SEQ ID NO:77) lbpA g7lO RBS - T7 Pol Change GGTACTGCCGGGCCTCTTGCGGGATGAATTCAAAATAACATCATCATTACGTCGCA CTGTGGCGGCTATCGCACTTTAACGTTTCGTGCTGCCCCCTCAGTCTATGCAATAG ACCATAAACTGCAAAAAAAAGTCCGCTGATAAGGCTTGAAAAGTTCATTTCCAGA CCCATTTTTACATCGAGCTAGCAATAATTTTGTTTAACTTTAAGAAGGAGATATACC ATGAACACGATTAACATCGCTAAGA (SEQ ID NO:78) HtrA_g710 RBS-T7 Pol Change GGTACTGCCGGGCCTCTTGCGGGATGAATTCTCGGAACTTCAGGCTATAAAACGA ATCTGAAGAACACAGCAGCTAGCAATAATTTTGTTTAACTTTAAGAAGGAGATATA CCATGAACACGATTAACATCGCTAAGA(SEQ ID NO:79) pKAT - 4U - T7 Pol Change GGTACTGCCGGGCCTCTTGCGGGATGAATTCCATTATTGCAATTAATAAACAACTA ACGGACAATTCTACCTAACAGATATCGTTGAACTTTTGAATAGTGATTCAGGAGGT TAATGAACACGATTAACATCGCTAAGA(SEQ ID NO:80) pKAT - Theo-4U-Lys - T7 Pol Change GGTACTGCCGGGCCTCTTGCGGGATGAATTCCATTATTGCAATTAATAAACAACTA ACGGACAATTCTACCTAACAGATATCAAGTGATACCAGCATCGTCTTGATGCCCTT GGCAGCACTTCAGAAATCTCTGAAGTGCTGTTTTTTTTCTCGAGGTTGAACTTTTG AATAGTGATTCAGGAGGTTAATGATGAACACGATTAACATCGCTAAGA (SEQ ID NO:81) ssDNA Oligos: LoxP Removal Bridge TGGCGGTGATAATGGTTGCGATATCAGAGTGCTTTAGCTAGCAATAATTTTGTTTAA CTT (SEQ ID NO:82) 4U LoxP Insertion Bridge TAACGGACAATTCTACCTAACAGATAACTTCGTATAATGTATGCTATACGAAGTTAT CGTTGAACTTTTGAATAGTGATT (SEQ ID NO:83) T4UL LoxP Insertion Bridge TAACGGACAATTCTACCTAACAGATAACTTCGTATAATGTATGCTATACGAAGTTAT CAAGTGATACCAGCATCGTCTTG (SEQ ID NO:84) Ara / LoxP Insertion Bridge TCGCAACTCTCTACTGTTTCTCCATAACTTCGTATAATGTATGCTATACGAAGTTATA CCCGTTTTTAAGGAGGTAAAAAAT (SEQ ID NO:85) Proteins: • sfGFP - superfolder green fluorescent protein - Pedelacq J-D et al (2005) Nature Biotechnology, 24(1): 79-8. • SsrA Degradation Tag - IGEM Biobrick BBa_M0052; McGinness KE et al (2006) Mol Cell., 22(5):701-707. • mScarlet - red fluorescent protein; Bindels D. et al (2016) Nature Methods, 14( 1): 53-55. • Cre Recombinase - Sternberg N. et al (1986) J. Mol. Biol., 187(2): 197-212. • BBa_K1223006 6xHis-Tag - IGEM Biobrick Registry • T7 RNA Polymerase - Shimizu Y. et al (2001) Nat. Biotechnol., 19(8): 751-755. • AraC - part of the AraBAD Promoter system; Khlebnikov A. et al (2000) J.Bacteriol., 182(241: 7029 7034. Promoters: • OR2-OR1 - constitutively active promoter; Shin J. and Noireaux V. (2010) J. Biolog. Eng., 4: 8. • IbpA - heat shock promoter; Chuang S-E. et al (1993) Gene, 134(1): 1-6. • DnaK - Heat shock Promoter; Rodrigues J. L. et al (2014) J. Biotechnol., 188: 61-71. • HtrA - Heat shock Promoter; Lipinska B. et al (1988) Nucleic acids research, 16(21): 10053-10067. • T7 Promoter - MacDonald I. C. etal (2021) Nature communications, 12(1): 4109. • ProD - Constitutively Active Promoter - Davis J. H. et al (2011) Nucleic acids research, 39(3), 1131-1141. • pKAT - Constitutively active promoter; Yao A. I. et al (2013) ACS synthetic biology:, 2(2), 111-120. • AraBAD - Arabinose Inducible Promoter; Khlebnikov A. et al (2000) J. Bacterio!., 182(24): 7029-7034. Terminators: • T500 terminator - Greenblatt J.F. (2008) Cell, 132(6): 917-918. • BBa_B1002 Terminator - Thesis, Huang H. (2009) Design and characterization of artificial transcriptional terminators. • BBaBOOI 5 Terminator - Leonard S. P. etal (2018) ACS Synthetic Biology, 1_(5)A219-1290. • SoxR Terminator - Lynch M.D. &Gill R. T. (2006) Biotechnology and Bioengineering, 94(1): 151-158. • T7 Terminator-MacDonald I. C. et al (2021)Nature Communications, 12(1): 4109. Recombination sites: • LoxP • Lox66 • Lox71 All from Shaw, D. et al (2Q21) Microbiology (Reading, England), 167(1): 000997. Riboswitches and 5 ’ UTRs: • g710 Ribosome Binding Site - Olins P.O. et al (1988) Gene, 73(1): 227-235 • Toehold Switch - Ribosome Binding Site; Green A. A. et al (2014) Cell, 159(4): 925-939. • Toehold Switch - Complementary Activation Sequence; Green A. A. et al (2014) Cell, 159(4): 925-939. • G2 LL G-Quadruplex Thermoswitch - Wieland M. &Hartig J. S. (2007) Chemistry &Biology, 757-763. • G3U2 G-Quadruplex Thermoswitch - Wieland M. &Hartig J. S. (2007) Chemistry &Biology, U(Ty. 757-763. • 4U Thermoswitch - RoBmanith J., &Narberhaus F. (2016) Nucleic acids Res., 44(11), 5410-5423. • Theo-4U-Lys Thermoswitch - RoBmanith J., &Narberhaus F. (2016) Nucleic acids Res., 44(11), 5410-5423. Restriction sites: EcoRV - Used to linearise pBR322 plasmid through blunt end digestion. EcoRI and Hindlll - Sticky end digestions, sites included as an alternative means of plasmid assembly. Sequence Design and Assembly Plasmid insert sequences were designed using published articles, supplementary data, and GenBank submissions. Parts were organised as follows: (5’ - 3’): Promoter - RBS / Riboswitch - Product - Terminator Restriction sites were included for insertion into a plasmid multiple cloning site (MCS) via sticky end ligation and for manipulation of DNA sequences if needed. However, the primary method of assembly was the use of NEBuilder™ HiFi DNA Assembly Master Mix (New England Biolabs - #E5520S) to join together multiple DNA sections with matching overlapping sequences at the ends. Insert sequences were synthesised by IDT as gBlocks™ (SEQ ID NOs: 67-74). These parts were designed to include their required protein products, promoters, terminators, and other relevant parts as needed for the full assembly, but also to include 25nt of overlap in order to be joined onto the next gBlock™ in the sequence. gBlocks™ at the ends of the desired insert sequence were designed to have 25nt of overlap with the sections flanking the EcoRV restriction site of pBR322 plasmid (Thermofisher Scientific - #SD0041). pBR322 was digested using EcoRV prior to the insertion reaction. All parts were then assembled together in a single reaction to combine all DNA fragments and recircularise the digested plasmid using the insert before purifying and transforming the plasmid into DH5a (New England Biolabs - #C2987H) or NEB Stable (New England Biolabs - #C3040H) E. coli via heat shock. LoxP sites were assembled using EcoRV Digested pBR322 and 4 gBlocks (SEQ ID NO: 69, 70, 71, 74). Each gBlock™ was flanked with primer sites for amplification