A method for detecting changes in nucleotide sequence changes using an isothermal nucleic acid amplification technology, a set of primers and a composition of a reaction mixture for the detection of selected genetic variants
By modifying the FIP internal primer set in LAMP technology to align with nucleic acid sequences, the method addresses inefficiencies in detecting genetic variants, achieving precise and efficient nucleotide sequence detection.
Patent Information
- Application Number
- HK62026124283
- Authority / Receiving Office
- HK · HK
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-09-27
- Filing Date
- 2026-06-03
- Publication Date
- 2026-07-10
AI Technical Summary
Existing methods for detecting nucleotide sequence changes using isothermal nucleic acid amplification technology are limited in their ability to accurately detect genetic variants due to mismatches in primer sequences, leading to inefficiencies and inaccuracies in amplification.
The use of modified FIP internal primer sets in LAMP technology, where the F2 primer sequence is adjusted at the 3' end to match the nucleic acid sequence downstream of the genetic variant, and other primers are designed to be complementary or reverse complementary to the nucleic acid segment, ensuring precise amplification.
This approach enhances the accuracy and efficiency of detecting genetic variants by ensuring primer sequences align perfectly with the target nucleic acid sequence, improving the reliability of nucleotide sequence detection.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
(19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number (43) Application Publication Date (21) Application Number 202480060815.0 (22) Application Date 2024.09.21 (30) Priority Data P.446241 2023.09.27 PL (85) PCT International Application Entering National Phase Date 2026.03.23 (86) PCT International Application Application Data PCT / PL2024 / 050067 2024.09.21 (87) PCT International Application Publication Data WO2025 / 071422 EN 2025.04.03 (71) Applicant Ginomutek Ltd. Address Wrocław, Poland (72) Inventor Annetta Silzniak (74) Patent Agency Beijing Yingsai Jia Hua Intellectual Property Agency Co., Ltd. 11204 Patent Attorney Hung Hsin-Yi Shuo (51) Int.Cl. C12Q 1 / 6853 (2006.01) C12Q 1 / 6858 (2006.01) C12Q 1 / 6886 (2006.01) (54) Invention Title Method for Detecting Changes in Nucleotide Sequence Using Isothermal Nucleic Acid Amplification Technology, Primer Set and Components of Reaction Mixture for Detecting Selected Genetic Variants (57) Abstract This invention relates to a method for detecting changes in nucleotide sequence using isothermal nucleic acid amplification technology, primer set and components of reaction mixture for detecting selected genetic variants. Claims (9 pages), Description (26 pages), Sequence Listing (electronic publication), Drawings (10 pages), CN 121889513 A, 2026.04.17, CN 1 21 88 95 13 A. 1. A method for detecting polynucleotide genetic variants using LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end, such that the 2-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of a nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge). At the end, the F1c primer is designed to be reverse complementary to the nucleic acid fragment (5'-3' strand) to be amplified and is located between the 3' end of the F2 primer and the 5' end of the B1c primer, while the remaining LAMP reaction primers, namely F3, B3, BIP, and optionally LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide having the same sequence as the fragment (5'-3' strand) of the nucleic acid region to be amplified.The 3' end of primer F3 is located upstream of primer F2, and the 5' end of primer F3 marks the beginning of the nucleic acid segment to be amplified. Primer B3 is an oligonucleotide that is reverse complementary to the nucleic acid segment to be amplified (5'-3' strand), and the 5' end of primer B3 marks the end of the nucleic acid segment to be amplified. Primer B2's 3' end precedes the 3' end of primer B3. Primer BIP consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified. The fragment is located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is reverse complementary to the nucleic acid segment to be amplified. The 5' end of the BIP primer is upstream of the 3' end of the B3 primer and downstream of the 3' end of the B1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' end of the B1c primer and the 3' end of the B2 primer. 2. A method for detecting polynucleotide genetic variants using LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at its 3' end, such that the 3-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein, after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer, while the remaining LAMP reaction primers, namely F3, B3, BIP, and optionally LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the 5'-3' strand of the nucleic acid segment to be amplified. The 3' end of the F3 primer is upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the 5'-3' strand of the nucleic acid segment to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer.The BIP primer consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified. The B1c fragment is located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably with a TTTT bridge at its 3' end) is connected to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is anticomplementary to the nucleic acid segment to be amplified. The 5' end of the BIP primer is upstream of the 3' end of the B3 primer and downstream of the 3' end of the B1c primer. The LF loop primer is anticomplementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' end of the B1c primer and the 3' end of the B2 primer. 3. A method for detecting polynucleotide genetic variants using LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end such that the 4-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer, while the remaining LAMP reaction primers, namely F3, B3, BIP and optionally LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide having the same sequence as the 5'-3' strand of the nucleic acid segment to be amplified. The 3' end of the F3 primer is upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the 5'-3' strand of the nucleic acid segment to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The BIP primer consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified. The B1c fragment is located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is reverse complementary to the nucleic acid segment to be amplified.Additionally, the 5' end of the BIP primer is located upstream of the 3' end of the B3 primer, and the 3' end of the BIP primer is located downstream of the 3' end of the B1c primer. Furthermore, the LF loop primer is inversely complementary to the nucleic acid segment to be amplified and is located between the 3' ends of the F2 primer and the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' ends of the B1c primer and the B2 primer. 4. A method for detecting polynucleotide genetic variants using LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at its 3' end such that the 5-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer, wherein the remaining LAMP reaction primers, namely F3, B3, BIP and optionally LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide having the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified, and the 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified. The 3' end of the B2 primer precedes the 3' end of the B3 primer. Furthermore, the BIP primer consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified. The B1c fragment is located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is reverse complementary to the nucleic acid segment to be amplified. Simultaneously, the 5' end of the BIP primer is upstream of the 3' end of the B3 primer and downstream of the 3' end of the B1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' ends of the F2 primer and the F1c primer.The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer. 5. A method for detecting polynucleotide genetic variants using LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end such that the 6-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer, while the remaining LAMP reaction primers, namely F3, B3, BIP and optionally LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide having the same sequence as the 5'-3' strand of the nucleic acid segment to be amplified. The 3' end of the F3 primer is upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is anticomplementary to the 5'-3' strand of the nucleic acid segment to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The BIP primer consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified. The fragment is located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is reverse complementary to the nucleic acid segment to be amplified. The 5' end of the BIP primer is upstream of the 3' end of the B3 primer, and the 3' end of the BIP primer is downstream of the 3' end of the B1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' end of the B1c primer and the 3' end of the B2 primer. 6. A method for detecting polynucleotide genetic variants using LAMP technology, characterized in that the FIP inner primer set used in the LAMP technology has an F2 sequence modified at the 3' end, such that the 7-nucleotide length of the F2 sequence is connected to the 5' end of the B2 primer.The nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion) is identical, as described in claim 3 / 9, page 4, CN 121889513 A. Wherein, after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along its entire length, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge). The F1c primer is designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer. The remaining LAMP reaction primers, namely F3, B3, BIP, and optionally LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the segment (5'-3' strand) of the nucleic acid to be amplified. The 3' end of the F3 primer is upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. Furthermore, the BIP primer consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified. The B1c fragment is located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is reverse complementary to the nucleic acid segment to be amplified. Simultaneously, the 5' end of the BIP primer is located upstream of the 3' end of the B3 primer and downstream of the 3' end of the B1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' end of the B1c primer and the 3' end of the B2 primer. 7. A method for detecting genetic variants using LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has a B2 sequence modified at its 3' end, such that the 2-nucleotide end of the B2 sequence is reverse complementary to a nucleic acid sequence upstream of a nucleic acid fragment containing the genetic variant to be detected insertion and / or deletion, wherein after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to...The nucleic acid fragment to be amplified (5'-3' strand) is identical and located between the 5' end of the F1c primer and the 3' end of the B2 primer. The remaining LAMP reaction primers, namely F3, B3, FIP, and optionally LF and / or LB loops, are designed as follows: The F3 primer is an oligonucleotide having the same sequence as the fragment (5'-3' strand) to be amplified, the 3' end of the F3 primer is upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid fragment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid fragment (5'-3' strand) to be amplified, the 5' end of the B3 primer marks the end of the nucleic acid fragment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer comprises an F1c fragment having a sequence that is reverse complementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. The 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the FIP primer is upstream of the 3' end of the F1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' end of the B1c primer and the 3' end of the B2 primer. 8. A method for detecting genetic variants using LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has a B2 sequence modified at its 3' end, such that the 3-nucleotide end of the B2 sequence is reverse complementary to a nucleic acid sequence upstream of a nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer, while the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally LF loop and / or LB loop, are designed as follows: the F3 primer is an oligonucleotide having the same sequence as the fragment (5'-3' strand) of the nucleic acid region to be amplified, theThe 3' end of primer F3 is located upstream of primer F2, and the 5' end of primer F3 marks the beginning of the nucleic acid segment to be amplified. Primer B3 is an oligonucleotide that is reverse complementary to the nucleic acid segment to be amplified (5'-3' strand), and the 5' end of primer B3 marks the end of the nucleic acid segment to be amplified. The 3' end of primer B2 precedes the 3' end of primer B3. The FIP primer consists of an F1c fragment having a sequence that is reverse complementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. The 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the FIP primer is upstream of the 3' end of the F1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' end of the B1c primer and the 3' end of the B2 primer. 9. A method for detecting genetic variants using LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has a B2 sequence modified at its 3' end, such that the 4-nucleotide end of the B2 sequence is reverse complementary to a nucleic acid sequence upstream of a nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer, while the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide having the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is anticomplementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer consists of an F1c fragment having a sequence anticomplementary to the nucleic acid segment to be amplified.The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. The 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the FIP primer is upstream of the 3' end of the F1c primer (page 5 / 9 of claim 6, CN 121889513 A). The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' end of the B1c primer and the 3' end of the B2 primer. 10. A method for detecting genetic variants using LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has a B2 sequence modified at its 3' end, such that the 5-nucleotide end of the B2 sequence is reverse complementary to a nucleic acid sequence upstream of a nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer, wherein the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the segment (5'-3' strand) of the nucleic acid to be amplified. The 3' end of the F3 primer is upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer consists of an F1c fragment having a sequence that is inversely complementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. Furthermore, the 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the FIP primer is upstream of the 3' end of the F1c primer.The LF loop primer is inversely complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' end of the B1c primer and the 3' end of the B2 primer. 11. A method for detecting genetic variants using LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has a B2 sequence modified at its 3' end, such that the 6-nucleotide end of the B2 sequence is reverse complementary to a nucleic acid sequence upstream of a nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer, while the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide having the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is anticomplementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer consists of an F1c fragment having a sequence anticomplementary to the nucleic acid segment to be amplified. (Claims 6 / 9, page 7, CN 121889513 A) The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. The 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the FIP primer is upstream of the 3' end of the F1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' ends of the F2 primer and the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' ends of the B1c primer and the B2 primer. 12. A method for detecting genetic variants using LAMP technology, characterized in that the BIP used in the LAMP technology...The primer set has a B2 sequence modified at its 3' end, such that the 7-nucleotide end of the B2 sequence is reverse complementary to the nucleic acid sequence upstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein, after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer, while the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same (5'-3' strand) sequence as the nucleic acid segment to be amplified. The 3' end of the F3 primer is upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the (5'-3' strand) nucleic acid segment to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer consists of an F1c fragment having a sequence that is reverse complementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. The 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the FIP primer is upstream of the 3' end of the F1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' end of the B1c primer and the 3' end of the B2 primer. 