by PCR (SEQ ID NOs: 31-35, 37-42) and various restriction sites are included for modular assembly. Primers were designed to screen for either the entire insert or individual parts via colony PCR as quality control for individual strains (SEQ ID NOs:45-54). Primers were also synthesised by IDT as 25 nmole ssDNAoligos. To minimise synthesis of large protein coding sequences, promoters and riboswitches were swapped out in a modular fashion. This was done via PCR using forward primers that targeted the very start of the protein coding sequences (SEQ ID NOs:36, 55) in combination with their relevant reverse primer to amplify the entire previously created insert. This was then joined onto a new shorter gBlock™ that included a new promoter or riboswitch and 25nt of overlap onto the start of the protein coding region (SEQ ID NOs: 75-81). For making small scale insertions and deletions (i.e., removing and inserting LoxP sites), primers were designed to amplify the plasmid entirely in a linear fashion immediately flanking the region where the change is desired (SEQ ID NOs: 56-63, 65, 66). NEBuilder was then used to utilise an ssDNA oligo bridge as a template to recircularise the plasmid. The ssDNA oligo includes 25nt of matching overlap either end of the linearised template, but also included either a LoxP site to be added (SEQ ID NOs: 83-85) or a randomised lOnt sequence if deleting LoxP (SEQ ID NO:82). Bridging oligos were synthesised by IDT as 100 nmole ssDNA oligos. DNA Purification DNA Products from PCR, restriction digests, and NEBuilder assemblies were purified using NEB™ Monarch® PCR &DNA Cleanup Kit (New England Biolabs -#T1030L). Depending on the size of the sample, 5x the volume of Binding Buffer was added to the sample and mixed by pipetting. The mixture was loaded into a spin column and centrifuged at 16,000g for 1 minute, the flow-through discarded. The spin column was loaded with 200 pL Wash Buffer with ethanol, centrifuged at 16,000g for 1 minute, and the flow-through discarded. For a second time, the spin column was loaded with 200 pL Wash Buffer with ethanol, centrifuged at 16,000g for 1 minute, and the flow-through discarded. The column was centrifuged while empty at 16,000g for 1 minute to remove residual wash buffer. The PCR purification column was transferred into a fresh microcentrifuge tube, with 8 - 30 pL of ultrapure water pipetted into the centre of the column membrane, with the volume depending on the desired concentration of DNA for downstream purposes. This was left for 5 minutes to resuspend the bound DNA. The column was centrifuged at 16,000g for 1 minute to extract DNA before quantifying via Nanodrop UV-vis (Thermo Scientific - #ND2000USCAN). Restriction digest protocol The following solution mixture was prepared: pBR322 (Thermofisher Scientific - ##SD0041) 10X CutSmart buffer (New England Biolabs - #B6004S) EcoRV-HF (New England Biolabs - #R3195S) Ultrapure Water (UPW) 2000 ng 2pL 2 pL Up to 20 pL The mixture was placed in a thermocycler to incubate for 1 hour at 37°C, then heat inactivated at 65°C for 20 minutes. The mixture was purified using NEB™ Monarch® PCR &DNA Cleanup Kit (New England Biolabs - #T1030L) and eluted in 20 pL ultrapure water. NEBuilder Protocol For assembling a dsDNA insert >200bp into a plasmid, the molar ratios of digested vector (pBR322) to insert were 1 : 1.65. With multiple inserts, each insert was used at 11:1 ration vs eachother, with the volumes used depending on the calculated molecular mass of the sequence, and the results of Nanodrop UV / Vis quantification. If the insert was shorter than 200bp, a 1:5 ratio was used instead. The following reaction mixture was prepared: 2X NEBuilder HIFIDNA Assembly Master Mix 4pL 87.9ng / pL EcoRV Digested pBR3 22 1 pL DNA Insert / s As described above UPW Up to 8 pL The reaction was then incubated at 50°C for 1 hour. The assembled plasmid was then purified using NEB™ Monarch® PCR &DNA Cleanup Kit (New England Biolabs -#T1030L) and eluted in 6 pL ultrapure water, then transformed into E.coli via heat shock protocol. If instead an ssDNA oligo was being used to bridge a PCR linearised plasmid, the reaction was as follows: 2X NEBuilder HIFI DNA Assembly Master Mix 4pL 0.005 pmol / pL PCR linearised plasmid 0.4 pL DNA Insert / s As described above UPW Up to 8 pL PCR Protocol For standard PCR, the following reaction mixture was prepared: 5X Q5 Buffer (New England Biolabs - #B9027S) 10 pL Q5 High GC Enhancer (New England Biolabs - #B9028AVIAL) 5 pL 10 mM dNTPs (New England Biolabs - #N0446S) 2 pL 100 pM Forward Primer 0.25 pL 100 pM Reverse Primer 0.25 pL DNA Template lOOng Q5 Taq Polymerase (New England Biolabs - #M0491S) 0.5 pL Nuclease Free Water / UPW up to 50 pL The following thermocycler program (Applied Biosystems ProFlex PCR system) was prepared and run: Temperature Time Cycles 98°C 1 Minute lx 98°C 10 Seconds 16x 64°C 30 Seconds 16x 72°C 1-9 Minutes* 16x 72°C 10 Minutes lx *Extension time was varied depending on the size of the amplicon, with 1 minute added per Ikb of amplicon size. For colony PCR (cPCR), the same basic protocol was used, but with several changes. The reaction mixture was miniaturised down to 10 pL, and the DNA template used was replaced with a bacterial colony picked directly from a plate with a small pipette time and immersed into the reaction mixture. The thermocycler program was as follows: Temperature Time Cycles 98°C 15 Minute lx 98°C 10 Seconds 3 Ox 64°C 30 Seconds 3 Ox 72°C 1-9 Minutes* 3 Ox 72°C 10 Minutes lx *Extension time was varied depending on the size of the amplicon, with 1 minute added per Ikb of amplicon size. Each 10 pL of cPCR product had 4 pL of Purple Loading Dye (New England Biolabs - #B7024S) added directly to the PCR reaction mixture, mixed, and was analysed by gel electrophoresis. E. coli heat shock, selection, culturing and analysis Atube of either NEB DH5-alpha (DH5a) or NEB Stable Competent^. coli cells was thawed on ice for 10 minutes. 1-5 pl containing 1 pg-100 ng of plasmid DNA was added to the cell mixture, the tube carefully flicked 4-5 times to mix cells and DNA and placed on ice for 30 minutes. Heat shock was carried out at exactly 42°C for exactly 30 seconds, the mixture then placed on ice for 5 minutes before 950 pl of room temperature Super Optimal broth with Catabolite repression medium (SOC medium) was pipetted into the mixture. The resulting mixture was placed on ice for 5 minutes, warmed at 37°C for 60 minutes before being shaken vigorously at 250 rpm. For transformations where the plasmid contained a temperature sensitive insert (e.g., RNA Thermoswitch controlled Cre Recombinase) this 37°C for 60 minutes was swapped for 25°C for 3 hours to avoid premature activation. Selection plates were warmed to 37°C. The cellular mixture was mixed thoroughly by flicking the tube and inverting, before performing a 1:10 dilutions in SOC medium (New England Biolabs - #B9020S if using DH5a E. coli, or New England Biolabs -#B9035S if using NEB Stable E. coll). 50 pl of each dilution was spread onto a selection plate and incubated overnight at 37°C. Alternatively, the cells were incubated at 30°C for 24-36 hours or 18°C for 72 hours. pBR322 contains an ampicillin resistance gene for selection. LB agar plates were prepared with 10g LB Lennox powder (Thermofisher scientific - #12780052) and 7.5g agar (VWR - #20767.23) in 500 mL UPW. This mixture was then autoclaved, cooled (but hot enough to still be liquid and poured into plates), before adding lOOOpL lOOmg / mL ampicillin (Thermofisher Scientific - #J63807.06). Liquid LB media + ampicillin for culturing was prepared in the same way but without agar. As LB media has autofluorescent properties that can obscure weak signals during downstream fluorescence investigations, M9 minimal media was also used for culturing. 100mL of M9 minimal media was prepared using 50mL 2X Minimal Salts (Gibco -#A1374401), 10 pL IM Calcium Chloride (Thermofisher Scientific -#L13191.30), 200 pL IM Magnesium Sulphate (Thermofisher Scientific - #423905000), 1000 pL 100X MEM Vitamin Solution (Gibco - # 11120052), 2 mL 20% Glucose (Thermofisher Scientific - #450740010), and 200 pL Ampicillin, with UPW added up to a total volume of 100 mL. M9 Agar was also prepared in the same way, with the same ratio of agar as LB added before autoclaving. Components such as sugars and antibiotics were added after the molten agar had cooled sufficiently before pouring into plates. Plates and media that contained arabinose was prepared to a concentration of 0.5% arabinose by adding 1 / 10 of the total media volume of filter sterilised 5% L(+)-arabinose (Thermofisher Scientific - # 365180250) dissolved in UPW. Colonies were picked by using a blue-light safe imager (Invitrogen - #G6600) to visualise fluorescent colonies on the agar plates. E. coli were then grown from individual colonies in 96 well plates (8 strains per insert variant) and cultured in either LB media + ampicillin overnight at either 37 °C or 30 °C (shaking incubator, 150rpm (New Brunswick -#M1335-0012) or 18 °C (air conditioned room, orbital shaker - Stuart Scientific - #SO3) if the strains were heat activated Cre strains) before being scanned for successful expression of both sfGFP and mScarlet using a BMG Clariostar plate reader, with fluorescence spectral scans set for each protein using bottom optics (sfGFP: Ex = 465nm, Em = 490nm - 560nm mScarlet: Ex = 555nm, Em = 590nm - 670nm) in a 96 well plate (Greiner - #M0812-100EA). If larger cultures were scanned for fluorescence, this was done using 3mL of culture in a macro cuvette (BRAND - #BR759030) in an Agilent Cary Eclipse fluorescence spectrophotometer with micro magnetic stirrer bars (SourcingMap - #a21060800ux0431). Fluorimeter settings were as follows: sfGFP: Ex = 480nm, Em = 495nm - 595nm mScarlet: Ex = 560nm, Em = 575nm -675nm, slit widths 5nm (for both excitation and emission), averaging time = 0.5s, and PMT voltage variable depending on the strength of the signal (between 600 V and 800 V). Gel Electrophoresis 1% agarose gels were cast by melting 0.5g agarose (Invitrogen - #16500100) in 50mL IX TAE buffer (Fisher - #B49). Once slightly cooled but still molten, 5 pL SYBRsafe DNA stain (Fisher - #S33102) was added, thoroughly mixed throughout the agarose, then poured into a cast and left to cool and set. Gels were then placed into a gel electrophoresis tank, immersed in IX TAE Buffer, and 10 pL samples mixed with loading dye were pipetted into the wells. The gel was then run at 140V-160V for 30 - 45 minutes (Fisher Scientific - #POWERPRO-300). Gels were then imaged for analysis using a UV imaging system (UVP - #BioDoc-It). In Vitro Cre Recombinase Activity Assay Sequences to be tested in vitro with recombinant Cre were amplified via PCR into a linear template containing both the region to be shortened by Cre activity and control sequence (Primers SEQ ID NO: 31 + 34). Samples were split into 2 sets, + / - Cre. Reaction mixtures were set up as follows: DNA 250ng 10X Cre Recombinase Buffer (New England Biolabs - #B0298SVIAL) 5 pL (+ / -) Cre Recombinase (New England Biolabs - #M0298SVIAL) 1 pL UPW Up to 50 pL Samples were then incubated at 37 °C for 30 minutes before purification via NEB™ Monarch® PCR &DNA Cleanup Kit. Purified DNA was then amplified by PCR, using the following primer sets depending on the section of DNA being screened: Cre activity region screening primers: SEQ ID NOs: 43 + 44 Control region screening primers: SEQ ID NOs: 51+52 Products were then analysed via gel electrophoresis (1% gel, 140V, 40 minutes). If Cre Activity is successful the LoxP Flanked sfGFP Cre Activity Region will drop by approximately 900bp in amplicon size from 1.8kb to 900bp. Preparation of T4UL-T7-sfGFPE. coli bacterial composite Polycaprolactone (PCL) filament 2 x 150mL of T4UL-T7-sfGFP E. coli were cultured in LB Media for 24 hours at 