13. A primer set, comprising the nucleotide sequence for amplifying a fragment of the human EGFR (epidermal growth factor receptor) gene, characterized in that the primer set comprises an inner primer set and an outer primer set, the inner primer set having the following nucleotide sequences (a) and (b), the outer primer set having the following nucleotide sequences (c) and (d), and the primer set being specific for fragments of the human EGFR gene carrying the NM_005228.5 (EGFR): c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19: a) F1c 5' GACCCCCACACAGCAAAGCA 3'(nucleotide sequence SEQ ID NO: 3), which is connected at the 3' end (preferably via a TTTT bridge) to sequence F2 5' TCCCGTCGCTATCAAAACAT 3' (nucleotide sequence SEQ ID NO: 4), b) B1c 5' GCTGCTCTGCTCTAGACCCT 3' (nucleotide sequence SEQ ID NO: 5 or), which is connected at the 3' end (preferably via a TTTT bridge) to sequence B2 5' AGAGGCCAGTGCTGTCT 3' (nucleotide sequence SEQ ID NO: 6), c) F3 5' TGGATCCCAGAAGGTGAGAA 3' (nucleotide sequence SEQ ID NO: 1), and claims 7 / 9 pages 8 CN 121889513 A d) B3 5' GGGGTGGATACCAGCATG 3' (nucleotide sequence SEQ ID NO: 2). 14. The primer set according to claim 13, characterized in that the primer set comprises a set of circular primer sequences containing nucleotide sequences contained in or complementary to a fragment of the human EGFR gene, the fragment of the human EGFR gene having SEQ ID NO: 7: LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8: LB 5' GCTCTAGTGGGTATAACTCCCTC 3'. 15. A primer set, comprising the nucleotide sequence for amplifying a fragment of the human EGFR (epidermal growth factor receptor) gene, characterized in that the primer set comprises an inner primer set and an outer primer set, the inner primer set having the following nucleotide sequences (a) and (b), the outer primer set having the following nucleotide sequences (c) and (d), the primer set being specific for fragments of the human EGFR gene carrying the NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation, or the NM_005228.3:c.2239_2253del15 mutation, or the NM_005228.3:c.2238_2252del15 mutation: a) F1c 5' GACCCCCACACAGCAAAGCA 3' (nucleotide sequence SEQ ID NO: 3) It is connected at its 3' end (preferably via a TTTT bridge) to sequence F2 5' TCCCGTCGCTATCAAGGAATCTC 3' (nucleotide sequence SEQ ID NO: 9), b) B1c 5' GCTGCTCTGCTCTAGACCCT 3' (nucleotide sequence SEQ ID NO: 9)5) It is connected at its 3' end (preferably via a TTTT bridge) to sequence B2 5' AGAGGCCAGTGCTGTCT 3' (nucleotide sequence SEQ ID NO: 6), c) F3 5' TGGATCCCAGAAGGTGAGAA 3' (nucleotide sequence SEQ ID NO: 1), and d) B3 5' GGGGTGGATACCAGCATG 3' (nucleotide sequence SEQ ID NO: 2). 16. The primer set according to claim 15, characterized in that the primer set comprises a set of circular primer sequences containing nucleotide sequences contained in or complementary to a fragment of the human EGFR gene having SEQ ID NO: 7: LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8: LB 5' GCTCTAGTGGGTATAACTCCCTC 3'. 17. A primer set for amplifying the nucleotide sequence of a fragment of the human EGFR (epidermal growth factor receptor) gene, characterized in that the primer set comprises an inner primer set and an outer primer set, the inner primer set having the following nucleotide sequences (a) and (b), and the outer primer set having the following nucleotide sequences (c) and (d), the primer set being specific for fragments of the human EGFR gene carrying the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) mutation in exon 19: a) F1c 5' GACCCCCACACAGCAAAGCA 3' (nucleotide sequence SEQ ID NO: 3), which is linked at the 3' end (preferably via a TTTT bridge) to sequence F2 5' TCCCGTCGCTGTCAAAACAT 3' (nucleotide sequence SEQ ID NO: 15), b) B1c 5' GCTGCTCTGCTCTAGACCCT 3' (nucleotide sequence SEQ ID NO: 5), which is connected at its 3' end (preferably via a TTTT bridge) to sequence B2 5' AGAGGCCAGTGCTGTCT 3' (nucleotide sequence SEQ ID NO: 6), c) F3 5' TGGATCCCAGAAGGTGAGAA 3' (nucleotide sequence SEQ ID NO: 1), and d) B3 5' GGGGTGGATACCAGCATG 3' (nucleotide sequence SEQ ID NO: 2). 18. The primer set according to claim 17, characterized in that the primer set comprises a nucleotide sequence containing aThe nucleotide sequence is contained in or complementary to a fragment of the human EGFR gene, the fragment of which has SEQ ID NO: 7: LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8: LB 5' GCTCTAGTGGGTATAACTCCCTC 3'. 19. A method for detecting mutations NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5 (EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) present in exon 19 of the human EGFR gene, characterized in that, Selected regions of the nucleotide sequence of the human genome are amplified using the primer set according to any one of claims 13 to 18, wherein the replication method is real-time LAMP. 20. The method for detecting the mutations NM_005228.5 (EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5 (EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) in exon 19 of the human EGFR gene according to claim 19, characterized in that the amplification is performed at a temperature program of 68°C for 50 min. 21. Detection of mutations present in exon 19 of the human EGFR gene: NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:cThe method of .2239_2253del15; NM_005228 .3:c .2238_2252del15; NM_005228 .5 (EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) is characterized in that the method includes the detection method according to claim 19 and / or 20. 22. A kit for detecting mutations present in exon 19 of the human EGFR gene: NM_005228.5(EGFR): c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR): c.2240_2254del (p.Leu747_Thr751del); NM_005228.3: c.2239_2253del15; NM_005228.3: c.2238_2252del15; NM_005228.5 (EGFR): c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys), characterized in that the kit comprises a primer set according to any one of claims 13 to 18. 23. The kit according to any one of claims 17 or 18, for detecting mutations present in exon 19 of the human EGFR gene: NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys), characterized in that the kit contains 5.0 µL Universal WarmStart® LAMP 2X Master Mix (New England Biolabs). 24. The kit according to any one of claims 19 to 23, for detecting the mutation NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) present in exon 19 of the human EGFR gene; NM_005228..5(EGFR):c .2240_2254del (p .Leu747_Thr751del); NM_005228 .3:c .2239_ 2253del15; NM_005228 .3:c .2238_2252del15; NM_005228 .5(EGFR):c .2230_ 2249delinsGTCAA (p.Ile744_Ala750delinsValLys), characterized in that the kit contains amplification primers according to claims 13 to 18, wherein the primer concentrations are as follows: 0.15 µM F3, 0.15 µM B3, 1.20 µM FIP NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); 1.20 µM FIP NM_ 005228 .5(EGFR):c .2240_2254del (p .Leu747_Thr751del); NM_005228 .3:c .2239_ 2253del15; NM_005228.3:c.2238_2252del15; 1.20 µM FIP NM_005228.5(EGFR):c.2230_ 2249delinsGTCAA (p.Ile744_Ala750delinsValLys), 1.20 µM BIP, 0.30 µM LF, 0.30 µM LB; D-(+)-trehalose (6%); mannitol (1.25%); fluorescent double-stranded DNA dye EvaGreen (Biotium) ≤ 1X, or fluorescent dye (New England Biolabs) ≤ 0.5 μL, or green fluorescent dye (Lucigen) ≤ 1 μL, or SYTO-13 (ThermoFisher Scientific) ≤ 16 µM, or SYTO-82 (ThermoFisher Scientific) ≤ 16 µM, or other double-stranded DNA dyes whose concentration does not inhibit the amplification process. Claims 9 / 9 pages 10 CN 121889513 A Method for detecting changes in nucleotide sequence using isothermal nucleic acid amplification technology, primer set and reaction mixture composition for detecting selected genetic variants Technical Field
[0001] This invention relates to a method for detecting changes in nucleotide sequence using isothermal nucleic acid amplification technology, primer set and reaction mixture composition for detecting selected genetic variants. This invention can be applied, for example, to medical diagnostics. Background Art
[0002] Genetic variants are permanent changes in the DNA sequence that makes up a gene. This type of genetic change was previously called a gene mutation, but this terminology has been revised because changes in DNA sequence are not always beneficial to disease. Variants may involve one or more nucleotides that make up a gene sequence. Genetic variants can be inherited from parents or develop throughout a person's life. Hereditary variants are passed from parents to children and are present in almost every cell of their body throughout their life. These variants are also called germline (reproductive) variants because they are present in the egg or sperm cells of the parents. When an egg and sperm combine to form a cell, the fertilized egg cell contains DNA from both parents. Any variants in the DNA will be present in the child's cells. Non-hereditary variants arise at some point in a person's life and are present only in certain cells or tissues, not in every cell of the body. Because non-hereditary variants usually occur in somatic cells (cells other than germ cells), they are often called somatic variants. These variants cannot be passed on to the next generation. Non-hereditary variants can be caused by a variety of environmental factors, such as ultraviolet radiation or replication errors occurring before cell division (S phase of the cell cycle), or nuclear division during mitosis. Some genetic changes are described as de novo variants; they are identified in the child and are not present in either parent. In some cases, the variant is present in the egg or sperm cells of the parents, but not in any other somatic cells. In other cases, the variant forms in the fertilized egg shortly after the egg and sperm unite. It is usually impossible to pinpoint exactly when a de novo variant appears. When the fertilized egg cell divides, each cell produced in the growing embryo will contain genetic material with a sequence that matches the variant in question. De novo variants are one possible explanation for hereditary diseases in which the affected child has the variant in every cell of the body, while the parents' genome lacks the variant and there is no family history of the disease caused by the specific variant. Variants acquired during development can lead to a condition called mosaicism, where a specific group of genomic sequences within the body differs from those in other cells. In mosaicism, the genetic variation is present neither in the parents' egg or sperm cells nor in the fertilized egg, and occurs at any time during later stages, between embryonic development and adulthood. As cells grow and divide, cells produced from those with the altered gene will contain the variation, i.e., variants, while other cells will not. This phenomenon is called somatic mosaicism when some somatic cells contain the genetic variant while others do not. Depending on the variant and the number of affected cells, somatic mosaicism can lead to health problems and clinical presentations of varying severity, but in different situations…It does not cause any phenotypic changes. When some egg or sperm cells have variants while others do not, this phenomenon is called germline mosaicism. In this case, healthy parents may pass on a genetic disease to their children. Most variants do not lead to disease development, and those variants are not common in the general population. Some variants are so common in the population that they can be considered common genetic variations. Although many common DNA variants have no negative impact on human health, some variants may affect the risk of disease development or drug metabolism, and thus affect the choice of appropriate treatment. Meanwhile, the presence of variants is common in other organisms and determines, for example, antibiotic resistance, plant growth rate, and pesticide resistance. Because the presence of some variants can cause life-threatening diseases, rapid diagnosis is important, and diagnostic methods need to be characterized by high sensitivity and specificity. One diagnostic method used to detect variants is DNA / RNA sequencing; however, its use is limited to specialized laboratories due to the complex analytical process involving numerous molecular methods in the intermediate stages of the analysis. DNA / RNA sequencing-based methods are also characterized by long waiting times before results are obtained. In less specialized centers, and in cases where the analysis involves a small number of genetic variants, the diagnosis of these variants is based on the presence of altered sequences, confirmed within the test sample using techniques involving the amplification of specific nucleic acid fragments within biological material (i.e., so-called nucleic acid amplification assays (NAAT) methods). The most widely used tests in NAAT techniques include detection based on real-time PCR methods. Various tests using real-time methods are commercially available; however, despite intense competition, these methods remain relatively expensive. Furthermore, these methods require highly specialized personnel, expensive equipment, and the isolation of genetic material from patient samples. Additionally, the method is relatively time-consuming due to the need for cyclic heating and cooling of the reaction mixture, and the equipment used for the diagnostic process consumes a relatively large amount of energy. Isothermal methods, including loop-mediated isothermal amplification (LAMP), facilitate faster diagnostic processes while reducing the energy and reagent costs required for analysis. According to the literature, these methods offer higher sensitivity and specificity than the aforementioned real-time PCR methods, and are also much faster. The isothermal process of these methods does not require specialized equipment. Due to the low equipment requirements of isothermal methods, these methods are ideal point-of-care testing (POCT) diagnostic solutions, where the test can be performed in the doctor's office or operating room during a single patient visit. This solution allows for rapid diagnostic testing (less than 60 minutes), facilitating the selection of targeted therapies or treatment monitoring as early as the first visit. This is particularly important in the case of malignant tumors.Essentially, the malignant tumors are typically associated with rapid tumor spread that ultimately affects prognosis and survival. The LAMP method has been exemplarily disclosed in patent publications WO0028082 and WO0224902. Most patent applications disclosed to date describing variant detection using primers in LAMP methods primarily concern the detection of single nucleotide variants and / or the use of a significantly higher number of reaction primers compared to the conventional group of six oligonucleotides, thereby increasing the chance of obtaining nonspecific results and production costs, while also extending the time required to design and optimize test kits. Furthermore, most proposed solutions result in complex calculations when analyzing results based on the time difference required for amplicon growth to begin exponentially, or when considering a negative result (no amplification) as proof of the presence of a variant. Proper interpretation of the results is crucial because most samples in the field of oncology are characterized by genetic mosaicism, rendering the aforementioned variant detection process meaningless. Examples of proposed solutions to date have been published in the following literature: US10364458B2 (SNP detection using additional STEM oligonucleotides), JP6408447B2 (using additional primer sets and fluorescent labeling of primers), US7638280B2 (no amplification in the presence of variants), or WO0134838A1 (ability to detect single nucleotide polymorphisms (SNPs) (only near intron-exon junctions)), or Khammanee T et al. A LAMP-SNP Assay Detecting C580Y Mutation in Pfkelch13 Gene from Clinically Dried Blood Spot Samples. Korean J Parasitol. 2021 Feb;59(1):15-22 (ability to detect single nucleotide polymorphisms (SNPs) only). Therefore, in the diagnosis of genetic variants using the LAMP method, there is still a need for an easy-to-use and reliable diagnostic method using appropriately refined primer sets, designed for point-of-care testing of genetic variants larger than those involving single nucleotides. The proposed method for designing LAMP reaction primers significantly simplifies the composition of the reaction mixture and reduces manufacturing costs. Furthermore, the fluorescent dye allows for real-time detection of reaction products, significantly reducing reaction time (≤ 60 min) and allowing for additional validation of the results using melting curves.