18°C, shaking at 150 rpm on an orbital shaker. Cultures were then loaded into 6 x 50 mL falcon tubes and centrifuged at 4000rpm for 15 minutes to pellet the bacteria (Eppendorf -#581 OR). The supernatant was discarded. Each pellet weighed approximately 300mg, to which 2g of PCL pellets (EasyComposites - #MP-PCL-4) was added and shaken thoroughly to mix and coat the pellets, for a total of 12g of bacteria coated pellets. To create custom PCL filament, a 3Devo Composer filament extruder was used. This machine has four different heating stages along its auger, with heater #4 nearest the hopper, and heater #1 nearest the extruder, allowing a great deal of control over the temperature of extruded plastics. As the auger sits filled with PCL from the previous usage, a higher temperature initial material setting is used on startup. This setting sets heater #4 at 55°C, #3 at 130°C, #2 at 130°C, and #1 at 110°C, with the auger speed set to 2 rpm. Once the machine was warmed up and flowing smoothly, a lower temperature setting was used, with heater #4 at 42°C, #3 at 85°C, #2 at 85°C, and #1 at 85°C, with the auger speed still set to 2 rpm. This was allowed to run continuously while cooling until the live monitoring thermometers match the newly set lower temperatures. Once producing PCL filament at this lower temperature, a portion of uncontaminated control PCL filament was produced until the hopper ran empty, at which point bacteria coated pellets were added (Figure 2a) and extruded (Figure 2b). The extruder was allowed to run continuously, with additional blank PCL added to the hopper after the bacterial pellets to keep the auger from running empty and avoiding damage to the machine. After 30 minutes, the output filament was collected and checked under a blue-light safe imager to look for clumps of mScarlet expressing bacteria. Low levels of bacteria were difficult to spot as PCL has autofluorescent properties that give it a pink / red colour when excited with blue light, and the T4UL-T7-sfGFP E. coli only expresses mScarlet at low temperature (such as its 18°C culture condition). However, small clumps of T4UL-T7-sfGFP E. coli that were not fully broken up by the extrusion process were visible and fluoresce strongly, allowing regions with bacteria present to be identified (Figure 2c). 1.75mm diameter, 3-4mm long sections of filament containing the bacterial chunks were cut out with a scalpel (Figure 2d), briefly pressed with a flat spatula against a hot plate (Sciquip - # SP2230-280H) set to 80°C and covered with clean tin foil to form thin flat discs roughly 8mm in diameter (Figure 2e). These were then left at room temperature for 2 hours to allow for any fluorescent protein expression or refolding after heating, loaded into the wells of a 96 well plate (Greiner - #M0812-100EA), and scanned for sfGFP and mScarlet fluorescence using a BMG Clariostar plate reader (top optics, Gain = 2000 for both fluorescent proteins). DNA Ratio Analysis and Calculation To determine the relative quantities and ratios of DNA that has been acted upon by recombinase to varying extents, PCR was performed on a heterogenous mixture of DNA that share the same primer binding sites but produce different sized amplicons due to the effect of Cre recombinase. cPCR was performed on colonies that contained sfGFP flanked by LoxP sites and Cre recombinase under the control of the AraC arabinose inducible promoter (the same strains used for the cPCR screening shown in Figure 4a) using primers that bound outside of the Cre Activity screening region (SEQ ID NO: 50 + 51). As the previous screening (Figure 4a) demonstrated that Cre had successfully reduced the size of the amplicon for colonies grown on arabinose plates, the sizes of these starting template amplicons were 2789bp (Non-shortened control template from LoxP flanked sfGFP strain grown on non-arabinose LB agar plate) and 1909bp (Cre-shortened template from LoxP flanked sfGFP strain grown on +0.5% arabinose LB agar plate). The cPCR reactions were purified and the yield determined via Nanodrop UV-Vis quantification. The cPCR products were then standardised to lOnM concentrations by diluting in ultrapure water, then assembled intolO pL PCR reactions with varying ratios of cPCR Product, as set out in Table 1. Table 1: DNA Ratio (Non-arabinose control (2789bp): Arabinose Cre-Shortened (1909bp)) Volume of lOnM Control Template (pL) Volume of lOnM Cre-shortened Template (pL) Volume of ultrapure water (up to lOpL) (pL) 8:1 4 0.5 0 4:1 2 0.5 2 2:1 1 0.5 3 1:1 0.5 0.5 3.5 1:2 0.5 1 3 1:4 0.5 2 2 1:8 0.5 4 0 These samples were then amplified by PCR (22x cycles, 2 minute extension time) using the Lox region screening primers (SEQ ID NO: 43 + 44) and analysed via gel electrophoresis (1% gel, 160V, 30 minutes). PCR products that used the non-shortened template will be 1784bp, while those that originate from the Cre shortened template will be 904bp long. By combining the non-shortened and Cre shortened starting templates in different ratios, the PCR products will comprise of two different sized bands, with the intensity of each band being proportional to their ratio in the starting template mixture. Each lane of the gel was then analysed using the ImageJ open-source software (vl ,54g) “Analyze-Gels” tool. This was used to quantify the intensity of each band by manually drawing lines to close off the base of each peak, then using the wand tool to calculate the area of each peak (see Figure 15a, 15b). The cumulative intensity of the peaks of interest in each lane was calculated, and the percentage of total intensity of each peak within its gel lane was calculated and used to predict the relative amount of DNA of each species (based on Nonshortened or Cre shortened template) in each reaction mixture (see Figure 15c). RESULTS An example of a genetic design in accordance with the invention is depicted in Figure 3a. The cassette includes i) a protein coding