[0003] The first object of the present invention is a method for detecting polynucleotide genetic variants using LAMP technology, characterized in the specification on page 2 / 26 of CN 121889513 A.The FIP internal primer set used in LAMP technology has an F2 sequence modified at its 3' end, such that the 2-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein, after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge). The F1c primer is designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The remaining LAMP reaction primers, namely F3, B3, BIP, and optionally LF loop and / or LB, are used. The loop is designed as follows: Primer F3 is an oligonucleotide having the same sequence as the 5'-3' strand of the nucleic acid segment to be amplified, with its 3' end upstream of primer F2, and its 5' end marking the beginning of the nucleic acid segment to be amplified. Primer B3 is an oligonucleotide reverse complementary to the 5'-3' strand of the nucleic acid segment to be amplified, with its 5' end marking the end of the nucleic acid segment to be amplified, and the 3' end of primer B2 preceding the 3' end of primer B3. Primer BIP consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified, with the B1c fragment located at the 5' end of primer F1c. Between the 3' end of primer B1c and the 3' end of primer B2, the B1c fragment (preferably at its 3' end and via a TTTT bridge) is connected to the 5' end of the B2 fragment of primer BIP, the B2 fragment being reverse complementary to the nucleic acid segment to be amplified, the 5' end of primer BIP being upstream of the 3' end of primer B3 and downstream of the 3' end of primer B1c, wherein the LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of primer F2 and the 3' end of primer F1c, and the LB loop primer has the same sequence as the segment to be amplified, the LB loop primer being located between the 3' end of primer B1c and the 3' end of primer B2.
[0004] A second object of the present invention is a method for detecting polynucleotide genetic variants using LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end, such that the 3-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected insertion and / or deletion, wherein after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the nucleic acid sequence via its 5' end (preferably via a TTTT bridge).The 3' end of the F1c primer is designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The remaining LAMP reaction primers, namely F3, B3, BIP, and optionally the LF loop and / or LB loop, are designed as follows: the F3 primer is an oligonucleotide having the same sequence as the fragment (5'-3' strand) to be amplified, with its 3' end upstream of the F2 primer and its 5' end marking the beginning of the nucleic acid fragment to be amplified; the B3 primer is an oligonucleotide reverse complementary to the nucleic acid fragment (5'-3' strand) to be amplified, with its 5' end marking the end of the nucleic acid fragment to be amplified; and the 3' end of the B2 primer precedes the 3' end of the B3 primer. Furthermore, the BIP primer is positioned between the 3' end of the F2 primer and the 3' end of the B2 primer. The primers consist of a B1c fragment having the same sequence as the nucleic acid segment to be amplified, located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is reverse complementary to the nucleic acid segment to be amplified. The 5' end of the BIP primer is upstream of the 3' end of the B3 primer and downstream of the 3' end of the B1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' ends of the F2 primer and the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' ends of the B1c primer and the B2 primer.
[0005] A third object of the present invention is a method for detecting polynucleotide genetic variants using LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end, such that the 4-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected, wherein, after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer, while the remaining LAMP reaction primers, namely F3, B3, BIP and optionally LF loop and / or LB, are... The loop is designed as follows: the F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified, the 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer is labeled with the nucleic acid segment to be amplified.The F1C primer is a B3 primer that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer is marked with the end of the nucleic acid segment to be amplified. The 3' end of the B2 primer precedes the 3' end of the B3 primer. The BIP primer consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified, located at the 5' end of the F1c primer. Between the 3' end of primer B1c and the 3' end of primer B2, the B1c fragment (preferably at its 3' end and via a TTTT bridge) is connected to the 5' end of the B2 fragment of primer BIP, the B2 fragment being reverse complementary to the nucleic acid segment to be amplified, the 5' end of primer BIP being upstream of the 3' end of primer B3 and downstream of the 3' end of primer B1c, wherein the LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of primer F2 and the 3' end of primer F1c, and the LB loop primer has the same sequence as the segment to be amplified, the LB loop primer being located between the 3' end of primer B1c and the 3' end of primer B2.
[0006] A fourth object of the present invention is a method for detecting polynucleotide genetic variants using LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end such that the 5-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected, wherein, after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer, while the remaining LAMP reaction primers, namely F3, B3, BIP and optionally LF loop and / or LB, The loop is designed as follows: Primer F3 is an oligonucleotide having the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified, with the 3' end of primer F3 upstream of primer F2, and the 5' end of primer F3 marking the beginning of the nucleic acid segment to be amplified. Primer B3 is an oligonucleotide reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified, with the 5' end of primer B3 marking the end of the nucleic acid segment to be amplified, and the 3' end of primer B2 preceding the 3' end of primer B3. Primer BIP consists of a fragment B1c having the same sequence as the nucleic acid segment to be amplified, located between the 5' end of primer F1c and the 3' end of primer B2, and the B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the B2 fragment of primer BIP.The 5' end of the B2 fragment is inversely complementary to the nucleic acid segment to be amplified. The 5' end of the BIP primer is upstream of the 3' end of the B3 primer, and the 3' end of the BIP primer is downstream of the 3' end of the B1c primer. The LF loop primer is inversely complementary to the nucleic acid segment to be amplified and is located between the 3' ends of the F2 and F1c primers. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' ends of the B1c primer and the B2 primer.
[0007] A fifth object of the present invention is a method for detecting polynucleotide genetic variants using LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end such that the 6-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected, wherein, after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer, while the remaining LAMP reaction primers, namely F3, B3, BIP and optionally LF loop and / or LB, The loop is designed as follows: Primer F3 is an oligonucleotide having the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified, with the 3' end of primer F3 upstream of primer F2, and the 5' end of primer F3 marking the beginning of the nucleic acid segment to be amplified. Primer B3 is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified, with the 5' end of primer B3 marking the end of the nucleic acid segment to be amplified, and the 3' end of primer B2 preceding the 3' end of primer B3. Primer A consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified, with the B1c fragment located at the 5' end of primer F1c. Between the 3' end of primer B1c and the 3' end of primer B2, the B1c fragment (preferably at its 3' end and via a TTTT bridge) is connected to the 5' end of primer B2 of primer BIP, the B2 fragment being reverse complementary to the nucleic acid segment to be amplified, the 5' end of primer BIP being upstream of the 3' end of primer B3 and downstream of the 3' end of primer B1c, and wherein the LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of primer F2 and the 3' end of primer F1c, and the LB loop primer has the same sequence as the segment to be amplified, the LB loop primer being located between the 3' end of primer B1c and the 3' end of primer B2.
[0008] A sixth object of the present invention is a method for detecting polynucleotide genetic variants using LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end such that the 7-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein, after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer, while the remaining LAMP reaction primers, namely F3, B3, BIP and optionally LF loop and / or LB, The loop is designed as follows: Primer F3 is an oligonucleotide having the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified, with the 3' end of primer F3 upstream of primer F2, and the 5' end of primer F3 marking the beginning of the nucleic acid segment to be amplified. Primer B3 is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified, with the 5' end of primer B3 marking the end of the nucleic acid segment to be amplified, and the 3' end of primer B2 preceding the 3' end of primer B3. Primer BIP consists of a fragment B1c having the same sequence as the nucleic acid segment to be amplified, with the B1c fragment located at the 5' end of primer F1c. Between the 3' end of primer B1c and the 3' end of primer B2, the B1c fragment (preferably at its 3' end and via a TTTT bridge) is connected to the 5' end of the B2 fragment of primer BIP, the B2 fragment being reverse complementary to the nucleic acid segment to be amplified, the 5' end of primer BIP being upstream of the 3' end of primer B3 and downstream of the 3' end of primer B1c, wherein the LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of primer F2 and the 3' end of primer F1c, and the LB loop primer has the same sequence as the segment to be amplified, the LB loop primer being located between the 3' end of primer B1c and the 3' end of primer B2.
[0009] A seventh object of the present invention is a method for detecting genetic variants using LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has a B2 sequence modified at its 3' end, such that the 2-nucleotide end of the B2 sequence is reverse complementary to a nucleic acid sequence upstream of an inserted and / or deleted nucleic acid fragment containing the genetic variant to be detected, wherein, after the insertion and / or deletion occurs, the B2 primer sequence is reverse complementary only to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge).The B1c primer is designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer. The remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: the F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) to be amplified, the 3' end of the F3 primer is upstream of the F2 primer, the 5' end of the F3 primer marks the beginning of the nucleic acid fragment to be amplified, and the B3 primer… The primer B3 is an oligonucleotide that is anticomplementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the primer B3 is marked with the end of the nucleic acid segment to be amplified, and the 3' end of the primer B2 precedes the 3' end of the primer B3. The primer FIP consists of an F1c fragment having a sequence anticomplementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the primer F2 and the 5' end of the primer B1c. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the F2 fragment of the primer FIP. The fragment is identical to the nucleic acid segment to be amplified. The 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the F3 primer is upstream of the 3' end of the F1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' ends of the F2 primer and the F1c primer. The LB loop primer has the same sequence as the segment to be amplified. (See page 5 / 26 of the specification, CN 121889513 A). The LB loop primer is located between the 3' ends of the B1c primer and the B2 primer.
[0010] An eighth object of the present invention is a method for detecting genetic variants using LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has a B2 sequence modified at its 3' end, such that the 3-nucleotide end of the B2 sequence is reverse complementary to a nucleic acid sequence upstream of an inserted and / or deleted nucleic acid fragment containing the genetic variant to be detected, wherein, after the insertion and / or deletion occurs, the B2 primer sequence is reverse complementary only to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge). The B1c primer is designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer. The remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: the F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) to be amplified nucleic acid region, the 3' end of the F3 primer is upstream of the F2 primer, the 5' end of the F3 primer marks the beginning of the nucleic acid fragment to be amplified, and the B3 primer…The FIP primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer is marked with the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer consists of an F1c fragment having a sequence reverse complementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the F2 fragment of the FIP primer. The fragment is identical to the nucleic acid segment to be amplified. The 5' end of the FIP primer is located upstream of the 3' end of the F3 primer, and the 3' end of the F3 primer is located upstream of the 3' end of the F1c primer. The LF loop primer is inversely complementary to the nucleic acid segment to be amplified and is located between the 3' ends of the F2 primer and the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' ends of the B1c primer and the B2 primer.
[0011] A ninth object of the present invention is a method for detecting genetic variants using LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has a B2 sequence modified at its 3' end, such that the 4-nucleotide end of the B2 sequence is reverse complementary to a nucleic acid sequence upstream of an inserted and / or deleted nucleic acid fragment containing the genetic variant to be detected, wherein, after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge). The B1c primer is designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer. The remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: the F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) to be amplified, the 3' end of the F3 primer is upstream of the F2 primer, the 5' end of the F3 primer marks the beginning of the nucleic acid fragment to be amplified, and the B3 primer… The primer B3 is an oligonucleotide that is anticomplementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the primer B3 is marked with the end of the nucleic acid segment to be amplified, and the 3' end of the primer B2 precedes the 3' end of the primer B3. The primer FIP consists of an F1c fragment having a sequence anticomplementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the primer F2 and the 5' end of the primer B1c. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the F2 fragment of the primer FIP. The F2 fragment is identical to the nucleic acid segment to be amplified, and the 5' end of the primer FIP is upstream of the 3' end of the primer F3.The 3' end of the primer is located upstream of the 3' end of the F1c primer, and the LF loop primer is inversely complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer, and the LB loop primer has the same sequence as the segment to be amplified and is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
[0012] The tenth object of the present invention is a method for detecting genetic variants using LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has a B2 sequence modified at the 3' end, such that the 5-nucleotide end of the B2 sequence is reverse complementary to the nucleic acid sequence upstream of the nucleic acid fragment to be detected, the nucleic acid fragment containing the genetic variant to be detected, wherein after the insertion and / or deletion occurs, the B2 primer sequence is reverse complementary only to the nucleic acid sequence described in the specification 6 / 26 page 16 CN 121889513 A, and the B2 primer sequence is connected to the 3' end of the B1c primer through its 5' end (preferably via a TTTT bridge). The B1c primer is designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer. The remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: the F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) to be amplified, the 3' end of the F3 primer is upstream of the F2 primer, the 5' end of the F3 primer marks the beginning of the nucleic acid fragment to be amplified, and the B3 primer… The primer B3 is an oligonucleotide that is anticomplementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the primer B3 is marked with the end of the nucleic acid segment to be amplified, and the 3' end of the primer B2 precedes the 3' end of the primer B3. The FIP primer consists of an F1c fragment having a sequence anticomplementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the primer F2 and the 5' end of the primer B1c. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the F2 fragment of the primer FIP. The fragment is identical to the nucleic acid segment to be amplified, and the 5' end of the FIP primer is located upstream of the 3' end of the F3 primer, and the 3' end of the F3 primer is located upstream of the 3' end of the F1c primer. The LF loop primer is inversely complementary to the nucleic acid segment to be amplified and is located between the 3' ends of the F2 primer and the F1c primer. The LB loop primer has the same sequence as the segment to be amplified and is located between the 3' ends of the B1c primer and the B2 primer.
[0013] The eleventh object of the present invention is a method for detecting genetic variants using LAMP technology, characterized in that LAMP...The BIP internal primer set used in this technique has a B2 sequence modified at its 3' end, such that the 6-nucleotide end of the B2 sequence is reverse complementary to a nucleic acid sequence upstream of the inserted and / or deleted nucleic acid fragment to be detected, the nucleic acid fragment containing the genetic variant to be detected, wherein, after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer, while the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: the F3 primer is an oligonucleotide having the same sequence as the fragment (5'-3' strand) of the nucleic acid region to be amplified, the F3 The 3' end of primer B3 is located upstream of primer F2. Primer F3's 5' end marks the beginning of the nucleic acid segment to be amplified. Primer B3 is an oligonucleotide reverse complementary to the nucleic acid segment to be amplified (5'-3' strand), with its 5' end marking the end. Primer B2's 3' end precedes the 3' end of primer B3. The FIP primer consists of an F1c fragment with a sequence reverse complementary to the nucleic acid segment to be amplified, located at the 3' end of primer F2 and the 5' end of primer B1c. Between the ends, (preferably at its 3' end and via a TTTT bridge) is connected to the 5' end of the F2 fragment of the FIP primer, the F2 fragment being identical to the nucleic acid segment to be amplified, while the 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the F3 primer is upstream of the 3' end of the F1c primer, wherein the LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' ends of the F2 primer and the 3' ends of the F1c primer, and the LB loop primer has the same sequence as the segment to be amplified, the LB loop primer being located between the 3' ends of the B1c primer and the 3' ends of the B2 primer.
[0014] The twelfth object of the present invention is a method for detecting genetic variants using LAMP technology, characterized in that the BIP internal primer set used in the LAMP technology has a B2 sequence modified at the 3' end, such that the 7-nucleotide end of the B2 sequence is reverse complementary to a nucleic acid sequence upstream of an inserted and / or deleted nucleic acid fragment to be detected, the nucleic acid fragment containing the genetic variant to be detected, wherein, after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the 5' end of the B2 primer sequence (preferably via a TTTT bridge) is connected to the 3' end of a B1c primer, the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located at the 5' end of the F1c primer and the B2 primer.Between the 3' ends, the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally LF and / or LB loops, are designed as follows: the F3 primer is an oligonucleotide having the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified, the 3' end of the F3 primer is upstream of the F2 primer, the 5' end of the F3 primer is marked with the beginning of the nucleic acid segment to be amplified, and the B3 primer is (see page 7 / 26 of the specification, CN 121889513 A). The B3 primer is an oligonucleotide that is anticomplementary to the nucleic acid segment to be amplified (5'-3' strand). The 5' end of the B3 primer is marked with the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer consists of an F1c fragment having a sequence anticomplementary to the nucleic acid segment to be amplified, located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is connected to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. The 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the F3 primer is upstream of the 3' end of the F1c primer. The LF loop primer is anticomplementary to the nucleic acid segment to be amplified and is located between the 3' ends of the F2 primer and the 3' ends of the F1c primer. The LB loop primer has the same sequence as the segment to be amplified. The loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
[0015] In each aspect of the invention, including the above-described objects of the invention without relating to its novelty features, the primers are designed according to current techniques, for example, according to Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000 Jun 15;28(12):E63. doi: 10.1093 / nar / 28.12.e63. PMID: 10871386; PMCID: PMC102748 and Nagamine K, Hase T, Notomi T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes. 2002 Jun;16(3):223-9. doi: 10.1006 / mcpr .2002 .0415The techniques described in PMID: 1 21 4 4 7 7 4 are used to design primers in a manner that does not deviate from the recommendations in the literature or by using bioinformatics software such as PrimerExplorer (Eiken).
[0016] The thirteenth object of the present invention is a primer set for amplifying the nucleotide sequence of a fragment of the human EGFR (epidermal growth factor receptor) gene, characterized in that the primer set comprises an inner primer set and an outer primer set, the inner primer set having the following nucleotide sequences (a) and (b), and the outer primer set having the following nucleotide sequences (c) and (d), the primer set being specific for fragments of the human EGFR gene carrying the NM_005228.5 (EGFR): c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19: a) F1c 5' GACCCCCACACAGCAAAGCA 3' (nucleotide sequence SEQ ID NO: 3), which is linked at the 3' end (preferably via a TTTT bridge) to sequence F2 5' TCCCGTCGCTATCAAAACAT 3' (nucleotide sequence SEQ ID NO: 4), b) B1c 5' GCTGCTCTGCTCTAGACCCT 3' (nucleotide sequence SEQ ID NO: 5), which is connected at the 3' end (preferably via a TTTT bridge) to sequence B2 5' AGAGGCCAGTGCTGTCT 3' (nucleotide sequence SEQ ID NO: 6), c) F3 5' TGGATCCCAGAAGGTGAGAA 3' (nucleotide sequence SEQ ID NO: 1), and d) B3 5' GGGGTGGATACCAGCATG 3' (nucleotide sequence SEQ ID NO: 2).
[0017] Preferably, according to the primer set of the present invention, the primer set is characterized in that the primer set comprises a set of circular primer sequences containing nucleotide sequences contained in or complementary to a fragment of the human EGFR gene having SEQ ID NO: 7: LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8: LB 5' GCTCTAGTGGGTATAACTCCCTC 3'.
[0018] The fourteenth object of the present invention is a primer set for amplifying the nucleotide sequence of a fragment of the human EGFR (epidermal growth factor receptor) gene, characterized in that the primer set comprises an inner primer set and an outer primer set, the inner primer set having the following nucleotide sequences (a) and (b), and the outer primer set having the following nucleotide sequences (c) and (d).The genome contains the following fragments of the human EGFR gene carrying the mutations NM_005228.5 (EGFR):c.2240_2254del (p.Leu747_Thr751del) or NM_005228.3:c.2239_2253del15 or NM_005228.3:c.2238_2252del15 in exon 19: a) F1c 5' GACCCCCACACAGCAAAGCA 3' (nucleotide sequence SEQ ID NO: 3), which is linked at the 3' end (preferably via a TTTT bridge) to the sequence F2 5' TCCCGTCGCTATCAAGGAATCTC 3' (nucleotide sequence SEQ ID NO: 9), b) B1c 5' GCTGCTCTGCTCTAGACCCT 3' (nucleotide sequence SEQ ID NO: 9). NO: 5), which is connected at the 3' end (preferably via a TTTT bridge) to sequence B2 5' AGAGGCCAGTGCTGTCT 3' (nucleotide sequence SEQ ID NO: 6), c) F3 5' TGGATCCCAGAAGGTGAGAA 3' (nucleotide sequence SEQ ID NO: 1), and d) B3 5' GGGGTGGATACCAGCATG 3' (nucleotide sequence SEQ ID NO: 2).
[0019] Preferably, according to the primer set of the present invention, the primer set is characterized in that the primer set comprises a set of circular primer sequences containing nucleotide sequences contained in or complementary to a fragment of the human EGFR gene having SEQ ID NO: 7: LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8: LB 5' GCTCTAGTGGGTATAACTCCCTC 3'.
[0020] The fifteenth object of the present invention is a primer set for amplifying the nucleotide sequence of a fragment of the human EGFR (epidermal growth factor receptor) gene, characterized in that the primer set comprises an inner primer set and an outer primer set, the inner primer set having the following nucleotide sequences (a) and (b), and the outer primer set having the following nucleotide sequences (c) and (d), the primer set being specific for fragments of the human EGFR gene carrying the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) mutation in exon 19: a) F1c 5'a) GACCCCCACACAGCAAAGCA 3' (nucleotide sequence SEQ ID NO: 3), which is connected at the 3' end (preferably via a TTTT bridge) to sequence F2 5' TCCCGTCGCTGTCAAAACAT 3' (nucleotide sequence SEQ ID NO: 15), b) B1c 5' GCTGCTCTGCTCTAGACCCT 3' (nucleotide sequence SEQ ID NO: 5), which is connected at the 3' end (preferably via a TTTT bridge) to sequence B2 5' AGAGGCCAGTGCTGTCT 3' (nucleotide sequence SEQ ID NO: 6), c) F3 5' TGGATCCCAGAAGGTGAGAA 3' (nucleotide sequence SEQ ID NO: 1), and d) B3 5' GGGGTGGATACCAGCATG 3' (nucleotide sequence SEQ ID NO: 2).
[0021] Preferably, according to the primer set of the present invention, the primer set comprises a set of circular primer sequences containing nucleotide sequences contained in or complementary to a fragment of the human EGFR gene, the fragment of the human EGFR gene having SEQ ID NO: 7: LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8: LB 5' GCTCTAGTGGGTATAACTCCCTC 3'.
[0022] The sixteenth objective of this invention is to detect the mutations present in exon 19 of the human EGFR gene: NM_005228.5 (EGFR): c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR): c.2240_2254del (p.Leu747_Thr751del); NM_005228.3: c.2239_2253del15; NM_005228.3: c.2238_2252del15; NM_005228.5 (EGFR): c.2230_2249delinsGTCAA (p.Ile744_ The method of Ala750delinsValLys is characterized by amplifying selected regions of the nucleotide sequence of the human genome using primer sets according to any one of objectives 11 to 14 of the present invention, wherein the replication method is real-time LAMP.
[0023] Preferably, the method of detecting the mutation NM_005228.5(EGFR):c.2235_2249del in exon 19 of the human EGFR gene according to the present invention is described.The method for amplifying (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3: (Instruction manual 9 / 26 page 19 CN 121889513 A c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) is characterized by amplification performed at a temperature program of 68°C for 50 min.
[0024] Preferably, the method for detecting mutations NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) in exon 19 of the human EGFR gene according to the present invention is characterized in that the method relates to the detection method according to the sixteenth object of the present invention and its preferred alternative methods.
[0025] The seventeenth object of the present invention is a kit for detecting the mutations present in exon 19 of the human EGFR gene: NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys), characterized in that the kit contains a primer set according to any one of the objects of the present invention as defined above.
[0026] Preferably, the kit according to the present invention for detecting the mutations NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) present in exon 19 of the human EGFR gene is characterized in that the kit contains 5.0 µL Universal WarmStart® LAMP 2X. Master Mix (New England Biolabs), for example, obtained from (https: / / www.neb.com / en / products / e1700-warmstart-lamp-kit-dna-rna#Product%20Information).
[0027] Preferably, the mutations present in exon 19 of the human EGFR gene, as defined above, are used to detect mutations NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA A kit for (p.Ile744_Ala750delinsValLys) is characterized by the following primer concentrations in the kit: 0.15 µM F3, 0.15 µM B3, 1.20 µM FIP NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); 1.20 µM FIP NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15;NM_005228.3:c.2238_2252del15; 1.20 µM FIP; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys), 1.20 µM BIP, 0.30 µM LF, 0.30 µM LB; D-(+)-trehalose (6%); mannitol (1.25%); fluorescent double-stranded DNA dye EvaGreen (Biotium) (https: / / biotium.com / product / evagreen-dye-20x-in-water / ) ≤ 1X, or fluorescent dye (New England Biolabs) (https: / / www.neb.com / en / products / b1700-lamp-fluorescent-dye#Product%20Information) ≤ 0.5 μL, or green fluorescent dye (Lucigen) (https: / / shop.biosearchtech.com / isothermal-amplification / isothermal-amplification-reagents / dna-lamp-kits-and-master-mixes / green-fluorescent-dye / p / PCRAMP-008) ≤ 1 μL, or SYTO-13 (ThermoFisher Scientific) (https: / / www.thermofisher.com / order / catalog / product / S7575?ef_id= [Instruction manual 10 / 26 pages 20 CN 121889513 A CjwKCAjw38SoBhB6EiwA8EQVLkJfh09SOOvPUC-QmpO9zp8pjrA7AO1DZnAR_TOzQfZtv- […]) AMS2xPKRoC3X4QAvD_BwE:G:s&s_kwcid=AL!3652!3!447292198733!!!g!!!10506731179! 109642167491&cid=bid_pca_iva_r01_co_cp1359_pjt0000_bid00000_0se_gaw_dy_pur_The concentrations of the LAMP technique used to detect genetic variants include: con&gclid=CjwKCAjw38SoBhB6EiwA8EQVLkJfh09SOOvPUC-QmpO9zp8pjrA7AO1DZnAR_ TOzQfZtv-AMS2xPKRoC3X4QAvD_BwE) ≤ 16 µM, or SYTO-82 (ThermoFisher Scientific) (https: / / www.thermofisher.com / order / catalog / product / S11363?SID=srch-srp-S11363) ≤ 16 µM, or other double-stranded DNA dyes whose concentrations do not inhibit the amplification process.