sequence for Cre recombinase under the control of the AraBAD arabinose inducible promoter, ii) sfGFP with an SsrA degradation tag flanked by LoxP or Lox 66 / 71 sites under the control of a constitutively active OR 1 / 2 promoter, and iii) mScarlet under the control of a constitutively active ProD promoter. When arabinose is added to activate the AraBAD promoter, Cre will be expressed and excise the sfGFP coding region, leading to a drop in sfGFP fluorescence. The SsrA tag is included to promote degradation of sfGFP to avoid a drop in fluorescence being masked by an accumulation of sfGFP prior to any Cre-induced changes. mScarlet will remain unaffected and act as a fluorescent reporter and reference for assessing sfGFP expression and cell density. Each protein sequence is also accompanied by an appropriately positioned ribosome binding site (RBS), and a unique terminator. Also shown are the relative positions of Cre activity screening primers and control primers, demonstrating how successful Cre excision brings the screening primers together leading to a shorter amplicon. Not shown but included in the insert is the AraC repressor protein coding region upstream of the bidirectional AraBAD promoter which provides the arabinose sensing functionality of the system. Figure 3b is a gel electrophoresis of an in vitro Cre recombinase assay carried out in accordance with the methods set out above. The assembled inserts were assembled, containing either LoxP or Lox 66 / 71 sites, and amplified by PCR. The PCR products were then treated with a commercially available purified Cre recombinase, then used as PCR templates with either Cre Screening primers (SEQ ID NO: 43 + 44) that produce a shorter amplicon if sfGFP has been excised or Control primers (SEQ ID NO: 51 + 52) that target a downstream region outside of any Cre activity. This assay demonstrates that the designed Cre sites are functional, with the expected drop in Cre Screening PCR amplicon size occurring in both the LoxP and Lox66 / 71 variants, with a stronger shortened product band occurring for LoxP. Figure 4 shows the results of in vivo testing of arabinose-inducible Cre recombinase. Using both Cre screening and control primers for E. coli grown on either control or 0.5% arabinose LB agar plates, those grown on arabinose demonstrated the expected reduction in Cre screening amplicon size, demonstrating that the Cre recombinase system is functional in E. coli and can be controlled with arabinose. The results are shown in the gel electrophoresis of colony PCR from arabinose-exposed DH5a E. coli of Figure 4a. Figure 4b is a graph showing the raw fluorescence kinetics of sfGFP expression. Control cultures demonstrated an increase in sfGFP expression, while those grown in 0.5% arabinose produced a far lower increase in sfGFP fluorescence intensity, suggesting that the arabinose-induced Cre activity is disrupting sfGFP expression. Figure 4c is a graph showing the sfGFP intensity / mScarlet intensity kinetics. mScarlet was used as a reference for cell growth to demonstrate that the increase in control sfGFP and not 0.5% arabinose sfGFP was not due to arabinose inhibiting cell growth. There is a lag in which 0.5% arabinose is producing more sfGFP than the control, likely due to the presence of glucose in the M9 minimal media preventing the activation of the arabinose operon until enough glucose has been depleted (Schleif R. (2010) FEMS microbiology reviews, 34(5): 779 796). Figure 4d is the fluorescence spectra of sfGFP and mScarlet referenced against OD600. Nanodrop UV-vis spectroscopy was used as an additional means of determining sfGFP intensity vs cell density, as well as comparing against and confirming mScarlet intensity as a reliable method of measuring cell growth with fluorescence. Figure 5 illustrates three genetic diagrams of heat controllable inserts as examples of the present invention. Each insert contains T7 polymerase under the control of a different heat sensitive genetic element, sfGFP under the control of a T7 promoter, and mScarlet under the control of a constitutively active ProD promoter. T7 polymerase is used to provide a stronger signal in response to any change in expression due to heat, as each expressed T7 polymerase can express multiple copies of sfGFP. mScarlet is again used as a fluorescent reporter of cell density. Specifically, the insert of Figure 5a uses an E. coli heat shock promoter (either Dnak, IbpA or HtrA) to test endogenous heat detection methods for use in this application. The insert of Figure 5b uses a constitutively active promoter (pKAT for RNAT, OR1 / 2 for GQ) and includes an RNA secondary structure across the ribosome binding site to prevent translation until disrupted by heat. The secondary structure is either a stem-loop (RNAT) or a G-quadruplex (GQ). The insert of Figure 5c contains 2 heat shock promoters (DnaK and IbpA). The first promoter (Dnak) controls the expression of T7 polymerase and includes a stem-loop RNA secondary structure “toehold switch” over its ribosome binding site (Toehold Switch Ribosome Binding Site - TS-RBS). The second promoter controls the expression of a short RNA sequence that is complementary to the TS-RBS (Toehold Switch - Complementary Activation Sequence - TS-CAS). The transcribed TS-CAS RNA strand binds to the TS-RBA and disrupts the stem-loop, revealing the RBS and allowing translation to occur. This mechanism is designed to require both heat shock promoters to be active at once to improve the specificity of the heat shock response, similar to an AND logic gate. Figure 6 shows the results of a heat shock T7-sfGFP insert. Figure 6a shows the full results while Figure 6b zooms in on the y-axis of same results. Each insert was transformed into E. coli and grown for 24 hours at 3 different temperatures (18°C, 30°C, 37°C). Each was then scanned for sfGFP and mScarlet fluorescence, with sfGFP being referenced against mScarlet to indicate the relative level of sfGFP expression vs cell density. The desired qualities of a thermoswitch for this application are to provide a low level of expression at low temperatures but a strong increase with an increase in temperature. For this purpose, the elements demonstrating the tightest control in response to increasing temperature were 4U riboswitch (4U), Theo-4U-Lys Riboswitch (T4UL), HtrA Promoter, and DnaK / IbpA Toehold. Figure 7 illustrates the kinetics of heat-sensitive genetic elements in accordance with the present invention. Each element-containing strain was scanned for sfGFP and mScarlet fluorescence over time at either 40°C or 18°C to determine how long each mechanism takes to respond to increased temperature and how strong the response is. sfGFP intensity was referenced against mScarlet intensity to determine the relative change in gene expression. Figure 7a shows the 4U riboswitch kinetics. Figure 7b shows the Theo-4U-Lys riboswitch kinetics. Figure 7c shows the HtrA promoter kinetics. Figure 7d shows the DnaK / IbpA Toehold Switch Kinetics. Figure 7e shows the compiled kinetic data for all elements at 40°C, normalised to starting values. Figure 7f shows the compiled kinetic data for all elements at 18°C, normalised to starting values. These results demonstrate that each heat-sensitive genetic element provides different dynamics and speed of response to the increase in temperature, as well as producing different strengths of response. Figure 8 is a genetic diagram of an insert with Arabinose-inducible Cre recombinase flanked by LoxP sites in accordance with the invention. This insert is similar to the insert depicted in Figure 3a. However, the LoxP site between Cre and sfGFP has been shifted upstream of the Cre recombinase coding sequence. This means that successful Cre expression will lead to excising its own coding sequence and sfGFP together. This causes a large drop in PCR amplicon size, as well as a reduction in sfGFP expression due to it no longer being maintained in a plasmid with an origin of replication, and Cre recombinase no longer being expressed potentially to reinsert it. Figure 9 shows the results of an arabinose-inducible LoxP flanked Cre insert in accordance with the present invention. Figure 9a is a gel electrophoresis of colony PCR from arabinose-exposed NEB Stable AraBAD-Cre E. coli. Using both Cre screening (SEQ ID NO: 44 + 53) and control primers (SEQ ID NO: 49 + 50) for E. coli grown on either glucose (control) or arabinose M9 minimal agar plates, those grown on arabinose demonstrate the expected ~2100bp reduction in Cre screening amplicon size, demonstrating that the LoxP flanked Cre recombinase system is functional in E. coli and can be controlled with arabinose. Figure 9b is a graph showing the end results of growth in M9 minimal media + / - arabinose. Both DH5a and NEB Stable E. coli were transformed with the AraBAD-LoxP flanked Cre insert and cultured for 24 hours at 37°C with or without arabinose, then scanned for both sfGFP and m Scarlet fluorescence. sfGFP intensity was then referenced against mScarlet intensity to determine the relative level of gene expression. The two different strains were used due to NEB stable having several of its own endogenous recombinases knocked out, potentially making it more reliable for using with inserts that contain repeating sequences such as recombination sites. Strains cultured in arabinose again demonstrate a reduction in sfGFP expression compared to the control. A larger drop was expected, however M9 minimal media also includes glucose which may have inhibited the arabinose operon until later on within the growth period, and the excised region includes sfGFP along with its promoter, potentially still able to be expressed after excision until it is lost through degradation or cell division. Figure 9c shows the spectra of NEB Stable sfGFP and mScarlet referenced against cell density determined through Nanodrop UV-vis spectroscopy. Figure 9d shows the spectra of DH5a sfGFP and mScarlet referenced against OD600 cell density determined through Nanodrop UV-vis spectroscopy. This further confirms that sfGFP expression has been reduced by arabinose-induced Cre recombinase activity, now also using UV-vis 600nm absorbance as an additional measure of cell density. Figure 10 is a genetic diagram of an insert having an RNA thermoswitch controllable Cre recombinase flanked by LoxP sites in accordance with the present invention. This insert is similar to the insert depicted in Figure 8. However, the AraBAD promoter and standard ribosome binding site have been replaced by the constitutively active pKAT promoter and Theo-4U-Lys (T4UL) RNA thermoswitch. Figure 11 shows the results of a heat inducible LoxP flanked Cre insert in accordance with the present invention. Figure Ila is a gel electrophoresis of colony PCR from NEB Stable T4UL-Cre E.coli grown at either 18°C for 72 hours or 37°C for 24 hours. cPCR was performed using both Cre screening (SEQ ID NO: 44 + 64) and control primers (SEQ ID NO: 49 + 50) for A. coli grown on LB agar plates at different temperatures. While excision is incomplete across all copies of the starting DNA within the sample, those grown on at 37°C demonstrate the some of the expected ~2100bp reduction from ~2500bp down to 300bp in Cre screening amplicon size, demonstrating that the LoxP flanked Cre recombinase system is functional inE. coli and can be activated to an extent by increasing the temperature. Figure lib is a graph showing the end results of growth in M9 minimal media + / - arabinose. Both DH5a and NEB Stable A. coli were transformed with the T4UL-LoxP flanked Cre insert and cultured for 24 hours at either 18°C, 30°C or 37°C, then scanned for both sfGFP and mScarlet fluorescence. sfGFP intensity was then referenced against mScarlet intensity to determine the relative level of gene expression. The previously tested AraBAD-Cre DH5a