[0028] The advantages of the method for detecting genetic variants using LAMP technology include high reliability and specificity of results, and facilitate the multiplexing of the kit to detect multiple variants in a single reaction. Furthermore, the method has lower production costs compared to previously disclosed solutions, which is related to the fact that the reaction requires fewer primers. According to the present invention, the detection method for mutations present in exon 19 of the human EGFR gene is as follows: NM_005228.5(EGFR): c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR): c.2240_2254del (p.Leu747_Thr751del); NM_005228.3: c.2239_2253del15; NM_005228.3: c.2238_2252del15; NM_005228.5 (EGFR): c.2230_2249delinsGTCAA (p.Ile744_ The advantages of the primer set and method for detecting the amplification products of Ala750delinsValLys are that it can simultaneously detect multiple clinically relevant mutations and can be used as a point-of-care test (POCT) on a portable gene analyzer as part of its intended applications. Accordingly, the use of fluorescent dyes for detecting the amplification products improves the sensitivity and specificity of the method and facilitates additional validation of the results using melting curves. Detailed Description
[0029] The accompanying drawings show an exemplary embodiment of the invention, wherein Figure 1 illustrates the specific characteristics of the method, wherein a specific signal was obtained for a synthetic template of the human EGFR gene modified to exhibit the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19, while a specific signal was obtained for a human EGFR gene template containing extracts from healthy individuals.No signal was obtained in the genetic material samples (wild-type) and template-free controls (NTC); Figure 2 illustrates the method-specific characteristics, where a specific signal was obtained for the synthetic template of the human EGFR gene modified to exhibit the mutation NM_005228.5(EGFR):c .2240_2254del (p .Leu747_Thr751del); NM_005228 .3:c .2239_2253del15; NM_005228 .3:c .2238_ 2252del15 within exon 19, while no signal was obtained in the samples containing human genetic material extracted from healthy individuals (wild-type) and template-free controls (NTC); Figure 3 illustrates the method-specific characteristics, where a specific signal was obtained for the synthetic template modified to exhibit the mutation NM_005228 .5(EGFR):c .2230_ A specific signal was obtained from the synthetic template of the human EGFR gene with the 2249delinsGTCAA (p.Ile744_Ala750delinsValLys) mutation, while no signal was obtained in samples containing human genetic material extracted from healthy individuals (wild type) and template-free controls (NTC). The real-time detection results are shown in Table 1, which indicates the shortest time required to detect the fluorescence signal.
[0030] Table 1: Specification 11 / 26 pages 21 CN 121889513 A
[0031] Figure 4 shows the specificity of the method involving melting curve analysis, which provides the melting temperature of the reaction product of the mutant NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); Figure 5 shows the specificity of the method involving melting curve analysis, which provides the melting temperature of the reaction product of the mutant NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_ The melting temperature of the reaction product of 005228.3:c.2238_2252del15); Figure 6 shows the specificity of the method involving melting curve analysis, which provides the melting temperature of the reaction product of the mutant NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys); Figures 7 through 10 depict an illustrative method of primer design as described in the first object of the invention, which uses deletion-associated genetic variants, wherein Figure 7 shows the genomic fragment undergoing deletion, Figure 8 shows the genomic fragment after deletion, and Figure 9 is in accordance with the specification.Page 12 / 26 22 CN 121889513 A illustrative depiction of the location of LAMP reaction primers and / or their attachment sites, wherein the F2 primer, attached to the F2c fragment located on the 3' > 5' strand of the genetic material, is used to detect genetic variants; Figure 10 illustratively depicts the location of LAMP reaction primers and / or their attachment sites, wherein the B2 primer, attached to the B2c fragment located on the 5' > 3' strand of the genetic material, is used to detect genetic variants; Figures 11 to 13 show the results of amplification reactions in an improved LAMP method depending on the presence / attachment of FIP or BIP primers, wherein reaction products appear in the presence of all primers, as shown in Figure 11, while no reaction products are present when FIP primers (Figure 12) or BIP primers (Figure 13) are not attached; Table 2 shows the time required for the amount of product obtained in a real-time LAMP reaction to increase exponentially
[0032] Table 2.
[0033] The results show that both FIP and BIP primers play a key role in the LAMP reaction process. Meanwhile, the mechanism of the LAMP reaction clearly demonstrates that the BIP primer is a functional equivalent of the FIP primer acting on the leading strand. Therefore, the modifications described in the second objective specification of this invention, page 13 / 26 of CN 121889513 A, allow for the detection of nucleotide variants using both the leading strand and BIP primers; Figure 14 shows the results of an amplification reaction using LAMP technology, characterized in that the FIP internal primer set used in the LAMP technology has an F2 sequence SEQ ID NO: 15 modified in the 3' end region, such that the 1-nucleotide end of the F2 sequence is identical to the nucleic acid sequence to be detected after insertion and / or deletion, the nucleic acid sequence containing the genetic variant to be detected, and that the remaining primers, namely F3, B3, BIP, and loops LF and LB, are identical to those shown in Example 1. Figure 14 shows the reaction product using a synthetic template modified to represent the human EGFR gene with the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19; the product was also present in a sample containing human genetic material extracted from healthy individuals (wild type), and no signal was detected in the template-free control (NTC). This result confirms that modification of the F2 or B2 primers at the single nucleotide level does not allow for specific detection of genetic variants, and Table 3 shows the time required to obtain an exponentially increasing amount of product in a real-time LAMP reaction.
[0034] Table 3: Specification 14 / 26 pages 24 CN 121889513 A
[0035] Figure 15 shows the amplification reaction using a method for detecting polynucleotide genetic variants utilizing LAMP technology.The result is characterized by the FIP internal primer set used in the LAMP technology having an F2 sequence modified in the 3' end region (see page 15 / 26 of CN 121889513 A SEQ ID NO: 11), such that the F2 sequence is 2 nucleotides long at its end and is identical to the nucleic acid sequence to be detected after insertion and / or deletion, the nucleic acid sequence containing the genetic variant to be detected, and the remaining primers, namely F3, B3, BIP, and loops LF and LB, are identical to those shown in Example 1. Figure 15 shows the reaction product using a synthetic template of the human EGFR gene modified to represent the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19, and no signal was detected in a sample containing human genetic material extracted from healthy individuals (wild type) compared to a template-free control (NTC). Table 3 shows the time required for the amount of product to increase exponentially in the real-time LAMP reaction. The results confirm that modifying the F2 or B2 primers within a 2-nucleotide range facilitates the specific detection of genetic variants. Figure 16 shows the results of an amplification reaction using a polynucleotide genetic variant detection method employing LAMP technology, characterized in that the FIP inner primer set used in the LAMP technology has an F2 sequence SEQ ID NO: 12 modified in the 3' end region such that the 3-nucleotide end of the F2 sequence is identical to the nucleic acid sequence to be detected after insertion and / or deletion, which contains the genetic variant to be detected, and that the remaining primers, namely F3, B3, BIP, and loops LF and LB, are identical to those shown in Example 1. Figure 16 shows the reaction product using a synthetic template of the human EGFR gene modified to represent the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19. However, no signal was obtained in samples containing human genetic material extracted from healthy individuals (wild-type) and in template-free controls (NTCs). Table 3 shows the time required for exponential growth in the amount of product obtained in real-time LAMP reactions. This result confirms that modification of the F2 or B2 primers within a 3-nucleotide range facilitates the specific detection of genetic variants. Figure 17 shows the results of an amplification reaction using a multinucleotide genetic variant detection method utilizing LAMP technology, characterized in that the FIP inner primer set used in the LAMP technology has an F2 sequence SEQ ID NO: 13 modified in the 3' end region, such that the 4-nucleotide-long end of the F2 sequence is coupled to the nucleic acid sequence to be detected after insertion and / or deletion.The nucleic acid sequence contained the genetic variant to be detected, and the remaining primers, namely F3, B3, BIP, and loops LF and LB, were identical to those shown in Example 1. Figure 17 shows the reaction product using a synthetic template modified to represent the human EGFR gene with the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19. However, no signal was obtained in samples containing human genetic material extracted from healthy individuals (wild type) compared to the template-free control (NTC). Table 3 shows the time required for an exponential increase in the amount of product obtained in the real-time LAMP reaction. This result confirms that modification of the F2 or B2 primers within a 4-nucleotide range facilitates the specific detection of genetic variants. Figure 18 shows the results of an amplification reaction using a polynucleotide genetic variant detection method employing LAMP technology. The method is characterized by the use of an FIP inner primer set with an F2 sequence (SEQ ID NO: 4) modified at the 3' end region, such that the 5-nucleotide terminus of the F2 sequence is identical to the nucleic acid sequence to be detected after insertion and / or deletion, which contains the genetic variant to be detected. The remaining primers, namely F3, B3, BIP, and loops LF and LB, are identical to those shown in Example 1. Figure 18 illustrates the reaction product using a synthetic template modified to represent the human EGFR gene with the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19. However, no signal was obtained in samples containing human genetic material extracted from healthy individuals (wild-type) compared to the template-free control (NTC). Table 3 shows the time required for an exponential increase in the amount of product obtained in the real-time LAMP reaction. The results confirm that modification of the F2 or B2 primers within a 5-nucleotide range facilitates the specific detection of genetic variants. Figure 19 shows the results of an amplification reaction using a polynucleotide genetic variant detection method utilizing LAMP technology, characterized in that the FIP inner primer set used in the LAMP technology has an F2 sequence SEQ ID NO: 14 modified in the 3' end region such that the 6-nucleotide end of the F2 sequence is identical to the nucleic acid sequence to be detected after insertion and / or deletion, the nucleic acid sequence containing the genetic variant to be detected, and the remaining primers, namely F3, B3, BIP, and loops LF and LB, are identical to those shown in Example 1. Figure 19 illustrates the specificity characteristics of this method, wherein the modified primers are shown in the specification page 16 / 26, 26 CN 121889513 A.The reaction product of the human EGFR gene with the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19 was obtained, but no signal was obtained in samples containing human genetic material extracted from healthy individuals (wild-type) or in the template-free control (NTS). Table 3 shows the time required for an exponential increase in the amount of product obtained in the real-time LAMP reaction. This result confirms that modification of the F2 or B2 primers within a 6-nucleotide range facilitates the specific detection of genetic variants. Figure 20 shows the results of an amplification reaction using a polynucleotide genetic variant detection method employing LAMP technology. The method is characterized by the use of an FIP inner primer set with an F2 sequence (SEQ ID NO: 16) modified at the 3' end region, such that the 7-nucleotide terminus of the F2 sequence is identical to the nucleic acid sequence to be detected after insertion and / or deletion, which contains the genetic variant to be detected. The remaining primers, namely F3, B3, BIP, and loops LF and LB, are identical to those shown in Example 1. Figure 20 illustrates the reaction product using a synthetic template modified to represent the human EGFR gene with the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19. However, no signal was obtained in samples containing human genetic material extracted from healthy individuals (wild-type) compared to the template-free control (NTC). Table 3 shows the time required for an exponential increase in the amount of product obtained in the real-time LAMP reaction. The results confirm that modification of the F2 or B2 primers within a 7-nucleotide range facilitates the specific detection of genetic variants. Figure 21 shows the results of an amplification reaction using a polynucleotide genetic variant detection method utilizing LAMP technology, characterized in that the BIP inner primer set used in the LAMP technology has a B2 sequence SEQ ID NO: 6 modified in the 3' end region such that the 5-nucleotide end of the B2 sequence is identical to the nucleic acid sequence to be detected after insertion and / or deletion, which contains the genetic variant to be detected, and that the remaining primers, namely F3, B3, FIP, and loops LF and LB, are identical to those shown in Example 1. Figure 21 shows the reaction product using a synthetic template modified to express the human EGFR gene with the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19. However, the reaction product using a template modified to express the NM_005228.5(EGFR):c.2235_2249del mutation in exon 19 is different.In a sample of the human EGFR gene with the (p.Glu746_Ala750del) mutation and containing a 10-nucleotide insertion at primer B2 (SEQ ID NO: 6), no signal was obtained compared to the template-free control (NTC). Table 4 shows the time required for the amount of product obtained in the real-time LAMP reaction to increase exponentially. This result confirms that modification of primer B2 within a 5-nucleotide range facilitates the specific detection of genetic variants.