and NEB Stable strains were included as a comparable but non-temperature sensitive controls. While sfGFP expression is expected to increase with temperature, NEB Stable T4UL demonstrates a drop in sfGFP expression when grown at 37°C, indicating that the T4UL riboswitch has been successfully activated. DH5a T4UL does demonstrate attenuated responses to increasing temperature compared to its control but it is not as effective as the NEB Stable strain. Figure 11c shows spectra of NEB Stable sfGFP and mScarlet referenced against OD600 cell density at different temperatures determined through Nanodrop UV-vis spectroscopy. Figure 12 is a photograph comparing a control PCL to PCL coated with pelleted T4UL-T7 sfGFP E. coli. E. coli was cultured for 48 hours at 18°C to minimise sfGFP expression as demonstrated in Figure 7. PCL has autofluorescent properties, producing a pinkish / red colour when excited. T4UL-T7 E. coli grown at low temperature does not produce strong sfGFP expression, and instead mostly also has a pinkish / red colour due to the ProD controlled expression of mScarlet. However, as shown in Figure 12, coating the pellets with E. coli pelleted through centrifugation still produced a visible increase in fluorescence. Figure 13 demonstrates fluorescence scanning of T4UL-T7 E. coli embedded within PCL. Figure 13a is a photograph of a 96 well plate, loaded with control blank PCL discs (column 1), T4UL-T7 PCL (column 2), T4UL in LB media grown at 18°C, and blank LB media. All samples were left at room temperature for 2 hours between extrusion and scanning. Figure 13b is a graph showing the raw spectral data for sfGFP and mScarlet in control blank PCL discs and T4UL-T7 E. coli PCL discs. Figure 13c is a graph showing the raw spectral data for sfGFP and mScarlet in blank LB media and T4UL-T7 E. coli in LB media. Figure 13d shows the spectral data of T4UL-T7 E. coli in PCL and LB. Both had their respective blanks / control spectra subtracted to remove background and normalised to their end values to portray them on the same axis. Both sets of spectra appear to match, confirming the presence of T4UL-T7 E. coli within the PCL plastic. Figure 13e is a graph showing high-density T4UL-T7 E. coli PCL versus T4UL-T7 E. coli in LB media. Due to the varying quantities of E. coli and unknown fluorescent properties of the composite PCL, it was difficult to quantify and directly compare T4UL-T7 E. coli within PCL with T4UL-T7 E. coli in LB media. However due to either a higher density of bacteria or positioning of a clump within the centre of the light path of the BMG Clariostar (Figure Ila, Row 1, Column 2), a single sample had an raw emission intensity comparable to those produced by the T4UL-T7 E. coli in LB media. These spectra had blank / control spectra subtracted but no further processing. Figure 13f compares high-density T4UL-T7 E. coli PCL with T4UL-T7 E. coli in 18°C LB media sfGFP intensity / mScarlet intensity. The E. coli that has been extruded appeared to have a greater relative level of sfGFP expression, with an explanation being that the heat of extrusion activated the T4UL-T7 mechanism. Figure 14 is an electrophoresis gel showing the cPCR results of T4UL-T7 E. coli embedded within PCL plastic. 8mm diameter T4UL-T7 E. coli PCL discs were cut into eighths, with 2 x eighths then added into 50uL cPCR mixtures with primers targeting the region between sfGFP and mScarlet (SEQ ID NO: 47 + 50). This demonstrates than, even when embedded within plastic, the genetic material of the bacteria is still accessible for analysis. Figure 15 is an electrophoresis gel of PCR containing varying ratios of Cre Shortened template. The aim of the experiment was to test whether the same primers can be used on DNA that contains a mixture of templates that have or have not been shortened by Cre recombinase. Templates were generated by performing cPCR on arabinose-inducible Cre E. coli colonies (see Figure 9a), either from control plates (Control template) or arabinose plates (Cre-shortened template). These were standardised to lOOnM and loaded into PCR mixtures containing the same Cre screening primers in varying ratios. Despite having a significant amount of complementarity between their sequences due to being the same sequence before or after Cre-shortening, both templates generate distinct bands and the intensities of these bands after PCR amplification reflect the relative starting ratios of each template. Figure 16 shows the results of quantification of relative ratios of Cre shortened DNA templates. Figure 16a is a screenshot of ImageJ Gel Analysis tool used to select gel lanes. Figure 16b shows the ImageJ Gel analysis tool output. Figure 16c shows the output of ImageJ based quantification of band intensity and reported percentage of proportions of each DNA species vs expected proportions based on PCR template input. Thes results demonstrate that gel electrophoresis and analysis with open-source software such as ImageJ can be used to calculate the proportions of Non-shortened and Cre-shortened DNA within a sample using PCR and a single set of primers. Figure 17 shows the design of an expanded heat-activated recombinase cassette. By combining multiple Recombinases, flanked by their own related recombination sites (E.g., Cre flanked by LoxP, FLP flanked by FRT, Dre flanked by ROX, etc.), a cassette can be assembled that, with each heating step, activates a recombinase which excises itself, bringing the next recombinase in the sequence under the control of a shared promoter. This can be used as a counter for the number of times a bacteria has been heated, with a different recombinase expressed for each occurrence. As each heating also leads to an additional excision of a recombinase protein coding region, a single set of primers can be used flanking the cassette to determine the number of times the bacteria has been heated via the size of the resulting PCR amplicon.
Claims
:
1. A plastic or rubber comprising at least one recombinant cell, the at least one recombinant cell genetically modified to include a gene cassette, wherein the cassette 5 comprises i) a promoter and ii) more than one recombinase-terminator sequence, wherein a recombinase-terminator sequence is a sequence for a recombinase followed by a terminator, and wherein each recombinase-terminator sequence codes for a different recombinase, each recombinase-terminator sequence being flanked by recognition sites specific for the recombinase, wherein the cassette is activatable by an external stimulus.
102. The plastic or rubber according to claim 1, wherein the cassette has a free circular or linear structure, is incorporated in a plasmid, or is integrated into the genome or the cell.
3. The plastic or rubber according to claim 1 or claim 2, wherein the recombinase is 15 selected from one or more tyrosine recombinases and / or serine recombinases.
4. The plastic or rubber according to any one of claims 1 to 3, wherein the number of recombinase sequences in the gene cassette is equal to or more than the number of times the cell is expected to be activated.
205. The plastic or rubber according to any one of claims 1 to 4, wherein the recognition sites have naturally occurring, or mutated, sequences.
6. The plastic or rubber according to any one of claims 1 to 5, wherein the cassette further 25 includes a sequence for a degradation tag.
7. The plastic or rubber according to any one of claims 1 to 6, wherein the cassette is activated by heat.30 8. The plastic or rubber according to any one of claims 1 to 7, wherein the cassette includesa sequence for a heat shock promoter or a promoter and accompanying heat shock protein interacting elements, and wherein the sequence is upstream and outside the cassette region flanked by the recombination sites.22 09 259. The plastic or rubber according to any one of claims 1 to 8, wherein the cassette includesa sequence for an RNA thermoswitch, a G-quadruplex thermoswitch or an RNA-based toehold switch AND gate, and wherein the thermoswitch or toehold switch is within the cassette region 5 flanked by the recombination sites.
10. The plastic or rubber according to claim 9, wherein the RNA thermoswitch is activated at or above a selected temperature.10 11. The plastic or rubber according to claim 9 or claim 10, wherein the RNA-based toeholdswitch AND gate is coupled to one or more heat shock promoters.
12. The plastic or rubber according to any one of claims 1 to 11, wherein the at least one recombinant cell comprises a single copy of the cassette.1513. The plastic or rubber according to any one of claims 1 to 12, wherein the at least one recombinant cell is selected from one or more strains of bacteria.
14. The plastic or rubber according to claim 13, wherein the bacteria is selected from 20 Escherichia coli or Bacillus subtilis.
15. A method for determining the number of times a cell has been activated by an external stimulus, the cell comprised in a plastic or rubber, the cell being genetically modified to include a gene cassette, the cassette being activatable by the external stimulus and comprising i) a 25 promoter and ii) more than one recombinase-terminator sequence, wherein a recombinaseterminator sequence is a sequence for a recombinase followed by a terminator, and wherein each recombinase-terminator sequence codes for a different recombinase, each recombinaseterminator sequence being flanked by recognition sites specific for the recombinase, the method comprising:30 Exposing the cell to the external stimulus one or more times to activate expression ofthe gene cassette; andSubjecting the resulting gene cassette to PCR and analysis of the resulting amplicons,22 09 25wherein, on activation, a recombinase is expressed and its sequence is excised from the gene cassette by its recognition sites, andwherein the size or sizes of the amplicons provides the number of recombinase sequences removed from and / or remaining in the cassette and correlates with the number of times the 5 cassette has been activated.
16. The method according to claim 15, wherein analysis of PCR amplicons is carried out using electrophoresis.10 17. The method according to claim 15 or claim 16, wherein the cell is one or more speciesof bacteria.
18. The method according to claim 17, wherein the bacteria species are selected from Escherichia coli and / or Bacillus subtilis.1519. The method according to any one of claims 15 to 18, wherein the external stimulus is heat.
20. The method according to any one of claims 15 to 19, wherein the gene cassette is as 20 further defined in any one of claims 2 to 6 or claims 8 to 11.
21. The method according to any one of claims 15 to 20, wherein the number of recombinase sequences in the gene cassette is equal to or more than the number of times the cell is expected or able to be activated.2522. A pl asti c or rubb er mixture compri si ng:i) an amount of plastic or rubber as claimed in any one of claims 1 to 14 that has been recycled one or more times,ii) an amount of plastic or rubber as claimed in any one of claims 1 to 14 that has not30 been recycled and / or,iii) optionally an amount of plastic or rubber as claimed in any one of claims 1 to 14 that has been recycled a different number of times to the plastic or rubber in i).
23. A method for determining the number of times a plastic or rubber has been recycled, the method comprising:i) taking a sample of plastic or rubber comprising at least one recombinant cell as claimed in any one of claims 1 to 14, or a mixture of plastic or rubber comprising at least one 5 recombinant cell as claimed in claim 22; andii) carrying out PCR on the recombinant cell(s) and analysing the resulting amplicons, wherein the size or sizes of the PCR amplicons provides the number of recombinase sequences removed from and / or remaining in the cassette and correlates with the number of times the cassette has been activated, and10 optionally wherein the amount of the or each PCR amplicon correlates with an amount of plastic or rubber in the sample.
24. The method according to claim 23, wherein analysis of PCR amplicons is carried outusing electrophoresis.
Citation Information
Patent Citations
A system to control the expression of a given gene using another gene that encodes a polypeptide with recombinant activity
EP1134287A1
Autodegradable plastics
GB2625769A
Methods of expressing transgenes
US20030084468A1
Extensible recombinase cascades
US20170306336A1
Modular nucleic acid-based circuits for counters, binary operations, memory and logic
US8645115B2