[0036] Table 4: Specification 17 / 26 pages 27 CN 121889513 A
[0037] Example 1: Primer Sequence
[0038] Specific oligonucleotide sequences for amplifying nucleotide sequences using RT-LAMP technology, the nucleotide sequences being specific to fragments of the human EGFR gene carrying the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation, the specific oligonucleotide sequences are shown below and have the following characteristics.
[0039] 1. The sequence of oligonucleotide F3: 5' TGGATCCCAGAAGGTGAGAA 3', which constitutes the same sequence as the 5'-3' strand of the human EGFR gene carrying the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation.
[0040] 2. The sequence of oligonucleotide B3: 5' GGGGTGGATACCAGCATG 3', which constitutes the complementary segment of the 5'-3' strand of the human EGFR gene carrying the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation, said mutation being located 247 nucleotides from the 3' end of oligonucleotide 1.
[0041] 3. The sequence of oligonucleotide F2: 5' TCCCGTCGCTATCAAAACAT 3', which constitutes the same sequence as the fragment (5'-3' chain) of the human EGFR gene carrying the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation, said mutation being located 9 nucleotides from the 3' end of oligonucleotide 1.
[0042] 4. The sequence of oligonucleotide B2: 5' AGAGGCCAGTGCTGTCT 3', which constitutes the complementary fragment of the human EGFR gene (5'-3' chain) carrying the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation, said mutation being located 228 nucleotides from the 3' end of oligonucleotide 1.
[0043] 5.The sequence of oligonucleotide F1c is 5' GACCCCCACACAGCAAAGCA 3', which constitutes the complementary segment of the human EGFR gene (5'-3' chain) carrying the NM_005228.5 (EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation, said mutation being located 67 nucleotides from the 3' end of oligonucleotide 1.
[0044] 6. The sequence of oligonucleotide B1c is 5' GCTGCTCTGCTCTAGACCCT 3', which constitutes the same sequence as the segment (5'-3' chain) of the human EGFR gene carrying the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation, said mutation being located 129 nucleotides from the 3' end of oligonucleotide 1.
[0045] The F1c and F2 oligonucleotide sequences are advantageously linked by a TTTT bridge and used as FIP primers. The B1c and B2 oligonucleotide sequences are advantageously linked by a TTTT bridge and used as BIP primers. Specification 18 / 26 pages 28 CN 121889513 A
[0046] 7. Sequence of oligonucleotide LF: 5' TCACATCGAGGATTTCCTTGTTG 3'.
[0047] 8. Sequence of oligonucleotide LB: 5' GCTCTAGTGGGTATAACTCCCTC 3'.
[0048] A specific oligonucleotide sequence for amplifying nucleotide sequences using RT-LAMP technology, the nucleotide sequence being specific to fragments of exon 19 of the human EGFR gene carrying the NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation or the NM_005228.3:c.2239_2253del15 mutation or the NM_005228.3:c.2238_2252del15 mutation, the specific oligonucleotide sequence being shown below and having the following characteristics.
[0049] 1. The sequence of oligonucleotide F3: 5' TGGATCCCAGAAGGTGAGAA 3', which is identical to the sequence of the human EGFR gene fragment (5'-3' strand) carrying the NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation or the NM_005228.3:c.2239_2253del15 mutation or the NM_005228.3:c.2238_2252del15 mutation.
[0050] 2. The sequence of oligonucleotide B3: 5' GGGGTGGATACCAGCATG 3', which is identical to the sequence of the human EGFR gene fragment (5'-3' strand) carrying the NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation.The complementary fragment of the human EGFR gene (5'-3' strand) with the mutation .5 (EGFR):c.2240_2254del (p.Leu747_Thr751del) or NM_005228.3:c.2239_2253del15 or NM_005228.3:c.2238_2252del15, wherein the mutation is located 247 nucleotides from the 3' end of oligonucleotide 1.
[0051] 3. The sequence of oligonucleotide F2: 5' TCCCGTCGCTATCAAGGAATCTC 3', which is identical to the sequence of the fragment (5'-3' chain) of the human EGFR gene carrying the NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation or the NM_005228.3:c.2239_2253del15 mutation or the NM_005228.3:c.2238_2252del15 mutation, said mutation being located 9 nucleotides from the 3' end of oligonucleotide 1.
[0052] 4. The sequence of oligonucleotide B2: 5' AGAGGCCAGTGCTGTCT 3', which constitutes a complementary segment of the human EGFR gene (5'-3' chain) carrying the NM_005228.5 (EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation or the NM_005228.3:c.2239_2253del15 mutation or the NM_005228.3:c.2238_2252del15 mutation, said mutation being located 228 nucleotides from the 3' end of oligonucleotide 1.
[0053] 5. The sequence of oligonucleotide F1c: 5' GACCCCCACACAGCAAAGCA 3', which constitutes a complementary fragment of the human EGFR gene (5'-3' chain) carrying the NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation or the NM_005228.3:c.2239_2253del15 mutation or the NM_005228.3:c.2238_2252del15 mutation, said mutation being located 67 nucleotides from the 3' end of oligonucleotide 1.
[0054] 6. The sequence of oligonucleotide B1c: 5' GCTGCTCTGCTCTAGACCCT 3', whose composition is consistent with carrying the NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation or NM_005228.3:c.2239_The sequence is identical to the 2253del15 mutation or the NM_005228.3:c.2238_2252del15 mutation in the human EGFR gene fragment (5'-3' strand), said mutation being located 129 nucleotides from the 3' end of oligonucleotide 1.
[0055] The F1c and F2 oligonucleotide sequences are advantageously linked by a TTTT bridge and used as FIP primers. The B1c and B2 oligonucleotide sequences are advantageously linked by a TTTT bridge and used as BIP primers.
[0056] 7. Sequence of oligonucleotide LF: 5' TCACATCGAGGATTTCCTTGTTG 3'.
[0057] 8. Sequence of oligonucleotide LB: 5' GCTCTAGTGGGTATAACTCCCTC 3'.
[0058] A specific oligonucleotide sequence for amplifying nucleotide sequences using RT-LAMP technology, the nucleotide sequence being specific to the fragment of exon 19 of the human EGFR gene carrying the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) mutation, the specific oligonucleotide sequence being as follows and having the following characteristics.
[0059] 1. The sequence of oligonucleotide F3: 5' TGGATCCCAGAAGGTGAGAA 3', which constitutes the same sequence as the fragment (5'-3' chain) of the human EGFR gene carrying the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) mutation.
[0060] 2. The sequence of oligonucleotide B3: 5' GGGGTGGATACCAGCATG 3', which constitutes a complementary segment of the human EGFR gene (5'-3' chain) carrying the NM_005228.5 (EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) mutation, said mutation being located 247 nucleotides from the 3' end of oligonucleotide 1.
[0061] 3. The sequence of oligonucleotide F2: 5' TCCCGTCGCTGTCAAAACAT 3', which is identical to the sequence of the fragment (5'-3' strand) of the human EGFR gene carrying the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) mutation, said mutation being located 9 nucleotides from the 3' end of oligonucleotide 1.
[0062] 4.The sequence of oligonucleotide B2 is 5' AGAGGCCAGTGCTGTCT 3', which constitutes the complementary fragment of the human EGFR gene (5'-3' chain) carrying the NM_005228.5 (EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) mutation, said mutation being located 228 nucleotides from the 3' end of oligonucleotide 1.
[0063] 5. The sequence of oligonucleotide F1c is 5' GACCCCCACACAGCAAAGCA 3', which constitutes the complementary fragment of the human EGFR gene (5'-3' chain) carrying the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) mutation, said mutation being located 67 nucleotides from the 3' end of oligonucleotide 1.
[0064] 6. Sequence of oligonucleotide B1c: 5' GCTGCTCTGCTCTAGACCCT 3', which constitutes the same sequence as the sequence of the fragment (5'-3' chain) of the human EGFR gene carrying the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) mutation, said mutation being located 129 nucleotides from the 3' end of oligonucleotide 1.
[0065] The F1c and F2 oligonucleotide sequences are advantageously linked by a TTTT bridge and used as FIP primers. The B1c and B2 oligonucleotide sequences are advantageously linked by a TTTT bridge and used as BIP primers.
[0066] 7. Sequence of oligonucleotide LF: 5' TCACATCGAGGATTTCCTTGTTG 3'.
[0067] 8. The sequence of oligonucleotide LB: 5' GCTCTAGTGGGTATAACTCCCTC 3'.
[0068] Example 2: Composition of the reaction mixture
[0069] The method for amplifying a fragment of the human EGFR gene using nucleotides as described in Example 1, wherein the fragment of the human EGFR gene carries one of the following mutations: NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA(p.Ile744_Ala750delinsValLys), the method is carried out by RT-LAMP technology with the following reaction mixture composition: 5.0 µL Universal WarmStart® LAMP 2X Master Mix (New England Biolabs) 0.15 µM F3 0.15 µM B3 1.20 µM FIP NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) 1.20 µM FIP NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15 1.20 µM FIP NM_005228 .5(EGFR):c .2230_2249delinsGTCAA (p .Ile744_ Ala750delinsValLys) 1.20 µM BIP Instruction Manual 20 / 26 pages 30 CN 121889513 A 0.30 µM LF 0.30 µM LB D-(+)-Trehalose (6%) Mannitol (1.25%) Fluorescent dye is EvaGreen (Biotium) (≤ 1X), or fluorescent dye 50X (New England Biolabs) ≤ 1 μL, or green fluorescent dye (Lucigen) ≤ 1 μL, or SYTO-13 (ThermoFisher Scientific) ≤ 16 µM, or SYTO-82 (ThermoFisher Scientific) ≤ 16 µM, or other double-stranded DNA dyes whose concentration will not inhibit the amplification process.
[0070] DNA template ≥ 250 copies / reaction
[0071] The total reaction volume was supplemented to 10 µL with water free of DNase and RNase.
[0072] Example 3: Temperature Program
[0073] The method for amplifying fragments of the human EGFR gene using nucleotides as described in Example 1 was performed by RT-LAMP technology with the reaction mixture composition described in Example 2 characterized by the following temperature program: 1) 68°C, 50 min.
[0074] 2) Preferably, melting curve analysis was performed after the amplification phase using an additional temperature program from 65°C to 95°C, wherein the increment was 0.5°C and each temperature level was held for 5 seconds.
[0075] Example 4: Detection Method
[0076] The method for nucleotide amplification and detection of a fragment of the human EGFR gene described in Example 1 was used, wherein the fragment of the human EGFR gene carries one of the following mutations: NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys), the method is carried out using RT-LAMP technology with the reaction mixture composition described in Example 2, characterized by the temperature program shown in Example 3, and the detection method is as follows. Before the reaction begins, a fluorescent dye is added to the reaction mixture in the following amounts: 0.5 µL EvaGreen 20X; 0.5 µL or ≤ 1X; for green fluorescent dyes (Lucigen), SYTO-13, and SYTO-82, ≤ 16 µM respectively; measurements are acquired in real-time and / or at the endpoint. For EvaGreen, fluorescent dye 50X (New England Biolabs), green fluorescent dye (Lucigen), and SYTO-13 dye, the excitation wavelength range is similar to that of FAM dyes, i.e., 490 nm to 500 nm (optimal wavelength 494 nm), or for SYTO-82 dye, the excitation wavelength is 535 nm (optimal wavelength 541 nm); for EvaGreen, green fluorescent dye (Lucigen), and SYTO-13 dye, the emission wavelength range is 509 nm to 530 nm (optimal 518 nm), or for SYTO-82 dye, the emission wavelength is 556 nm (optimal wavelength 560 nm). Detection method: record fluorescence intensity changes every 60 seconds.
[0077] Example 5: Method Sensitivity and Specificity
[0078] The sensitivity and specificity of the method were determined by establishing a dilution series using the nucleotides described in Example 1, via RT-LAMP technology with the reaction mixture composition described in Example 2 characterized by the temperature program shown in Example 3, and the detection method was as described in Example 4, using a modified nucleotide to exhibit the presence of NM_005228.5(EGFR):c.2235_2249del in exon 19.The synthesis of the human EGFR gene was performed using a template containing the following mutations: (p.Glu746_Ala750del) mutation or NM_005228.5 (EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation or NM_005228.3:c.2239_2253del15 mutation or NM_005228.3:c.2238_2252del15 mutation or NM_005228.5 (EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys). See instruction manual, pages 21 / 26, 31, CN 121889513 A. The copy number of the mutation in the reaction mixture ranged from 250 to 1000 copies, with real-time measurements of product amplification (Figures 1, 2, and 3 (real-time LAMP of dilution series)), and melting temperature readings ranging from 87.5°C to 88.5°C (Figures 4, 5, and 6). The time required to detect fluorescence emitted from a single sample is shown in Table 1.
[0079] The primers shown facilitate the detection of the NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) mutation or the NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation or the NM_005228.3:c.2239_2253del15 mutation or the NM_005228.3:c.2238_2252del15 mutation or the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) mutation, wherein the minimum number of mutations in the reaction mixture is 250 genomic copies.
[0080] Compared to tests based on real-time LAMP technology, the method and reaction mixture composition for detecting genetic variants and oligonucleotides, characterized by the scheme described in this patent, have the advantages of high reliability and specificity of results, and facilitate the multiplexing of the kit to detect multiple variants in a single reaction. Furthermore, the method has lower production costs compared to previously disclosed solutions, which is related to the need for fewer primers in the reaction.
[0081] Sequence Listing
[0082] < 110 > Genomtec SA
[0083] < 120 > Method for detecting variations in nucleotide sequence using isothermal nucleic acid amplification technology, primer set for detecting selected genetic variants, and composition of the reaction mixture
[0084] < 170 >PatentIn version 3.5
[0085] <210> 1 F3
[0086] <211> 20
[0087] <212> DNA
[0088] <213> Artificial
[0089] <223> Primer
[0090] <400> 1
[0091] F3
[0092] TGGATCCCAGAAGGTGAGAA 20
[0093] <210> 2 B3
[0094] <211> 18
[0095] <212> DNA
[0096] <213> Artificial
[0097] <223> Primer
[0098] <400> 2
[0099] B3
[0100] GGGGTGGATACCAGCATG 18
[0101] <210> 3 F1c
[0102] <211> 20
[0103] <212> DNA
[0104] <213> Artificial
[0105] <223> Primer
[0106] <400> 3. Instruction manual, pages 22 / 26, 32 CN 121889513 A
[0107] F1c
[0108] GACCCCCACACAGCAAAGCA 20
[0109] <210> 4 F2 NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) <211 > 20
[0110] <212> DNA
[0111] <213> Artificial
[0112] <223> Primer
[0113] <400> 4
[0114] F2 NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del)
[0115] TCCCGTCGCTATCAAAACAT 20
[0116] <210> 5 B1c
[0117] <211> 20
[0118] <212> DNA
[0119] <213> Artificial
[0120] <223> Primer
[0121] <400> 5
[0122] B1c
[0123] GCTGCTCTGCTCTAGACCCT 20
[0124] <210> 6 B2
[0125] <211> 17
[0126] <212> DNA
[0127] <213> Artificial
[0128] <223> Primer
[0129] <400> 6
[0130] B2
[0131] AGAGGCCAGTGCTGTCT 17
[0132] <210> 7 LF
[0133] <211> 23
[0134] <212> DNA
[0135] <213> Artificial
[0136] <223> Primer
[0137] <400> 7
[0138] LF
[0139] TCACATCGAGGATTTCCTTGTTG 23
[0140] <210> 8 LB
[0141] <211> 23
[0142] <212> DNA
[0143] <213> Artificial
[0144] <223> Primer specifications, pages 23 / 26, 33 CN 121889513 A
[0145] <400> 8
[0146] LB
[0147] GCTCTAGTGGGTATAACTCCCTC 23
[0148] <210> 9 F2 NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_ 005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15
[0149] <211> 23
[0150] <212> DNA
[0151] <213> Artificial
[0152] <223> Primer
[0153] <400> 9
[0154] F2 NM_005228 .5 (EGFR): c .2240_2254del (p .Leu747_Thr751del); NM_005228.3: c.2239_2253del15; NM_005228.3: c.2238_2252del15
[0155] TCCCGTCGCTATCAAGGAATCTC 23
[0156] <210> 10 F2 NM_005228 .5(EGFR):c .2235_2249del (p .Glu746_Ala750del) MOD1
[0157] <211> 20
[0158] <212> DNA
[0159] <213> Artificial
[0160] <223> Primer
[0161] <400> 10
[0162] F2 NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) MOD1
[0163] AAATTCCCGTCGCTATCAAA 20
[0164] <210> 11 F2 NM_005228 .5(EGFR):c .2235_2249del (p.Glu746_Ala750del) MOD2
[0165] <211> 20
[0166] <212> DNA
[0167] <213> Artificial
[0168] <223> Primer
[0169] <400> 11
[0170] F2 NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) MOD2
[0171] AATTCCCGTCGCTATCAAAA 20
[0172] <210> 12 F2 NM_005228 .5(EGFR):c .2235_2249del (p .Glu746_Ala750del) MOD3
[0173] <211> 20
[0174] <212> DNA
[0175] <213> Artificial
[0176] <223> Primer
[0177] <400> 12
[0178] F2 NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) MOD3 Specification 24 / 26 pages 34 CN 121889513 A
[0179] ATTCCCGTCGCTATCAAAAC 20
[0180] <210> 13 F2 NM_005228 .5(EGFR):c .2235_2249del (p .Glu746_Ala750del) MOD4
[0181] <211> 20
[0182] <212> DNA
[0183] <213> Artificial
[0184] <223> Primer
[0185] <400> 13
[0186] F2 NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) MOD4
[0187] TTCCCGTCGCTATCAAAACA 20
[0188] <210> 14 F2 NM_005228 .5(EGFR):c .2235_2249del (p .Glu746_Ala750del) MOD6
[0189] <211> 20
[0190] <212> DNA
[0191] <213> Artificial
[0192] <223> Primer
[0193] <400> 14
[0194] F2 NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) MOD6
[0195] CCCGTCGCTATCAAAACATC 20
[0196] <210> 15 F2 NM_005228 .5(EGFR):c .2230_2249delinsGTCAA (p .Ile744_ Ala750delinsValLys)
[0197] . <211> 20
[0198] <212> DNA
[0199] <213> Individual
[0200] <223> Document
[0201] <400> 15
[0202] F 2 NM_005 228 .5 (EGFR) :c .2230_ 224 9d elinsG TC AA (p .Ile744_ Ala750delinsValLys)
[0203] TCCCGTCGCTGTCAAAACAT 20
[0204] . <210> 16 F2 NM_005228 .5(EGFR):c .2235_2249del (p .Glu746_Ala750del) MOD7
[0205] <211> 20
[0206] <212> DNA
[0207] <213> Individual
[0208] <223> Document
[0209] <400> 16
[0210] F2 NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) MOD7
[0211] CCGTCGCTATCAAAACATCT 20
[0212] <210> 17 gBlock NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del) specific 25 / 26 fragment 35 CN 121889513 A MOD7
[0213] <211> 905
[0214] <212> DNA
[0215] <213>
[0216] <223> gBlock
[0217] <400> 17
[0218] GCATTTTTATGAAAGGGGCCATTGACCTTGCCATGGGGTGCAGCACAGGGCGGGAGGGCCGCCTCT CACCGCACGGCATCAGAATGCAGCCCAGCTGAAATGGGCTCATCTTCGTTTGCTTCTTCTAGATCCTCTTTGCATGAAATCTGATTTCAGTTAGGCCTAGACGCAGCATTAAATTCTGGATGAAATGATCCACACGGACTTTATAACAGGC TTTACAAGCTTGAGATTCTTTTATCTAAATAATCAGTGTGATTCGTGGAGCCCAACAGCTGCAGGGCTGCGGGGGCG TCACAGCCCCCAGCAATATCAGCCTTAGGTGCGGCTCCACAGCCCCAGTGTCCCTCACCTTCGGGGTGCATCGCTGG TAACATCCACCCAGATCACTGGGCAGCATGTGGCACCATCTCACAATTGCCAGTTAACGTCTTCCTTCTCTCCTGT CATAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAAACATCTCCGAAAGCCAACAAG GAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTCCATGGCTCTGAACCTCAGGCCCACCTTTTCTCATGT CTGGCAGCTGCTCTGCTCTAGACCCTGCTCATCTCCACATCCTAAATGTTCACTTTCTATGTCTTTCCCTTTCTAGC TCTAGTGGGTATAACTCCCTCCCCTTAGAGACACTGTCATCTCGCACTGGCCTCTCCCATGCTGGTATCCACCCCAA AAGGCTGGAAACAGGCAATTACTGGCATCTACCCAGCACTAGTTTCTTGACACGCATGACGAGTGAGTGCTCTTGGT GAGCCTGGAGCATGGGTATTGTTTTTGGTATTTTTTGGATGAAGAAATGGAGGCATAAAGAAATTG Instruction Manual 26 / 26 Page 36 CN 121889513 A Figure 1 Figure 2 Instruction Manual Appendix 1 / 10 Page 37 CN 121889513 A Figure 3 Figure 4 Instruction Manual Appendix 2 / 10 Page 38 CN 121889513 A Figure 5 Figure 6 Instruction Manual Appendix 3 / 10 Page 39 CN 121889513 A Figure 7 Figure 8 Figure 9 Instruction Manual Drawings 4 / 10 Page 40 CN 121889513 A Figure 10 Figure 11 Instruction Manual DrawingsPage 5 / 10, 41 CN 121889513 A, Figure 12, Figure 13, Instruction Manual Drawings; Page 6 / 10, 42 CN 121889513 A, Figure 14, Figure 15, Instruction Manual Drawings; Page 7 / 10, 43 CN 121889513 A, Figure 16, Figure 17, Instruction Manual Drawings; Page 8 / 10, 44 CN 121889513 A, Figure 18, Figure 19, Instruction Manual Drawings; Page 9 / 10, 45 CN 121889513 A, Figure 20, Figure 21, Instruction Manual Drawings; Page 10 / 10, 46 CN 121889513 A
Claims
1. A method for detecting polynucleotide genetic variants using LAMP technology, characterized in that, The FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end, such that the 2-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected for insertion and / or deletion, wherein, after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment (5'-3' strand) to be amplified and located between the 3' end of the F2 primer and the 5' end of the B1c primer, while the remaining LAMP reaction primers, namely F3, B3, BIP, and optionally LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The BIP primer consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified. The B1c fragment is located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is reverse complementary to the nucleic acid segment to be amplified. Simultaneously, the 5' end of the BIP primer is upstream of the 3' end of the B3 primer, and the 3' end of the BIP primer is downstream of the 3' end of the B1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
2. A method for detecting polynucleotide genetic variants using LAMP technology, characterized in that, The FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end, such that the 3-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected for insertion and / or deletion, wherein, after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer, while the remaining LAMP reaction primers, namely F3, B3, BIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The BIP primer consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified. The B1c fragment is located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is reverse complementary to the nucleic acid segment to be amplified. Simultaneously, the 5' end of the BIP primer is upstream of the 3' end of the B3 primer, and the 3' end of the BIP primer is downstream of the 3' end of the B1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
3. A method for detecting polynucleotide genetic variants using LAMP technology, characterized in that, The FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end, such that the 4-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected for insertion and / or deletion, wherein, after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer, while the remaining LAMP reaction primers, namely F3, B3, BIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The BIP primer consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified. The B1c fragment is located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is reverse complementary to the nucleic acid segment to be amplified. Simultaneously, the 5' end of the BIP primer is upstream of the 3' end of the B3 primer, and the 3' end of the BIP primer is downstream of the 3' end of the B1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
4. A method for detecting polynucleotide genetic variants using LAMP technology, characterized in that, The FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end, such that the 5-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected for insertion and / or deletion, wherein, after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer, wherein the remaining LAMP reaction primers, namely F3, B3, BIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The BIP primer consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified. The B1c fragment is located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is reverse complementary to the nucleic acid segment to be amplified. Simultaneously, the 5' end of the BIP primer is upstream of the 3' end of the B3 primer, and the 3' end of the BIP primer is downstream of the 3' end of the B1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
5. A method for detecting polynucleotide genetic variants using LAMP technology, characterized in that, The FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end, such that the 6-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the inserted and / or deleted nucleic acid of the genetic variant to be detected. After the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along its entire length, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge). The F1c primer is designed to be reverse complementary to the nucleic acid fragment (5'-3' strand) to be amplified and is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The remaining LAMP reaction primers, namely F3, B3, BIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The BIP primer consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified. The B1c fragment is located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is reverse complementary to the nucleic acid segment to be amplified. Simultaneously, the 5' end of the BIP primer is upstream of the 3' end of the B3 primer, and the 3' end of the BIP primer is downstream of the 3' end of the B1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
6. A method for detecting polynucleotide genetic variants using LAMP technology, characterized in that, The FIP internal primer set used in the LAMP technology has an F2 sequence modified at the 3' end, such that the 7-nucleotide end of the F2 sequence is identical to the nucleic acid sequence downstream of the nucleic acid fragment containing the genetic variant to be detected for insertion and / or deletion, wherein, after the insertion and / or deletion occurs, the F2 primer sequence matches the nucleic acid sequence along the entire length of the F2 primer, and the F2 primer sequence is connected to the 3' end of the F1c primer via its 5' end (preferably via a TTTT bridge), the F1c primer being designed to be reverse complementary to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 3' end of the F2 primer and the 5' end of the B1c primer, while the remaining LAMP reaction primers, namely F3, B3, BIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The BIP primer consists of a B1c fragment having the same sequence as the nucleic acid segment to be amplified. The B1c fragment is located between the 5' end of the F1c primer and the 3' end of the B2 primer. The B1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the B2 fragment of the BIP primer. The B2 fragment is reverse complementary to the nucleic acid segment to be amplified. Simultaneously, the 5' end of the BIP primer is upstream of the 3' end of the B3 primer, and the 3' end of the BIP primer is downstream of the 3' end of the B1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
7. A method for detecting genetic variants using LAMP technology, characterized in that, The BIP internal primer set used in the LAMP technology has a B2 sequence modified at the 3' end, such that the 2-nucleotide end of the B2 sequence is reverse complementary to the nucleic acid sequence upstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein, after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer, while the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer consists of an F1c fragment having a sequence that is inversely complementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. Furthermore, the 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the FIP primer is upstream of the 3' end of the F1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
8. A method for detecting genetic variants using LAMP technology, characterized in that, The BIP internal primer set used in the LAMP technology has a B2 sequence modified at its 3' end, such that the 3-nucleotide end of the B2 sequence is reverse complementary to the nucleic acid sequence upstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein, after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer, while the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer consists of an F1c fragment having a sequence that is inversely complementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. Furthermore, the 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the FIP primer is upstream of the 3' end of the F1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
9. A method for detecting genetic variants using LAMP technology, characterized in that, The BIP internal primer set used in the LAMP technology has a B2 sequence modified at its 3' end, such that the 4-nucleotide end of the B2 sequence is reverse complementary to the nucleic acid sequence upstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein, after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer, while the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer consists of an F1c fragment having a sequence that is inversely complementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. Furthermore, the 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the FIP primer is upstream of the 3' end of the F1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
10. A method for detecting genetic variants using LAMP technology, characterized in that, The BIP internal primer set used in the LAMP technology has a B2 sequence modified at the 3' end, such that the 5-nucleotide end of the B2 sequence is reverse complementary to the nucleic acid sequence upstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer, wherein the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer consists of an F1c fragment having a sequence that is inversely complementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. Furthermore, the 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the FIP primer is upstream of the 3' end of the F1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
11. A method for detecting genetic variants using LAMP technology, characterized in that, The BIP internal primer set used in the LAMP technology has a B2 sequence modified at the 3' end, such that the 6-nucleotide end of the B2 sequence is reverse complementary to the nucleic acid sequence upstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein, after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer, while the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence as the fragment (5'-3' strand) of the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer consists of an F1c fragment having a sequence that is inversely complementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. Furthermore, the 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the FIP primer is upstream of the 3' end of the F1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
12. A method for detecting genetic variants using LAMP technology, characterized in that, The BIP internal primer set used in the LAMP technology has a B2 sequence modified at the 3' end, such that the 7-nucleotide end of the B2 sequence is reverse complementary to the nucleic acid sequence upstream of the nucleic acid fragment containing the genetic variant to be detected (insertion and / or deletion), wherein, after the insertion and / or deletion occurs, the B2 primer sequence is only reverse complementary to the nucleic acid sequence, and the B2 primer sequence is connected to the 3' end of the B1c primer via its 5' end (preferably via a TTTT bridge), the B1c primer being designed to be identical to the nucleic acid fragment to be amplified (5'-3' strand) and located between the 5' end of the F1c primer and the 3' end of the B2 primer, while the remaining LAMP reaction primers, namely F3, B3, FIP, and optionally the LF loop and / or LB loop, are designed as follows: The F3 primer is an oligonucleotide with the same sequence (5'-3' strand) as the nucleic acid segment to be amplified. The 3' end of the F3 primer is located upstream of the F2 primer, and the 5' end of the F3 primer marks the beginning of the nucleic acid segment to be amplified. The B3 primer is an oligonucleotide that is reverse complementary to the nucleic acid segment (5'-3' strand) to be amplified. The 5' end of the B3 primer marks the end of the nucleic acid segment to be amplified, and the 3' end of the B2 primer precedes the 3' end of the B3 primer. The FIP primer consists of an F1c fragment having a sequence that is inversely complementary to the nucleic acid segment to be amplified. The F1c fragment is located between the 3' end of the F2 primer and the 5' end of the B1c primer. The F1c fragment (preferably at its 3' end and connected via a TTTT bridge) is linked to the 5' end of the F2 fragment of the FIP primer. The F2 fragment is identical to the nucleic acid segment to be amplified. Furthermore, the 5' end of the FIP primer is upstream of the 3' end of the F3 primer, and the 3' end of the FIP primer is upstream of the 3' end of the F1c primer. The LF loop primer is reverse complementary to the nucleic acid segment to be amplified and is located between the 3' end of the F2 primer and the 3' end of the F1c primer. The LB loop primer has the same sequence as the region to be amplified, and the LB loop primer is located between the 3' end of the B1c primer and the 3' end of the B2 primer.
13. Primer set, used to amplify human... EGFR The nucleotide sequence of a fragment of the (epidermal growth factor receptor) gene, characterized in that, The primer set comprises an inner primer set and an outer primer set. The inner primer set has the following nucleotide sequences (a) and (b), and the outer primer set has the following nucleotide sequences (c) and (d). The primer set is for individuals carrying the NM_005228.5(EGFR): c.2235_2249del (p.Glu746_Ala750del) mutation in exon 19. EGFR Gene segments are specific: a) F1c 5' GACCCCCACACAGCAAAGCA 3' (nucleotide sequence SEQ ID NO: 3), which is linked at its 3' end (preferably via a TTTT bridge) to sequence F2 5' TCCCGTCGCTATCAAAACAT 3' (nucleotide sequence SEQ ID NO: 4). b) B1c 5' GCTGCTCTGCTCTAGACCCT 3' (nucleotide sequence SEQ ID NO: 5 or ), which is linked at the 3' end (preferably via a TTTT bridge) to sequence B2 5' AGAGGCCAGTGCTGTCT 3' (nucleotide sequence SEQ ID NO: 6). c) F3 5' TGGATCCCAGAAGGTGAGAA 3' (nucleotide sequence SEQ ID NO: 1), and d)B3 5' GGGGTGGATACCAGCATG 3' (nucleotide sequence SEQ ID NO: 2).
14. The primer set according to claim 13, characterized in that, The primer set comprises a set of circular primer sequences containing nucleotide sequences, which are contained in human... EGFR In gene fragments or related to the person described EGFR Gene segment complementation, the person EGFR The gene fragments have SEQ ID NO: 7: LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8: LB 5' GCTCTAGTGGGTATAACTCCCTC 3'.
15. Primer set, used to amplify human... EGFR The nucleotide sequence of a fragment of the (epidermal growth factor receptor) gene, characterized in that, The primer set comprises an inner primer set and an outer primer set. The inner primer set has the following nucleotide sequences (a) and (b), and the outer primer set has the following nucleotide sequences (c) and (d). The primer set is for individuals carrying the NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del) mutation, the NM_005228.3:c.2239_2253del15 mutation, or the NM_005228.3:c.2238_2252del15 mutation in exon 19. EGFR Gene segments are specific: a) F1c 5' GACCCCCACACAGCAAAGCA 3' (nucleotide sequence SEQ ID NO: 3), which is linked at its 3' end (preferably via a TTTT bridge) to sequence F2 5' TCCCGTCGCTATCAAGGAATCTC 3' (nucleotide sequence SEQ ID NO: 9). b) B1c 5' GCTGCTCTGCTCTAGACCCT 3' (nucleotide sequence SEQ ID NO: 5), which is linked at its 3' end (preferably via a TTTT bridge) to sequence B2 5' AGAGGCCAGTGCTGTCT 3' (nucleotide sequence SEQ ID NO: 6). c) F3 5' TGGATCCCAGAAGGTGAGAA 3' (nucleotide sequence SEQ ID NO: 1), and d)B3 5' GGGGTGGATACCAGCATG 3' (nucleotide sequence SEQ ID NO: 2).
16. The primer set according to claim 15, characterized in that, The primer set comprises a set of circular primer sequences containing nucleotide sequences, which are contained in human... EGFR In gene fragments or related to the person described EGFR Gene segment complementation, the person EGFR The gene fragments have SEQ ID NO: 7: LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8: LB 5' GCTCTAGTGGGTATAACTCCCTC 3'.
17. Primer set, used to amplify human... EGFR The nucleotide sequence of a fragment of the (epidermal growth factor receptor) gene, characterized in that, The primer set comprises an inner primer set and an outer primer set. The inner primer set has the following nucleotide sequences (a) and (b), and the outer primer set has the following nucleotide sequences (c) and (d). The primer set is specific to the human EGFR gene fragment carrying the NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys) mutation in exon 19. a) F1c 5' GACCCCCACACAGCAAAGCA 3' (nucleotide sequence SEQ ID NO: 3), which is linked at its 3' end (preferably via a TTTT bridge) to sequence F2 5' TCCCGTCGCTGTCAAAACAT 3' (nucleotide sequence SEQ ID NO: 15). b) B1c 5' GCTGCTCTGCTCTAGACCCT 3' (nucleotide sequence SEQ ID NO: 5), which is linked at its 3' end (preferably via a TTTT bridge) to sequence B2 5' AGAGGCCAGTGCTGTCT 3' (nucleotide sequence SEQ ID NO: 6). c) F3 5' TGGATCCCAGAAGGTGAGAA 3' (nucleotide sequence SEQ ID NO: 1), and d)B3 5' GGGGTGGATACCAGCATG 3' (nucleotide sequence SEQ ID NO: 2).
18. The primer set according to claim 17, characterized in that, The primer set comprises a set of circular primer sequences containing nucleotide sequences, which are contained in human... EGFR In gene fragments or related to the person described EGFR Gene segment complementation, the person EGFR The gene fragments have SEQ ID NO: 7: LF 5' TCACATCGAGGATTTCCTTGTTG 3' and SEQ ID NO: 8: LB 5' GCTCTAGTGGGTATAACTCCCTC 3'.
19. Detection of presence in humans EGFR The method for detecting mutations in exon 19 of the gene NM_005228.5(EGFR):c.2235_2249del(p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys), characterized in that, Selected regions of the nucleotide sequence of the human genome are amplified using the primer set according to any one of claims 13 to 18, wherein the replication method is real-time LAMP.
20. The detection method according to claim 19 for the presence of [something] in humans EGFR The method for detecting mutations in exon 19 of the gene NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys), characterized in that, The amplification was performed at a temperature program of 68°C for 50 minutes.
21. Detection of presence in humans EGFR The method for detecting mutations in exon 19 of the gene NM_005228.5(EGFR):c.2235_2249del(p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys), characterized in that, The method includes the detection method according to claims 19 and / or 20.
22. A reagent kit for detecting substances present in humans. EGFR The mutations in exon 19 of the gene NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys), are characterized by, The kit contains a primer set according to any one of claims 13 to 18.
23. The kit according to any one of claims 17 or 18, for detecting substances present in humans. EGFR The mutations in exon 19 of the gene NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys), are characterized by, The kit contains 5.0 µL Universal WarmStart® LAMP 2X Master Mix (New England Biolabs).
24. The kit according to any one of claims 19 to 23, for detecting substances present in humans. EGFR The mutations in exon 19 of the gene NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys), are characterized by, The kit contains amplification primers according to claims 13 to 18, wherein the primer concentrations are as follows: 0.15 µM F3, 0.15 µM B3, 1.20 µM FIP NM_005228.5(EGFR):c.2235_2249del (p.Glu746_Ala750del); 1.20 µM FIP NM_005228.5(EGFR):c.2240_2254del (p.Leu747_Thr751del); NM_005228.3:c.2239_2253del15; NM_005228.3:c.2238_2252del15; 1.20 µM FIP NM_005228.5(EGFR):c.2230_2249delinsGTCAA (p.Ile744_Ala750delinsValLys), 1.20 µM BIP, 0.30 µM LF, 0.30 µMLB; D-(+)-trehalose (6%); mannitol (1.25%); fluorescent double-stranded DNA dye of EvaGreen (Biotium) ≤ 1X, or fluorescent dye (New England Biolabs) ≤ 0.5 μL, or green fluorescent dye (Lucigen) ≤ 1 μL, or SYTO-13 (ThermoFisher Scientific) ≤ 16 µM, or SYTO-82 (ThermoFisher Scientific) ≤ 16 µM, or other double-stranded DNA dyes at concentrations that do not inhibit the amplification process.